WO2023167340A1 - Peptide dérivé de bartonella spp. - Google Patents

Peptide dérivé de bartonella spp. Download PDF

Info

Publication number
WO2023167340A1
WO2023167340A1 PCT/JP2023/008410 JP2023008410W WO2023167340A1 WO 2023167340 A1 WO2023167340 A1 WO 2023167340A1 JP 2023008410 W JP2023008410 W JP 2023008410W WO 2023167340 A1 WO2023167340 A1 WO 2023167340A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
amino acid
seq
acid sequence
sequence shown
Prior art date
Application number
PCT/JP2023/008410
Other languages
English (en)
Japanese (ja)
Inventor
健太郎 塚本
Original Assignee
学校法人藤田学園
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 学校法人藤田学園 filed Critical 学校法人藤田学園
Publication of WO2023167340A1 publication Critical patent/WO2023167340A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/14—Extraction; Separation; Purification
    • C07K1/16—Extraction; Separation; Purification by chromatography
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

Definitions

  • the Bartonella genus is known to cause cat scratch disease and bacterial hemangioma distributed all over the world, and as a pathogenic bacterium that causes karyon disease mainly in the Andean region of South America.It promotes cell proliferation of vascular endothelial cells. It is known to induce angiogenesis in the infected site as a result.
  • An autotransporter protein (hereinafter sometimes referred to as BafA) produced by Bartonella is considered to be involved in the angiogenesis-promoting action of the bacterium belonging to the genus Bartonella.
  • BafA interacts with vascular endothelial cell growth factor receptor-2 (VEGF receptor-2) and functions as a VEGF analogue, and is attracting attention as a new angiogenic factor.
  • VEGF receptor-2 vascular endothelial cell growth factor receptor-2
  • a peptide having a partial sequence of BafA has an angiogenesis-promoting effect (Patent Document 1).
  • the problem to be solved by the present invention is to provide a new peptide having angiogenesis-promoting activity.
  • a chimeric peptide comprising a first domain and a second domain The first domain is (i) a peptide comprising at least the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 1 to SEQ ID NO: 4, or (iii) any of SEQ ID NO: 1 to SEQ ID NO: 4 including peptides comprising amino acid sequences having additions, substitutions or deletions of one or more amino acids in the amino acid sequence;
  • the second domain is (i) a peptide comprising at least the amino acid sequence shown in any one of SEQ ID NO: 5 to SEQ ID NO: 12; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 5 to SEQ ID NO: 12, or (iii) any of
  • a chimeric peptide comprising a first domain and a second domain (i) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 5; (ii) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 6; (iii) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:3 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:9; (iv) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:3 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:10; or (v) the first domain comprises A chimeric peptide comprising a peptide comprising the amino acid sequence
  • the chimeric peptide of (1) or (2) comprising an amino acid linker connecting the first domain and the second domain.
  • a nucleic acid encoding the peptide according to any one of (1) to (3).
  • An expression vector comprising the nucleic acid according to (4).
  • An angiogenesis-promoting agent comprising the chimeric peptide according to any one of (1) to (3) or the nucleic acid according to (4).
  • An angiogenesis-promoting agent comprising a chimeric peptide comprising a first domain and a second domain
  • a chimeric peptide is (i) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 5; (ii) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 6; (iii) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:3 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:9; (iv) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:3 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:10; or (v) the first domain comprises
  • An angiogenesis-promoting agent comprising the nucleic acid according to (11).
  • a drug for treating ischemic disease including (15) Including a step of heat treatment at 50 ° C. or higher, A method for producing a peptide derived from a bacterium belonging to the genus Bartonella. (16) The method according to (15), further comprising the step of purifying by column chromatography.
  • the present invention may be as follows. (17) A chimeric peptide comprising a first domain and a second domain,
  • the first domain is (i) a peptide comprising at least the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 1 to SEQ ID NO: 4, or (iii) any of SEQ ID NO: 1 to SEQ ID NO: 4 including peptides comprising amino acid sequences having additions, substitutions or deletions of one or more amino acids in the amino acid sequence;
  • the second domain is (i) a peptide comprising at least the amino acid sequence shown in any one of SEQ ID NO: 5 to SEQ ID NO: 12; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 5 to SEQ ID NO: 12, or (ii
  • angiogenesis-promoting agent comprising the chimeric peptide described in (17) or a nucleic acid encoding the peptide.
  • a medicament comprising the chimeric peptide or peptide described in (17).
  • a pharmaceutical comprising the chimeric peptide described in (17) or a nucleic acid encoding the peptide.
  • the drug may be a drug for treatment or prevention of ischemic disease.
  • the present invention may be as follows.
  • [A1] A method for promoting angiogenesis, comprising an effective amount of the chimeric peptide or peptide described in (17) for a patient in need thereof, or a nucleic acid encoding the chimeric peptide or peptide described in (17).
  • a method comprising administering [A2] A method for treating or preventing an ischemic disease, wherein an effective amount of the chimeric peptide or peptide described in (17) or the chimeric peptide or peptide described in (17) is administered to a patient in need thereof.
  • [B1] A chimeric peptide or peptide according to (17) or a nucleic acid encoding a chimeric peptide or peptide according to (17) for use in promoting angiogenesis.
  • [B2] A chimeric peptide or peptide according to (17), or a nucleic acid encoding a chimeric peptide or peptide according to (17), for use in treating or preventing an ischemic disease.
  • [C1] Use of the chimeric peptide or peptide described in (17) or a nucleic acid encoding the chimeric peptide or peptide described in (17) for promoting angiogenesis.
  • [C2] Use of the chimeric peptide or peptide described in (17) or a nucleic acid encoding the chimeric peptide or peptide described in (17) for treating or preventing an ischemic disease.
  • [D1] Use of the chimeric peptide or peptide described in (17) or a nucleic acid encoding the chimeric peptide or peptide described in (17) in the production of an angiogenesis-promoting agent.
  • [D2] Use of the chimeric peptide or peptide described in (17), or a nucleic acid encoding the chimeric peptide or peptide described in (17), in the manufacture of an ischemic disease therapeutic or prophylactic agent.
  • the treatment or prevention of an ischemic disease may be treatment, prevention, or both treatment and prevention.
  • FIG. 1 shows the results of measurement of protein yield of peptides in Example 1.
  • FIG. 2 shows the results of measurement of the cell proliferation-promoting activity of the peptides in Example 1.
  • FIG. 2 shows the results of amino acid sequence analysis in Example 1.
  • FIG. 4A shows the results of measuring the protein yield of the chimeric peptide in Example 2.
  • FIG. 4B shows fractions in gel filtration column chromatography in the production of chimeric peptide in Example 2.
  • FIG. 2 shows the results of measuring the cell proliferation-promoting activity of the chimeric peptide in Example 2.
  • FIG. 4 shows the results of a HUVEC tube structure formation test using chimeric peptides in Example 2.
  • FIG. 2 shows the results of activation (phosphorylation) of VEGF2 receptor and ERK1/2 by chimeric peptides in Example 2.
  • FIG. 3 shows separation results due to differences in molecular weight depending on the presence or absence of heat treatment in the production of BafA in Example 3.
  • FIG. 3 shows SDS-PAGE with and without heat treatment in the production of BafA in Example 3.
  • FIG. 10A shows the protocol for testing in the lower limb ischemia mouse model in Example 4.
  • 10B and 10C show test results in the lower limb ischemia mouse model in Example 4.
  • FIG. The amino acid sequences shown in SEQ ID NOS: 1-6 are shown.
  • the amino acid sequences shown in SEQ ID NOS: 7-14 are shown.
  • the amino acid sequences shown in SEQ ID NOS: 15-18 are shown.
  • FIG. 19 shows sequence information corresponding to the sequence number.
  • ID means the ID region, and in the combination of the first domain and the second domain described as ID, it means that the chimeric peptide is obtained by substituting the ID region.
  • a chimeric peptide in this embodiment comprises a first domain and a second domain.
  • the first domain contains any of the following peptides.
  • any of SEQ ID NO: 1 to SEQ ID NO: 4 A peptide comprising an amino acid sequence having an addition, substitution or deletion of one or more amino acids of the amino acid sequence.
  • the second domain contains any of the following peptides.
  • a chimeric peptide in this embodiment is a peptide that can improve both yield and pro-angiogenic activity.
  • the chimeric peptide of this embodiment is believed to be useful in the fields of angiogenesis therapy and regenerative medicine.
  • the angiogenesis-promoting activity in the present embodiment is based on confirmation in Examples that it promotes cell proliferation in vascular endothelial cells and promotes tube formation of vascular endothelial cells.
  • the chimeric peptide in this embodiment includes a peptide having the amino acid sequence shown in SEQ ID NO: 2 as the first domain and a peptide having the amino acid sequence shown in SEQ ID NO: 7 as the second domain. However, in the present embodiment, it is preferable not to include such a combination.
  • the first domain is (i) a peptide comprising the amino acid sequence shown in SEQ ID NO: 2; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 2, or (iii) one or more amino acids of the amino acid sequence shown in SEQ ID NO: 2 are added, substituted or comprising a peptide comprising an amino acid sequence with a deletion;
  • the second domain is (i) a peptide comprising the amino acid sequence shown in SEQ ID NO:7; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 7, or (iii) one or more amino acids of the amino acid sequence shown in SEQ ID NO: 7 are added, substituted or It may be a peptide, including a peptide containing an amino acid sequence having a deletion, but is preferably a peptide in which two or
  • the chimeric peptide in this embodiment includes a peptide having the amino acid sequence shown in SEQ ID NO: 4 as the first domain and a peptide having the amino acid sequence shown in SEQ ID NO: 11 as the second domain. However, in the present embodiment, it is preferable not to include such a combination.
  • the first domain is (i) a peptide comprising the amino acid sequence shown in SEQ ID NO: 4; (ii) a peptide containing an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 4, or (iii) one or more amino acids of the amino acid sequence shown in SEQ ID NO: 4 are added, substituted, or comprising a peptide comprising an amino acid sequence with a deletion;
  • the second domain is (i) a peptide comprising the amino acid sequence shown in SEQ ID NO: 11; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 11, or (iii) one or more amino acids of the amino acid sequence shown in SEQ ID NO: 11 are added, substituted, or It may be a peptide, including a peptide containing an amino acid sequence having a deletion, but is preferably a peptide in which
  • the chimeric peptide in this embodiment includes a peptide having the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4 as the first domain, and the amino acid sequence shown in SEQ ID NO: 7 or SEQ ID NO: 11 as the second domain. However, in this embodiment, it is preferable not to include such a combination.
  • the chimeric peptide in this embodiment is a combination of a peptide contained in the first domain and a peptide contained in the second domain, preferably as a combination of the first domain and the second domain, any of SEQ ID NO: 1 to SEQ ID NO: 4 Any combination of the peptide containing the amino acid sequence shown in SEQ ID NO: 5 to SEQ ID NO: 12 with the peptide containing the amino acid sequence shown in any of SEQ ID NO: 1 or SEQ ID NO: 2 may be used. etc.
  • any combination of peptides containing the amino acid sequence shown in any one of SEQ ID NO: 9 to SEQ ID NO: 12 is preferred.
  • any combination of peptides containing the amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO: 2 any of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 8, or SEQ ID NO: 5 or SEQ ID NO: 6 Any combination of peptides containing the amino acid sequence shown in SEQ ID NO. .
  • any combination of the peptide containing the amino acid sequence shown by SEQ ID NO: 8 is preferable, and in this case, the peptide containing the first domain More preferably, the first domain is a peptide containing the amino acid sequence shown in SEQ ID NO:2.
  • the first domain is a peptide containing the amino acid sequence shown in SEQ ID NO:2.
  • the peptide containing the first domain is more preferably a peptide containing the amino acid sequence shown in SEQ ID NO:2.
  • a combination of a peptide containing the first domain and a peptide containing the second domain preferably as a combination of the first domain and the second domain, (i) a combination of a peptide comprising the amino acid sequence shown by SEQ ID NO: 1 and a peptide comprising the amino acid sequence shown by SEQ ID NO: 5; (ii) a combination of a peptide comprising the amino acid sequence represented by SEQ ID NO: 1 and a peptide comprising the amino acid sequence represented by SEQ ID NO: 6; (iii) a combination of a peptide comprising the amino acid sequence shown by SEQ ID NO:3 and a peptide comprising the amino acid sequence shown by SEQ ID NO:9; (iv) a combination of a peptide comprising the amino acid sequence shown by SEQ
  • the chimeric peptide in this embodiment is (i) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 5; (ii) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO: 6; (iii) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:3 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:9; (iv) the first domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:3 and the second domain comprises a peptide comprising the amino acid sequence shown in SEQ ID NO:10; or (v) the first domain comprises A chimeric peptide comprising a peptide comprising the amino acid sequence shown in SEQ ID NO:
  • SEQ ID NOS: 1 to 19 are applied and SEQ ID NO: 1 is shown as an example, but when referring to a peptide having the amino acid sequence shown by SEQ ID NO: 1, (i) the amino acid sequence shown by SEQ ID NO: 1 (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in SEQ ID NO: 1; or (iii) one or more amino acids of the amino acid sequence shown in SEQ ID NO: 1 is added (i) a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 is preferred.
  • amino acid sequence shown by SEQ ID NO: 1 is an amino acid sequence corresponding to the region from position 25 to position 391 in the total length of 860 residues of the protein produced by Bartonella Rattimassiliensis.
  • the amino acid sequence shown by SEQ ID NO: 2 is an amino acid sequence corresponding to the region from position 25 to position 395 in the 871 residues of the full-length protein produced by Bartonella Koehlerae.
  • the amino acid sequence shown by SEQ ID NO: 3 is an amino acid sequence corresponding to the region from position 25 to position 423 in the 860 residues of the full-length protein produced by Bartonella Rattimassiliensis.
  • the amino acid sequence shown by SEQ ID NO: 4 is an amino acid sequence corresponding to the region from position 25 to position 427 in the 871 residues of the full-length protein produced by Bartonella Koehlerae.
  • the amino acid sequence shown by SEQ ID NO: 5 is an amino acid sequence corresponding to the region from position 395 to position 479 in a partial sequence of 589 residues of a protein produced by Bartonella gabonensis.
  • the amino acid sequence shown by SEQ ID NO: 6 is an amino acid sequence corresponding to the region from position 395 to position 483 in the full length 863 residues of the protein produced by Bartonella Kosoyi.
  • the amino acid sequence shown by SEQ ID NO: 7 is an amino acid sequence corresponding to the region from position 396 to position 494 in the full length 871 residues of the protein produced by Bartonella koehlerae.
  • the amino acid sequence shown by SEQ ID NO: 8 is an amino acid sequence corresponding to the region from position 397 to position 497 in the full length 874 residues of the protein produced by Bartonella henselae.
  • the amino acid sequence shown by SEQ ID NO: 9 is an amino acid sequence corresponding to a region from position 424 to position 479 in a partial sequence of 589 residues of a protein produced by Bartonella gabonensis.
  • the amino acid sequence shown by SEQ ID NO: 10 is an amino acid sequence corresponding to the region from position 427 to position 483 in the full length 863 residues of the protein produced by Bartonella Kosoyi.
  • the amino acid sequence shown by SEQ ID NO: 11 is an amino acid sequence corresponding to the region from position 428 to position 494 in the full-length 871 residues of the protein produced by Bartonella koehlerae.
  • the amino acid sequence shown by SEQ ID NO: 12 is an amino acid sequence corresponding to the region from position 429 to position 497 in the full length 874 residues of the protein produced by Bartonella henselae.
  • the 860-residue amino acid sequence of the protein produced by Bartonella Rattimassiliensis has the NCBI accession number WP — 026088004.
  • the full-length 871-residue amino acid sequence of the protein produced by Bartonella Koehlerae is WP — 034458933 as the accession number of NCBI.
  • the amino acid sequence of 589 residues of the partial sequence of the protein produced by Bartonella gabonensis is WP_175869542 as the accession number of NCBI.
  • the amino acid sequence of the full-length 863 residues of the protein produced by Bartonella Kosoyi is WP — 120101250 as the accession number of NCBI.
  • the amino acid sequence of the full-length 874 residues of the protein produced by Bartonella henselae is WP — 011180481 as the accession number of NCBI.
  • the proteins represented by these amino acid sequences are proteins understood to be autotransporter proteins (BafA).
  • a novel peptide having improved yield and angiogenesis-promoting activity can be provided by forming a chimeric peptide in which the first domain and the second domain are bound.
  • the first domain and the second domain may be bound via a linker.
  • the linker is preferably an amino acid linker consisting of a peptide of 1-15 amino acids, more preferably 1-10 amino acids, more preferably 1-6 amino acids. Within the range of 1 to 15 or within the preferred range, the number may be 2 or more, 3 or more, or 4 or more.
  • a linker used for linking peptides can be used, and examples thereof include a GS linker containing glycine and serine.
  • an amino acid sequence present on the C-terminal side of the first domain in the amino acid sequence of the original BafA where the first domain exists may be used as a linker
  • the amino acid sequence of the original BafA where the second domain exists An amino acid sequence present on the N-terminal side of the second domain may be used as a linker.
  • a chimeric peptide containing the first domain and the second domain can be appropriately selected as long as it maintains improved yield and angiogenesis-promoting activity.
  • the chimeric peptide or nucleic acid encoding the peptide in this embodiment is not particularly limited as long as it can express the chimeric peptide or peptide in this embodiment.
  • the nucleic acid can be, for example, a nucleic acid that can be contained in any suitable vector such as plasmids, cosmids, episomes, artificial chromosomes, phage and viral vectors. In a vector, it may be incorporated together with factors necessary for transcription or translation, and may exist continuously or discontinuously with those factors.
  • the nucleic acid may be DNA, RNA, or a DNA/RNA chimeric nucleic acid.
  • nucleic acids containing nucleotides other than ATCG may be used as long as they are capable of expressing chimeric peptides.
  • the term "vector” is used in the sense of including cloning vectors and expression vectors, and transforms a host, preferably a cell, to promote expression (e.g., transcription and translation) of an introduced sequence. and means a vehicle by which DNA or RNA (eg, a foreign gene) can be introduced into a host cell.
  • the nucleic acid in the present embodiment is preferably a nucleic acid in which the codons encoding each amino acid in the amino acid sequence of the chimeric peptide or peptide are consecutive, but a nucleic acid having a nucleotide sequence complementary to the chimeric peptide or nucleic acid encoding the peptide.
  • the vector in this embodiment may contain factors necessary for transcription and translation.
  • the vector may contain regulatory elements for transcription and translation, such as promoters, enhancers and terminators.
  • a vector may contain a signal sequence so that the vector containing the nucleic acid directs the transport and localization of the expressed peptide in a host cell.
  • a signal sequence may be appropriately included in a vector by those skilled in the art in a manner in which the signal factor functions.
  • the vector is not particularly limited, and conventionally known vectors may be used.
  • the transformant in this embodiment is a chimeric peptide or a host, preferably a cell (host cell) that expresses the peptide.
  • transformation means introducing a nucleic acid or vector into a host so that the host expresses the introduced gene (nucleic acid) and produces the target peptide.
  • a host that contains the introduced nucleic acid, preferably in the form of a vector, is a transformant.
  • Nucleic acids, vectors, and transformants in this embodiment can be produced by appropriately applying conventionally known methods and used to produce peptides (including chimeric peptides) in this embodiment.
  • a chimeric peptide or a nucleic acid having a nucleotide sequence complementary to a nucleic acid encoding a peptide can also be produced by a conventionally known method.
  • the nucleic acids and vectors in this embodiment can be produced by appropriately applying a conventionally known method and introduced into a subject to provide angiogenesis-promoting activity (including vascular endothelial cell proliferation-promoting activity).
  • This embodiment also provides a method for producing a peptide derived from a bacterium belonging to the genus Bartonella.
  • a method for producing a peptide derived from a bacterium belonging to the genus Bartonella By carrying out the production method of this embodiment, it is possible to produce highly pure peptides. That is, the production method of the present embodiment is provided as a useful production method for the purpose of providing a novel peptide having angiogenesis-promoting activity of the present embodiment.
  • the manufacturing method in this embodiment includes a step of heat-treating at 50° C. or higher. The heat treatment may be performed at any point after the peptide is expressed, and is not particularly limited.
  • the heat treatment may be performed in the presence of the peptide in the culture solution of the transformant, or the heat treatment may be performed in the presence of the peptide after lysing or disrupting the transformant. After lysing or disrupting the transformant, the heat treatment may be performed in a state where the peptide is present in the solution after crude purification.
  • the heat treatment time is not particularly limited as long as the heat-denaturing impurities can be thermally denatured. For example, it may be 5 minutes or longer, such as 10 minutes or longer.
  • the upper limit of the heat treatment time is not particularly limited, but may be, for example, 60 minutes or less, or 30 minutes or less.
  • the heat treatment may be performed within the range of 5 to 60 minutes so as to exhibit the desired effect.
  • the temperature is not particularly limited as long as it is 50° C. or higher, but may be 55° C. or higher and 58° C. or higher.
  • the temperature in the heat treatment step may be, for example, 100° C. or less, 90° C. or less, 80° C. or less, 75° C. or less, or 72° C. or less.
  • heat treatment may be performed at 50° C. or higher and 100° C. or lower, 55° C. or higher and 75° C. or lower, 58° C. or higher and 72° C. or lower, 60° C. or higher and 70° C. or lower, for 5 minutes or longer and 10 minutes or longer.
  • the heat treatment time may be 5 minutes or more and 30 minutes or less, or may be 10 minutes or more and 30 minutes or less.
  • the target peptide derived from a bacterium belonging to the genus Bartonella was subjected to a thermal shift assay in which heat was applied to 100°C and changes in fluorescence were monitored in real time. is confirmed.
  • the method for producing a peptide derived from a bacterium belonging to the genus Bartonella may include the step of culturing a transformant that produces the peptide of interest.
  • the method for producing a peptide in this embodiment may further include the step of producing a transformant.
  • the steps of producing a transformant may include steps such as determination of a nucleic acid sequence and introduction of a vector into a host cell. Conditions in the process of culturing the transformant are not particularly limited, and the process of culturing may be carried out by a conventionally known method.
  • Peptides derived from Bartonella bacteria in this embodiment can be produced using nucleic acids, vectors and transformants, and protein expression using bacterial cells such as E. coli, animal cells, insect cells, etc. It is possible to prepare peptides by cells of the system. Among them, preparation by a protein expression system using E. coli is preferable.
  • a nucleic acid encoding a peptide of interest is prepared by artificial gene synthesis or the like, and a vector incorporating this is used in Escherichia coli. to transform.
  • the target peptide may be expressed by culturing and growing.
  • the method for producing a peptide in the present embodiment may include a step of isolating transformant cells from a culture solution containing the transformant. Separation of the cells may be carried out, for example, by filtering or centrifuging a culture medium containing E. coli expressing the peptide of interest, removing the supernatant, and collecting the cells. Conditions in the step of separating the cells from the culture solution are not particularly limited, and the separation step may be carried out by a conventionally known method.
  • the method for producing peptides in this embodiment may include a step of lysing or crushing the cells.
  • methods for lysing or crushing bacterial cells include stirring treatment, bead crushing treatment, ultrasonic treatment, alkali treatment, enzyme treatment, and the like.
  • Conditions in the step of lysing or crushing the cells are not particularly limited, and the step may be carried out by a conventionally known method.
  • a peptide (chimeric peptide) derived from a bacterium belonging to the genus Bartonella may be produced by a conventionally known cell-free translation system.
  • the peptide (chimeric peptide) in this embodiment can also be chemically synthesized by a conventionally known method.
  • Peptides derived from bacteria of the genus Bartonella include a first domain and a second domain
  • the first domain is (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 1 to SEQ ID NO: 4; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in either SEQ ID NO: 1 or SEQ ID NO: 4; or (iii) a peptide shown in either SEQ ID NO: 1 or SEQ ID NO: 4 including peptides comprising amino acid sequences having additions, substitutions or deletions of one or more amino acids in the amino acid sequence;
  • the second domain is (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 5 to SEQ ID NO: 12; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 5 to SEQ ID NO: 12, or (iii
  • the peptide derived from a bacterium belonging to the genus Bartonella includes a first domain and a second domain
  • the peptide comprising the first domain is (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 1 to SEQ ID NO: 4; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in either SEQ ID NO: 1 or SEQ ID NO: 4; or (iii) a peptide shown in either SEQ ID NO: 1 or SEQ ID NO: 4
  • the peptide comprising the second domain is (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 5 to SEQ ID NO: 12; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID
  • a peptide derived from a bacterium belonging to the genus Bartonella (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 13 to SEQ ID NO: 19; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 13 to SEQ ID NO: 19, or (iii) any of SEQ ID NO: 13 to SEQ ID NO: 19 It may be a peptide comprising an amino acid sequence having an addition, substitution or deletion of one or more amino acids in the amino acid sequence.
  • the peptide derived from a bacterium belonging to the genus Bartonella may be a peptide containing all or a partial amino acid sequence derived from an autotransporter protein (BafA), and the peptide may be a peptide having an angiogenesis-promoting action, i.e. , which may be a peptide containing all or a partial amino acid sequence derived from an autotransporter protein (BafA) and having an angiogenesis-promoting effect, having all or a partial amino acid sequence derived from an autotransporter protein (BafA), It may be a peptide having an angiogenesis-promoting action.
  • the peptide derived from a bacterium belonging to the genus Bartonella may be a peptide having a partial amino acid sequence derived from an autotransporter protein (BafA). It may be a peptide having an amino acid sequence that constitutes a (passenger) domain.
  • a peptide derived from a bacterium belonging to the genus Bartonella may be a peptide having a partial amino acid sequence derived from an autotransporter protein (BafA) and having an angiogenesis-promoting effect.
  • Peptides produced by the method for producing peptides derived from bacteria of the genus Bartonella may be peptides produced by 28 strains of bacteria of the genus Bartonella.
  • the artificial peptide may be a chimeric peptide, a peptide produced by live bacteria of 28 strains of the genus Bartonella, or an artificial peptide produced using a genetic engineering technique.
  • the artificial peptide is not particularly limited in terms of the presence or absence of mutations from the intact peptide, as long as it has an angiogenesis-promoting effect, but is preferably a peptide that can be obtained in high yield. It may be an intact peptide, a peptide with high yield and high activity.
  • autotransporter proteins derived from BafA with high yield and high activity are suitable as target peptides for the production method of the present embodiment, regardless of the presence or absence of mutations relative to intact peptides.
  • a peptide having a partial amino acid sequence of the autotransporter protein (BafA) may be used as the target peptide as long as it has a high yield and high activity.
  • the angiogenesis-promoting agent in the present embodiment is provided as containing a useful new peptide as an angiogenesis-promoting agent.
  • the angiogenesis-promoting agent in this embodiment may contain any of the chimeric peptides in this embodiment below, and may contain any of the following peptides.
  • the chimeric peptide in this embodiment as an angiogenesis-promoting agent may be any combination of any of the following chimeric peptides in this embodiment, and may be the above-mentioned preferred chimeric peptides or more preferred chimeric peptides. .
  • chimeric peptide in this embodiment as an angiogenesis promoting agent may be selected from preferred chimeric peptides and more preferred chimeric peptides in any combination of the first domain and the second domain.
  • a chimeric peptide is a chimeric peptide comprising the following first and second domains.
  • the first domain comprises any of the following peptides, (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 1 to SEQ ID NO: 4; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 1 to SEQ ID NO: 4, or (iii) any of SEQ ID NO: 1 to SEQ ID NO: 4 A peptide comprising an amino acid sequence having an addition, substitution or deletion of one or more amino acids of the amino acid sequence:
  • the second domain comprises any of the following peptides: (i) a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 5 to SEQ ID NO: 12; (ii) a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 5 to SEQ ID NO: 12, or (iii) any of SEQ ID NO: 5 to SEQ ID NO: 12 A peptid
  • a peptide is the following peptides.
  • a peptide comprising an amino acid sequence represented by any one of SEQ ID NO: 13 to SEQ ID NO: 19;
  • a peptide comprising an amino acid sequence having 80% or more identity with the amino acid sequence shown in any of SEQ ID NO: 13 to SEQ ID NO: 19, or
  • any of SEQ ID NO: 13 to SEQ ID NO: 19 A peptide comprising an amino acid sequence having an addition, substitution or deletion of one or more amino acids of the amino acid sequence.
  • the chimeric peptide in this embodiment as an angiogenesis-promoting agent may have an amino acid sequence represented by any one of SEQ ID NO: 13 to SEQ ID NO: 19, and is represented by any one of SEQ ID NO: 13 to SEQ ID NO: 18. It is preferably an amino acid sequence, and may be an amino acid sequence represented by any one of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17 and SEQ ID NO: 18.
  • the amino acid sequences represented by SEQ ID NO: 1 to SEQ ID NO: 12 are as described above.
  • the amino acid sequence shown by SEQ ID NO: 13 is an amino acid sequence corresponding to the region from position 25 to position 486 in the partial sequence of 589 residues of a protein produced by Bartonella florencae.
  • the amino acid sequence shown by SEQ ID NO: 14 is an amino acid sequence corresponding to the region from position 25 to position 425 in the partial sequence of 589 residues of a protein produced by Bartonella florencae.
  • the amino acid sequence shown by SEQ ID NO: 15 is an amino acid sequence corresponding to the region from position 25 to position 480 in the full length 858 residues of the protein produced by Bartonella saheliensis.
  • the amino acid sequence shown by SEQ ID NO: 16 is an amino acid sequence corresponding to the region from position 25 to position 425 in the full length 858 residues of the protein produced by Bartonella saheliensis.
  • the amino acid sequence represented by SEQ ID NO: 17 is an amino acid sequence corresponding to the region from position 25 to position 482 in the 860 residues of the full-length protein produced by Bartonella Rattimassiliensis.
  • the amino acid sequence shown by SEQ ID NO: 18 is an amino acid sequence corresponding to the region from position 25 to position 423 in the 860 residues of the full-length protein produced by Bartonella Rattimassiliensis.
  • the amino acid sequence shown by SEQ ID NO: 19 is an amino acid sequence corresponding to the region from position 25 to position 494 in the 871 residues of the full-length protein produced by Bartonella koehlerae.
  • the amino acid sequence of 589 residues of the partial sequence of the protein produced by Bartonella florencae is WP — 019219656 as the accession number of NCBI.
  • the full-length 858-residue amino acid sequence of the protein produced by Bartonella saheliensis is WP — 144752087 as the accession number of NCBI.
  • the amino acid sequence of the full-length 860 residues of the protein produced by Bartonella Rattimassiliensis and the amino acid sequence of the full-length 871 residues of the protein produced by Bartonella koehlerae are as described above. .
  • the proteins represented by these amino acid sequences are proteins understood to be autotransporter proteins (BafA).
  • amino acid is used in its broadest sense and includes natural amino acids as well as artificial amino acid variants and derivatives. Amino acids may be referred to by their conventional one-letter or three-letter abbreviations. As used herein, “amino acid” includes natural proteinaceous L-amino acids, non-natural amino acids, and the like.
  • Non-natural amino acids include, for example, ⁇ , ⁇ -disubstituted amino acids ( ⁇ -methylalanine etc.), N-alkyl- ⁇ -amino acids, D-amino acids, ⁇ -amino acids, ⁇ - hydroxy acids, amino acids whose side chains are structurally different from their natural counterparts (norleucine, homohistidine, etc.), amino acids with extra methylenes in their side chains ("homo" amino acids, homophenylalanine, homohistidine, etc.), and in side chains Examples include, but are not limited to, amino acids in which the carboxylic acid functional group of is substituted with a sulfonic acid group (cysteic acid, etc.).
  • the peptide preferably has an amino acid sequence consisting of natural amino acids, but part of the amino acid sequence may contain amino acids other than natural amino acids.
  • peptide is used as a concept including protein, and protein includes peptide.
  • having an identity of 80% or more means that a peptide having an amino acid sequence before mutation and a peptide having a sequence mutated from the amino acid sequence have the maximum number of amino acid residues that match. It means that the number of common amino acid residues is 80% or more of the number of amino acids in the amino acid sequence before mutation when aligned as above.
  • the identity is not particularly limited as long as the peptide retains the desired activity, and may be, for example, 85% or more, 90% or more, 95% or more, or 100%.
  • mutation of an amino acid means adding (inserting) a new amino acid residue to an amino acid sequence, substituting an amino acid residue with another amino acid residue, or removing an amino acid residue from an amino acid sequence. It means to delete or the like.
  • a mutation in the amino acid sequence shown in any one of SEQ ID NOS: 1 to 4 is expressed as a chimeric peptide when a peptide containing the amino acid sequence shown in any one of SEQ ID NOS: 1 to 4 is used. As long as it can be expressed in a substantially equivalent range, it is acceptable. In cases where the expression level can be said to be substantially equivalent, compared with the chimeric peptide using a peptide containing the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4, 70% or more, 80% or more, 85% % or more, 90% or more, 95% or more, or 100% or more.
  • SEQ ID NO: 1 to SEQ ID NO: 4 If there is a mutation in any of SEQ ID NO: 1 to SEQ ID NO: 4, compared with a chimeric peptide using a peptide containing the amino acid sequence shown in any of SEQ ID NO: 1 to SEQ ID NO: 4, SEQ ID NO:
  • the angiogenesis-promoting activity of the chimeric peptide having a mutation in any one of SEQ ID NOs: 1 to 4 is preferably within a range in which, for example, the cell growth-promoting activity is substantially equivalent.
  • a chimeric peptide using a peptide containing an amino acid sequence represented by any one of SEQ ID NO: 1 to SEQ ID NO: 4 as a case where the angiogenesis promoting activity, for example, the cell proliferation promoting activity, among them, can be said to be substantially equivalent. By comparison, it may be 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 100% or more.
  • SEQ ID NOS: 5 to 12 When the amino acid sequences shown in SEQ ID NOS: 5 to 12 have mutations, the details of the mutations in any of SEQ ID NOS: 1 to 4 apply as they are, but SEQ ID NOS: 5 to 12 Preferably, WYL and RPPR are retained in the amino acid sequences shown. That is, when the amino acid sequence represented by any one of SEQ ID NOs: 5 to 12 has a mutation, the amino acid sequence represented by any one of SEQ ID NOs: 5 to 12 has a mutation in a region other than WYL and RPPR.
  • SEQ ID NO: 5 it is preferable to further retain Y398, Y400, L402, R405 and R407, and it is preferable to further retain G413, S430 and S461. . Also, G395 and G396 may be held. In SEQ ID NOS: 6 to 12, it is preferable to retain the corresponding amino acids as in SEQ ID NO: 5.
  • Mutations in the amino acid sequences shown in SEQ ID NOS: 13 to 19 are compared with peptides containing the amino acid sequences shown in any of SEQ ID NOS: 13 to 19, and any of SEQ ID NOS: 13 to 19. It is preferable that the angiogenesis-promoting activity of peptides having mutations in the indicated amino acid sequences, especially cell growth-promoting activity, is within a range that can be said to be substantially equivalent.
  • Angiogenesis-promoting activity among others, for example, cell proliferation-promoting activity, is 70% or more compared to the peptide containing the amino acid sequence shown in any one of SEQ ID NO: 16 to SEQ ID NO: 19 when it can be said to be approximately equivalent. , 80% or more, 85% or more, 90% or more, 95% or more, 100% or more.
  • the peptide containing the amino acid sequence is not particularly limited as long as it is a peptide containing at least the amino acid sequence, but the peptide containing the amino acid sequence may be a peptide having the amino acid sequence.
  • the peptide having the amino acid sequence means that the amino acid sequence of the peptide is the amino acid sequence shown by the given SEQ ID NO.
  • This embodiment also provides a medicament comprising a peptide, nucleic acid, or pro-angiogenic agent.
  • the medicament in this embodiment contains the peptide, nucleic acid, or angiogenesis-promoting agent in this embodiment, and the chimeric peptide or peptide, or the chimeric peptide or peptide expressed by the nucleic acid, has an angiogenesis-promoting action. can be used as a medicine.
  • capsules e.g., soft capsules, including microcapsules
  • liquids e.g., troches, syrups, emulsions, suspensions
  • injections e.g., subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections agents
  • external agents e.g., nasal formulations, transdermal formulations, ointments
  • suppositories e.g., rectal suppositories, vaginal suppositories
  • pellets e.g., inhalants (e.g., nasal formulations) , pulmonary agents), and infusions.
  • Tablets, powders, granules and the like which are solid preparations, may be made into sustained release preparations or rapidly disintegrating preparations using conventionally known techniques. These pharmaceutical formulations can be administered orally or parenterally (eg, topically, rectally, intravenously, etc.).
  • a pharmacologically acceptable additive used for preparing a pharmaceutical formulation it is possible to use ingredients that are commonly used in this technical field.
  • the additives are not particularly limited, but for example, excipients, lubricants, binders, disintegrants, solvents, solubilizers, suspending agents, tonicity agents, buffers and pain-relieving agents and the like. If necessary, as the additive, a preservative, an antioxidant, a coloring agent, a sweetening agent, an adsorbent, a wetting agent, etc. may be used in an appropriate amount.
  • the dosage and administration method of the peptide (chimeric peptide), the nucleic acid encoding the peptide (chimeric peptide), or the vector containing the nucleic acid encoding the peptide (chimeric peptide) are not particularly limited. However, it may be selected as appropriate according to the subject of administration, symptoms and the like.
  • the dosage of the peptide (chimeric peptide) is not particularly limited, and is, for example, about 0.01 to 1000 mg per day, and within this range, about 0.1 mg or more, about 1 mg or more, about 2 mg or more.
  • the dosage of the nucleic acid or vector is equivalent to the dosage of the peptide (chimeric peptide) can be adjusted.
  • the dose of the peptide (chimeric peptide) may be administered in divided doses depending on the number of administrations per day.
  • the frequency of administration may be once, twice, or three times per day, and the time of administration may be set as appropriate, such as after meals, before meals, between meals, on an empty stomach, before bedtime, and the like. you can
  • the administration interval is also not particularly limited, and for example, administration may be appropriately set to every day, every other day, every two days, every other week, or every other week.
  • the angiogenesis-promoting agent can be used in fields where symptoms can be improved by promoting angiogenesis.
  • Diseases whose symptoms can be improved by promoting angiogenesis include, but are not limited to, ischemic diseases.
  • ischemic disease refers to a disease in which blood supply is reduced and cell death progresses in tissues downstream of arteries that have been constricted or occluded by factors such as thrombosis or embolism.
  • the peptide or angiogenesis-promoting agent of the present embodiment promotes angiogenesis at such damaged sites, thereby improving such conditions even when cell death or the like occurs.
  • the peptide or angiogenesis-promoting agent of the present embodiment can be used to promote wound healing, particularly tendon and ligament injuries that have poor capillary distribution and take a long time to heal. It can be used for promotion of repair, idiopathic femoral head necrosis, improvement of ischemic symptoms associated with vascular occlusion due to arteriosclerosis, and the like. Examples of ischemic diseases include obstructive peripheral vascular disease and ischemic heart disease.
  • the angiogenesis promoting agent of this embodiment is used in the field of regenerative medicine, it can be used to promote angiogenesis when producing transplanted cells or organs.
  • the angiogenesis-promoting agent in this embodiment can also be used as a research reagent having angiogenesis-promoting activity in the fields of angiogenesis research and regenerative medicine research.
  • the angiogenesis-promoting agent in the present embodiment can be used as a research reagent as a new angiogenesis factor in addition to cell growth factors such as VEGF, HGF, FGF and PDGF in the fields of angiogenesis research and cancer research.
  • the angiogenesis-promoting agent in the present embodiment may promote angiogenesis or induce angiogenesis. That is, the angiogenesis-promoting agent in this embodiment may be understood as an angiogenesis-inducing agent.
  • Example 1 Selection of domains used for chimeric peptides
  • Example 1-1 Measurement and Comparison of Protein Yield
  • a nucleic acid encoding each peptide was prepared by artificial gene synthesis and incorporated into a pET-28b vector (Merck Millipore, hereinafter the same).
  • Escherichia coli BL21(DE3) strain was transformed with these vectors and cultured at 30° C. using 800 mL of kanamycin-containing LB medium until the absorbance at a wavelength of 600 nm reached 0.8 Abs. After culturing, isopropyl- ⁇ -D-thiogalactoside was added to a final concentration of 20 ⁇ M to induce expression at 14° C. for 16 hours.
  • the cells were collected by centrifugation and disrupted by ultrasonic treatment.
  • the cell lysate was treated at 60° C. to 70° C. for 15 minutes, and then centrifuged to recover the supernatant containing the peptide of interest.
  • the peptide of interest expressed as a His-tagged protein was subjected to affinity chromatography using a HisTrap HP column (Cytiva), followed by gel filtration chromatography using a Superdex 200 10/300 GL column (Cytiva). Graphically purified.
  • Example 1-2 Measurement and comparison of cell proliferation-promoting activity Human umbilical vein endothelial cells (HUVEC, PromoCell) were seeded in a 96-well plate, and each peptide prepared was added to 4 ng/mL, 20 ng/mL, or 100 ng/mL, or VEGF- as a control. A165 (product number: 100-20, PeproTech) was added at 1.5 ng/mL, 7.5 ng/mL, or 37.5 ng/mL, and M199 medium containing 10% fetal bovine serum albumin (product number: 11043023, Thermo Fisher Scientific) for 2 days.
  • HUVEC Human umbilical vein endothelial cells
  • PromoCell Human umbilical vein endothelial cells
  • the cultured cells were fluorescently stained with Hoechst 33342 (product number: 19172-51, Nacalai Tesque) and CellMask Deep Red (product number: C10046, Invitrogen), and the number of cells was counted using the high-content imaging system Opera Phenix (PerkinElmer). It was measured. The results are shown in FIG. It was confirmed that Bri-D423 having the amino acid sequence shown in SEQ ID NO:18 retains the same activity as Bri-R482 having the amino acid sequence shown in SEQ ID NO:17.
  • Bfl-R486 having the amino acid sequence shown in SEQ ID NO: 13 and Bsa-R480 having the amino acid sequence shown in SEQ ID NO: 15
  • the peptide corresponding to Bri-D423 has the amino acid sequence shown in SEQ ID NO: 14.
  • Bsa-G425 having the amino acid sequence shown in SEQ ID NO: 16.
  • Example 1-3 Amino Acid Sequence Analysis
  • SEQ ID NOs:5 to 8 were subjected to alignment analysis using CLC Main Workbench software (version 21, Qiagen). The results are shown in FIG.
  • Example 2 Preparation of Chimeric Peptide
  • Example 2-1 Preparation of vector incorporating nucleic acid encoding chimeric peptide (Bri-Bga) It has an amino acid sequence from position 25 to position 482 of an autotransporter protein (NCBI accession number: WP_026088004) produced by Bartonella Rattimassiliensis (Bri-R482).
  • a nucleic acid encoding the peptide was prepared by artificial gene synthesis and incorporated into the pET-28b vector.
  • a nucleic acid containing a region encoding a peptide having an amino acid sequence from positions 25 to 391 was amplified by PCR using the prepared vector as a template. The following sequences were used as primers.
  • nucleic acid encoding a peptide having an amino acid sequence from positions 25 to 479 of an autotransporter protein (NCBI accession number: WP_175869542) produced by Bartonella gabonensis (Bga-R479) was prepared by artificial gene synthesis. was incorporated into the pET-28b vector.
  • a nucleic acid containing a region encoding a peptide having an amino acid sequence from positions 395 to 479 was amplified by PCR using the prepared vector as a template. The following sequences were used as primers. Forward: AGGAGATCACGACGGTGGATGGCGGTGCCTACCAGTAC (SEQ ID NO: 22) Reverse: CTGTCCACCAGTCATGCTAGC (SEQ ID NO: 23)
  • nucleic acid encoding a peptide having an amino acid sequence from positions 25 to 483 of an autotransporter protein (NCBI accession number: WP_120101250) produced by Bartonella Kosoyi (Bks-R483) was prepared by artificial gene synthesis. was incorporated into the pET-28b vector.
  • a nucleic acid containing a region encoding a peptide having an amino acid sequence from positions 395 to 483 was amplified by PCR using the prepared vector as a template. The following sequences were used as primers. Forward: AGGAGATCACGACGGTGGATGGTGGCACGTACCAGTATCG (SEQ ID NO: 24) Reverse: CTGTCCACCAGTCATGCTAGC (SEQ ID NO: 25)
  • Example 2-3 Preparation of Chimeric Peptide (Bri-Bga or Bri-Bks) Escherichia coli BL21 (DE3) strain was transformed with the vector expressing Bri-Bga or Bri-Bks prepared by the method described above. These E. coli were cultured at 30° C. using kanamycin-containing LB medium until the absorbance at a wavelength of 600 nm reached 0.8 Abs. After culturing, isopropyl- ⁇ -D-thiogalactoside was added to a final concentration of 20 ⁇ M to induce expression at 14° C. for 16 hours. Subsequently, the cells were collected by centrifugation and disrupted by ultrasonic treatment.
  • the cell lysate was treated at 60° C. to 70° C. for 15 minutes, and then centrifuged to recover the supernatant containing the peptide of interest. From this supernatant, the peptide of interest expressed as a His-tagged protein was subjected to affinity chromatography using a HisTrap HP column (Cytiva), followed by gel filtration chromatography using a Superdex 200 10/300 GL column (Cytiva). Graphically purified.
  • FIG. 4A Fractions of each chimeric protein in gel filtration chromatography are shown in FIG. 4B.
  • FIG. 5 shows the results of measuring the cell growth-promoting activity of each chimeric peptide in the same manner as in Examples. In Examples 2-1 to 2-3, methods for producing two chimeric peptides were shown, and other chimeric peptides were produced according to the method.
  • the amino acid sequences of the expressed chimeric peptides are shown in Table 2. Table 1 shows the amino acid sequence of the peptide expressed as a control.
  • Example 2-4 HUVEC lumen structure formation test by chimeric peptide
  • a collagen gel was prepared using a collagen gel culture kit (Fujifilm Wako Pure Chemical Industries, Ltd.). VEGF-A165 (20 ng/mL final concentration) or each peptide (50 ng/mL final concentration) was added to the collagen gel. PBS was used as a control. HUVECs were conditioned in advance with 2% FBS-containing EGM medium (PromoCell) for 18 hours, then collected and seeded at 7.0 ⁇ 10 4 cells/well on a collagen gel solidified in a 48-well plate.
  • FBS-containing EGM medium PromoCell
  • collagen gel was added to the upper layer, and cultured for 24 hours by a sandwich culture method in EGM medium containing 2% FBS containing VEGF-A165 (final concentration: 20 ng/mL) or each peptide (final concentration: 50 ng/mL).
  • EGM medium containing 2% FBS containing VEGF-A165 (final concentration: 20 ng/mL) or each peptide (final concentration: 50 ng/mL).
  • the formed luminal structures were stained with 1 ⁇ M calcein AM (Dojindo Laboratories) and confocal images were acquired with Opera Phenix. The results are shown in FIG.
  • the amino acid sequences of the expressed chimeric peptides are shown in Table 3.
  • Example 2-5 Activation (phosphorylation) of VEGF2 receptors, ERK1/2 by chimeric peptides HUVECs were seeded on a gelatin-coated 12-well plate at 1.0 ⁇ 10 5 cells/well and cultured for 24 hours. After the culture supernatant was replaced with 10% FBS-containing M199 medium and conditioned overnight, VEGF-A165 or a chimeric peptide prepared according to Example 2-3 (0 to 1 nM concentration) was added and incubated for 5 minutes. processed.
  • a lysis buffer [0.2 M NaCl, 1 mM EDTA, 1 mM dithiothreitol, protease inhibitor cocktail, phosphatase inhibitor cocktail (Nacalai Tesque)] was added to the cells, and the cells were disrupted by sonication. After centrifugation, proteins in the obtained supernatant were separated by SDS-PAGE.
  • the proteins in the gel were transferred to a PVDF membrane, blocked using an iBind solution kit (Thermo Fisher Scientific), and then probed sequentially with the prepared primary antibody and secondary antibody using iBind western systems
  • primary antibody mouse anti -VEGFR2 antibody (product number: sc-393163, Santa Cruz Biotechnology), rabbit anti-phospho-VEGFR antibody (product number: 3770, Cell Signaling Technology), mouse anti-ERK1/2 antibody (product number: 9107, Cell Signaling Te chnology ), rabbit anti-phospho-ERK1/2 antibody (product number: 4370, Cell Signaling Technology), secondary antibody: IRDye 800CW goat anti-rabbit IgG (product number: 926-32211, LI-COR Bioscience), IRDye 680LT goat anti Mouse IgG (product number: 926-68020, LI-COR Bioscience)]. Fluorescent signals were detected with an Odyssey CLx imaging scanner (LI-COR Bioscience) and quantified using Empire Studio software (LI-COR Bioscience). The results
  • Example 3 Production of BafA Escherichia coli expressing Bba-R462 was recovered in the same manner as in Example 1-1, and the cells were disrupted by ultrasonic treatment, followed by heat treatment at 60° C. for 15 minutes. For comparison, a sample without heat treatment was also produced. They were centrifuged and the supernatant containing Bba-R462 was collected. After subjecting this supernatant to a HisTrap HP column to obtain a crude fraction, gel filtration chromatography was performed using a Superdex 200 10/300 GL column to separate the proteins contained in the crude fraction according to the difference in molecular weight. did.
  • Example 4 Ischemia ameliorating effect in lower limb ischemia mouse model by administration of chimeric peptide
  • Example 4-1 Preparation of Chimeric Peptide (Bko-Bhe) According to Example 2, the sequence of positions 397 to 497 of the autotransporter protein produced by Bartonella henselae after positions 25 to 395 of the autotransporter protein produced by Bartonella koehlerae. A peptide having an amino acid sequence to which was added (hereinafter sometimes referred to as Bko-Bhe) was prepared.
  • Example 4-2 Ischemia Improvement Effect by Administration of Chimeric Peptide BALB/c mice (female, 8 weeks old) were anesthetized by intraperitoneally administering 200 ⁇ L to 250 ⁇ L of a mixed anesthetic solution, and the femoral artery of the right leg was ligated and removed.
  • An ischemia model was created by In the administration of Mock (solvent only), VEGF (0.1 ⁇ g/dose), and BafA (chimeric peptide prepared in Example 4-1) (0.1 ⁇ g/dose), 0, 4 , 7 and 10 days (once daily) by intramuscular injection into the ischemic area. Blood flow was analyzed by laser Doppler method under anesthesia on the 14th day after induction of ischemia.
  • the degree of blood flow improvement is represented by ischemia leg/healthy leg.
  • the results are shown in FIG. Similar to the positive control VEGF, the chimeric peptide was also observed to have an effect of improving ischemia.
  • the amino acid sequences of the expressed chimeric peptides are shown in Table 4.
  • IL-2ss amino acid sequence: MYRMQLLSCIALSCIALSLALVTNS: SEQ ID NO: 26
  • IL-2ss-Bko-Bhe a peptide having an amino acid sequence
  • IL-2ss was added for the purpose of extracellular secretion of intracellularly expressed Bko-Bhe.
  • Example 5-2 Vascular Endothelial Proliferation Promotion Effect by Introduction of Nucleic Acid of Chimeric Peptide Using the vector prepared in Example 5-1 and Lipofectamine 3000 Reagent (product number: L3000001, Thermo Fisher Scientific), HUVEC (PromoCell) was transformed, and IL- 2ss-Bko-Bhe was expressed intracellularly.
  • pcDNA3.3 TOPO Mammalian Expression Vector in which no nucleic acid encoding IL2ss-Bko-Bhe was incorporated was used.
  • HUVECs transformed with the vector were cultured for 3 days using M199 medium containing 10% fetal bovine serum albumin.
  • Example 1-2 After culturing, the number of cells was measured according to the method described in Example 1-2 to evaluate the cell proliferation-promoting effect of nucleic acid introduction of the chimeric peptide IL-2ss-Bko-Bhe. Results are shown in FIGS.
  • the amino acid sequences of the chimeric peptides used are shown in Table 5.
  • the amino acid sequence of expressed IL-2ss-Bko-Bhe is shown in SEQ ID NO:27, and the nucleic acid sequence encoding the amino acid sequence is shown in SEQ ID NO:28.
  • IS is added following the signal sequence having the amino acid sequence shown in SEQ ID NO: 26, and the Bko-Bhe amino acid sequence is bound.
  • nucleotide sequence encoding the signal sequence is followed by ATATCG and the nucleotide sequence encoding the Bko-Bhe amino acid sequence.
  • SEQ ID NO:27 and SEQ ID NO:28 there is no amino acid linker connecting the first and second domains.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Vascular Medicine (AREA)
  • Immunology (AREA)
  • Cardiology (AREA)
  • Analytical Chemistry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne : un peptide chimérique contenant un premier domaine et un second domaine, le premier domaine contenant (I) un peptide contenant au moins une séquence d'acides aminés représentée par l'une quelconque des SEQ NOS ID : 1 à 4 ; (ii) un peptide contenant une séquence d'acides aminés présentant 80 % ou plus d'identité avec une séquence d'acides aminés représentée par l'un quelconque des SEQ ID NO : 1 à 4, ou (ii) un peptide contenant une séquence d'acides aminés présentant un ou plusieurs acides aminés d'une séquence d'acides aminés représentée par l'une quelconque des SEQ ID NO : 1 à 4 ajoutée, substituée ou supprimée et que le second domaine contient (i) un peptide contenant au moins une séquence d'acides aminés représentée par l'un quelconque des SEQ ID NO : 5 à 12, (ii) un peptide contenant une séquence d'acides aminés présentant 80 % ou plus d'identité avec une séquence d'acides aminés représentée par l'un quelconque des SEQ ID NO : 5 à 12, ou (iii) un peptide contenant une séquence d'acides aminés présentant un ou plusieurs acides aminés d'une séquence d'acides aminés représentée par l'une quelconque des SEQ ID NO : 5 à 12 ajoutée, substituée ou supprimée.
PCT/JP2023/008410 2022-03-04 2023-03-06 Peptide dérivé de bartonella spp. WO2023167340A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2022033895 2022-03-04
JP2022-033895 2022-03-04

Publications (1)

Publication Number Publication Date
WO2023167340A1 true WO2023167340A1 (fr) 2023-09-07

Family

ID=87883755

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2023/008410 WO2023167340A1 (fr) 2022-03-04 2023-03-06 Peptide dérivé de bartonella spp.

Country Status (1)

Country Link
WO (1) WO2023167340A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020132575A (ja) * 2019-02-20 2020-08-31 学校法人藤田学園 血管新生促進剤

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020132575A (ja) * 2019-02-20 2020-08-31 学校法人藤田学園 血管新生促進剤

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BEN ELHOUL MOUNA; ZARAî JAOUADI NADIA; REKIK HATEM; OMRANE BENMRAD MAROUA; MECHRI SONDES; MOUJEHED EMNA; KOURDALI SIDALI; EL : "Biochemical and molecular characterization of new keratinoytic protease fromActinomadura viridiluteaDZ50", INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES, ELSEVIER BV, NL, vol. 92, 4 July 2016 (2016-07-04), NL , pages 299 - 315, XP029755248, ISSN: 0141-8130, DOI: 10.1016/j.ijbiomac.2016.07.009 *
DATABASE Protein 202108004, ANONYMOUS : "BafA family autotransporter [Bartonella saheliensis] ", XP093088450, retrieved from NCBI Database accession no. WP_144752087 *
DATABASE Protein 21 July 2021 (2021-07-21), ANONYMOUS : "BafA family autotransporter [Bartonella koehlerae] ", XP093088429, retrieved from NCBI Database accession no. WP_034458933 *
DATABASE Protein 21 July 2021 (2021-07-21), ANONYMOUS : "BafA family autotransporter [Bartonella rattimassiliensis] ", XP093088454, Database accession no. WP_026088004 *
DATABASE Protein 29 June 2013 (2013-06-29), ANONYMOUS : "hypothetical protein, partial [Bartonella florencae] ", XP093088442, retrieved from NCBI Database accession no. WP_019219656 *
JAFARI FARZANEH, KIANI-GHALEH FARID, EFTEKHARI SHAHRZAD, RAZZAGHSHOAR RAZLIGHI MEHDI, NAZARI NAZANIN, HAJIRAJABI MARYAM, MASOOMI S: "Cloning, overexpression, and structural characterization of a novel archaeal thermostable neopullulanase from Desulfurococcus mucosus DSM 2162", PREPARATIVE BIOCHEMISTRY AND BIOTECHNOLOGY, DEKKER, NEW YORK, NY, US, vol. 52, no. 10, 1 November 2022 (2022-11-01), US , pages 1190 - 1201, XP093088456, ISSN: 1082-6068, DOI: 10.1080/10826068.2022.2033996 *
KUMADAKI,KAYO ET AL.: "#Y-3 Comparison of the physiological activities of the BafA protein family produced by Bartonella bacteria", PREPRINTS OF THE 67TH JAPANESE SOCIETY FOR SYMPOSIUM ON TOXINS; SEPTEMBER 9, 2021 - SEPTEMBER 10, 2021, JAPANESE SOCIETY FOR SYMPOSIUM ON TOXINS, JP, vol. 67, 1 January 2021 (2021-01-01) - 10 September 2021 (2021-09-10), JP, pages 31 - 34, XP009549352, ISSN: 1344-9346 *
OMRANE BENMRAD MAROUA; MOUJEHED EMNA; BEN ELHOUL MOUNA; ZARAI JAOUADI NADIA; MECHRI SONDES; REKIK HATEM; KOURDALI SIDALI; EL HATTA: "A novel organic solvent- and detergent-stable serine alkaline protease fromTrametes cingulatastrain CTM10101", INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES, ELSEVIER BV, NL, vol. 91, 10 June 2016 (2016-06-10), NL , pages 961 - 972, XP029680429, ISSN: 0141-8130, DOI: 10.1016/j.ijbiomac.2016.06.025 *
TSUKAMOTO KENTARO, SHINZAWA NAOAKI, KAWAI AKITO, SUZUKI MASAHIRO, KIDOYA HIROYASU, TAKAKURA NOBUYUKI, YAMAGUCHI HISATERU, KAMEYAMA: "The Bartonella autotransporter BafA activates the host VEGF pathway to drive angiogenesis", NATURE COMMUNICATIONS, vol. 11, no. 1, XP093088436, DOI: 10.1038/s41467-020-17391-2 *

Similar Documents

Publication Publication Date Title
JP7470669B2 (ja) 組換えタンパク質及びそれらの治療的用途
EP1003860B1 (fr) Facteur modifie affectant le tissu dorsal et composition a base de ce facteur
JP2023091081A (ja) Ｗｎｔシグナリングアゴニスト分子
JPWO2018079702A1 (ja) ラクトフェリン／アルブミン融合タンパク質及びその製造方法
JP6114186B2 (ja) 組換えヒトｇ−ｃｓｆ二量体およびその神経系疾患の治療における用途
CN102762591A (zh) 结合il-23的基于纤连蛋白的支架结构域蛋白质
AU676847B2 (en) Dorsal tissue affecting factor and compositions
CN114349840B (zh) 一种融合蛋白及其制备方法与应用
EP0785950B1 (fr) Analogues du facteur de croissance des keratinocytes
WO2022215946A1 (fr) Variant peptidique de pénétration cellulaire et son utilisation
US20180327768A1 (en) Targeted delivery of therapeutic proteins bioencapsulated in plant cells to cell types of interest for the treatment of disease
CN101437846A (zh) 蛋白、核酸和药物
WO2023167340A1 (fr) Peptide dérivé de bartonella spp.
JPH03505039A (ja) 可溶性ｃｄ４を発現するレトロウイルスベクター、エイズの遺伝子治療法
US20160271219A1 (en) Lymphangiogenesis-promoting agents
JP2022049715A (ja) インスリン分泌促進ペプチド
CN113501862B (zh) 一种多肽及其在制备免疫调节药物中的应用
JP7229519B2 (ja) 血管新生促進剤
WO1993010233A1 (fr) Synthese et purification des formes tronquees et proteiniques mutantes du facteur neurotrophique ciliaire de l'homme
US20230043161A1 (en) Application of cst1 in prevention and/or treatment of liver immune dysregulation diseases
CN107223133B (zh) 一种可溶的异质二聚t细胞受体及其制法和应用
EP0820507B1 (fr) Peptides ndf (facteur de differenciation neu)
LU86718A1 (fr) Nouveau facteur pour la regulation de la croissance cellulaire
US10385113B2 (en) Engineered FGF compositions and methods of use thereof
WO2024193713A1 (fr) Vaccin thérapeutique contre il-17 bivalent, son procédé de préparation et son utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23763597

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024504458

Country of ref document: JP

Kind code of ref document: A