WO2023121178A1 - Mtor 유전자 및 stat3 유전자의 발현을 동시에 억제하는 핵산 - Google Patents

Mtor 유전자 및 stat3 유전자의 발현을 동시에 억제하는 핵산 Download PDF

Info

Publication number
WO2023121178A1
WO2023121178A1 PCT/KR2022/020715 KR2022020715W WO2023121178A1 WO 2023121178 A1 WO2023121178 A1 WO 2023121178A1 KR 2022020715 W KR2022020715 W KR 2022020715W WO 2023121178 A1 WO2023121178 A1 WO 2023121178A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid molecule
gene
expression
inhibits
Prior art date
Application number
PCT/KR2022/020715
Other languages
English (en)
French (fr)
Inventor
이완
유중기
엄기환
Original Assignee
(주)큐리진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)큐리진 filed Critical (주)큐리진
Publication of WO2023121178A1 publication Critical patent/WO2023121178A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to a nucleic acid molecule that inhibits the expression of mTOR gene and STAT3 gene at the same time, and an anti-cancer pharmaceutical composition comprising the same.
  • Cancer is one of the diseases that cause the most deaths worldwide, and the development of innovative cancer treatments can reduce medical costs and create high added value at the same time. Also, according to statistics in 2008, molecular therapies that can overcome resistance to existing anticancer drugs accounted for $17.5 billion in 7 major countries (US, Japan, France, Germany, Italy, Spain, UK), and in 2018, about It is expected to show a growth rate of 9.5% compared to 2008, accounting for a market size of about $45 billion. Cancer treatment is divided into surgery, radiation therapy, chemotherapy, and biological therapy. Among them, chemotherapy is a treatment that suppresses or kills the proliferation of cancer cells with chemical substances.
  • RNA interference (hereinafter referred to as RNAi) has been shown to act on sequence-specific mRNAs in various types of mammalian cells (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773).
  • RNAi is a small interfering ribonucleic acid short interfering RNA (hereinafter referred to as siRNA) having a double helix structure of 21-25 nucleotides in size that specifically binds to an mRNA transcript having a complementary sequence. It is a phenomenon that inhibits the expression of a specific protein by degrading the transcript.
  • RNA double strands are processed by an endonuclease called Dicer and converted into siRNAs of 21 to 23 base pairs (bp), which bind to RISC (RNA-induced silencing complex)
  • RISC RNA-induced silencing complex
  • siRNA for the same target gene has an excellent inhibitory effect on mRNA expression in vitro and in vivo compared to antisense oligonucleotide (ASO), and the effect lasts for a long time (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res. Commun. 2002. 296: 1000-1004).
  • ASO antisense oligonucleotide
  • the RNAi technology-based therapeutics market, including siRNA has been analyzed to have a global market size of more than 12 trillion won by 2020. It is being evaluated as a next-generation gene therapy technology that can treat incurable diseases.
  • siRNA complementarily binds to the target mRNA and regulates the expression of the target gene in a sequence-specific manner, it takes a long time for existing antibody-based medicines or small molecule drugs to be optimized for a specific protein target. Compared to the development period and development cost required, it is possible to develop lead compounds optimized for all protein targets, including target substances that cannot be medicated, while the applicable target can be dramatically expanded and the development period shortened. (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13 (4): 664-670).
  • siRNA therapeutics have the advantage that side effects are predictable because the target is clear, but such target specificity is a disease caused by problems in various genes. can also be a cause
  • Another object of the present invention is to provide a recombinant expression vector containing the nucleic acid molecule of the present invention and a virus into which it is introduced.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer.
  • Another object of the present invention is to provide a use of the nucleic acid molecule, the recombinant expression vector, or the virus for preventing or treating cancer.
  • an object of the present invention is to provide a method for treating cancer, wherein the nucleic acid molecule, the recombinant expression vector or the virus is administered to a subject suffering from cancer.
  • the present invention provides a nucleic acid molecule that simultaneously inhibits the mTOR gene and the STAT3 gene.
  • the present invention provides a recombinant expression vector containing the nucleic acid molecule and a virus into which the vector is introduced.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the nucleic acid molecule, a recombinant expression vector containing the same, or a virus introduced therein as an active ingredient.
  • the present invention provides a use of the nucleic acid molecule, the recombinant expression vector, or the virus for preventing or treating cancer.
  • the present invention provides a method for treating cancer, wherein the nucleic acid molecule, the recombinant expression vector, or the virus is administered to a subject suffering from cancer.
  • the dual-target nucleic acid molecule of the present invention designed so that the sense strand inhibits the expression of the mTOR gene and the antisense strand inhibits the expression of the STAT3 gene, simultaneously inhibits the expression of the mTOR gene and the STAT3 gene when applied as siRNA in cancer cells, thus anticancer It can be usefully used as a composition for anticancer or as an adjuvant for anticancer, can be delivered locally, and has excellent selectivity.
  • FIG. 1 is a diagram showing a vector map for expressing shRNAs containing the dual target siRNA set of the present invention in cells.
  • Figure 2 is a diagram confirming the effect of inhibiting mTOR and STAT3 gene expression by double-stranded siRNAs of sets 1 to 10 of the present invention:
  • CA102 double-stranded siRNA that simultaneously inhibits conventional mTOR and STAT3;
  • mTOR/STAT3 #2 dual target siRNA set 1 (si-MS1);
  • mTOR/STAT3 #3 dual target siRNA set 2 (si-MS2);
  • mTOR/STAT3 #4 dual target siRNA set 3 (si-MS3);
  • mTOR/STAT3 #5 dual target siRNA set 4 (si-MS4);
  • mTOR/STAT3 #6 dual target siRNA set 5 (si-MS5);
  • mTOR/STAT3 #7 dual target siRNA set 6 (si-MS6);
  • mTOR/STAT3 #8 dual target siRNA set 7 (si-MS7);
  • mTOR/STAT3 #9 dual target siRNA set 8 (si-MS8);
  • mTOR/STAT3 #10 dual target siRNA set 9 (si-MS9);
  • mTOR/STAT3 #11 dual target siRNA set 10 (si-MS10).
  • nucleic acids are written in the 5′ ⁇ 3′ direction from left to right.
  • Numerical ranges recited within the specification are inclusive of the numbers defining the range and include each integer or any non-integer fraction within the defined range.
  • the present invention relates to a nucleic acid molecule that simultaneously inhibits the expression of mammalian target of rapamycin (mTOR) gene and signal transducer and activator of transcription 3 (STAT3) gene.
  • mTOR mammalian target of rapamycin
  • STAT3 signal transducer and activator of transcription 3
  • the nucleic acid molecule may include a base sequence having 80% or more homology with each of the base sequences represented by SEQ ID NOs: 1 to 20.
  • the nucleic acid molecule has SEQ ID NOs: 1 and 2; SEQ ID NOs 3 and 4; SEQ ID NOs 5 and 6; SEQ ID NOs 7 and 8; SEQ ID NOs 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs 17 and 18; and at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 19 and 20 or a nucleotide sequence encoding the same.
  • a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17 or 19 can inhibit mTOR gene expression by RNA interference.
  • a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20 can inhibit STAT3 gene expression by RNA interference.
  • the nucleic acid molecule that inhibits mTOR gene expression may form a double strand with a nucleic acid molecule that inhibits STAT3 gene expression through a partial or 100% complementary bond, and the nucleic acid molecule that inhibits STAT3 gene expression is a mTOR gene It can form a double strand by partially or 100% complementary binding with a nucleic acid molecule that inhibits expression.
  • the nucleic acid molecule that inhibits mTOR gene expression may include a nucleotide sequence having 60% or more complementarity with the reverse complementary sequence of the nucleic acid molecule that inhibits STAT3 gene expression, and the nucleic acid molecule that inhibits STAT3 gene expression is It may include a nucleotide sequence having 60% or more complementarity with a reverse complementary sequence of a nucleic acid molecule that inhibits mTOR gene expression.
  • the nucleic acid molecule that inhibits mTOR gene expression is 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% reverse complementary sequence of the nucleic acid molecule that inhibits STAT3 gene expression.
  • it may include a base sequence having 99% or more complementarity
  • the nucleic acid molecule that inhibits STAT3 gene expression is 70%, 80%, 85%, 90%, 95%, 70%, 80%, 85%, 95 %, 96%, 97%, 98%, or may include a base sequence having a complementarity of 99% or more.
  • Nucleic acid molecules that inhibit mTOR gene expression or variants of nucleic acid molecules that inhibit STAT3 gene expression are included within the scope of the present invention.
  • the expression cassette of the present invention is a functional equivalent of the nucleic acid molecules constituting it, for example, although some base sequences of the nucleic acid molecules have been modified by deletion, substitution, or insertion, the base sequence molecules and It is a concept that includes variants that can perform the same functional action.
  • the "percentage of sequence homology" for nucleic acid molecules is determined by comparing two optimally aligned sequences with a region of comparison, wherein a portion of the sequence of the nucleic acid molecule in the region of comparison is a reference sequence (addition or deletion) to the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).
  • the nucleic acid molecule has SEQ ID NO: 1 to SEQ ID NO: 2, SEQ ID NO: 3 to SEQ ID NO: 4, SEQ ID NO: 5 to SEQ ID NO: 6, SEQ ID NO: 7 to SEQ ID NO: 8, and SEQ ID NO: 9 to sequence SEQ ID NO: 10, SEQ ID NO: 11 with SEQ ID NO: 12, SEQ ID NO: 13 with SEQ ID NO: 14, SEQ ID NO: 15 with SEQ ID NO: 16, SEQ ID NO: 17 with SEQ ID NO: 18, or SEQ ID NO: 19 with SEQ ID NO: 20 It may be a double-stranded siRNA that is complementary to each other.
  • the nucleic acid molecule may be a short hairpin RNA (shRNA) comprising sequentially a nucleic acid molecule that inhibits mTOR gene expression, a loop sequence capable of forming a hairpin structure, and a nucleic acid molecule that inhibits STAT3 gene expression, , It may include a nucleotide sequence encoding the shRNA.
  • shRNA short hairpin RNA
  • siRNAs of SEQ ID NOs: 1 and 2 of set 1 are 15mers out of 19mers
  • siRNAs of SEQ ID NOs: 3 and 4 of set 2 are 15mers out of 19mers
  • siRNAs of SEQ ID NOs: 5 and 6 of set 3 15mers of 19mers
  • siRNAs of SEQ ID NOs: 7 and 8 of set 4 bind to 16mers of 20mers
  • siRNAs of SEQ ID NOs: 9 and 10 of set 5 bind complementaryly to 15mers of 19mers.
  • siRNAs of SEQ ID NOs: 11 and 12 of Set 6 have 17mers out of 20mers
  • siRNAs of SEQ ID NOs: 13 and 14 of Set 7 have 17mers out of 19mers
  • siRNAs of SEQ ID NOs 15 and 16 of Set 8 have 16mers out of 19mers
  • siRNAs of SEQ ID NOs: 17 and 18 of Set 9 were constructed such that 17mers out of 20mers and 16mers of SEQ ID NOs: 17 and 18 of Set 10 were complementarily bonded to each other to form double-stranded siRNAs
  • double-stranded siRNAs was confirmed to be a set of dual-target siRNAs by targeting the mTOR gene and the STAT3 gene, respectively, and simultaneously suppressing the expression of both genes.
  • the shRNA is a nucleic acid molecule encoding a siRNA that inhibits the expression of the mTOR gene and a nucleic acid molecule that encodes a siRNA that inhibits the expression of the STAT3 gene are partially complementary and linked palindrome by a loop region to form a hairpin structure, depending on the nucleotide sequence of the loop portion of the hairpin structure, it may be TTCAAGAGAG (UUCAAGAGAG when expressed as shRNA) loop shRNA or TTGGATCCAA (UUGGAUCCAA when expressed as shRNA) loop shRNA.
  • the siRNA that inhibits the expression of the mTOR gene and the STAT3 gene has a sequence complementary to a part of the human ( Homo sapiens ) mTOR gene or STAT3 gene, and can degrade mRNA of the mTOR gene or STAT3 gene or inhibit translation.
  • expression inhibition means to cause a reduction in the expression (into mRNA) or translation (into protein) of a target gene, preferably by which the expression of the target gene is undetectable or insignificant. means to exist.
  • siRNA small interfering RNA
  • siRNA refers to a short double-stranded RNA capable of inducing RNA interference (RNAi) through cleavage of a specific mRNA.
  • siRNA consists of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto, but in the double-stranded siRNA of the present invention, the sense RNA strand consists of the nucleotide sequence of SEQ ID NO: 1 Since it is siRNA (antisense strand for mTOR gene) and the antisense RNA strand is siRNA (antisense strand for STAT3 gene) consisting of the nucleotide sequence of SEQ ID NO: 2, the double-stranded siRNA inhibits the expression of mTOR gene and STAT3 gene at the same time, respectively Since it can be done, it is provided as an efficient gene knock-down method or as a method of gene
  • RNA short hairpin RNA
  • shRNA short hairpin RNA
  • the length of the double-stranded structure is not particularly limited, but is preferably 10 nucleotides or more, more preferably is at least 20 nucleotides.
  • the shRNA may be included in an expression cassette, and the shRNA is converted from U to T in a set sequence consisting of an siRNA antisense strand and a sense strand for each gene, and then TTGGATCCAA (TTGGATCCAA loop) or TTCAAGAGAG (TTCAAGAGAG loop), the antisense strand and TT are sequentially connected to construct an expression cassette encoding shRNA and express it in a cell.
  • the expression cassette may include one or more of the nucleic acids in which U is converted to T in the nucleotide sequences of SEQ ID NOs: 1 to 20.
  • the invention relates to a recombinant expression vector comprising a nucleic acid molecule of the invention.
  • the recombinant expression vector of the present invention may include an expression cassette encoding a nucleic acid molecule that inhibits mTOR gene expression and a nucleic acid molecule that inhibits STAT3 gene expression.
  • the recombinant expression vector of the present invention has SEQ ID NOs: 1 and 2; SEQ ID NOs 3 and 4; SEQ ID NOs 5 and 6; SEQ ID NOs 7 and 8; SEQ ID NOs 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs 13 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs 17 and 18; and at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 19 and 20 or a nucleotide sequence encoding the same.
  • the recombinant vector of the present invention can be prepared by a recombinant DNA method known in the art, and in one embodiment, a pE3.1 vector was used.
  • useful non-viral vectors for delivering nucleic acid molecules that inhibit the expression of the mTOR gene and the STAT3 gene include all vectors commonly used in gene therapy, for example, various plasmids and liposomes that can be expressed in eukaryotic cells etc.
  • the nucleotide sequence encoding the shRNA containing it is preferably operably linked to at least a promoter.
  • the promoter may be any promoter as long as it can function in eukaryotic cells, but the U6 promoter is more preferred. Regulation including leader sequence, polyadenylation sequence, promoter, enhancer, upstream activating sequence, signal peptide sequence and transcription terminator as necessary for efficient transcription of double-stranded siRNA or shRNA that simultaneously inhibits the expression of mTOR gene and STAT3 gene Sequences may additionally be included.
  • viruses or viral vectors useful for delivering siRNA or shRNA that simultaneously inhibit the expression of mTOR gene and STAT3 gene include baculoviridiae, parvoviridiae, picornoviridiae ), herepesviridiae, poxviridiae, adenoviridiae, etc., but are not limited thereto.
  • the present invention relates to a virus into which a recombinant expression vector of the present invention has been introduced.
  • the virus of the present invention may be an adenovirus, and may be an adenovirus having a group C serotype of type 5.
  • the virus of the present invention may further comprise a human telomere promoter (hTERT).
  • hTERT human telomere promoter
  • the virus of the present invention is SEQ ID NOs: 1 and 2, SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 14, SEQ ID NOs: 15 and 16, SEQ ID NOs: 17 and 18, and SEQ ID NOs: 19 and 20; and a recombinant expression vector comprising a human telomere promoter (hTERT).
  • hTERT human telomere promoter
  • the respective expressed sequences may form double strands with partial or 100% complementary binding.
  • telomere promoter may be operably linked to an endogenous gene of a virus.
  • the endogenous gene of adenovirus has a structure of 5'ITR-C1-C2-C3-C4-C5 3'ITR; C1 includes E1A, E1B or E1A-E1B; C2 includes E2B-L1-L2-L3-E2A-L4; wherein C3 does not include E3 or includes E3; said C4 includes L5; and C5 may not include E4 or may include E4.
  • the adenovirus may be partially deleted in the E3 region.
  • an expression cassette comprising a nucleic acid molecule that inhibits mTOR gene expression and a nucleic acid molecule that inhibits STAT3 gene expression, or a nucleic acid molecule encoding the same (eg, shRNA) is located at the C3 site of an endogenous gene of adenovirus can do.
  • the expression cassette can simultaneously inhibit STAT3 and mTOR by expressing a double-stranded siRNA in which a STAT3-specific sense strand and an mTOR-specific antisense strand form a partially complementary bond.
  • the hTERT promoter can be operably linked to E1A and E1B of the endogenous gene of adenovirus.
  • an IRES sequence may be further included between E1A and E1B of the endogenous adenovirus gene.
  • Adenovirus into which the recombinant expression vector of the present invention is introduced has higher oncolytic activity than wild-type adenovirus, and may have higher oncolytic activity than adenovirus into which hTERT promoter is introduced into wild-type adenovirus.
  • operably linked refers to a functional linkage between a gene expression control sequence (eg, a promoter, a signal sequence, or an array of transcriptional regulatory factor binding sites) and another gene sequence, whereby Regulatory sequences will control the transcription and/or translation of said other gene sequences.
  • a gene expression control sequence eg, a promoter, a signal sequence, or an array of transcriptional regulatory factor binding sites
  • the present invention relates to a pharmaceutical composition for preventing or treating cancer containing the nucleic acid molecule of the present invention, the recombinant expression vector of the present invention, or the virus of the present invention as an active ingredient.
  • the composition of the present invention may further include an anti-cancer agent, for example, acibacin, aclarubicin, acodazole, acronisin, adozelesin, alanosin, aldesleukin, allo Purinol Sodium, Altretamine, Aminoglutethimide, Amonafide, Amplogen, Amsacrine, Androgens, Anguidin, Aphidicolin Glycinate, Asaray, Asparaginase, 5-Azacytidine , Azathioprine, Bacillus Calmete-Guerin (BCG), Baker's Antipol, Beta-2-deoxythioguanosine, Bisantrene HCl, Bleomycin Sulfate, Bulseppan, Butionine Sulfoximin, BWA 773U82 , BW 502U83/HCl, BW 7U85 mesylate, cerasemide, carbetimer, carboplatin, car
  • the cancer is colorectal cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, gastric cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer, esophageal cancer, small intestine cancer , perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureteric cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma , intraocular melanoma, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, glioblastoma multiforme, and pituitary gland
  • treatment refers to any activity that ameliorates or beneficially alters the death of cancer cells or symptoms of cancer by administering a composition containing the nucleic acid of the present invention.
  • Those of ordinary skill in the art to which the present invention pertains will be able to determine the degree of improvement, enhancement and treatment by knowing the exact criteria of the disease for which the composition of the present application is effective by referring to the data presented by the Korean Medical Association, etc. will be.
  • the pharmaceutical composition may be one or more formulations selected from the group consisting of oral formulations, external preparations, suppositories, sterile injection solutions, and sprays.
  • a therapeutically effective amount of the composition of the present invention may vary depending on several factors, such as the method of administration, the target site, and the condition of the patient. Therefore, when used in the human body, the dosage should be determined in an appropriate amount considering both safety and efficiency. It is also possible to estimate the amount to be used in humans from the effective amount determined through animal experiments. These considerations in determining an effective amount can be found, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.
  • composition of the present invention may also include a carrier, diluent, excipient or a combination of two or more commonly used in biological preparations.
  • the pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. , saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used. Customary additives may be added.
  • diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate formulations for injection, such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets.
  • formulations for injection such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets.
  • it can be preferably formulated according to each disease or component by using an appropriate method in the art or by using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).
  • composition of the present invention includes 0.0001 to 10% by weight of the protein, preferably 0.001 to 1% by weight, based on the total weight of the composition.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, Lactose, Mannitol, Taffy, Gum Arabic, Pregelatinized Starch, Corn Starch, Powdered Cellulose, Hydroxypropyl Cellulose, Opadry, Sodium Starch Glycolate, Carnauba Lead, Synthetic Aluminum Silicate, Stearic Acid, Magnesium Stearate, Aluminum Stearate, Stearic Acid Calcium, white sugar, dextrose, sorbitol, and talc may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 part by weight to 90 parts by weight based on the composition, but is not limited thereto.
  • composition of the present invention may be parenterally administered (for example, intravenously, subcutaneously, intraperitoneally, or topically applied) or orally, depending on the desired method, and the dosage may vary depending on the patient's weight, age, sex, health condition, The range varies according to diet, administration time, administration method, excretion rate, and severity of disease.
  • the daily dosage of the composition according to the present invention is 0.0001 to 10 mg/ml, preferably 0.0001 to 5 mg/ml, and it is more preferable to divide the administration once or several times a day.
  • Liquid formulations for oral administration of the composition of the present invention include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, and preservatives in addition to water and liquid paraffin, which are commonly used simple diluents etc. may be included.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, suppositories, and the like.
  • the pharmaceutical composition of the present invention can be used for the prevention or treatment of cancer and its complications, and can also be used as an anticancer adjuvant.
  • the present invention relates to the use of the nucleic acid molecule of the present invention, a recombinant expression vector containing the same, or a virus containing the same for preventing or treating cancer.
  • the present invention relates to a method for treating cancer, wherein a nucleic acid molecule of the present invention, a recombinant expression vector containing the same, or a virus containing the same is administered to a subject suffering from cancer.
  • Dual-targeting siRNA double strand capable of simultaneously inhibiting STAT3 (signal transducer and activator of transcription 3) and mTOR (mammalian target of rapamycin) was prepared according to the sequence shown in Table 1 below (Bioneer, Daejeon, Korea). Specifically, siRNAs of SEQ ID NOs: 1 and 2 of Set 1 have 15 mer out of 19 mer, siRNAs of SEQ ID NOs 3 and 4 of Set 2 have 15 mer out of 19 mer, and siRNAs of SEQ ID NO 5 and 6 of Set 3 have 15 mer out of 19 mer.
  • siRNAs of SEQ ID NOs: 7 and 8 of set 4 bind 16 mer out of 20 mer
  • siRNAs of SEQ ID NOs 9 and 10 of set 5 bind 15 mer out of 19 mer complementarily.
  • siRNAs of SEQ ID NOs: 11 and 12 of Set 6 have 17mers out of 20mers
  • siRNAs of SEQ ID NOs: 13 and 14 of Set 7 have 17mers out of 19mers
  • siRNAs of SEQ ID NOs 15 and 16 of Set 8 have 16mers out of 19mers
  • siRNAs of SEQ ID NOs: 17 and 18 of set 9 bind 17mers out of 20mers
  • siRNAs of SEQ ID NOs: 17 and 18 of set 10 bind complementaryly to 16mers out of 19mers.
  • the sense siRNA (antisense_mTOR) of each set was mTOR mRNA (gi
  • STAT3 acute- phase response factor
  • a cassette expressing shRNA was prepared. Specifically, a DNA sequence encoding shRNA (shRNA Expression cassettes (TTGGATCCAA loop shRNA and TTCAAGAGAG loop shRNA) were constructed. The prepared shRNA expression cassettes were placed after the U6 promoter at the restriction enzyme PstI and EcoRV cutting positions of the pE3.1 vector (Fig. 1), respectively, to obtain two types of shRNAs including dual target siRNAs targeting mTOR and STAT3. A recombinant expression vector for expression in cells was constructed.
  • shRNA Expression cassettes TTGGATCCAA loop shRNA and TTCAAGAGAG loop shRNA
  • the cell density was 50% in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) at 37°C. , and cultured under 5% CO 2 conditions.
  • the cells were transfected with lipofectamine3000 (Invitrogen, Carlsbad, CA, USA) for the dual target siRNAs of sets 1 to 10 prepared in Example 1, respectively, to simultaneously knock down mTOR and STAT3, and as a positive control CA102 (a set of conventional double-stranded siRNAs that simultaneously inhibit mTOR and STAT3: gacuguggcauccaccugcau and augcagguaggcgccucaguc) was used. 72 hours after transfection, the cells were disrupted and total RNA was extracted using the GeneJET RNA Purification Kit (Invitrogen).
  • a reverse transcription reaction was performed with RevoScriptTM RT PreMix (iNtRON BIOTECHNOLOGY) using the extracted total RNA as a template.
  • mTOR Hs00234522_m1
  • STAT3 Hs01047580_m1
  • GAPDH Hs02758991_g1
  • AmpONE taq DNA polymerase GeneAll
  • TaqMan Gene Expression assays Applied Biosystems
  • the reaction was performed using a PRISM 7700 Sequence Detection System and QS3 Real-time PCR (Biosystems). Real-time PCR reaction conditions were [50 ° C. for 2 minutes, 95 ° C. for 10 minutes, and 95 ° C. for 15 seconds and 60 ° C. for 60 seconds in two stages] for a total of 40 cycles. All reactions were repeated three times and their average values were taken. The results obtained in this way were normalized to the mRNA value of GAPDH, a housekeeping gene.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산 분자 및 이를 포함하는 항암용 약학적 조성물에 관한 것으로, 본 발명의 이중 표적 핵산 분자는 실제로 암세포에서 siRNA로 적용했을 때 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하였으므로, 항암용 조성물 또는 항암보조제로서 유용하게 이용될 수 있으며, 국소 전달이 가능하고, 선택성이 뛰어난 효과가 있다.

Description

MTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산
본 발명은 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산 분자 및 이를 포함하는 항암용 약학적 조성물에 관한 것이다.
암은 전세계적으로 가장 많은 사망자를 내는 질병 중 하나로, 혁신적인 암 치료제의 개발은 이에 대한 치료시 발생되는 의료비를 절감할 수 있음과 동시에 고부가가치를 창출할 수 있다. 또한, 2008년의 통계에 따르면, 기존항암제 내성을 극복 할 수 있는 분자 치료제는 주요 7개국(US, Japan, France, Germany, Italy, Spain, UK)에서 $17.5 billion을 차지했고, 2018년의 경우 약 $45 billion 정도의 market size를 차지하여, 2008년 대비 9.5%의 성장률을 보일 것이라 예측되고 있다. 암의 치료는 수술, 방사선치료, 화학요법, 생물학적 치료로 구분되는데, 이 중에 화학요법은 화학물질로서 암 세포의 증식을 억제하거나 죽이는 치료법으로 항암제에 의하여 나타나는 독성은 상당부분 정상세포에서도 나타나기 때문에 일정 정도의 독성을 나타내며, 항암제가 효과를 나타내다가도 일정 기간의 사용 후에는 효과가 상실되는 내성이 발생하기 때문에 암세포에 선택적으로 작용하고 내성이 생기지 않는 항암제의 개발이 절실하다 (암 정복의 현주소 Biowave 2004. 6(19)). 최근 암에 대한 분자유전정보의 확보를 통해 암의 분자적 특성을 표적으로 한 새로운 항암제의 개발이 진행되고 있으며, 암세포만이 가지고 있는 특징적인 분자적 표적(molecular target)을 겨냥하는 항암제들은 약제 내성이 생기지 않는다는 보고도 있다.
유전자의 발현을 억제하는 기술은 질병치료를 위한 치료제 개발 및 표적 검증에서 중요한 도구이다. 간섭 RNA(RNA interference, 이하 RNAi라고 한다)는 그 역할이 발견된 이후로, 다양한 종류의 포유동물세포(mammalian cell)에서 서열 특이적 mRNA에 작용한다는 사실이 밝혀졌다 (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773). RNAi는 21-25개의 뉴클레오타이드 크기의 이중나선 구조를 가진 작은 간섭 리보핵산 짧은 간섭 RNA (small interfering RNA, 이하 siRNA라고 한다)이 상보적인 서열을 가지는 전사체(mRNA transcript)에 특이적으로 결합하여 해당 전사체를 분해함으로써 특정 단백질의 발현을 억제하는 현상이다. 세포 내에서는 RNA 이중가닥이 Dicer라는 엔도뉴클라아제(endonuclease)에 의해 프로세싱되어 21 내지 23개의 이중가닥(base pair,bp)의 siRNA로 변환되며, siRNA 는 RISC(RNA-induced silencing complex)에 결합하여 가이드(안티센스) 가닥이 타겟 mRNA를 인식하여 분해하는 과정을 통해 타겟 유전자의 발현을 서열 특이적으로 저해한다 (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503-514). 베르트랑(Bertrand) 연구진에 따르면 동일한 타겟 유전자에 대한 siRNA가 안티센스 올리고뉴클레오티드(Antisense oligonucleotide, ASO)에 비하여 생체 내/외(in vitro 및 in vivo)에서 mRNA 발현의 저해효과가 뛰어나고, 해당 효과가 오랫동안 지속되는 효과를 포함하는 것으로 밝혀졌다 (Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem. Biophys. Res.Commun. 2002. 296: 1000-1004). siRNA를 포함하는 RNAi 기술 기반 치료제 시장은 향후 세계 시장규모가 2020년경에 총 12조원 이상을 형성하는 것으로 분석되었으며, 해당 기술을 적용할 수 있는 대상이 획기적으로 확대되어 기존의 항체, 화합물 기반 의약품으로 치료하기 어려운 질병을 치료할 수 있는 차세대 유전자 치료기술로 평가되고 있다. 또한 siRNA의 작용 기작은 타겟 mRNA와 상보적으로 결합하여 서열 특이적으로 타겟 유전자의 발현을 조절하기 때문에, 기존의 항체 기반 의약품이나 화학물질(small molecule drug)이 특정한 단백질 표적에 최적화되기까지 오랜 동안의 개발 기간 및 개발 비용이 소요되는 것에 비하여, 적용할 수 있는 대상이 획기적으로 확대될 수 있고, 개발 기간이 단축되면서, 의약화가 불가능한 표적 물질을 포함한 모든 단백질 표적에 대하여 최적화된 리드 화합물을 개발할 수 있다는 장점을 가진다 (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13(4):664-670). 이에, 최근 이 리보핵산 매개 간섭현상이 기존의 화학 합성 의약 개발에서 발생되는 문제의 해결책을 제시하면서 전사체 수준에서 특정 단백질의 발현을 선택적으로 억제하여 각종 질병 치료제, 특히 종양 치료제 개발에 이용하려는 연구가 진행되고 있다. 또한, siRNA 치료제는 기존 항암제와 달리 표적이 명확하여 부작용이 예측 가능하다는 장점이 있으나, 이러한 표적 특이성은 다양한 유전자의 문제에 의해 발생하는 질병인 종양의 경우, 오히려 이러한 표적 특이성은 치료 효과가 높지 않은 원인이 되기도 한다.
본 발명의 목적은 이중 표적 핵산 분자를 제공하는 것이다.
또한, 본 발명의 목적은 본 발명의 핵산 분자를 포함하는 재조합 발현 벡터 및 이를 도입한 바이러스를 제공하는 것이다.
또한, 본 발명의 목적은 암의 예방 또는 치료용 약학조성물을 제공하는 것이다.
또한, 본 발명의 목적은 상기 핵산 분자, 상기 재조합 발현 벡터 또는 상기 바이러스의 암 예방 또는 치료 용도를 제공하는 것이다.
아울러, 본 발명의 목적은 상기 핵산 분자, 상기 재조합 발현 벡터 또는 상기 바이러스를 암에 걸린 개체에 투여하는, 암 치료 방법을 제공하는 것이다.
상기 목적의 달성을 위해, 본 발명은 mTOR 유전자 및 STAT3 유전자를 동시에 억제하는 핵산 분자를 제공한다.
또한, 본 발명은 상기 핵산 분자를 포함하는 재조합 발현 벡터 및 이를 도입한 바이러스를 제공한다.
또한, 본 발명은 상기 핵산 분자, 이를 포함하는 재조합 발현 벡터 또는 이를 도입한 바이러스를 유효성분으로 포함하는 암의 예방 또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 상기 핵산 분자, 상기 재조합 발현 벡터 또는 상기 바이러스의 암 예방 또는 치료 용도를 제공한다.
아울러, 본 발명은 상기 핵산 분자, 상기 재조합 발현 벡터 또는 상기 바이러스를 암에 걸린 개체에 투여하는, 암 치료 방법을 제공한다.
센스 가닥은 mTOR 유전자의 발현을 억제하고 안티센스 가닥은 STAT3 유전자의 발현을 억제하도록 설계된 본 발명의 이중 표적 핵산 분자는 실제로 암세포에서 siRNA로 적용했을 때 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하였으므로, 항암용 조성물 또는 항암보조제로서 유용하게 이용될 수 있으며, 국소 전달이 가능하고, 선택성이 뛰어난 효과가 있다.
도 1은 본 발명의 이중 표적 siRNA 세트를 포함하는 shRNA를 세포 내에서 발현하기 위한 벡터의 맵을 나타낸 도이다.
도 2는 본 발명의 세트 1 내지 10의 이중 가닥 siRNA에 의한 mTOR 및 STAT3 유전자 발현 억제 효과를 확인한 도이다:
CA102: 종래의 mTOR 및 STAT3를 동시에 억제하는 이중 가닥 siRNA;
mTOR/STAT3 #2: 이중 표적 siRNA 세트 1 (si-MS1);
mTOR/STAT3 #3: 이중 표적 siRNA 세트 2 (si-MS2);
mTOR/STAT3 #4: 이중 표적 siRNA 세트 3 (si-MS3);
mTOR/STAT3 #5: 이중 표적 siRNA 세트 4 (si-MS4);
mTOR/STAT3 #6: 이중 표적 siRNA 세트 5 (si-MS5);
mTOR/STAT3 #7: 이중 표적 siRNA 세트 6 (si-MS6);
mTOR/STAT3 #8: 이중 표적 siRNA 세트 7 (si-MS7);
mTOR/STAT3 #9: 이중 표적 siRNA 세트 8 (si-MS8);
mTOR/STAT3 #10: 이중 표적 siRNA 세트 9 (si-MS9); 및
mTOR/STAT3 #11: 이중 표적 siRNA 세트 10 (si-MS10).
이하, 본 발명의 구현예로 본 발명을 상세히 설명하기로 한다. 다만, 하기 구현예는 본 발명에 대한 예시로 제시되는 것으로, 이에 의해 본 발명이 제한되지는 않으며 본 발명은 후술하는 특허청구범위의 기재 및 그로부터 해석되는 균등 범주 내에서 다양한 변형 및 응용이 가능하다.
달리 지시되지 않는 한, 핵산은 좌측에서 우측으로 5'→3' 방향으로 기록된다. 명세서 내에서 열거된 수치 범위는 범위를 정의하는 숫자를 포함하고, 정의된 범위 내의 각각의 정수 또는 임의의 비-정수 분획을 포함한다.
달리 정의되지 않는 한, 본원에서 사용된 모든 기술적 및 과학적 용어는 본 발명이 속하는 분야의 당업자가 통상적으로 이해하는 것과 동일한 의미를 갖는다. 본원에 기술된 것들과 유사하거나 등가인 임의의 방법 및 재료가 본 발명을 테스트하기 위한 실행에서 사용될 수 있지만, 바람직한 재료 및 방법이 본원에서 기술된다.
일 측면에서, 본 발명은 mTOR(mammalian target of rapamycin) 유전자 및 STAT3(signal transducer and activator of transcription 3) 유전자의 발현을 동시에 억제하는 핵산 분자에 관한 것이다.
일 구현예에서, 상기 핵산 분자는 서열번호 1 내지 20으로 표시되는 각각의 염기 서열과 80% 이상의 상동성을 갖는 염기서열을 포함할 수 있다.
일 구현예에서, 상기 핵산 분자는 서열번호 1 및 2; 서열번호 3 및 4; 서열번호 5 및 6; 서열번호 7 및 8; 서열번호 9 및 10; 서열번호 11 및 12; 서열번호 13 및 14; 서열번호 15 및 16; 서열번호 17 및 18; 및 서열번호 19 및 20으로 이루어진 군에서 선택된 1종 이상의 염기서열 또는 이를 코딩하는 염기서열을 포함할 수 있다.
일 구현예에서, 서열번호 1, 3, 5, 7, 9, 11, 13, 15, 17 또는 19의 염기서열을 포함하는 핵산 분자는 RNA 간섭에 의해 mTOR 유전자 발현을 억제할 수 있다.
일 구현예에서, 서열번호 2, 4, 6, 8, 10, 12, 14, 16, 18 또는 20의 염기서열을 포함하는 핵산 분자는 RNA 간섭에 의해 STAT3 유전자 발현을 억제할 수 있다.
일 구현예에서, mTOR 유전자 발현을 억제하는 핵산 분자는 STAT3 유전자 발현을 억제하는 핵산 분자와 부분적 또는 100% 상보적인 결합으로 이중가닥을 형성할 수 있으며, STAT3 유전자 발현을 억제하는 핵산 분자는 mTOR 유전자 발현을 억제하는 핵산 분자와 부분적 또는 100% 상보적인 결합으로 이중가닥을 형성할 수 있다.
일 구현예에서, mTOR 유전자 발현을 억제하는 핵산 분자는 STAT3 유전자 발현을 억제하는 핵산 분자의 역상보 서열과 60% 이상의 상보성을 갖는 염기서열을 포함할 수 있고, STAT3 유전자 발현을 억제하는 핵산 분자는 mTOR 유전자 발현을 억제하는 핵산 분자의 역상보 서열과 60% 이상의 상보성을 갖는 염기서열을 포함할 수 있다.
일 구현예에서, mTOR 유전자 발현을 억제하는 핵산 분자는 STAT3 유전자 발현을 억제하는 핵산 분자의 역상보 서열과 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% 또는 99% 이상의 상보성을 갖는 염기서열을 포함할 수 있고, STAT3 유전자 발현을 억제하는 핵산 분자는 mTOR 유전자 발현을 억제하는 핵산 분자의 역상보 서열과 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% 또는 99% 이상의 상보성을 갖는 염기서열을 포함할 수 있다.
mTOR 유전자 발현을 억제하는 핵산 분자 또는 STAT3 유전자 발현을 억제하는 핵산 분자의 변이체가 본 발명의 범위 내에 포함된다. 본 발명의 발현 카세트는 이를 구성하는 핵산 분자의 작용성 등가물, 예를 들어, 핵산 분자의 일부 염기서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, 염기 서열 분자와 기능적으로 동일한 작용을 할 수 있는 변이체(variants)를 포함하는 개념이다. 핵산 분자에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 핵산 분자 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
일 구현예에서, 상기 핵산 분자는 서열번호 1이 서열번호 2와, 서열번호 3이 서열번호 4와, 서열번호 5가 서열번호 6과, 서열번호 7이 서열번호 8과, 서열번호 9가 서열번호 10과, 서열번호 11이 서열번호 12와, 서열번호 13이 서열번호 14와, 서열번호 15가 서열번호 16과, 서열번호 17이 서열번호 18과, 또는 서열번호 19가 서열번호 20과 부분적으로 상보적 결합을 이루고 있는 이중 가닥(double strand) siRNA일 수 있다.
일 구현예에서, 상기 핵산 분자는 mTOR 유전자 발현을 억제하는 핵산 분자, 헤어핀 구조를 이룰 수 있는 루프 서열, 및 STAT3 유전자 발현을 억제하는 핵산 분자를 순차적으로 포함하는 shRNA(short hairpin RNA)일 수 있으며, 상기 shRNA를 코딩하는 염기서열을 포함할 수 있다.
본 발명의 일 실시예에서, 세트 1의 서열번호 1 및 2의 siRNA는 19mer 중 15mer가, 세트 2의 서열번호 3 및 4의 siRNA는 19mer 중 15mer가, 세트 3의 서열번호 5 및 6의 siRNA는 19mer 중 15mer가, 세트 4의 서열번호 7 및 8의 siRNA는 20mer 중 16mer가, 및 세트 5의 서열번호 9 및 10의 siRNA는 19mer 중 15mer가 상보적으로 결합한다. 또한, 세트 6의 서열번호 11 및 12의 siRNA는 20mer 중 17mer가, 세트 7의 서열번호 13 및 14의 siRNA는 19mer 중 17mer가, 세트 8의 서열번호 15 및 16의 siRNA는 19mer 중 16mer가, 세트 9의 서열번호 17 및 18의 siRNA는 20mer 중 17mer가, 및 세트 10의 서열번호 17 및 18의 siRNA는 19mer 중 16mer가 상보적으로 결합되어 이중 가닥의 siRNA를 이루도록 제작하였고, 이중 가닥의 siRNA가 각각 mTOR 유전자 및 STAT3 유전자를 표적화하여 두 유전자의 발현을 동시에 억제함을 확인함으로써 이중 표적 siRNA 세트임을 확인하였다.
일 구현예에서, 상기 shRNA는 mTOR 유전자의 발현을 억제하는 siRNA를 코딩하는 핵산 분자 및 STAT3 유전자의 발현을 억제하는 siRNA를 코딩하는 핵산 분자가 부분적으로 상보적 결합하고 루프 영역에 의해 회문적으로 연결되어 헤어핀 구조를 형성할 수 있으며, 헤어핀 구조의 루프 부분 염기서열에 따라 TTCAAGAGAG (shRNA로 발현시 UUCAAGAGAG) loop shRNA 또는 TTGGATCCAA (shRNA로 발현시 UUGGAUCCAA) loop shRNA일 수 있다.
본 발명에서 mTOR 유전자 및 STAT3 유전자의 발현을 억제하는 siRNA는 인간(Homo sapiens)의 mTOR 유전자 또는 STAT3 유전자의 일부와 상보적인 서열을 가지고, mTOR 유전자 또는 STAT3 유전자의 mRNA를 분해하거나, 번역을 억제할 수 있다.
본 발명에서 사용되는 용어, "발현 억제"란 표적 유전자의 (mRNA로의) 발현 또는 (단백질로의) 번역 저하를 야기하는 것을 의미하며, 바람직하게는 이에 의해 표적 유전자 발현이 탐지 불가능해지거나 무의미한 수준으로 존재하게 되는 것을 의미한다.
본 발명에서 사용되는 용어, "siRNA(small interfering RNA)"란 특정 mRNA의 절단(cleavage)을 통하여 RNAi(RNA interference) 현상을 유도할 수 있는 짧은 이중사슬 RNA를 의미한다. 일반적으로 siRNA는 표적 유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성되나, 본 발명의 이중 가닥 siRNA는 센스 RNA 가닥이 서열번호 1의 염기서열로 이루어진 siRNA (mTOR 유전자에 대한 안티센스 가닥)이고, 안티센스 RNA 가닥이 서열번호 2의 염기서열로 이루어진 siRNA (STAT3 유전자에 대한 안티센스 가닥)이므로, 이중 가닥의 siRNA가 각각 동시에 mTOR 유전자 및 STAT3 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knock-down) 방법으로서 또는, 유전자치료(gene therapy)의 방법으로 제공된다.
본 발명의 용어 "shRNA(short hairpin RNA)"란, 단일가닥 RNA에서 부분적으로 회문상의 염기서열을 포함함으로써, 3´영역에 이중가닥 구조를 가지고 헤어핀과 같은 구조를 형성하고, 세포내에서 발현된 후에 세포내에 존재하는 RNase의 일종인 dicer에 의하여 절단되어 siRNA로 변환될 수 있는 RNA를 의미하는데, 상기 이중가닥 구조의 길이는 특별히 한정되지는 않으나, 바람직하게는 10 뉴클레오티드 이상이고, 보다 바람직하게는 20 뉴클레오티드 이상이다. 본 발명에 있어서, 상기 shRNA는 발현 카세트에 포함될 수 있으며, 상기 shRNA는 각 유전자에 대한 siRNA 안티센스 가닥 및 센스 가닥으로 이루어진 세트 서열에서 U를 T로 변환한 뒤, 센스 가닥의 3'에 TTGGATCCAA (TTGGATCCAA 루프) 또는 TTCAAGAGAG (TTCAAGAGAG 루프), 안티센스 가닥 및 TT를 순차적으로 연결하여 shRNA를 코딩하는 발현 카세트를 제작하고 이를 세포 내에서 발현시킴으로써 생산할 수 있다. 이 경우에 발현 카세트는 서열번호 1 내지 20의 염기서열에서 U가 T로 변환된 핵산들 중 하나 이상을 포함할 수 있다.
일 측면에서, 본 발명은 본 발명의 핵산 분자를 포함하는 재조합 발현 벡터에 관한 것이다.
일 구현예에서, 본 발명의 재조합 발현 벡터는 mTOR 유전자 발현을 억제하는 핵산 분자 및 STAT3 유전자 발현을 억제하는 핵산 분자를 코딩하는 발현 카세트를 포함할 수 있다.
일 구현예에서, 본 발명의 재조합 발현 벡터는 서열번호 1 및 2; 서열번호 3 및 4; 서열번호 5 및 6; 서열번호 7 및 8; 서열번호 9 및 10; 서열번호 11 및 12; 서열번호 13 및 14; 서열번호 15 및 16; 서열번호 17 및 18; 및 서열번호 19 및 20으로 이루어진 군에서 선택된 1종 이상의 염기서열 또는 이를 코딩하는 염기서열을 포함할 수 있다.
본 발명의 재조합 벡터는 당해 분야에 공지된 재조합 DNA 방법에 의해 제조될 수 있으며, 일 실시예에서는 pE3.1 벡터를 이용하였다.
본 발명에서 mTOR 유전자 및 STAT3 유전자의 발현을 억제하는 핵산 분자를 전달하기에 유용한 비바이러스 벡터로는 통상적으로 유전자 요법에 사용되는 모든 벡터를 포함하며, 예를 들어 진핵세포에서 발현 가능한 다양한 플라스미드 및 리포좀 등이 있다.
본 발명에서 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 이중 가닥 siRNA가 전달된 세포에서 적절히 전사되게 하기 위해서는 이를 포함하는 shRNA를 암호화하는 염기서열이 적어도 프로모터에 작동가능하게 연결되는 것이 바람직하다. 상기 프로모터는 진핵세포에서 기능할 수 있는 프로모터라면 어떤 것이든지 무방하나, U6 프로모터가 보다 바람직하다. mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 이중 가닥 siRNA 또는 shRNA의 효율적인 전사를 위하여 필요에 따라 리더 서열, 폴리아데닐화 서열, 프로모터, 인핸서, 업스트림 활성화 서열, 신호펩타이드 서열 및 전사 종결인자를 비롯한 조절서열을 추가로 포함할 수도 있다.
본 발명에서 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 siRNA 또는 shRNA를 전달하기에 유용한 바이러스 또는 바이러스 벡터로는 바쿨로비리디애(baculoviridiae), 파르보비리디애(parvoviridiae), 피코르노비리디애(picornoviridiae), 헤레페스비리디애(herepesviridiae), 폭스비리디애(poxviridiae), 아데노비리디애(adenoviridiae) 등이 있지만, 이에 제한되는 것은 아니다.
일 측면에서, 본 발명은 본 발명의 재조합 발현 벡터를 도입한 바이러스에 관한 것이다.
일 구현예에서, 본 발명의 바이러스는 아데노 바이러스일 수 있고, 그룹 C의 혈청형이 5 타입인 아데노바이러스일 수 있다.
일 구현예에서, 본 발명의 바이러스는 인간 텔로미어 프로모터(hTERT)를 추가로 포함할 수 있다.
일 구현예에서, 본 발명의 바이러스는 서열번호 1 및 2, 서열번호 3 및 4, 서열번호 5 및 6, 서열번호 7 및 8, 서열번호 9 및 10, 서열번호 11 및 12, 서열번호 13 및 14, 서열번호 15 및 16, 서열번호 17 및 18, 및 서열번호 19 및 20으로 이루어진 군에서 선택된 1종 이상의 염기서열 또는 이를 코딩하는 염기서열; 및 인간 텔로미어 프로모터(hTERT)를 포함하는 재조합 발현 벡터를 포함할 수 있다.
일 구현예에서, mTOR 유전자 발현을 억제하는 핵산 분자와 STAT3 유전자 발현을 억제하는 핵산 분자가 발현되는 경우, 각각 발현된 서열이 부분적 또는 100% 상보적인 결합으로 이중가닥을 형성할 수 있다.
일 구현예에서, 인간 텔로미어 프로모터는 바이러스의 내재적 유전자와 작동 가능하게 연결될 수 있다.
일 구현예에서, 아데노 바이러스의 내재적 유전자는 5'ITR-C1-C2-C3-C4-C5 3'ITR의 구조를 가지며; 상기 C1은 E1A, E1B 또는 E1A-E1B를 포함하고; 상기 C2는 E2B-L1-L2-L3-E2A-L4를 포함하며; 상기 C3는 E3를 포함하지 않거나 E3를 포함하고; 상기 C4는 L5를 포함하며; 및 상기 C5는 E4를 포함하지 않거나 E4를 포함할 수 있다.
일 구현예에서, 아데노바이러스는 E3 영역이 일부 결실될 수 있다.
일 구현예에서, mTOR 유전자 발현을 억제하는 핵산 분자 및 STAT3 유전자 발현을 억제하는 핵산 분자, 또는 이를 코딩하는 핵산 분자 (예컨대, shRNA)를 포함하는 발현 카세트가 아데노 바이러스의 내재적 유전자의 C3 부위에 위치할 수 있다.
일 구현예에서, 상기 발현 카세트는 STAT3에 특이적인 센스 가닥 및 mTOR에 특이적인 안티 센스 가닥이 부분적으로 상보적인 결합을 이루고 있는 이중 가닥 siRNA를 발현시킴으로써 STAT3 및 mTOR을 동시에 억제할 수 있다.
일 구현예에서, hTERT 프로모터가 아데노 바이러스의 내재적 유전자의 E1A 및 E1B와 작동가능하게 연결될 수 있다.
일 구현예에서, 아데노 바이러스의 내재적 유전자의 E1A 및 E1B 사이에 IRES 서열이 추가로 포함될 수 있다.
본 발명의 본 발명의 재조합 발현 벡터를 도입한 아데노 바이러스는 야생형 아데노바이러스에 비해 종양살상능이 높으며, 야생형 아데노바이러스에 hTERT 프로모터가 도입된 아데노바이러스에 비해 종양살상능이 높을 수 있다.
본 발명에 있어서, 용어 "작동가능하게 연결된"은 유전자 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절 인자 결합 위치의 어레이)과 다른 유전자 서열 사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 유전자 서열의 전사 및/또는 해독을 조절하게 된다.
일 측면에서, 본 발명은 본 발명의 핵산 분자, 본 발명의 재조합 발현 벡터 또는 본 발명의 바이러스를 유효성분으로 함유하는 암의 예방 또는 치료용 약학조성물에 관한 것이다.
일 구현예에서, 본 발명의 조성물은 항암제를 추가로 포함할 수 있으며, 예를 들어, 아시바이신, 아클라루비신, 아코다졸, 아크로나이신, 아도젤레신, 알라노신, 알데스루킨, 알로푸리놀 소듐, 알트레타민, 아미노글루테티미드, 아모나파이드, 암플리겐, 암사크린, 안드로겐스, 안구이딘, 아피디콜린 글리시네이트, 아사레이, 아스파라기나아제, 5-아자시티딘, 아자티오프린, 바실러스 칼메테-구에린(BCG), 베이커스 안티폴, 베타-2-디옥시티오구아노신, 비스안트렌 HCl, 블레오마이신 설페이트, 불서판, 부티오닌 설폭시민, BWA 773U82, BW 502U83/HCl, BW 7U85 메실레이트, 세라세미드, 카르베티머, 카르보플라틴, 카르무스틴, 클로람부실, 클로로퀴녹살린-설포나미드, 클로로조토신, 크로모마이신 A3, 시스플라틴, 클라드리빈, 코르티코스테로이드, 코리너박테리움 파르붐, CPT-11, 크리스나톨, 사이클로사이티딘, 사이클로포스파미드, 사이타라빈, 사이템베나, 다비스 말리에이트, 데카르바진, 닥티노마이신, 다우노루바이신 HCl, 디아자유리딘, 덱스라족산, 디언하이드로 갈락티톨, 디아지쿠온, 디브로모둘시톨, 디데민 B, 디에틸디티오카르바메이트, 디클라이코알데하이드, 다이하이드로-5-아자사이틴, 독소루비신, 에치노마이신, 데다트렉세이트, 에델포신, 에플롤니틴, 엘리옷스 용액, 엘사미트루신, 에피루비신, 에소루비신, 에스트라머스틴 포스페이트, 에스트로겐, 에타니다졸, 에티오포스, 에토포사이드, 파드라졸, 파자라빈, 펜레티나이드, 필그라스팀, 피나스테라이드, 플라본 아세트산, 플록스유리딘, 플루다라빈 포스페이트, 5'-플루오로우라실, Fluosol™, 플루타미드, 갈륨 나이트레이트, 겜사이타빈, 고세레린 아세테이트, 헤프설팜, 헥사메틸렌 비스아세트아미드, 호모하링토닌, 하이드라진 설페이트, 4-하이드록시안드로스테네디온, 하이드로지우레아, 이다루비신 HCl, 이포스파미드, 4-이포메아놀, 이프로플라틴, 이소트레티노인, 류코보린 칼슘, 류프로라이드 아세테이트, 레바미솔, 리포좀 다우노루비신, 리포좀 포집 독소루비신, 로머스틴, 로니다민, 마이탄신, 메클로레타민 하이드로클로라이드, 멜팔란, 메노가릴, 메르바론, 6-머캅토푸린, 메스나, 바실러스 칼레테-구에린의 메탄올 추출물, 메토트렉세이트, N-메틸포름아미드, 미페프리스톤, 미토구아존, 마이토마이신-C, 미토탄, 미톡산트론 하이드로클로라이드, 모노사이트/마크로파아지 콜로니-자극 인자, 나빌론, 나폭시딘, 네오카르지노스타틴, 옥트레오타이드 아세테이트, 오르마플라틴, 옥살리플라틴, 파크리탁셀, 팔라, 펜토스타틴, 피페라진디온, 피포브로만, 피라루비신, 피리트렉심, 피록산트론 하이드로클로라이드, PIXY-321, 플리카마이신, 포르피머 소듐, 프레드니무스틴, 프로카르바진, 프로게스틴스, 파이라조푸린, 라족산, 사르그라모스팀, 세무스틴, 스피로게르마늄, 스피로무스틴, 스트렙토나이그린, 스트렙토조신, 술로페너르, 수라민 소듐, 타목시펜, 탁소레레, 테가푸르, 테니포사이드, 테레프탈아미딘, 테록시론, 티오구아닌, 티오테파, 티미딘 인젝션, 티아조푸린, 토포테칸, 토레미펜, 트레티노인, 트리플루오페라진 하이드로클로라이드, 트리플루리딘, 트리메트렉세이트, TNF(tumor necrosis factor), 우라실 머스타드, 빈블라스틴 설페이트, 빈크리스틴 설페이트, 빈데신, 비노렐빈, 빈졸리딘, Yoshi 864, 조루비신, 사이토신아라비노시드, 에토포시드, 멜파란, 탁솔 및 이들의 혼합물을 포함할 수 있다. 바람직하게는 시스플라틴, 파클리탁셀, 5-FU(5-fluorouracil), 메토트렉세이트, 독소루비신, 다우노루비신, 사이토신아라비노시드, 에토포시드, 멜파란, 클로람부실, 사이클로포스파마이드, 빈데신, 마이토마이신, 블레오마이신, 타목시펜 및 탁솔이고, 더욱 바람직하게는, 시스플라틴, 파클리탁셀 또는 5-FU(5-fluorouracil)이나, 본 발명의 조성물과 병용 처리하여 항암 효과에 시너지 효과를 나타낼 수 있는 목적을 달성하기 위해서라면, 이에 제한되지 않는다.
상기 암은 대장암, 유방암, 자궁암, 자궁경부암, 난소암, 전립선암, 뇌종양, 두경부암종, 흑색종, 골수종, 백혈병, 림프종, 위암, 폐암, 췌장암, 비소세포성폐암, 간암, 식도암, 소장암, 항문부근암, 나팔관암종, 자궁내막암종, 질암종, 음문암종, 호지킨병, 방광암, 신장암, 수뇨관암, 신장세포암종, 신장골반암종, 골암, 피부암, 두부암, 경부암, 피부흑색종, 안구내흑색종, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직육종, 요도암, 음경암, 중추신경계(central nervous system; CNS) 종양, 1차 CNS 림프종, 척수종양, 다형성교모세포종 및 뇌하수체선종으로 구성된 군으로부터 선택되는 어느 하나일 수 있다.
본 발명에서 사용된 용어 "치료"란 본원발명의 핵산을 포함하는 조성물의 투여로 암세포의 사멸 또는 암의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 본원의 조성물이 효과가 있는 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.
일 구현예에서, 상기 약학적 조성물은 경구형 제형, 외용제, 좌제, 멸균 주사용액 및 분무제를 포함하는 군으로부터 선택되는 하나 이상의 제형일 수 있다.
본 발명의 조성물의 치료적으로 유효한 양은 여러 요소, 예를 들면 투여방법, 목적부위, 환자의 상태 등에 따라 달라질 수 있다. 따라서, 인체에 사용 시 투여량은 안전성 및 효율성을 함께 고려하여 적정량으로 결정되어야 한다. 동물실험을 통해 결정한 유효량으로부터 인간에 사용되는 양을 추정하는 것도 가능하다. 유효한 양의 결정시 고려할 이러한 사항은, 예를 들면 Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed.(2001), Pergamon Press; 및 E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed.(1990), Mack Publishing Co.에 기술되어있다.
본 발명의 조성물은 또한 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 둘 이상의 이들의 조합을 포함할 수 있다. 약제학적으로 허용 가능한 담체는 조성물을 생체 내 전달에 적합한 것이면 특별히 제한되지 않으며, 예를 들면, Merck Index, 13th ed., Merck & Co. Inc. 에 기재된 화합물, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 이용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한, 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주이용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다. 더 나아가 당 분야의 적정한 방법으로 또는 Remington's Pharmaceutical Science(Mack Publishing Company, Easton PA, 18th, 1990)에 개시되어 있는 방법을 이용하여 각 질환에 따라 또는 성분에 따라 바람직하게 제제화할 수 있다.
본 발명의 조성물에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 본 발명의 조성물은, 조성물 총 중량에 대하여 상기 단백질을 0.0001 내지 10 중량 %로, 바람직하게는 0.001 내지 1 중량 %를 포함한다.
본 발명의 약학 조성물은 약제학적으로 허용 가능한 첨가제를 더 포함할 수 있으며, 이때 약제학적으로 허용 가능한 첨가제로는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바 납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 백당, 덱스트로스, 소르비톨 및 탈크 등이 사용될 수 있다. 본 발명에 따른 약제학적으로 허용 가능한 첨가제는 상기 조성물에 대해 0.1 중량부 내지 90 중량부 포함되는 것이 바람직하나, 이에 한정되는 것은 아니다.
본 발명의 조성물은 목적하는 방법에 따라 비 경구 투여(예를 들어 정맥 내, 피하, 복강 내 또는 국소에 적용)하거나 경구 투여할 수 있으며, 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도 등에 따라 그 범위가 다양하다. 본 발명에 따른 조성물의 일일 투여량은 0.0001 ~ 10 ㎎/㎖이며, 바람직하게는 0.0001 ~ 5 ㎎/㎖이며, 하루 일 회 내지 수회에 나누어 투여하는 것이 더욱 바람직하다.
본 발명의 조성물의 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데, 통상적으로 사용되는 단순 희석제인 물, 액체 파라핀 이외에 다양한 부형제, 예컨대 습윤제, 감미제, 방향제, 보존제 등이 함께 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제, 좌제 등이 포함된다.
본 발명의 약학 조성물은 암 및 이의 합병증의 예방 또는 치료에 이용될 수 있으며, 항암보조제로도 사용될 수 있다.
일 측면에서, 본 발명은 본 발명의 핵산 분자, 이를 포함하는 재조합 발현 벡터 또는 이를 포함하는 바이러스의 암 예방 또는 치료 용도에 관한 것이다.
일 측면에서, 본 발명은 본 발명의 핵산 분자, 이를 포함하는 재조합 발현 벡터 또는 이를 포함하는 바이러스를 암에 걸린 개체에 투여하는, 암 치료 방법에 관한 것이다.
하기의 실시예를 통하여 본 발명을 보다 상세하게 설명한다. 그러나 하기 실시예는 본 발명의 내용을 구체화하기 위한 것일 뿐 이에 의해 본 발명이 한정되는 것은 아니다.
실시예 1. mTOR 및 STAT3 이중 표적 siRNA 제작
STAT3(signal transducer and activator of transcription 3) 및 mTOR(mammalian target of rapamycin)를 동시에 억제할 수 있는 이중 표적 siRNA (double strand)를 하기의 표 1의 서열로 제작하였다 (Bioneer, Daejeon, Korea). 구체적으로, 세트 1의 서열번호 1 및 2의 siRNA는 19mer 중 15mer가, 세트 2의 서열번호 3 및 4의 siRNA는 19mer 중 15mer가, 세트 3의 서열번호 5 및 6의 siRNA는 19mer 중 15mer가, 세트 4의 서열번호 7 및 8의 siRNA는 20mer 중 16mer가, 및 세트 5의 서열번호 9 및 10의 siRNA는 19mer 중 15mer가 상보적으로 결합한다. 또한, 세트 6의 서열번호 11 및 12의 siRNA는 20mer 중 17mer가, 세트 7의 서열번호 13 및 14의 siRNA는 19mer 중 17mer가, 세트 8의 서열번호 15 및 16의 siRNA는 19mer 중 16mer가, 세트 9의 서열번호 17 및 18의 siRNA는 20mer 중 17mer가, 및 세트 10의 서열번호 17 및 18의 siRNA는 19mer 중 16mer가 상보적으로 결합한다. 하기 표 1의 각 세트의 두 서열이 double strand 형태로 세포 내로 들어간 뒤, 각 세트의 sense siRNA (antisense_mTOR)가 mTOR mRNA(gi|206725550|ref|NM_004958.3| Homo sapiens mechanistic target of rapamycin (serine/threonine kinase) (MTOR), mRNA)의 표적 부위에 상보적으로 결합하며, antisense siRNA (antisense_STAT3)가 STAT3 mRNA(gi|47080104|ref|NM_139276.2| Homo sapiens signal transducer and activator of transcription 3 (acute-phase response factor)(STAT3), transcript variant 1, mRNA)의 표적 부위에 상보적으로 결합하여, mTOR 및 STAT3 유전자의 발현을 동시에 감소시킨다.
set siRNA Sequence(sense), 5'-3' 서열번호 Sequence(antisense), 5'-3' 서열번호 length 상보적 결합 길이
1 si-MS1 UGGAGCAUGUCCAUGAUGA 1 UCAUCCUGGAGAUUCUCUA 2 19 15
2 si-MS2 CGGGGCAACAAAUUAAGGA 3 UUCUUAAUUUGUUGACGGG 4 19 15
3 si-MS3 UCUAUCUCCCAGGCCUAAA 5 UUGAGGCCUUGGUGAUACA 6 19 15
4 si-MS4 UCAUGGCCUUUUAGAAGGAA 7 UUCGUUCCAAAGGGCCAGGA 8 20 16
5 si-MS5 CUGGCUAACCACAUGAGCA 9 UGCUAAUGACGUUAUCCAG 10 19 15
6 si-MS6 UCAGCCACAGCAGCUUGGC 11 GUCAAGCUGCUGUAGCUGA 12 19 17
7 si-MS7 CCCCAUGCAGCUGCAGCAG 13 CUGCCGCAGCUCCAUUGGG 14 19 16
8 si-MS8 CAGCGCAUGCGGCCCAGCA 15 UGCUGGGCCGCAGUGGCUG 16 19 16
9 si-MS9 GCAGCGCAUGCGGCCCAGCA 17 UGCUGGGCCGCAGUGGCUGC 18 20 17
10 si-MS10 GCAGCGCAUGCGGCCCAGC 19 GCUGGGCCGCAGUGGCUGC 20 19 16
실시예 2. mTOR 및 STAT3 이중 표적 shRNA 발현 카세트 제작
상기 실시예에서 제작한 siRNA를 세포 내에서 발현할 수 있게 하기 위하여, shRNA를 발현하는 카세트를 제작하였다. 구체적으로, 5'에서 3' 방향으로 상기 표 1의 siRNA 세트의 센스 가닥의 3'에 TTGGATCCAA (TTGGATCCAA 루프) 또는 TTCAAGAGAG (TTCAAGAGAG 루프), 안티센스 가닥 및 TT를 연결하여 shRNA를 코딩하는 DNA 서열 (shRNA 발현 카세트들 (TTGGATCCAA 루프 shRNA 및 TTCAAGAGAG 루프 shRNA))을 제작하였다. 제작한 shRNA 발현 카세트들을 각각 pE3.1 벡터 (도 1)의 제한효소 PstⅠ 및 EcoRⅤ 절단 위치에 U6 프로모터 이후에 오도록 배치하여, mTOR 및 STAT3를 표적으로 하는 이중 표적 siRNA를 포함하는 두 종의 shRNA를 세포 내에서 발현하는 재조합 발현 벡터를 제작하였다.
실시예 3. 이중 표적 siRNA의 유전자 발현 억제 효과 확인
6-웰 플레이트에 Hela 세포를 2×105 cells/well의 밀도로 분주한 뒤, 세포 밀도가 50%가 될 때까지 10% FBS (Hyclone 사)가 첨가된 RPMI 배지 (Hyclone 사)에서 37℃, 5% CO2 조건으로 배양하였다. 그 후, 상기 세포에 상기 실시예 1에서 제작한 세트 1 내지 10의 이중 표적 siRNA를 각각 lipofectamine3000 (Invitrogen, Carlsbad, CA, USA)으로 트랜스펙션하여 mTOR 및 STAT3를 동시에 낙다운하였으며, 양성대조군으로 CA102 (종래의 mTOR 및 STAT3를 동시에 억제하는 이중 가닥 siRNA 세트: gacuguggcauccaccugcau 및 augcagguaggcgccucaguc)를 사용하였다. 트랜스펙션 72시간 후, 세포를 파쇄하여 GeneJET RNA Purification Kit (Invitrogen)로 총 RNA를 추출하였다. 추출한 총 RNA를 주형으로 사용하여 RevoScriptTM RT PreMix(iNtRON BIOTECHNOLOGY)로 역전사 반응을 수행하였다. 역전사된 cDNA를 25 내지 200ng 함유한 시료 20㎕와 AmpONE taq DNA polymerase (GeneAll) 및 TaqMan Gene Expression assays (Applied Biosystems)를 이용하여 mTOR (Hs00234522_m1), STAT3 (Hs01047580_m1) 및 GAPDH (Hs02758991_g1)에 대하여, ABI PRISM 7700 Sequence Detection System 및 QS3 Real-time PCR(Biosystems)을 이용하여 반응을 수행하였다. Real-time PCR 반응 조건은 [50℃에서 2분, 95℃에서 10분, 및 95℃에서 15초 및 60℃에서 60초의 두 단계 사이클]을 총 40 사이클로 수행하였다. 모든 반응은 3회씩 반복 수행되고 이들의 평균값이 취해졌다. 이렇게 얻은 결과들은 하우스키핑 유전자인 GAPDH의 mRNA 값에 대해 정규화하였다.
그 결과, 세트 1 내지 10의 이중 표적 siRNA 중 세트 1 (mTOR/STAT3 #2), 세트 4, 5, 8, 9 및 10에 의해 mTOR 및 STAT3가 대조군에 비해 현저히 억제된 것으로 나타나, 이중 표적 siRNA가 두 유전자 모두 동시에 발현 억제하는 것을 알 수 있었다 (도 2).

Claims (15)

  1. mTOR(mammalian target of rapamycin) 유전자 및 STAT3(signal transducer and activator of transcription 3) 유전자의 발현을 동시에 억제하는 핵산 분자.
  2. 제 1항에 있어서, 서열번호 1 내지 20으로 표시되는 각각의 염기 서열과 80% 이상의 상동성을 갖는 염기서열을 포함하는, 핵산 분자.
  3. 제 2항에 있어서, 서열번호 1, 3, 5, 7, 9, 11, 13, 15, 17 또는 19의 염기서열을 포함하는 핵산 분자는 RNA 간섭에 의해 mTOR 유전자의 발현을 억제하는, 핵산 분자.
  4. 제 2항에 있어서, 서열번호 2, 4, 6, 8, 10, 12, 14, 16, 18 또는 20의 염기서열을 포함하는 핵산 분자는 RNA 간섭에 의해 STAT3 유전자의 발현을 억제하는, 핵산 분자.
  5. 제 1항에 있어서, mTOR 유전자의 발현을 억제하는 핵산 분자는 STAT3 유전자의 발현을 억제하는 핵산 분자와 부분적 또는 100% 상보적인 결합으로 이중가닥을 형성하는, 핵산 분자.
  6. 제 1항에 있어서, mTOR 유전자의 발현을 억제하는 핵산 분자는 STAT3 유전자의 발현을 억제하는 핵산 분자의 역상보 서열과 60% 이상의 상보성을 갖는 염기서열을 포함하는, 핵산 분자.
  7. 제 1항에 있어서, mTOR 유전자의 발현을 억제하는 핵산 분자, 헤어핀 구조를 이룰 수 있는 루프 서열, 및 STAT3 유전자의 발현을 억제하는 핵산 분자를 순차적으로 포함하는 shRNA(short hairpin RNA)인, 핵산 분자.
  8. 제 1항의 핵산 분자를 포함하는 재조합 발현 벡터.
  9. 제 8항에 있어서, mTOR 유전자의 발현을 억제하는 핵산 분자 및 STAT3 유전자의 발현을 억제하는 핵산 분자를 코딩하는 발현 카세트를 포함하는 재조합 발현 벡터.
  10. 제 8항의 재조합 발현 벡터를 도입한 바이러스.
  11. 제 10항에 있어서, 인간 텔로미어 프로모터(hTERT)를 추가로 포함하는, 바이러스.
  12. 제 1항의 핵산 분자, 제 8항의 재조합 발현 벡터 또는 제 10항의 바이러스를 유효성분으로 포함하는 암의 예방 또는 치료용 약학조성물.
  13. 제 12항에 있어서, 항암제를 추가로 포함하는 암의 예방 또는 치료용 약학조성물.
  14. 제 1항의 핵산 분자, 제 8항의 재조합 발현 벡터 또는 제 10항의 바이러스의 암 예방 또는 치료 용도.
  15. 제 1항의 핵산 분자, 제 8항의 재조합 발현 벡터 또는 제 10항의 바이러스를 암에 걸린 개체에 투여하는, 암 치료 방법.
PCT/KR2022/020715 2021-12-20 2022-12-19 Mtor 유전자 및 stat3 유전자의 발현을 동시에 억제하는 핵산 WO2023121178A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0182835 2021-12-20
KR1020210182835A KR20230093859A (ko) 2021-12-20 2021-12-20 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산

Publications (1)

Publication Number Publication Date
WO2023121178A1 true WO2023121178A1 (ko) 2023-06-29

Family

ID=86903352

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/020715 WO2023121178A1 (ko) 2021-12-20 2022-12-19 Mtor 유전자 및 stat3 유전자의 발현을 동시에 억제하는 핵산

Country Status (2)

Country Link
KR (1) KR20230093859A (ko)
WO (1) WO2023121178A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190087726A (ko) * 2018-01-17 2019-07-25 (주)큐리진 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산
KR20200009286A (ko) * 2018-07-18 2020-01-30 (주)큐리진 AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산
KR20200009498A (ko) * 2018-07-19 2020-01-30 (주)큐리진 Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
KR20210118757A (ko) * 2020-03-23 2021-10-01 (주)큐리진 STAT3 및 mTOR를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
KR20210118759A (ko) * 2020-03-23 2021-10-01 (주)큐리진 이중 특이적 핵산분자를 포함한 항암 바이러스의 구조

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190087726A (ko) * 2018-01-17 2019-07-25 (주)큐리진 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산
KR20200009286A (ko) * 2018-07-18 2020-01-30 (주)큐리진 AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산
KR20200009498A (ko) * 2018-07-19 2020-01-30 (주)큐리진 Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
KR20210118757A (ko) * 2020-03-23 2021-10-01 (주)큐리진 STAT3 및 mTOR를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
KR20210118759A (ko) * 2020-03-23 2021-10-01 (주)큐리진 이중 특이적 핵산분자를 포함한 항암 바이러스의 구조

Also Published As

Publication number Publication date
KR20230093859A (ko) 2023-06-27

Similar Documents

Publication Publication Date Title
US10550391B2 (en) Organic compositions to treat beta-ENaC-related diseases
KR20210118759A (ko) 이중 특이적 핵산분자를 포함한 항암 바이러스의 구조
CN110234764B (zh) 同时抑制mTOR基因及STAT3基因表达的核酸
KR101993377B1 (ko) Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
WO2023121178A1 (ko) Mtor 유전자 및 stat3 유전자의 발현을 동시에 억제하는 핵산
WO2021194179A1 (ko) Stat3 및 mtor를 이중 특이적으로 표적하는 핵산서열을 포함한 항암 바이러스
KR102145664B1 (ko) AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산
KR101999515B1 (ko) AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산
KR102145665B1 (ko) Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
KR101865025B1 (ko) mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산
WO2022191661A1 (ko) C-met 유전자 및 pd-l1 유전자의 발현을 동시에 억제하는 핵산
AU2018303104B2 (en) Nucleic acid simultaneously inhibiting expression of AR gene and mTOR gene
WO2021194181A1 (ko) Ar 및 mtor를 이중 특이적으로 표적하는 핵산분자를 포함하는 항암바이러스
US20200399642A1 (en) Methods and compositions for treating and preventing metastatic tumors
KR20130012095A (ko) ＴＧＦ－β１ 발현을 억제하는 ｓｈＲＮＡ
KR101042052B1 (ko) 항-ｍｉｃｒｏＲＮＡ를 포함하는 고형암 예방 또는 치료용조성물
WO2019017714A2 (ko) Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
KR20220104653A (ko) miR 145 억제제를 유효성분으로 포함하는 심근경색증의 치료용 조성물
AU2015221515B2 (en) Organic compositions to treat Beta-ENaC-related diseases
KR20220164732A (ko) 변형된 단간섭 rna 조성물 및 암 치료에 있어서의 이의 용도
CN117280030A (zh) 用于治疗缺氧和缺血相关病症的药剂、组合物和方法
KR20230042646A (ko) Wfdc2의 발현을 조절하는 안티센스 화합물
KR20230042672A (ko) Wfdc2의 발현을 조절하는 안티센스 화합물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22911811

Country of ref document: EP

Kind code of ref document: A1