WO2023086913A2 - Relaxin-2 fusion protein analogs and methods of using same - Google Patents

Relaxin-2 fusion protein analogs and methods of using same Download PDF

Info

Publication number
WO2023086913A2
WO2023086913A2 PCT/US2022/079681 US2022079681W WO2023086913A2 WO 2023086913 A2 WO2023086913 A2 WO 2023086913A2 US 2022079681 W US2022079681 W US 2022079681W WO 2023086913 A2 WO2023086913 A2 WO 2023086913A2
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
acid sequence
seq
peptide comprises
fusion protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/079681
Other languages
English (en)
French (fr)
Other versions
WO2023086913A3 (en
Inventor
John Diener
Andrew KRUSE
Franz GRUSWITZ
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tectonic Therapeutic Inc
Original Assignee
Tectonic Therapeutic Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tectonic Therapeutic Inc filed Critical Tectonic Therapeutic Inc
Priority to CA3237801A priority Critical patent/CA3237801A1/en
Priority to JP2024527767A priority patent/JP2024543455A/ja
Priority to IL312731A priority patent/IL312731A/en
Priority to EP22893856.9A priority patent/EP4429694A4/en
Priority to CN202280086174.7A priority patent/CN118510536A/zh
Priority to AU2022388751A priority patent/AU2022388751A1/en
Priority to MX2024005654A priority patent/MX2024005654A/es
Priority to KR1020247019339A priority patent/KR20240110824A/ko
Publication of WO2023086913A2 publication Critical patent/WO2023086913A2/en
Publication of WO2023086913A3 publication Critical patent/WO2023086913A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/64Relaxins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

  • This disclosure provides relaxin-2 fusion protein analogs with improved pharmacokinetic properties, methods for making these fusion proteins, and methods of using these fusion proteins to enhance relaxin-2 related activity in a subject and treat or prevent relaxin-2 related diseases.
  • Relaxin-2 exhibits strong antifibrotic activity. In injured tissues, fibroblast activation and proliferation cause increased collagen production and interstitial fibrosis. Fibrosis in the heart is increased by biomechanical overload, and influences ventricular dysfunction, remodeling, and arrhythmogenesis. However, due to the limited in vivo half-life of relaxin, treatment of patients has to be repeated every 14 to 21 days, whereby compound administration has to be performed as a continuous infusion for at least 48 hours. Further, the synthesis of relaxin-2 is difficult. Due to the low solubility of the B-chain and the requirement for the laborious, specific introduction of cysteine bridges between A and B-chains, yields of active peptide obtained by these methods are extremely low.
  • This disclosure provides fusion proteins that are engineered relaxin-2 analogs with improved pharmacokinetic properties. This disclosure also provides methods of using these fusion proteins to enhance relaxin-2 related activity in a subject and to treat or prevent relaxin- 2 related diseases.
  • a fusion protein comprising, from N-terminus to C-terminus, a first peptide; a linker peptide; and a second peptide, wherein the first peptide comprises an amino acid sequence that differs at 0, 1, 2, 3, 4, or 5 amino acids when compared to the amino acid sequence of SEQ ID NO: 7 and the second peptide comprises an amino acid sequence that differs at 0, 1, 2, 3, 4, or 5 amino acids when compared to the amino acid sequence of SEQ ID NO: 9; or the first peptide comprises an amino acid sequence that differs at 0, 1, 2, 3, 4, or 5 amino acids when compared to the amino acid sequence of SEQ ID NO: 9 and the second peptide comprises an amino acid sequence that differs at 0, 1, 2, 3, 4, or 5 amino acids when compared to the amino acid sequence of SEQ ID NO: 7; the linker peptide comprises an amino acid sequence with 12-15 amino acids, comprising 2-5 acidic amino acids and 10-13 non-acidic amino acids; and the fusion protein has a pl from
  • the linker peptide comprises an amino acid sequence selected from the group consisting of
  • R1R1R1R2R1R1R1R1R2R1R1R1R2R1R1R2R1 SEQ ID NO : 195 ) ;
  • R1R1R1R2R2R1R1R1R2R2R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1 SEQ ID NO : 198
  • R1R1R2R1R2R1R1R2R1R1R1R1R1R1R1R1R1 SEQ ID NO : 199
  • Ri is a non-acidic amino acid
  • R2 is an acidic amino acid.
  • the acidic amino acid(s) are aspartate or glutamate. In some embodiments, the acidic amino acid(s) are glutamate. In some embodiments, the non-acidic amino acid(s) are glycine, proline, or serine. In some embodiments, the non-acidic amino acid(s) are glycine.
  • the linker peptide comprises the amino acid sequence of one or more of SEQ ID NO: 14, 15, 16, 17, or 18. In some embodiments, the linker peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-23.
  • the first peptide comprises the amino acid sequence of DSWX3EEVIKLCGRELVRAQIAICGX4ST (SEQ ID NO: 3), wherein X 3 is methionine, lysine, or glutamine, and wherein X4 is methionine or lysine.
  • the first peptide comprises the amino acid sequence of X5QX6YSALANKCCHVGCTKRSLAX7 FC (SEQ ID NO: 4), wherein X5 is arginine or absent, Xe is leucine or aspartic acid, and wherein X7 is arginine, glutamine, or glutamate.
  • the second peptide comprises the amino acid sequence of DSWX3EEVIKLCGRELVRAQIAICGX4ST (SEQ ID NO: 3), wherein X 3 is methionine, lysine, or glutamine, and wherein X4 is methionine or lysine.
  • the second peptide comprises the amino acid sequence of X5QX6YSALANKCCHVGCTKRS LAX7FC (SEQ ID NO: 4), wherein X5 is arginine or absent, Xe is leucine or aspartate, and wherein X7 is arginine, glutamine or glutamate.
  • the first peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 5-7.
  • the second peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 5-7.
  • the first peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-13.
  • the second peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-13.
  • the first peptide comprises the amino acid sequence of SEQ ID NO: 5 and the second peptide comprises the amino acid sequence of SEQ ID NO: 8; the first peptide comprises the amino acid sequence of SEQ ID NO: 5 and the second peptide comprises the amino acid sequence of SEQ ID NO: 9; the first peptide comprises the amino acid sequence of SEQ ID NO: 5 and the second peptide comprises the amino acid sequence of SEQ ID NO: 10; the first peptide comprises the amino acid sequence of SEQ ID NO: 5 and the second peptide comprises the amino acid sequence of SEQ ID NO: 11; the first peptide comprises the amino acid sequence of SEQ ID NO: 5 and the second peptide comprises the amino acid sequence of SEQ ID NO: 12; the first peptide comprises the amino acid sequence of SEQ ID NO: 5 and the second peptide comprises the amino acid sequence of SEQ ID NO: 13; the first peptide comprises the amino acid sequence of SEQ ID NO: 6 and the second peptide comprises the amino acid sequence of SEQ ID NO: 9; the first
  • the second peptide comprises the amino acid sequence of SEQ ID NO: 5 and the first peptide comprises the amino acid sequence of SEQ ID NO: 8; the second peptide comprises the amino acid sequence of SEQ ID NO: 5 and the first peptide comprises the amino acid sequence of SEQ ID NO: 9; the second peptide comprises the amino acid sequence of SEQ ID NO: 5 and the first peptide comprises the amino acid sequence of SEQ ID NO: 10; the second peptide comprises the amino acid sequence of SEQ ID NO: 5 and the first peptide comprises the amino acid sequence of SEQ ID NO: 11; the second peptide comprises the amino acid sequence of SEQ ID NO: 5 and the first peptide comprises the amino acid sequence of SEQ ID NO: 12; the second peptide comprises the amino acid sequence of SEQ ID NO: 5 and the first peptide comprises the amino acid sequence of SEQ ID NO: 13; the second peptide comprises the amino acid sequence of SEQ ID NO: 6 and the first peptide comprises the amino acid sequence of SEQ ID NO: 9; the second
  • the fusion protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 25-48.
  • the first peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 5-7.
  • the second peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 5-7.
  • the first peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-13.
  • the second peptide consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-13.
  • the first peptide consists of the amino acid sequence of SEQ ID NO: 5 and the second peptide consists of the amino acid sequence of SEQ ID NO: 8; the first peptide consists of the amino acid sequence of SEQ ID NO: 5 and the second peptide consists of the amino acid sequence of SEQ ID NO: 9; the first peptide consists of the amino acid sequence of SEQ ID NO: 5 and the second peptide consists of the amino acid sequence of SEQ ID NO: 10; the first peptide consists of the amino acid sequence of SEQ ID NO: 5 and the second peptide consists of the amino acid sequence of SEQ ID NO: 11 ; the first peptide consists of the amino acid sequence of SEQ ID NO: 5 and the second peptide consists of the amino acid sequence of SEQ ID NO: 12; the first peptide consists of the amino acid sequence of SEQ ID NO: 5 and the second peptide consists of the amino acid sequence of SEQ ID NO: 13; the first peptide
  • the second peptide consists of the amino acid sequence of SEQ ID NO: 5 and the first peptide consists of the amino acid sequence of SEQ ID NO: 8; the second peptide consists of the amino acid sequence of SEQ ID NO: 5 and the first peptide consists of the amino acid sequence of SEQ ID NO: 9; the second peptide consists of the amino acid sequence of SEQ ID NO: 5 and the first peptide consists of the amino acid sequence of SEQ ID NO: 10; the second peptide consists of the amino acid sequence of SEQ ID NO: 5 and the first peptide consists of the amino acid sequence of SEQ ID NO: 11 ; the second peptide consists of the amino acid sequence of SEQ ID NO: 5 and the first peptide consists of the amino acid sequence of SEQ ID NO: 12; the second peptide consists of the amino acid sequence of SEQ ID NO: 5 and the first peptide consists of the amino acid sequence of SEQ ID NO: 13; the second peptide
  • the fusion protein further comprises an IgG Fc.
  • the IgG Fc comprises the amino acid alanine at EU positions 234 and 235.
  • the IgG Fc comprises the amino acid alanine at EU position 329.
  • the IgG Fc comprises the amino acid alanine at EU positions 234, 235 and 329.
  • the IgG Fc comprises the amino acids alanine, alanine, alanine, leucine, and serine at EU positions 234, 235, 329, 428 and 434, respectively.
  • the IgG Fc comprises the amino acids lysine, phenylalanine, and tyrosine at EU positions 433, 434 and 436, respectively. In some embodiments, the IgG Fc comprises the amino acids tyrosine, threonine and glutamate at EU positions 252, 254 and 256, respectively. In some embodiments, the IgG Fc comprises the amino acids leucine and serine at EU positions 428 and 434, respectively.
  • the IgG Fc comprises an amino acid sequence at least 85% identical to the amino acid sequence of a human IgGl Fc. In some embodiments, the IgG Fc comprises the amino acid sequence of a human IgGl Fc. In some embodiments, the IgG Fc comprises an amino acid sequence at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 50-52 and 201-203. In some embodiments, the IgG Fc comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 50- 52 and 201-203.
  • the IgG Fc is linked to the N-terminus of the first peptide. In some embodiments, the IgG Fc is linked to the C-terminus of the second peptide.
  • the fusion protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 53-85 and 204-211. In some embodiments, the fusion protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 86-118 and 214-221. [0024] In some embodiments, the fusion protein consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 53-85 and 204-211. In some embodiments, the fusion protein consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 86-118 and 214-221.
  • the first and second peptides do not comprise the amino acid sequence of a peptide selected from the group consisting of
  • DSWKEEVIKLCGRELVRAQIAICGKSTWS SEQ ID NO : 188 ;
  • fusion protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 53-118 and 204-225.
  • the fusion protein consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 53-118 and 204-225.
  • polynucleotide comprising a nucleotide sequence encoding any of the fusion proteins provided above and herein.
  • the polynucleotide is an RNA molecule.
  • the polynucleotide is a DNA molecule.
  • an expression vector comprising any polynucleotides described above and herein.
  • the expression vector is a plasmid.
  • the expression vector is a viral vector.
  • a host cell comprising any polynucleotides or expression vectors described above and herein.
  • the host cell is a prokaryotic cell.
  • the host cell is a eukaryotic cell.
  • the prokaryotic cell an E. coli cell or a Bacillus cell.
  • the eukaryotic cell is selected from the group consisting of a yeast cell, an insect cell, and a mammalian cell.
  • the mammalian cell is selected from the group consisting of a CHO cell, a HeLa cell, and a 293 cell.
  • Also provided herein is a population of cells comprising two or more of any of the host cells described above and herein.
  • Also provided herein is a method of producing any of the fusion proteins described above and herein comprising culturing any of the host cells described above and herein under conditions such that the fusion protein is produced.
  • a pharmaceutical composition comprising an effective amount of any of the fusion proteins described above and herein, or any polynucleotides described above and herein, or any expression vectors described above and herein.
  • Also provided herein is a method of enhancing a relaxin-2-related activity in a primary cell, comprising contacting the primary cell with any of the fusion proteins described above and herein, thereby enhancing relaxin-2-related activity in the cell.
  • the fusion protein activates the relaxin-2 receptor, RXFP1, on a cell surface.
  • the method elevates cAMP levels in the primary cell, inducing vasodilation, inducing the expression of angiogenic factors, inducing the expression of MMPs, and inducing collagen degradation.
  • the primary cell is selected from the group consisting of endothelial cells, vascular smooth muscle cells, other vascular cells, cardiomyocytes, other cardiac cells, and fibroblasts. In some embodiments, the primary cell is within a subject. In some embodiments, the subject has a relaxin-2-associated disorder. In some embodiments, the relaxin-2-associated disorder is selected from the group consisting of kidney diseases, fibrotic diseases, and cardiovascular diseases.
  • the disorder is selected from the group consisting of focal segmental glomerular sclerosis (FSGS), diabetic nephropathy, hepatorenal syndrome, scleroderma, idiopathic pulmonary fibrosis, renal fibrosis, cardiac fibrosis, NASH, dilated cardiomyopathy, diastolic heart failure, pulmonary arterial hypertension, chronic heart failure, acute heart failure, congestive heart failure, coronary artery disease, hypertension, and pre-eclampsia.
  • FGS focal segmental glomerular sclerosis
  • Also provided herein is a method of treating a relaxin-associated disorder in a subject in need thereof, comprising administering to the subject an effective amount of any of the fusion proteins described above and herein, any polynucleotides described above and herein, any expression vectors described above and herein, or any pharmaceutical composition described above and herein, thereby treating the relaxin-associated disorder.
  • the relaxin-2-associated disorder is selected from the group consisting of kidney diseases, fibrotic diseases, and cardiovascular diseases.
  • the disorder is selected from the group consisting of focal segmental glomerular sclerosis (FSGS), diabetic nephropathy, hepatorenal syndrome, scleroderma, idiopathic pulmonary fibrosis, renal fibrosis, cardiac fibrosis, NASH, dilated cardiomyopathy, diastolic heart failure, pulmonary arterial hypertension, chronic heart failure, acute heart failure, congestive heart failure, coronary artery disease, hypertension, and pre-eclampsia.
  • the method decreases arterial pressure, increases renal artery blood flow, increases cardiac filling at diastole, resolves established fibrosis, or suppresses new fibrosis development.
  • kits comprising an effective amount any of the fusion proteins described above and herein, any polynucleotides described above and herein, any expression vectors described above and herein, or any pharmaceutical composition described above and herein, and an instruction of use.
  • the disclosure provides fusion proteins comprising a human relaxin-2 B chain, or a derivative thereof, and a human relaxin-2 A chain, or a derivative thereof, joined by a peptide linker, wherein the fusion proteins have high in vivo circulating half-life when administered to mammals.
  • the in vivo circulating half-life of the fusion proteins provided in this disclosure is greater than 2 hours.
  • the fusion proteins provided in this disclosure have low pl.
  • the pl of the fusion proteins provided in this disclosure is less than 8.5.
  • the low pl of the fusion proteins provided in this disclosure is caused by acidic amino acid residues present in the peptide linker.
  • the peptide linker of the fusion protein comprises 2 or more acidic amino acids.
  • the peptide linker is 10-15 total amino acids in length.
  • polynucleotide refers to a polymer of DNA or RNA.
  • the polynucleotide sequence can be single-stranded or double-stranded; contain natural, nonnatural, or altered nucleotides; and contain a natural, non-natural, or altered intemucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified polynucleotide sequence.
  • Polynucleotide sequences include, but are not limited to, all polynucleotide sequences which are obtained by any means available in the art, including, without limitation, recombinant means, e.g., the cloning of polynucleotide sequences from a recombinant library or a cell genome, using ordinary cloning technology and polymerase chain reaction, and the like, and by synthetic means.
  • recombinant means e.g., the cloning of polynucleotide sequences from a recombinant library or a cell genome, using ordinary cloning technology and polymerase chain reaction, and the like, and by synthetic means.
  • amino acid sequence refers to the information describing the relative order and identity of amino acid residues which make up a polypeptide.
  • an amino acid sequence that differs at 1 or more amino acids refers to an amino acid sequence that comprises at least one substitution, alteration, inversion, addition, or deletion of an amino acid residue compared to a reference amino acid sequence.
  • the determination of “percent identity” between two sequences can be accomplished using a mathematical algorithm.
  • a specific, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin S & Altschul S F, (1990) PNAS 87: 2264-2268, modified as in Karlin S & Altschul SF, (1993) PNAS 90: 5873-5877, each of which is herein incorporated by reference in its entirety.
  • Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul SF et al., (1990) J Mol Biol 215: 403, which is herein incorporated by reference in its entirety.
  • Gapped BLAST can be utilized as described in Altschul S F et al., (1997) Nuc Acids Res 25: 3389-3402, which is herein incorporated by reference in its entirety.
  • PSI BLAST can be used to perform an iterated search which detects distant relationships between molecules. Id.
  • the default parameters of the respective programs e.g., of XBLAST and NBLAST
  • NCBI National Center for Biotechnology Information
  • Another specific, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) CABIOS 4:11-17, which is herein incorporated by reference in its entirety.
  • the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.
  • the term “linked to” refers to covalent or noncovalent binding between two molecules or moieties.
  • linkage need not be direct, but instead, can be via an intervening molecule or moiety.
  • human relaxin-2 B chain or “relaxin B chain” or “relaxin B” or “rel B” refer to a peptide comprising or consisting of the amino acid sequence as set forth in DSWMEEVIKLCGRELVRAQIAICGMSTWS (SEQ ID NO: 1) or derivatives thereof.
  • a derivative of a relaxin B chain comprises the amino acid sequence of SEQ ID NO: 1 with 1, 2, 3, 4, or 5 amino acid changes.
  • human relaxin-2 A chain or “relaxin A chain” or “relaxin A” or “rel A” refer to a peptide comprising or consisting of the amino acid sequence as set forth in QLYSALANKCCHVGCTKRSLARFC (SEQ ID NO: 2) or derivatives thereof.
  • a derivative of a relaxin A chain comprises the amino acid sequence of SEQ ID NO: 2 with 1, 2, 3, 4, or 5 amino acid changes.
  • linker peptide refers to a peptide that links the relaxin A chain and the relaxin B chain in the fusion proteins described herein.
  • the term “acidic amino acid” refers to an amino acid that has a carboxylic acid in its side chain.
  • the acidic amino acid is aspartate, glutamate, 2-aminoadipic acid, 2-aminobutyric acid or 2-aminopimelic acid.
  • acid amino acids include aspartate and glutamate.
  • non-acidic amino acid refers to amino acids that are not acidic amino acids.
  • non-acidic amino acids include glycine, proline, and serine.
  • non-specific amino acids also include arginine, histidine, lysine, threonine, asparagine, glutamine, cysteine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan.
  • IgG Fc refers to the immunoglobulin G (IgG) fragment crystallizable (Fc) region.
  • the IgG Fc is the human IgGl, IgG2, IgG3, or IgG4 Fc region.
  • the IgG Fc is the IgGl Fc region.
  • EU numbering system refers to the EU numbering convention for the constant regions of an antibody, as described in Edelman, G. M. et al., Proc. Natl. Acad. USA, 63, 78-85 (1969) and Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Dept. Health and Human Services, 5th edition, 1991, each of which is herein incorporated by reference in its entirety.
  • RXFP1 comprises the amino acid sequence shown in NCBI Reference Sequence: NP_067647.2, NP_001240656.1, NP_001240657.1, NP_001240658.1,
  • the terms “treat,” “treating,” and “treatment” refer to therapeutic or preventative measures described herein.
  • the methods of “treatment” employ administration of a fusion protein to a subject having a disease or disorder, or predisposed to having such a disease or disorder, in order to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of the disease or disorder or recurring disease or disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
  • the term “effective amount” in the context of the administration of a therapy to a subject refers to the amount of a therapy that achieves a desired prophylactic or therapeutic effect.
  • the term “subject” includes any human or non-human animal. In one embodiment, the subject is a human or non-human mammal. In one embodiment, the subject is a human.
  • the term “pl” means the isoelectric point, i.e., the pH of a solution at which the next charge on a fusion protein is zero.
  • the pl is the calculated or theoretical pl.
  • the pl is measured experimentally by an instrument.
  • the disclosure provides fusion proteins comprising a human relaxin-2 B chain, or a derivative thereof, and a human relaxin-2 A chain, or a derivative thereof, linked by a peptide linker, wherein the fusion proteins have high in vivo circulating half-life when administered to mammals.
  • the fusion protein comprises, from N-terminus to C- terminus, a human relaxin-2 B chain, or a derivative thereof, a peptide linker and a human relaxin-2 A chain, or a derivative thereof.
  • the fusion protein comprises, from N-terminus to C-terminus, a human relaxin-2 A chain, or a derivative thereof, a peptide linker and a human relaxin-2 B chain, or a derivative thereof.
  • the fusion protein further comprises an IgG Fc.
  • the IgG Fc is linked to the N-terminus or C-terminus of the human relaxin B chain-linker protein-human relaxin A chain fusion protein or the human relaxin A chain-linker protein-human relaxin B chain fusion protein.
  • the IgG Fc described above is replaced with PEG.
  • the disclosure provides human relaxin-2 B chain derivatives, wherein the derivatives have 1, 2, 3, 4, or 5 amino acid changes when compared to the amino acid sequence of SEQ ID NO: 1.
  • the amino acid that corresponds with position 13 of SEQ ID NO: 1 must be arginine.
  • the amino acid that corresponds with position 17 of SEQ ID NO: 1 must be arginine.
  • the amino acid that corresponds with position 20 of SEQ ID NO: 1 must be isoleucine.
  • the amino acid that corresponds with position 13 of SEQ ID NO: 1 must be arginine; the amino acid that corresponds with position 17 of SEQ ID NO: 1 must be arginine; and the amino acid that corresponds with position 20 of SEQ ID NO: 1 must be isoleucine.
  • the human relaxin-2 B chain derivatives comprise or consist of the following formula: DSWX3EEVIKLCGRELVRAQIAICGX4ST ( SEQ I D NO : 3 ) , wherein X3 and X4 are absent or any amino acid.
  • X3 is methionine, lysine or glutamine
  • X4 is methionine or lysine.
  • X4 is lysine.
  • the human relaxin-2 B chain derivatives used in the fusion proteins described herein do not include the amino acid sequences of SEQ ID NOs: 187-190.
  • the human relaxin-2 B chain derivatives are from 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 amino acids in length. In some embodiments, the human relaxin- 2 B chain derivatives are 25, 26, 27, 28, or 29 amino acids in length. In some embodiments, the human relaxin-2 B chain derivatives are 27 amino acids in length.
  • the human relaxin-2 B chain derivatives comprise or consist of the amino acid sequences shown in Table 1, below. Table 1. Human Relaxin-2 B Chain Derivative Sequences
  • the disclosure provides human relaxin-2 A chain derivatives, wherein the derivatives have 1, 2, 3, 4, or 5 amino acid changes when compared to the amino acid sequence of SEQ ID NO: 2.
  • the amino acid that corresponds with position 3 of SEQ ID NO: 2 must be lysine.
  • the amino acid that corresponds with position 23 of SEQ ID NO: 2 must be phenylalanine.
  • the amino acid that corresponds with position 3 of SEQ ID NO: 2 must be lysine; and the amino acid that corresponds with position 23 of SEQ ID NO: 2 must be phenylalanine.
  • the human relaxin-2 A chain derivatives comprise or consist of the following formula: X5QX6YSALANKCCHVGCTKRSLAX7FC ( SEQ ID NO : 4 ) , wherein X5, Xe, and X7 are absent or any amino acid.
  • X5 is arginine or absent
  • Xe is leucine or aspartate
  • X7 is arginine, glutamine, or glutamate.
  • the human relaxin-2 A chain derivatives are from 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length. In some embodiments, the human relaxin-2 A chain derivatives are 22, 23, 24, 25, or 26 amino acids in length. In some embodiments, the human relaxin-2 A chain derivatives are 24 amino acids in length. In some embodiments, the human relaxin-2 A chain derivatives are 25 amino acids in length.
  • the human relaxin-2 A chain derivatives comprise or consist of the amino acid sequences shown in Table 2, below.
  • the disclosure provides linker peptides, wherein the peptides have at least two acidic amino acids.
  • the acidic amino acid is glutamate.
  • the acidic amino acid is aspartate.
  • the acidic amino acid is a nonstandard amino acid.
  • the acidic amino acid is 2-aminoadipic acid, 2- aminobutyric acid or 2-aminopimelic acid.
  • the linker peptide has 2, 3, 4, 5, 6, 7, 8, 9, or 10 acidic amino acids.
  • the linker peptide is 8, 9, 10, 11, 12, 13, 14, or 15 amino acids in length. In some embodiments, the linker peptide is 12, 13, 14, or 15 amino acids in length. In some embodiments, the linker peptide has 2, 3, 4, or 5 acidic amino acids. In some embodiments, the linker peptide is 12, 13, 14, or 15 amino acids in length and has 2, 3, 4, or 5 acidic amino acids. In some embodiments, the remaining amino acids are non-acidic amino acids. In some embodiments, the non-acidic amino acids can be any standard amino acid that is not aspartate or glutamate. In some embodiments, non-acidic amino acids can be any amino acid that does not have a carboxylic acid in its side chain.
  • the non- acidic amino acid is glycine, proline, serine, arginine, histidine, lysine, threonine, asparagine, glutamine, cysteine, alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, or tryptophan.
  • the non-acidic amino acid is glycine, proline, or cysteine. In some embodiments, the non-acidic amino acid is glycine.
  • the linker peptide comprises acidic amino acids, wherein all the acidic amino acids are the same amino acids. In some embodiments, the acidic amino acids in the linker peptide are both/all glutamates. In some embodiments, the acidic amino acids in the linker peptide are both/all aspartates. In some embodiments, the linker peptide comprises amino acids that are a mixture of acidic amino acids. In some embodiments, the linker peptide comprises both glutamate and aspartate as acidic amino acids.
  • the linker peptide comprises an amino acid sequence selected from the group consisting of
  • R1R1R1R2R1R1R1R1R2R1R1R1R2R1R1R2R1 SEQ ID NO : 195 ) ;
  • R1R1R1R2R2R1R1R1R2R2R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1R1 SEQ ID NO : 198
  • R1R1R2R1R2R1R1R2R1R1R1R1R1R1R1R1R1 SEQ ID NO : 199
  • Ri is a non-acidic amino acid
  • R2 is an acidic amino acid.
  • the linker peptide comprises non-acidic amino acids, wherein all the non-acidic amino acids are the same amino acids. In some embodiments, the non-acidic amino acids in the linker peptide are all glycine. In some embodiments, the linker peptide comprises amino acids that are a mixture of non-acidic amino acids. In some embodiments, the linker peptide comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 different types of non-acidic amino acids.
  • the linker peptide comprises or consists of the amino acid sequences shown in Table 3, below.
  • the linker peptide comprises 2, 3, 4, or 5 repeats of SEQ ID NO: 14, 15, 16, 17, or 18.
  • 3 repeats of SEQ ID NO: 14 would be the amino acid sequence of GGGEGGGEGGGE ( SEQ I D NO : 24 ) .
  • the fusion protein comprises an N-terminal or first peptide, a linker peptide, and a C-terminal or second peptide.
  • the N-terminal peptide comprises a human relaxin-2 A chain or a derivative thereof and the C-terminal peptide comprises a human relaxin-2 B chain or a derivative thereof.
  • the N- terminal peptide comprises a human relaxin-2 B chain or a derivative thereof and the C- terminal peptide comprises a human relaxin-2 A chain or a derivative thereof.
  • any combination of any of the embodiments of the human relaxin-2 A chain or a derivative thereof, with a human relaxin-2 A chain or a derivative thereof linked by any of the linker peptides disclosed herein can be used to construct embodiments of the fusion proteins described herein.
  • At least one of the N-terminal peptide and the C-terminal peptide is a derivative of a human relaxin-2 A chain or a human relaxin-2 B chain.
  • the N-terminal peptide comprises a human relaxin-2 A chain derivative and the C-terminal peptide comprises a human relaxin-2 B chain derivative.
  • the N-terminal peptide comprises a human relaxin-2 B chain derivative and the C-terminal peptide comprises a human relaxin-2 A chain derivative.
  • the portion of the fusion protein comprising the N-terminal peptide, the linker peptide, and the C-terminal peptide comprises or consists of the amino acid sequences shown in Table 5, below. Table 5.
  • the fusion proteins provided herein further comprise an IgG Fc.
  • the IgG Fc can be linked to the N-terminal end of the N-terminal peptide or the C-terminal end of the C-terminal peptide.
  • the IgG Fc can be linked directly to the N-terminal peptide or the C-terminal peptide or they can be linked to the N-terminal peptide or the C-terminal peptide through an IgG Fc linker.
  • the IgG Fc linker comprises or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.
  • the IgG Fc linker comprises or consists of 1, 2, 3, 4, or 5 amino acids.
  • the IgG Fc linker comprises or consists of 3 or 4 amino acids. In some embodiments, the IgG Fc linker comprises or consists of the amino acid sequence of GGS (SEQ ID NO: 193). It is known in the art that the C- terminal lysine (K) in many monoclonal antibodies is flexible, and is often clipped off during expression and purification with no known impairment in activity. In some embodiments, the IgG Fc comprises the amino acid sequence of one of SEQ ID NOs: 49-52 with SEQ ID NO: 193 as the IgG Fc linker at the C-terminal end of the IgG Fc. In some embodiments, the IgG Fc comprises the amino acid sequence of one of SEQ ID NOs: 200-203 with SEQ ID NO: 193 as the IgG Fc linker at the C-terminal end of the IgG Fc.
  • one, two, or more mutations are introduced into the Fc region of an antibody described herein (e.g, CH2 domain (residues 231- 340 of human IgGl) and/or CH3 domain (residues 341-447 of human IgGl)) and/or the hinge region, numbered according to the EU numbering system, to alter one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and/or antigen-dependent cellular cytotoxicity.
  • an antibody described herein e.g, CH2 domain (residues 231- 340 of human IgGl) and/or CH3 domain (residues 341-447 of human IgGl)
  • the hinge region numbered according to the EU numbering system
  • one, two, or more mutations are introduced into the hinge region of the Fc region (CHI domain) such that the number of cysteine residues in the hinge region are altered (e.g, increased or decreased) as described in, e.g., U.S. Pat. No. 5,677,425, herein incorporated by reference in its entirety.
  • the number of cysteine residues in the hinge region of the CHI domain may be altered to, e.g, facilitate assembly of the light and heavy chains, or to alter (e.g, increase or decrease) the stability of the antibody.
  • one, two, or more amino acid mutations are introduced into an IgG constant domain, or FcRn-binding fragment thereof (preferably an Fc or hinge-Fc domain fragment) to alter (e.g., decrease or increase) half-life of the antibody in vivo.
  • an IgG constant domain, or FcRn-binding fragment thereof preferably an Fc or hinge-Fc domain fragment
  • one, two, or more amino acid mutations are introduced into an IgG constant domain, or FcRn-binding fragment thereof (preferably an Fc or hinge-Fc domain fragment) to decrease the half-life of the antibody in vivo.
  • one, two, or more amino acid mutations are introduced into an IgG constant domain, or FcRn-binding fragment thereof (preferably an Fc or hinge-Fc domain fragment) to increase the half-life of the antibody in vivo.
  • the antibodies may have one or more amino acid mutations (e.g, substitutions) in the second constant (CH2) domain (residues 231-340 of human IgGl) and/or the third constant (CH3) domain (residues 341-447 of human IgGl), numbered according to the EU numbering system.
  • the constant region of the IgGl of an antibody described herein comprises a methionine (M) to tyrosine (Y) substitution in position 252, a serine (S) to threonine (T) substitution in position 254, and a threonine (T) to glutamic acid (E) substitution in position 256, numbered according to the EU numbering system.
  • M methionine
  • Y tyrosine
  • S serine
  • T threonine
  • E glutamic acid
  • an antibody comprises an IgG constant domain comprising one, two, three or more amino acid substitutions of amino acid residues at positions 251-257, 285-290, 308-314, 385-389, and 428-436, numbered according to the EU numbering system.
  • one, two, or more mutations are introduced into the Fc region of an antibody described herein (e.g, CH2 domain (residues 231-340 of human IgGl) and/or CH3 domain (residues 341-447 of human IgGl)) and/or the hinge region, numbered according to the EU numbering system, to increase or decrease the affinity of the antibody for an Fc receptor (e.g., an activated Fc receptor) on the surface of an effector cell.
  • an Fc receptor e.g., an activated Fc receptor
  • Mutations in the Fc region of an antibody that decrease or increase the affinity of an antibody for an Fc receptor and techniques for introducing such mutations into the Fc receptor or fragment thereof are known to one of skill in the art. Examples of mutations in the Fc receptor of an antibody that can be made to alter the affinity of the antibody for an Fc receptor are described in, e.g, Smith P et al., (2012) PNAS 109: 6181-6186, U.S. Pat. No. 6,737,056, and International Publication Nos. WO 02/060919; WO 98/23289; and WO 97/34631, all of which are herein incorporated by reference in their entireties.
  • the antibody comprises a heavy chain constant region that is a variant of a wild-type heavy chain constant region, wherein the variant heavy chain constant region binds to FcyRIIB with higher affinity than the wild-type heavy chain constant region binds to FcyRIIB.
  • the variant heavy chain constant region is a variant human heavy chain constant region, e.g, a variant human IgGl, a variant human IgG2, or a variant human IgG4 heavy chain constant region.
  • the variant human IgG heavy chain constant region comprises one or more of the following amino acid mutations, according to the EU numbering system: G236D, P238D, S239D, S267E, L328F, and L328E.
  • the variant human IgG heavy chain constant region comprises a set of amino acid mutations selected from the group consisting of: S267E and L328F; P238D and L328E; P238D and one or more substitutions selected from the group consisting of E233D, G237D, H268D, P271G, and A330R; P238D, E233D, G237D, H268D, P271G, and A330R; G236D and S267E; S239D and S267E; V262E, S267E, and L328F; and V264E, S267E, and L328F, according to the EU numbering system.
  • the FcyRIIB is expressed on a cell selected from the group consisting of macrophages, monocytes, B cells, dendritic cells, endothelial cells, and activated T cells.
  • one, two, or more amino acid substitutions are introduced into an IgG constant domain Fc region to alter the effector function(s) of the antibody.
  • one or more amino acids selected from amino acid residues 234, 235, 236, 237, 239, 243, 267, 292, 297, 300, 318, 320, 322, 328, 330, 332, and 396, numbered according to the EU numbering system can be replaced with a different amino acid residue such that the antibody has an altered affinity for an effector ligand but retains the antigen-binding ability of the parent antibody.
  • the effector ligand to which affinity is altered can be, for example, an Fc receptor or the Cl component of complement.
  • the deletion or inactivation (through point mutations or other means) of a constant region domain may reduce Fc receptor binding of the circulating antibody thereby increasing tumor localization. See, e.g., U.S. Pat. Nos. 5,585,097 and 8,591,886, each of which is herein incorporated by reference in its entirety, for a description of mutations that delete or inactivate the constant domain and thereby increase tumor localization.
  • one or more amino acid substitutions may be introduced into the Fc region of an antibody described herein to remove potential glycosylation sites on the Fc region, which may reduce Fc receptor binding (see, e.g., Shields R L et al., (2001) J Biol Chem 276: 6591-604, which is herein incorporated by reference in its entirety).
  • one or more of the following mutations in the constant region of an antibody described herein may be made: an N297A substitution; an N297Q substitution; an L234A substitution; an L234F substitution; an L235A substitution; an L235F substitution; an L235V substitution; an L237A substitution; an S239D substitution; an E233P substitution; an L234V substitution; an L235A substitution; a C236 deletion; aP238A substitution; an S239D substitution; an F243L substitution; aD265A substitution; an S267E substitution; an L328F substitution; an R292P substitution; a Y300L substitution; an A327Q substitution; a P329A substitution (PA); an A332L substitution; an I332E substitution; or a P396L substitution, numbered according to the EU numbering system.
  • PA P329A substitution
  • a mutation selected from the group consisting of D265A, P329A, and a combination thereof, numbered according to the EU numbering system may be made in the constant region of an antibody described herein.
  • a mutation selected from the group consisting of L235A, L237A, and a combination thereof, numbered according to the EU numbering system may be made in the constant region of an antibody described herein.
  • a mutation selected from the group consisting of S267E, L328F, and a combination thereof, numbered according to the EU numbering system may be made in the constant region of an antibody described herein.
  • a mutation selected from the group consisting of S239D, I332E, optionally A330L, and a combination thereof, numbered according to the EU numbering system may be made in the constant region of an antibody described herein.
  • a mutation selected from the group consisting ofL235V, F243L, R292P, Y300L, P396L, and a combination thereof, numbered according to the EU numbering system may be made in the constant region of an antibody described herein.
  • a mutation selected from the group consisting of S267E, L328F, and a combination thereof, numbered according to the EU numbering system may be made in the constant region of an antibody described herein.
  • an antibody described herein comprises the constant domain of an IgGl with an N297Q or N297A amino acid substitution, numbered according to the EU numbering system.
  • an antibody described herein comprises the constant domain of an IgGl with a mutation selected from the group consisting of D265A, P329A, and a combination thereof, numbered according to the EU numbering system.
  • an antibody described herein comprises the constant domain of an IgGl with a mutation selected from the group consisting of L234A, L235A (LALA), and a combination thereof, numbered according to the EU numbering system.
  • an antibody described herein comprises the constant domain of an IgGl with a mutation selected from the group consisting of L234F, L235F, N297A, and a combination thereof, numbered according to the EU numbering system.
  • amino acid residues in the constant region of an antibody described herein in the positions corresponding to positions L234, L235, and D265 in a human IgGl heavy chain, numbered according to the EU numbering system are not L, L, and D, respectively.
  • the amino acids corresponding to positions L234, L235, and D265 in a human IgGl heavy chain are F, E, and A; or A, A, and A, respectively, numbered according to the EU numbering system.
  • one or more amino acids selected from amino acid residues 329, 331, and 322 in the constant region of an antibody described herein, numbered according to the EU numbering system can be replaced with a different amino acid residue such that the antibody has altered Clq binding and/or reduced or abolished complement dependent cytotoxicity (CDC).
  • CDC complement dependent cytotoxicity
  • This approach is described in further detail in U.S. Pat. No. 6,194,551 (Idusogie et al.), which is herein incorporated by reference in its entirety.
  • one or more amino acid residues within amino acid positions 231 to 238 in the N-terminal region of the CH2 domain of an antibody described herein are altered to thereby alter the ability of the antibody to fix complement, numbered according to the EU numbering system.
  • the Fc region of an antibody described herein is modified to increase the ability of the antibody to mediate antibody dependent cellular cytotoxicity (ADCC) and/or to increase the affinity of the antibody for an Fey receptor by mutating one or more amino acids (e.g, introducing amino acid substitutions) at the following positions: 238, 239, 248, 249, 252, 254, 255, 256, 258, 265, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 301,
  • ADCC antibody dependent cellular cytotoxicity
  • the IgG Fc is an IgGl Fc, or a derivative thereof.
  • the IgGFc or IgGl Fc comprises an amino acid sequence at least 85, 90, 95, 96, 97, 98, or 99% identical to the amino acid sequence of IgGl Fc.
  • the IgG Fc or IgGl Fc comprises an amino acid sequence at least 85, 90, 95, 96, 97, 98, 99, or 100% identical to an amino acid sequence provided below in Table 6.
  • any IgG Fc, or derivative thereof can be linked to the N- terminus or C-terminus of any of the embodiments described in Table 4 or 5 above with or without an IgG Fc linker.
  • human IgGl Fc, or a derivative thereof can be linked to the N-terminus or C-terminus of any of the embodiments described in Table 4 or 5 above with or without an IgG Fc linker.
  • the amino acid sequence of the human IgGl Fc comprises or consists of the amino acid sequence of SEQ ID NO: 49 or 200.
  • the derivative if human IgGl Fc comprises an amino acid sequence at least 85, 90, 95, 96, 97, 98, or 99% identical to the amino acid sequence of SEQ ID NO: 49 or 200.
  • a human IgGl Fc comprising a LAL A mutation, or a derivative thereof can be linked to the N-terminus or C-terminus of any of the embodiments described in Table 4 or 5 above with or without an IgG Fc linker.
  • the amino acid sequence of the human IgGl Fc comprising a LALA mutation comprises or consists of the amino acid sequence of SEQ ID NO: 50 or 201.
  • the derivative if human IgGl Fc comprising a LALA mutation comprises an amino acid sequence at least 85, 90, 95, 96, 97, 98, or 99% identical to the amino acid sequence of SEQ ID NO: 50 or 201.
  • a human IgGl Fc comprising a LALA PA mutation, or a derivative thereof can be linked to the N-terminus or C-terminus of any of the embodiments described in Table 4 or 5 above with or without an IgG Fc linker.
  • the amino acid sequence of the human IgGl Fc comprising a LALA PA mutation comprises or consists of the amino acid sequence of SEQ ID NO: 51 or 202.
  • the derivative if human IgGl Fc comprising a LALA PA mutation comprises an amino acid sequence at least 85, 90, 95, 96, 97, 98, or 99% identical to the amino acid sequence of SEQ ID NO: 51 or 202.
  • a human IgGl Fc comprising a LALA PA LS mutation can be linked to the N-terminus or C-terminus of any of the embodiments described in Table 4 or 5 above with or without an IgG Fc linker.
  • the amino acid sequence of the human IgGl Fc comprising a LALA PA LS mutation comprises or consists of the amino acid sequence of SEQ ID NO: 52 or 203.
  • the derivative if human IgGl Fc comprising a LALA PA LS mutation comprises an amino acid sequence at least 85, 90, 95, 96, 97, 98, or 99% identical to the amino acid sequence of SEQ ID NO: 52 or 203.
  • the fusion protein comprises or consists of the amino acid sequences shown in Table 7, below.
  • the IgG Fc comprises a mouse IgG kappa signal sequence comprising the amino acid sequence of METDTLLLWVLLLWVPGSTG (SEQ ID NO: 194). In some embodiments a different signal sequence is used. In some embodiments, some shown in Table 7, no signal sequence is present on the fusion protein as produced.
  • half-life extending moiety includes non-proteinaceous, half- life extending moieties, such as PEG or HES, and proteinaceous half-life extending moieties such as Fc domain.
  • non-proteinaceous half-life extending moieties are linked to the fusion proteins described herein.
  • the non-proteinaceous half-life extending moieties are linked to the fusion proteins instead of IgG Fc.
  • the non-proteinaceous half-life extending moieties are linked to the fusion proteins in addition to IgG Fc.
  • polymer molecules that act as non-proteinaceous half-life extending moieties include polymer molecules selected from the group consisting of polyalkylene oxide (PAO), including polyalkylene glycol (PAG), such as polyethylene glycol (PEG) and polypropylene glycol (PPG), branched PEGs, hydroxyalkyl starch (HAS), such as hydroxy ethyl starch (HES), polysialic acid (PSA), poly-vinyl alcohol (PVA), poly-carboxylate, poly-(vinylpyrrolidone), polyethylene-co-maleic acid anhydride, polystyrene-co-maleic acid anhydride, dextran, including carboxymethyl-dextran, or any other biopolymer suitable for reducing immunogenicity and/or increasing functional in vivo half-life and/or serum half-life.
  • PAO polyalkylene oxide
  • PAG polyalkylene glycol
  • PEG polyethylene glycol
  • PPG polypropylene glyco
  • polymer molecule is human albumin or another abundant plasma protein.
  • polyalkylene glycol-derived polymers are biocompatible, non-toxic, non-antigenic, non-immunogenic, have various water solubility properties, and are easily excreted from living organisms.
  • PEG has the advantage of having only few reactive groups capable of cross-linking compared to, e.g., polysaccharides such as dextran.
  • monofunctional PEG e.g., methoxypolyethylene glycol (mPEG)
  • mPEG methoxypolyethylene glycol
  • the hydroxyl end groups of the polymer molecule must be provided in activated form, i.e., with reactive functional groups (examples of which include primary amino groups, hydrazide (HZ), thiol, succinate (SUC), succinimidyl succinate (SS), succinimidyl succinamide (SSA), succinimidyl propionate (SPA), succinimidyl butyrate (SBA), succinimidyl carboxymethylate (SCM), benzotriazole carbonate (BTC), N- hydroxysuccinimide (NHS), aldehyde, nitrophenylcarbonate (NPC), and tresylate (TRES)).
  • Suitable activated polymer molecules are commercially available, e.g., from Shearwater Polymers, Inc., Huntsville, Ala., USA, or from PolyMASC Pharmaceuticals pic, UK.
  • the polymer molecules can be activated by conventional methods known in the art, e.g, as disclosed in WO 90/13540. Specific examples of activated linear or branched polymer molecules for use herein are described in the Shearwater Polymers, Inc. 1997 and 2000 Catalogs (Functionalized Biocompatible Polymers for Research and pharmaceuticals, Polyethylene Glycol and Derivatives, incorporated herein by reference).
  • activated PEG polymers include the following linear PEGs: NHS-PEG (e.g., SPA-PEG, SSPA- PEG, SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG-PEG, and SCM-PEG), and NOR-PEG, BTC-PEG, EPOXPEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG, and MAL-PEG, and branched PEGs such as PEG2-NHS and those disclosed in U.S. Pat. No. 5,932,462 and U.S. Pat. No.
  • activated PEG polymers particularly preferred for coupling to cysteine residues include the following linear PEGs: vinylsulfone-PEG (VS-PEG), preferably vinylsulfone-mPEG (VS-mPEG); maleimide-PEG (MAL-PEG), preferably maleimide-mPEG (MAL-mPEG) and orthopyridyl-disulfide-PEG (OPSS-PEG), preferably orthopyridyl- disulfide-mPEG (OPSS-mPEG).
  • vinylsulfone-PEG VS-PEG
  • MAL-PEG maleimide-mPEG
  • OPSS-PEG orthopyridyl-disulfide-PEG
  • OPSS-mPEG orthopyridyl- disulfide-mPEG
  • PEG or mPEG polymers will have a size of about 5 kDa, about 10 kDa, about 12 kDa or about 20 kD
  • the activation method and/or conjugation chemistry to be used depends on the attachment group(s) of the fusion protein (examples of which are given further above), as well as the functional groups of the polymer (e.g., being amine, hydroxyl, carboxyl, aldehyde, sulfhydryl, succinimidyl, maleimide, vinylsulfone or haloacetate).
  • the PEGylation may be directed towards conjugation to all available attachment groups on the fusion protein (i.e., such attachment groups that are exposed at the surface of the polypeptide) or may be directed towards one or more specific attachment groups, e.g., the N- terminal amino group as described in U.S. Pat. No. 5,985,265 or to cysteine residues.
  • the conjugation may be achieved in one step or in a stepwise manner (e.g, as described in WO 99/55377).
  • the fusion protein is usually treated with a reducing agent, such as dithiothreitol (DDT) prior to PEGylation.
  • DDT dithiothreitol
  • the reducing agent is subsequently removed by any conventional method, such as by desalting. Conjugation of PEG to a cysteine residue typically takes place in a suitable buffer at pH 6-9 at temperatures varying from 4° C. to 25° C. for periods up to 16 hours.
  • the PEGylation is designed so as to produce the optimal molecule with respect to the number of PEG molecules attached, the size and form of such molecules (e.g, whether they are linear or branched), and the attachment site(s) in the fusion protein.
  • the molecular weight of the polymer to be used may e.g, be chosen on the basis of the desired effect to be achieved.
  • the polymer molecule which may be linear or branched, has a high molecular weight, preferably about 10-25 kDa, such as about 15-25 kDa, e.g., about 20 kDa.
  • the polymer conjugation is performed under conditions aimed at reacting as many of the available polymer attachment groups with polymer molecules. This is achieved by means of a suitable molar excess of the polymer relative to the polypeptide.
  • the molar ratios of activated polymer molecules to polypeptide are up to about 1000-1, such as up to about 200-1, or up to about 100-1. In some cases the ratio may be somewhat lower, however, such as up to about 50-1, 10-1, 5-1, 2-1 or 1-1 in order to obtain optimal reaction.
  • linker it is also contemplated to couple the polymer molecules to the fusion protein through a linker.
  • Suitable linkers are well known to the skilled person.
  • a preferred example is cyanuric chloride (Abuchowski et al., (1977), J. Biol. Chem., 252, 3578-3581; U.S. Pat. No. 4,179,337; Shafer et al., (1986), J. Polym. Sci. Polym. Chem. Ed., 24, 375-378).
  • HAS and HES non-proteinaceous polymers as well as methods of producing HAS or HES conjugates are disclosed for example in WO 02/080979, WO 03/070772, WO 057092391 and WO 057092390.
  • PSA polymer polysialic acid
  • PSA is a polymer of sialic acid (a sugar).
  • sialic acid a sugar
  • polysialic acid provides a protective microenvironment on conjugation. This increases the active life of the fusion protein in the circulation and prevents it from being recognized by the immune system.
  • the PSA polymer is naturally found in the human body. It was adopted by certain bacteria which evolved over millions of years to coat their walls with it. These naturally polysialylated bacteria were then able, by virtue of molecular mimicry, to foil the body’s defense system.
  • PSA, nature’s ultimate stealth technology can be easily produced from such bacteria in large quantities and with predetermined physical characteristics. Bacterial PSA is completely non-immunogenic, even when coupled to proteins, as it is chemically identical to PSA in the human body.
  • the relaxin-2 fusion proteins described herein have high levels of biological activity as compared to native relaxin-2. In some embodiments, any of the relaxin-2 fusion proteins described herein have from about 1% to about 200% of a biological activity as compared to native relaxin-2. In some embodiments, the relaxin-2 fusion protein has at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 125% about 150%, about 175%, or about 200% of a biological activity as compared to native relaxin-2.
  • any of the relaxin-2 fusion proteins described herein have from about 1% to about 200% of maximal biological activity as compared to native relaxin-2.
  • maximal biological activity is the maximum response (E max ) of relaxin-2 or relaxin-2 fusion protein.
  • the relaxin-2 fusion protein has at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 125% about 150%, about 175%, or about 200% of a maximal biological activity as compared to native relaxin-2.
  • any of the relaxin-2 fusion proteins described herein have about at least about 0.001-fold to about at least 1,000-fold enhanced potency as compared to native relaxin-2.
  • potency is the concentration of relaxin-2 or relaxin-2 fusion protein to elicit a half-maximal response (EC50).
  • the relaxin-2 fusion protein has at least about 0.001-fold, about 0.01-fold, about 0.1-fold, about 1-fold, about 10- fold, about 100-fold, or about 1,000-fold of the potency as compared to native relaxin-2.
  • the biological activity can be any biological activity of native relaxin-2.
  • the biological activity can be the capacity to bind the receptor of native relaxin-2, RXFP1.
  • the binding of relaxin-2 to RXFP1 can be measured by any well-known methods in the art, such as radioligand binding.
  • the fusion proteins described herein bind to RXFP1 when it is expressed on a cell surface.
  • the biological activity can be the capacity to activate RXFP1 on a cell surface.
  • the activation of RXFP1 by the relaxin-2 fusion proteins described herein can be determined by the increase of cAMP using any methods well known in the art, such as measuring the activity of a cAMP-driven reporter gene, e.g., [3-galactosidase.
  • the activation of RXFP1 by the relaxin-2 fusion proteins described herein in a cell may also be determined by using a biosensor such as the GloSensor biosensor.
  • the activation of RXFP1 by the relaxin- 2 fusion proteins described herein in a cell may also be determined by measuring the expression of certain genes, such as angiogenic factors, e.g., VEGF, or the expression of MMPs using well-known methods in the art.
  • the biological activity is a physiological, biochemical activity or any other effect-inducing activity of the relaxin-2.
  • Exemplary biological activities include, but are not limited to, vasodilation, collagen degradation, angiogenesis, decreasing arterial blood pressure, increasing renal artery blood flow, increasing cardiac filling at diastole, resolving established fibrosis, and suppressing new fibrosis development.
  • the fusion proteins described herein have improved pharmacokinetics profiles.
  • the structure of the fusion proteins described herein is based upon, at least in part, the surprising discovery that reducing the pl of relaxin-2 fusion protein analogs increases their circulating half-life.
  • the circulating half-life is in a mammal.
  • the mammal is a rodent or a primate.
  • the rodent is a rat or a mouse.
  • the primate is a human or a monkey.
  • the monkey is a cynomolgus monkey.
  • the mammal is a human.
  • the fusion proteins described herein may have a circulating half-life of greater than about 5 hours, 10 hours, 20 hours, 50 hours, 75 hours, 100 hours, 125 hours, 150 hours, or more. In some embodiments, the fusion proteins described herein may have a circulating half-life of 5- 10 hours, 10-20 hours, 20-50 hours, 50-75 hours, 75-100 hours, 100-125 hours, or 125-150 hours. Values and ranges intermediate to the recited values are also intended to be part of this disclosure. In some embodiments, the fusion proteins described herein have a longer circulating half-life than a native two chain relaxin-2. For example, the circulating half-life of a native two chain relaxin-2 may be less than about 5 hours.
  • the pl of the fusion protein is less than 9.0, 8.9, 8.8, 8.7, 8.6, 8.5,
  • the pl of the fusion proteins described herein are between 6.0 and 9.4. In some embodiments, the pl of the fusion proteins described herein are 6.5-8.5, 6.6-8.4, 6.7-8.3, 6.8-8.2, 6.8-8.1, 6.8-8.0, or 6.8-7.9. In some embodiments, the pl referred to above is the calculated or theoretical pl. In some embodiments, the pl referred to above is the experimentally measured pl.
  • Circulating half-life refers to the time it takes for the blood plasma concentration of a drug to halve its steady-state when circulating in the full blood of an organism. Circulating half-life of a particular agent may vary depending on a multitude of factors including, but not limited to, dosage, formulation, and/or administration route of the agent. One of ordinary skill in the art is able to determine the circulating half-life of an agent using well known methods in the art, such as the method described Chen supra.
  • the disclosure also provides nucleic acid molecules that encode any of the fusion proteins or peptides described herein.
  • the nucleic acid molecules described herein are DNA molecules.
  • the nucleic acid molecules described herein are RNA molecules.
  • the nucleic acid molecules described herein can be transcribed from a promoter in an expression vector.
  • the vector is a non-viral vector.
  • Exemplary non- viral vectors include, but are not limited to, plasmid DNA, transposons, episomal plasmids, minicircles, ministrings, and oligonucleotides (e.g, mRNA, naked DNA).
  • the vector is a DNA plasmid vector.
  • the vector is a viral vector.
  • Viral vectors can be replication competent or replication incompetent. Viral vectors can be integrating or non-integrating. A number of viral based systems have been developed for gene transfer into mammalian cells, and a suitable viral vector can be selected by a person of ordinary skill in the art.
  • Exemplary viral vectors include, but are not limited to, adenovirus vectors (e.g, adenovirus 5), adeno- associated virus (AAV) vectors (e.g, AAV2, 3, 5, 6, 8, 9), retrovirus vectors (MMSV, MSCV), lentivirus vectors (e.g, HIV-1, HIV-2), gammaretrovirus vectors, herpes virus vectors (e.g, HSV1, HSV2), alphavirus vectors (e.g, SFV, SIN, VEE, Ml), flavivirus (e.g, Kunjin, West Nile, Dengue virus), rhabdovirus vectors (e.g, rabies virus, VSV), measles virus vector (e.g, MV-Edm), Newcastle disease virus vectors, poxvirus vectors (e.g., VV), measles virus, and picomavirus vectors (e.g., Coxsackievirus).
  • adenovirus vectors e.g
  • the vector or expression cassette comprises one or more additional elements. Additional elements include, but are not limited to, promoters, enhancers, polyadenylation (poly A) sequences, and selection genes.
  • the vector comprises a polynucleotide sequence that encodes an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to an amino acid sequence recited in any of Tables 1-7.
  • the vector comprises or consists of a nucleotide sequence at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of the nucleotide sequence recited in Table 8, below.
  • any of the nucleotide sequences shown in Table 8 further comprise additional nucleotide sequence on their 5' and/or 3' ends.
  • any of the nucleotide sequences shown in Table 8 further comprise the nucleotide sequence ACGGGACCGATCCAGCCTCCGGACTCTAGAGCCACC ( SEQ ID NO : 185 ) on their 5' ends and/or any of the nucleotide sequences shown in Table 8 further comprise the nucleotide sequence TGATAAACCGGTTAGTAATGAGTTTGATATCTCGAC ( SEQ I D NO : 186 ) on their 3' ends.
  • compositions comprising the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • the pharmaceutical compositions described herein are formulated with suitable carriers, excipients, and other agents that provide improved transfer, delivery, tolerance, and the like.
  • suitable carriers, excipients, and other agents that provide improved transfer, delivery, tolerance, and the like.
  • a multitude of appropriate formulations can be found in the formulary known to all pharmaceutical chemists: Remington ’s Pharmaceutical Sciences, Mack Publishing Company, Easton, PA.
  • formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles (such as L1POFECTINTM, Life Technologies, Carlsbad, CA), DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax.
  • vesicles such as L1POFECTINTM, Life Technologies, Carlsbad, CA
  • the dose of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them administered to a patient may vary depending upon the age and the size of the patient, target disease, conditions, route of administration, and the like.
  • the preferred dose is typically calculated according to body weight or body surface area.
  • Effective dosages and schedules for administering the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them may be determined empirically; for example, patient progress can be monitored by periodic assessment, and the dose adjusted accordingly.
  • interspecies scaling of dosages can be performed using well-known methods in the art (e.g., Mordenti et al., 1991, Pharmaceut. Res. 8:1351).
  • Various delivery systems are known and can be used to administer the pharmaceutical composition disclosed herein, e.g, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, receptor mediated endocytosis (see, e.g., Wu et al., 1987, J. Biol. Chem. 262:4429-4432).
  • Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • composition may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g, oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • any pharmaceutical composition described herein can be delivered subcutaneously or intravenously with a standard needle and syringe.
  • a pen delivery device readily has applications in delivering a pharmaceutical composition disclosed herein.
  • Such a pen delivery device can be reusable or disposable.
  • a reusable pen delivery device generally utilizes a replaceable cartridge that contains a pharmaceutical composition. Once all of the pharmaceutical composition within the cartridge has been administered and the cartridge is empty, the empty cartridge can readily be discarded and replaced with a new cartridge that contains the pharmaceutical composition. The pen delivery device can then be reused.
  • a disposable pen delivery device there is no replaceable cartridge. Rather, the disposable pen delivery device comes prefilled with the pharmaceutical composition held in a reservoir within the device. Once the reservoir is emptied of the pharmaceutical composition, the entire device is discarded.
  • the pharmaceutical composition can be delivered in a controlled release system.
  • a pump may be used (see, Langer, supra, Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201).
  • polymeric materials can be used; see, Medical Applications of Controlled Release, Langer and Wise (eds.), 1974, CRC Pres., Boca Raton, Florida.
  • a controlled release system can be placed in proximity of the composition’s target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, 1984, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138). Other controlled release systems are discussed in the review by Langer, 1990, Science 249: 1527-1533.
  • the injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous and intramuscular injections, drip infusions, etc. These injectable preparations may be prepared by methods publicly known. For example, the injectable preparations may be prepared, e.g., by dissolving, suspending, or emulsifying any of the fusion proteins described herein in a sterile aqueous medium or an oily medium conventionally used for injections.
  • aqueous medium for injections there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)], etc.
  • an alcohol e.g., ethanol
  • a polyalcohol e.g., propylene glycol, polyethylene glycol
  • a nonionic surfactant e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil
  • oily medium there are employed, e.g., sesame oil, soybean oil, etc., which may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc.
  • a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc.
  • the pharmaceutical compositions for oral or parenteral use described above are prepared into dosage forms in a unit dose suited to fit a dose of the active ingredients.
  • dosage forms in a unit dose include, for example, tablets, pills, capsules, injections (ampoules), suppositories, etc.
  • the amount of the aforesaid fusion protein contained is generally about 5 to about 500 mg per dosage form in a unit dose; especially in the form of injection, it is preferred that the aforesaid fusion protein is contained in about 5 to about 100 mg and in about 10 to about 250 mg for the other dosage forms.
  • the present disclosure provides methods comprising administering to a subject in need thereof a therapeutic composition comprising the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • the therapeutic composition can comprise any of the fusion proteins or component peptides as disclosed herein and a pharmaceutically acceptable carrier or diluent.
  • the expression “a subject in need thereof’ means a human or non-human animal that exhibits one or more symptoms or indicia of a relaxin-2 associated disorder or disease, or who otherwise would benefit an increase or decrease in relaxin-2 activity.
  • the fusion proteins or component peptides described herein and the expression vectors that encode them are useful, inter alia, for treating any disease or disorder in which activation or deactivation of RXFP1 is beneficial.
  • the present disclosure provides methods for activating RXFP1 on a cell surface, comprising administering an effective amount of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them to a subject in need thereof, thereby activating RXFP1 on the surface of the cell.
  • Activation of RXFP1 on the cell surface can lead to cellular responses, including but not limited to, the elevation of cAMP levels, vasodilation, the expression of angiogenic factors, including VEGF, the expression of MMPs, and collagen degradation.
  • the cell is selected from the group consisting of endothelial cells, vascular smooth muscle cells, other vascular cells, cardiomyocytes, other cardiac cells, and fibroblasts.
  • This disclosure also provides methods for treating various relaxin-2 associated diseases.
  • the term “relaxin-2-associated disease,” is a disease or disorder that is caused by, or associated with, relaxin-2 protein production or relaxin-2 protein activity.
  • the term “relaxin-2-associated disease” includes a disease, disorder or condition that would benefit from an increase in relaxin-2 protein activity.
  • Non-limiting examples of relaxin-2-associated diseases include, for example, kidney diseases, including but not limited to, focal segmental glomerular sclerosis (FSGS), diabetic nephropathy, hepatorenal syndrome; fibrotic diseases, including but not limited to, scleroderma, idiopathic pulmonary fibrosis, renal fibrosis, cardiac fibrosis, NASH; cardiovascular diseases, including dilated cardiomyopathy, diastolic heart failure, pulmonary arterial hypertension, chronic heart failure, acute heart failure, congestive heart failure, coronary artery disease, hypertension, pre-eclampsia. Further details regarding signs and symptoms of the various diseases or conditions are provided herein and are well known in the art.
  • FSGS focal segmental glomerular sclerosis
  • fibrotic diseases including but not limited to, scleroderma, idiopathic pulmonary fibrosis, renal fibrosis, cardiac fibrosis, NASH
  • cardiovascular diseases including dilated cardiomyopathy, di
  • compositions according to the methods described herein may result in a reduction of the severity, signs, symptoms, or markers of a relaxin-2-associated disease or disorder in a patient with a relaxin-2-associated disease or disorder.
  • reduction in this context is meant a statistically significant decrease in such level.
  • the reduction can be, for example, at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay used.
  • compositions and therapeutic formulations comprising the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them in combination with one or more additional therapeutically active components, and methods of treatment comprising administering such combinations to subjects in need thereof.
  • Exemplary additional therapeutic agents include any therapeutic agents that may be used for the treatment of any relaxin-2-related disorders described herein.
  • Exemplary additional therapeutic agents that may be combined with or administered in combination with the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them include, but are not limited to, angiotensin II receptor blockers, e.g., azilsartan, candesartan, eprosartan, losartan, ACE inhibitors, e.g., lisinopril, benazepril, captopril, enalapril, moexipril, perindopril, quinapril, trandolapril, calcium channel blockers, e.g, amlodipine, amlodipine and benazepril, amlodipine and valsartan, diltiazem, felodipine, isradipine, nicardipine, n
  • the additional therapeutic agents are drugs effective in treating fibrosis, including but not limited to, small molecule drugs and antibodies.
  • exemplary anti- fibrosis drugs include, but are not limited to, TGF-J3 inhibitors, e.g., small molecules such as hydronidone, distiertide, or antibodies such as fresolimumab, PDGF or VEGF antagonist, e.g. , small molecules such as imatinib, nilotinib, or any drugs that target extracellular factors that are involved in the pathogenesis of fibrosis.
  • TGF-J3 inhibitors e.g., small molecules such as hydronidone, distiertide, or antibodies such as fresolimumab, PDGF or VEGF antagonist, e.g. , small molecules such as imatinib, nilotinib, or any drugs that target extracellular factors that are involved in the pathogenesis of fibrosis.
  • exemplary drugs for fibrosis can be found
  • the additional therapeutically active component(s) may be administered just prior to, concurrent with, or shortly after the administration of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • compositions in which the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them is co-formulated with one or more of the additional therapeutically active component(s) as described elsewhere herein.
  • multiple doses of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them may be administered to a subject over a defined time course.
  • the methods according to this aspect of the disclosure comprise sequentially administering to a subject multiple doses of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • “sequentially administering” means that each dose of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them is administered to the subject at a different point in time, e.g, on different days separated by a predetermined interval (e.g., hours, days, weeks, or months).
  • the present disclosure provides methods which comprise sequentially administering to the patient a single initial dose of a fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them, followed by one or more secondary doses of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them, and optionally followed by one or more tertiary doses of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • the terms “initial dose,” “secondary doses,” and “tertiary doses,” refer to the temporal sequence of administration of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • the “initial dose” is the dose which is administered at the beginning of the treatment regimen (also referred to as the “baseline dose”);
  • the “secondary doses” are the doses which are administered after the initial dose;
  • the “tertiary doses” are the doses which are administered after the secondary doses.
  • the initial, secondary, and tertiary doses may all contain the same amount of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them, but generally may differ from one another in terms of frequency of administration. In certain embodiments, however, the amounts of fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them contained in the initial, secondary and/or tertiary doses varies from one another (e.g., adjusted up or down as appropriate) during the course of treatment.
  • two or more (e.g., 2, 3, 4, or 5) doses are administered at the beginning of the treatment regimen as “loading doses” followed by subsequent doses that are administered on a less frequent basis (e.g., “maintenance doses”).
  • each secondary and/or tertiary dose is administered 1 to 26 (e.g., 1, 1/, 2, 2/, 3, 3/, 4, 4/, 5, 5/, 6, 6/, 7, 7/, 8, 8/, 9, 9/, 10, 10/, 11, 11 /, 12, 12/, 13, 13/, 14, 14/, 15, 15/, 16, 16/, 17, 17/, 18, 18/, 19, 19/, 20, 20/, 21, 21/, 22, 22/, 23, 23/, 24, 24/, 25, 25/, 26, 26/, or more) weeks after the immediately preceding dose.
  • 1 to 26 e.g., 1, 1/, 2, 2/, 3, 3/, 4, 4/, 5, 5/, 6, 6/, 7, 7/, 8, 8/, 9, 9/, 10, 10/, 11, 11 /, 12, 12/, 13, 13/, 14, 14/, 15, 15/, 16, 16/, 17, 17/, 18, 18/, 19, 19/, 20, 20/, 21, 21/, 22, 22/, 23, 23/, 24, 24/, 25, 25/, 26, 26/,
  • the immediately preceding dose means, in a sequence of multiple administrations, the dose of fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them, which is administered to a patient prior to the administration of the very next dose in the sequence with no intervening doses.
  • the methods according to this aspect of the disclosure may comprise administering to a patient any number of secondary and/or tertiary doses of fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • a single secondary dose is administered to the patient.
  • two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) secondary doses are administered to the patient.
  • only a single tertiary dose is administered to the patient.
  • two or more (e.g, 2, 3, 4, 5, 6, 7, 8, or more) tertiary doses are administered to the patient.
  • each secondary dose may be administered at the same frequency as the other secondary doses. For example, each secondary dose may be administered to the patient 1 to 2 weeks after the immediately preceding dose. Similarly, in embodiments involving multiple tertiary doses, each tertiary dose may be administered at the same frequency as the other tertiary doses. For example, each tertiary dose may be administered to the patient 2 to 4 weeks after the immediately preceding dose. Alternatively, the frequency at which the secondary and/or tertiary doses are administered to a patient can vary over the course of the treatment regimen. The frequency of administration may also be adjusted during the course of treatment by a physician depending on the needs of the individual patient following clinical examination.
  • one or more of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them are administered to a subject as a weight-based dose.
  • a “weight-based dose” e.g., a dose in mg/kg is a dose of the protein or peptides that will change depending on the subject’s weight.
  • one or more of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them is administered to a subject as a fixed dose.
  • a “fixed dose” (e.g., a dose in mg) means that one dose of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them is used for all subjects regardless of any specific subject-related factors, such as weight.
  • a fixed dose of fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them is based on a predetermined weight or age.
  • a suitable dose of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them can be in the range of about 0.001 to about 200.0 milligram per kilogram body weight of the recipient, generally in the range of about 1 to 50 mg per kilogram body weight.
  • the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them can be administered at about 0.1 mg/kg, about 0.2 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 40 mg/kg, about 50 mg/kg per single dose. Values and ranges intermediate to the recited values are also intended to be part of this disclosure.
  • one or more of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them is administered as a fixed dose of between about 10 mg to about 2500 mg.
  • the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them are administered as a fixed dose of about 10 mg, about 15 mg, about 20 mg, 25 mg, about 30 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, about 400 mg, about 425 mg, about 450 mg, about 475 mg, about 500 mg, about 525 mg, about 550 mg, about 575 mg, about 600 mg, about 625 mg, about 650 mg, about 675 mg, about 700 mg, about 725 mg, about 750 mg, about 7
  • compositions described herein may be comprised in a kit.
  • the kit comprises one or more of the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them.
  • the kit may further include reagents or instructions for using the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them in a subject. It may also include one or more buffers.
  • kits may be packaged either in aqueous media or in lyophilized form.
  • the container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit (labeling reagent and label may be packaged together), the kit also will generally contain a second, third, or other additional container into which the additional components may be separately placed.
  • the kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent. However, various combinations of components may be comprised in a vial.
  • the kits of the present disclosure also typically include a means for containing the fusion proteins or component peptides described herein or the nucleic acid molecules, or the expression vectors that encode them, and any other reagent containers in close confinement for commercial sale.
  • the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the components of the kit may be provided as dried powder(s).
  • the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • Heparin chromatography is a method commonly employed at early candidate screening to better understand a molecule’s propensity to interact with elements of the vasculature when dosed in patients.
  • Heparin and heparin sulfate proteoglycans are negatively charged polysaccharides present in vasculature and in tissues, of which positively charged molecules may bind at physiological pH (i.e., pl > 7.4).
  • heparin chromatography was employed to screen for candidates/variants with reduced heparin binding, which is predictive of good PK properties. Materials used for the heparin chromatography are provided in Table 9.
  • Table 12 shows the results of the heparin chromatography for a variety of relaxin-2 analog fusion proteins.
  • IgG is from Jackson ImmunoResearch (Catalog # 009-000-003).
  • the “Prior fusion protein” is a LALA IgG-RelB-Linker-RelA fusion with a theoretical pl of 8.5, but an experimentally determined pl of 9.4. Its linker protein comprises only one acidic amino acid.
  • SEQ ID NOs: 53, 56, 58, 59, and 61-64 have linker proteins comprising at least two acidic amino acids as well as LALA IgG (SEQ ID NO: 50 or 201).
  • the final two fusion proteins have linker proteins comprising only one acidic amino acid and have higher theoretical pi’s. As shown in Table 12, above, there is a correlation between lower pl and lower non-specific binding found through heparin chromatography.
  • gold nanoparticles are pre-coated with anti-human antibodies (Fc, Fab and H+L), which when incubated with target antibodies in dilute solutions, capture and concentrate in solution the antibody of interest.
  • Fc, Fab and H+L anti-human antibodies
  • the inter-particle distances decrease between gold nanoparticles, leading to increased plasmon wavelengths (i.e., red shift) that can be quantified using UV-VIS spectroscopy.
  • Materials used for the spectroscopy are provided in Table 13.
  • Goat anti -human Fc IgG antibody (capture) and goat IgG antibody (non-capture) were buffer exchanged into 20 mM sodium acetate, pH 4.3. After buffer exchange, concentrations were normalized to 0.4 mg/mL for both antibodies.
  • a 4:1 volume ratio mixture of capture (anti-Fc):non-capture (Goat IgG) solution was prepared for 80% capture capacity coating solution to be used to incubate gold nanoparticles (AuNPs).
  • thiolated PEG was added to 0.1 pM final concentration from the diluted 10 pM stock to block empty sites on the AuNPs (i.e., 5mL solution of AuNPs, add 50pL lOpM stock) and incubated at RT for one hour in the dark.
  • lOpL of AuNP concentrate was incubated with lOOpL antibody test solution (normalize to 0.05 mg/mL) at room temperature in the dark for 2 hours in a 96-well polypropylene plate.
  • Two blank solutions were prepared with lOpL lOx AuNP concentrated to lOOpL PBS for purposes of blanking the assay and determining wavelength shift upon addition of test antibody.
  • Ganitumab was included as a positive control (high association, red shift) and Panitumumab as a negative control (no association, no UV shift). Each sample was prepared in duplicate for analysis.
  • HEK293 cells were seeded into a 96-well tissue culture plate followed by transient cotransfection with a human RXFP1 and a pGloSensor-22F plasmid.
  • Transfected cells were stimulated by relaxin-2 or fusion protein analogs thereof, inducing Gs-mediated cAMP signaling.
  • cAMP is assayed using the activity of the GloSensor biosensor, which is a mutant luciferase fused to a cAMP binding domain, leading to a production of light in the presence of its substrate luciferin. This readout of relative luminescent units (RLU) is used a proxy for cAMP response.
  • RLU relative luminescent units
  • CCh-independent media was pre-warmed to 37°C using the bead bath. A single aliquot of D-luciferin was thawed and added at 5% final concentration (e.g. 4.75 mL cAMP assay media + 250 pL of D-luciferin stock; gives 1.25 mg/mL or 3.93 mM final D-luciferin). This was used within the same day or discarded.
  • HEK293 cells (ATCC CRL-1573) were cultured in DMEM + 10% FBS, 1% (IX or 10 U/mL) Pen-Strep in a humidified CO2 incubator at 37C, 5% CO2 until 80-100% confluency. Cells were typically split 1:6 for 3 days and maintained in a sterile T-75 tissue culture flask.
  • Raw data was exported to Excel using the MARS data analysis software that is opened following a run on the CLARIOstar plate reader. These values are measured in RLU, or relative luminescence units.
  • Heparin Chromatography was performed to understand the propensity of a relaxin-2 fusion protein analog to interact with elements of the vasculature and/or rapidly distribute into tissues when dosed in patients. Analogs that were found to bind heparin weakly may be predictive of good pharmacokinetic properties. Briefly, a heparin column was equilibrated using mobile phase A (20 mM Tris pH 7.4) for 10 minutes at 0.5 mL/min prior to analysis. 10 pg per sample was run using the Heparin Chromatography method on an Agilent HPLC using 280 nm detection, using gradient shown in Table 16, below (mobile phase B: 20 mM Tris pH 7.4, 1 M NaCl):
  • a positive control no Heparin binding, pembrolizumab
  • negative control mimild Heparin binding, adalimumab
  • the approximate concentration of NaCl needed to elute was calculated using the following calculation:
  • Imaged capillary isoelectric focusing was used to separate differentially charged molecules (i.e., relaxin-2 fusion protein analogs) using electrophoretic mobility in an ampholyte solution to determine their isoelectric points (pl). Molecules were loaded to a capillary and separated based on their pl by allowing molecules to migrate along an electrical field until the molecules reached the pH corresponding to their pl. UV absorption of the whole capillary was measured throughout the separation, which allowed for real-time observation as well as final quantification.
  • BVP ELISA was employed to understand the propensity of a relaxin-2 fusion protein analog for non-specific or non-target interactions.
  • BVPs are empty viral capsids with no viral genome, but in the process of production, budding off from the cell membrane allows them to take components of the cell membrane along with them.
  • the BVPs possess a highly diverse cell surface with many moieties present, which mimic what the molecule of interest (i.e., relaxin-2 fusion protein analog) may encounter in vivo.
  • BVPs are coated on a plate by adding 25 pL of BVP solution to each well. BVP solution was made by diluting BVP stock (Medna Scientific; Cat. No.
  • Plates were incubated at 25°C for 1 hour, after which the wells were bloted and washed three times with PBST.
  • 25 pL/well of 1 10,000 diluted detection monoclonal antibody (Peroxidase AffiniPure Goat AntiHuman IgG, Fey fragment specific; Jackson ImmunoResearch; Cat. No. 50-194-1564) was added, and plates were incubated at 25°C for 1 hour, after which the wells were bloted and washed three times with PBST.
  • 1-StepTM Ultra TMB-ELISA Substrate Solution (Life Technologies; Cat. No. 34029) was then added. After about 2 minutes, 25 pL 2N HC1 was added to quench the reaction, and a plate reader was used to analyze the plate at 450 nm with correction at 570 nm.
  • a transient hRXFPl assay was performed substantially as described in Example 3.
  • Affinity-Capture Self-Interaction Nanoparticle Spectroscopy (AC-SINS) AC-SINS
  • AC-SINS was performed to understand the propensity of a molecule (i.e., relaxin-2 fusion protein analog) to self-associate.
  • the methodology performed was similar to the method described in Example 2.
  • AuNP solution was prepared as follows: 1.5 mL of coated AuNP solution was centrifuged at 20,000 x g for 5 minutes to sediment the AuNPs and 1,350 pL was carefully removed using a 1 mL pipette. The pelleted AuNPs were gently resuspended using a 200pL pipete to generate a lOx concentrated stock of coated AuNPs.
  • Nanoscale Differential Scanning Fluorimetry (NanoDSF)
  • NanoDSF was performed using the NanoTemper Prometheus Panta to investigate the conformational stability of a relaxin-2 protein fusion analog. Conformational stability was measured by applying a thermal ramp to a solution containing the molecule of interest, measuring the intrinsic fluorescence, backs catering, and using dynamic light scatering (DLS) to provide various thermal stability parameters.
  • DLS dynamic light scatering

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Endocrinology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
PCT/US2022/079681 2021-11-11 2022-11-11 Relaxin-2 fusion protein analogs and methods of using same Ceased WO2023086913A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA3237801A CA3237801A1 (en) 2021-11-11 2022-11-11 Relaxin-2 fusion protein analogs and methods of using same
JP2024527767A JP2024543455A (ja) 2021-11-11 2022-11-11 リラキシン-2融合タンパク質類似体及びそれを使用する方法
IL312731A IL312731A (en) 2021-11-11 2022-11-11 Relaxin-2 fusion protein analogs and methods of using same
EP22893856.9A EP4429694A4 (en) 2021-11-11 2022-11-11 RELAXIN-2 FUSION PROTEIN ANALOGUES AND METHODS OF USE THEREOF
CN202280086174.7A CN118510536A (zh) 2021-11-11 2022-11-11 松弛素-2融合蛋白类似物及其使用方法
AU2022388751A AU2022388751A1 (en) 2021-11-11 2022-11-11 Relaxin-2 fusion protein analogs and methods of using same
MX2024005654A MX2024005654A (es) 2021-11-11 2022-11-11 Análogos de la proteína de fusión de la relaxina-2 y métodos de usos de los mismos.
KR1020247019339A KR20240110824A (ko) 2021-11-11 2022-11-11 릴랙신-2 융합 단백질 유사체 및 이의 사용 방법

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163263917P 2021-11-11 2021-11-11
US63/263,917 2021-11-11

Publications (2)

Publication Number Publication Date
WO2023086913A2 true WO2023086913A2 (en) 2023-05-19
WO2023086913A3 WO2023086913A3 (en) 2023-06-22

Family

ID=86336636

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/079681 Ceased WO2023086913A2 (en) 2021-11-11 2022-11-11 Relaxin-2 fusion protein analogs and methods of using same

Country Status (10)

Country Link
US (1) US12509497B2 (https=)
EP (1) EP4429694A4 (https=)
JP (1) JP2024543455A (https=)
KR (1) KR20240110824A (https=)
CN (1) CN118510536A (https=)
AU (1) AU2022388751A1 (https=)
CA (1) CA3237801A1 (https=)
IL (1) IL312731A (https=)
MX (1) MX2024005654A (https=)
WO (1) WO2023086913A2 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12264188B2 (en) 2023-05-18 2025-04-01 Tectonic Operating Company, Inc. Relaxin-2 fusion proteins
US12509497B2 (en) 2021-11-11 2025-12-30 Tectonic Operating Company, Inc. Relaxin-2 fusion protein analogs and methods of using same

Family Cites Families (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4835251A (en) 1986-06-23 1989-05-30 Genetech, Inc. Method of chain combination
WO2007115414A1 (en) 2006-04-11 2007-10-18 University Of Guelph Modified h2 relaxin for tumor suppression
WO2009055854A1 (en) 2007-10-30 2009-05-07 Howard Florey Institute Of Experimental Physiology And Medicine Chimeric relaxin polypeptides comprising an a and b chain derived from different relaxin family peptides
WO2010105081A1 (en) 2009-03-13 2010-09-16 Medtronic, Inc. Method of treating heart failure
US8389475B2 (en) 2009-08-10 2013-03-05 The Board Of Trustees Of The Leland Stanford Junior University Relaxin analogs
US20110243943A1 (en) 2010-04-02 2011-10-06 Athena Discovery, Inc. Treatment using relaxin-fusion proteins with extended in vivo half-lives
EA030886B1 (ru) 2010-08-17 2018-10-31 Амбркс, Инк. Модифицированные полипептиды релаксина, содержащие некодируемую в природе аминокислоту, связанную с полимером, и их применение
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
EP2614076A4 (en) 2010-09-08 2014-03-05 Florey Howard Inst CHANGED RELAXIN POLYPEPTIDES
GB201110833D0 (en) 2011-06-24 2011-08-10 Bold Venture Llc Compositions
RU2014103288A (ru) 2011-07-01 2015-08-10 Байер Интеллектчуал Проперти Гмбх Слитые полипептиды релаксина и их применение
KR20140039257A (ko) 2011-07-08 2014-04-01 바이엘 인텔렉쳐 프로퍼티 게엠베하 릴랙신을 방출하는 융합 단백질 및 이의 용도
JP6276690B2 (ja) 2011-08-04 2018-02-07 ファリス バイオテック ゲーエムベーハー ヒトリラキシン−2を調製する方法
EP2630964A1 (en) 2012-02-22 2013-08-28 Immundiagnostik AG Method and medicament for treating patients in risk of prediabetes and type-2 diabetes
WO2013177529A1 (en) 2012-05-24 2013-11-28 Angion Biomedica Corp. Relaxin-like compounds and uses thereof
WO2014040008A1 (en) 2012-09-10 2014-03-13 Angion Biomedica Corp. Relaxin-like peptides and uses thereof
US9381231B2 (en) 2012-10-09 2016-07-05 University Of Florida Research Foundation, Inc. Use of relaxin to restore maternal physiology in pregnancies conceived by assisted reproductive technologies
US20150232526A1 (en) 2012-10-10 2015-08-20 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Use of relaxin to treat atrial fibrillation
US9005630B2 (en) 2012-11-01 2015-04-14 Veterinaerinstituttet Fusion proteins for the treatment of allergic diseases
US9907833B2 (en) 2013-07-25 2018-03-06 University Of Florida Research Foundation, Incorporated Use of relaxin to treat placental syndromes
JP6822839B2 (ja) 2013-09-13 2021-01-27 ザ・スクリップス・リサーチ・インスティテュート 修飾された治療剤、及びその組成物
KR20160055940A (ko) 2013-09-24 2016-05-18 엘라스타겐 피티와이 리미티드 단백질 추출 방법
EP3068891A1 (en) 2013-11-13 2016-09-21 Aequus Biopharma Inc. Engineered glycoproteins and uses thereof
RU2711322C1 (ru) * 2013-12-20 2020-01-16 Ф. Хоффманн-Ля Рош Аг Улучшенные способы получения рекомбинантного полипептида
EP3131925B1 (en) 2014-04-17 2020-02-19 The Florey Institute of Neuroscience and Mental Health Modified relaxin b chain peptides
EP2946788A1 (en) 2014-05-23 2015-11-25 Immundiagnostik AG Method and composition for treating heart failure with preserved ejection fraction
WO2016144968A1 (en) 2015-03-09 2016-09-15 University Of Washington Relaxin therapy for disorders of the diaphragm
GB201516068D0 (en) 2015-09-10 2015-10-28 Biomed Ltd B V Novel therapy
PT3387019T (pt) 2015-12-09 2022-01-14 Scripps Research Inst Proteínas de fusão de imunoglobulina de relaxina e métodos de uso
IL263079B2 (en) 2016-05-18 2024-05-01 Modernatx Inc Polynucleotides encoding relaxin
WO2018023170A1 (en) 2016-08-04 2018-02-08 Hudson Institute of Medical Research A method of treatment
WO2018068047A1 (en) 2016-10-07 2018-04-12 Beth Israel Deaconess Medical Center, Inc. Compositions comprising relaxin and methods of use thereof
EP3574004A1 (en) * 2017-01-25 2019-12-04 Medimmune, LLC Relaxin fusion polypeptides and uses thereof
PE20191716A1 (es) * 2017-02-08 2019-12-05 Bristol Myers Squibb Co Polipeptidos de relaxina modificada que comprenden un mejorador farmacocinetico y sus usos
WO2019149781A1 (en) 2018-01-31 2019-08-08 Sanofi Modified lipidated relaxin b chain peptides and their therapeutic use
TW201934572A (zh) 2018-01-31 2019-09-01 法商賽諾菲公司 經修飾之鬆弛素b鏈胜肽及其治療用途
NZ766762A (en) 2018-01-31 2026-03-27 Sanofi Sa Modified lipidated relaxin b chain peptides and their therapeutic use
TWI844709B (zh) 2019-07-31 2024-06-11 美商美國禮來大藥廠 鬆弛素(relaxin)類似物及其使用方法
WO2021094626A1 (en) 2019-11-16 2021-05-20 Relaxera Pharmazeutische Gmbh & Co. Kg Medical composition for treating cardiac wasting and cachexia
CN115768801A (zh) * 2020-05-08 2023-03-07 哈佛学院院长等 工程化松弛素及其使用方法
JP2023526512A (ja) 2020-05-22 2023-06-21 トラスティーズ オブ ボストン ユニバーシティ 線維化疾患を処置するための方法および組成物
US20210380655A1 (en) 2020-06-02 2021-12-09 Trustees Of Boston University Production of soluble relaxin and relaxin analogs
CA3186143A1 (en) 2020-06-17 2021-12-23 Medimmune Limited Heterodimeric relaxin fusions and uses thereof
CN114075276A (zh) 2020-08-17 2022-02-22 成都奥达生物科技有限公司 一种长效松弛素2类似物
CN113577289A (zh) 2021-01-11 2021-11-02 张莉 Rxfp1/3抑制剂在制备预防或治疗青少年特发性脊柱侧凸疾病的药物中的用途
AU2022334113A1 (en) 2021-08-23 2024-03-14 River 2 Renal Corp. Combination of relaxin and vasopressin analogues for treatment of renal disorders or conditions
CA3230581A1 (en) 2021-09-14 2023-03-23 Bellylabs Oy Assay method for relaxin
WO2023056044A1 (en) 2021-10-01 2023-04-06 Modernatx, Inc. Polynucleotides encoding relaxin for the treatment of fibrosis and/or cardiovascular disease
CN118510536A (zh) 2021-11-11 2024-08-16 泰克托尼治疗股份有限公司 松弛素-2融合蛋白类似物及其使用方法
AU2022410335A1 (en) 2021-12-15 2024-07-18 Medimmune Limited Treatment using heterodimeric relaxin fusions
CA3252059A1 (en) 2022-05-07 2025-07-07 Beijing Tuo Jie Biopharmaceutical Co. Ltd. Relaxin fusion protein or analogue and its medical use
JP2025528469A (ja) 2022-08-31 2025-08-28 リラクセラ ファルマツォイティッシュ ゲゼルシャフト エムベーハー ウント コー. カーゲー 免疫抑制薬及び処置方法
AU2024270919A1 (en) * 2023-05-18 2026-01-15 Tectonic Operating Company, Inc. Relaxin-2 fusion protein analogs and methods of using same

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12509497B2 (en) 2021-11-11 2025-12-30 Tectonic Operating Company, Inc. Relaxin-2 fusion protein analogs and methods of using same
US12264188B2 (en) 2023-05-18 2025-04-01 Tectonic Operating Company, Inc. Relaxin-2 fusion proteins

Also Published As

Publication number Publication date
WO2023086913A3 (en) 2023-06-22
JP2024543455A (ja) 2024-11-21
KR20240110824A (ko) 2024-07-16
CN118510536A (zh) 2024-08-16
IL312731A (en) 2024-07-01
US12509497B2 (en) 2025-12-30
MX2024005654A (es) 2024-09-11
EP4429694A2 (en) 2024-09-18
CA3237801A1 (en) 2023-05-19
EP4429694A4 (en) 2025-10-01
AU2022388751A1 (en) 2024-05-30
US20230340058A1 (en) 2023-10-26

Similar Documents

Publication Publication Date Title
EP3393500B1 (en) Polymer conjugates having reduced antigenicity
US12509497B2 (en) Relaxin-2 fusion protein analogs and methods of using same
WO2011103105A1 (en) Fibronectin based scaffold domain proteins that bind il-23
CN103379915A (zh) Hsa相关组合物及使用方法
KR20170044115A (ko) 동일한 진핵생물 세포 생산 숙주 내 조건부 활성 생체 단백질의 발견 및 제조
JP7465378B2 (ja) Hiv融合体を標的とするポリペプチド
US12264188B2 (en) Relaxin-2 fusion proteins
WO2018207023A2 (en) Fc-fusion protein derivatives with high dual hiv antiviral and immunomodulatory activity
CN116003634A (zh) Cd164融合蛋白及其应用
JP2023524981A (ja) 操作されたリラキシンおよびその使用の方法
US20260085125A1 (en) Apelin receptor binding polypeptides and methods
JP2024537239A (ja) インターロイキン-10ムテイン及びその融合タンパク質
EP4646427A2 (en) Smagp fusion molecules and methods of use thereof
HK40091844A (zh) 双功能蛋白质和包含其的药物组合物
HK40086042A (zh) 双功能蛋白质和包含其的药物组合物
Egerer et al. The Prevention of HIV Infection with Viral Entry Inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22893856

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3237801

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2024527767

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: AU2022388751

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2022388751

Country of ref document: AU

Date of ref document: 20221111

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247019339

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020247019339

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2022893856

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022893856

Country of ref document: EP

Effective date: 20240611

WWE Wipo information: entry into national phase

Ref document number: 202280086174.7

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 11202403127S

Country of ref document: SG

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22893856

Country of ref document: EP

Kind code of ref document: A2