WO2023059040A1 - Cdk 억제제 및 id2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물 - Google Patents

Cdk 억제제 및 id2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2023059040A1
WO2023059040A1 PCT/KR2022/014930 KR2022014930W WO2023059040A1 WO 2023059040 A1 WO2023059040 A1 WO 2023059040A1 KR 2022014930 W KR2022014930 W KR 2022014930W WO 2023059040 A1 WO2023059040 A1 WO 2023059040A1
Authority
WO
WIPO (PCT)
Prior art keywords
bladder cancer
activator
expression
apigenin
cells
Prior art date
Application number
PCT/KR2022/014930
Other languages
English (en)
French (fr)
Inventor
신동명
김용환
Original Assignee
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 재단법인 아산사회복지재단
Publication of WO2023059040A1 publication Critical patent/WO2023059040A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating bladder cancer comprising a CDK inhibitor and an ID2 activator.
  • Bladder cancer is the 10th most common cancer worldwide, and in 2020, about 573,278 new bladder cancer patients occurred, and more than 212,536 patients died. It is a disease with high incidence and mortality. Bladder cancer is characterized by high rates of somatic mutations and exhibits clinical and pathological heterogeneity.
  • Non-invasive bladder cancer is a lesion in which cancer is confined to the mucous membrane without invasion of the muscle layer, and can be treated relatively simply by injecting anticancer drugs or BCG into the bladder depending on the presence or absence of risk factors after transurethral resection of bladder tumor. Recurrence and progression to invasive cancer are problematic.
  • invasive bladder cancer refers to a state in which cancer has penetrated into the muscle layer, and for its treatment, not only must a radical cystectomy and complex urinary diversion be performed, but it can also cause fatal results to the patient. Therefore, prediction, early detection, and prevention of recurrence and progression after primary treatment are very important.
  • An object of the present invention is to select a major factor in bladder cancer in order to discover an effective new treatment target in bladder cancer, and to evaluate whether the selected factor has a therapeutic effect on bladder cancer, thereby providing a method for preventing or treating bladder cancer that can maximize the therapeutic effect. is to provide a new
  • the present invention relates to a CDK inhibitor or a pharmaceutically acceptable salt thereof; And it provides a pharmaceutical composition for preventing or treating bladder cancer comprising an ID2 activator or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention is a CDK inhibitor or a pharmaceutically acceptable salt thereof; and an ID2 activator or a pharmaceutically acceptable salt thereof as an active ingredient for concomitant administration for preventing or treating bladder cancer.
  • ID2 is a factor significantly related to the tumor grade of bladder cancer
  • ID2 activator exhibits a therapeutic effect on bladder cancer
  • a CDK1 inhibitor and ID2 activator compared to the case of administration alone, it was confirmed that apoptosis of bladder cancer was induced and the invasiveness of cancer cells was significantly inhibited, thereby significantly suppressing the size and progression of bladder cancer.
  • a composition containing a CDK inhibitor and an ID2 activator and a method of combined administration can be provided as a new therapeutic means for preventing or treating bladder cancer.
  • the red box is Tumor (T)
  • the gray box is Normal (N).
  • Figure 2 shows the results of analyzing the relationship between the expression level of ID2 according to the grade of bladder cancer with the TCGA data set.
  • Figure 3 shows the results of analyzing the relationship between the expression level of ID2 according to the pT category of bladder cancer with the TCGA data set.
  • Figure 4 is a result of confirming the expression of other CDK1-TFCP2L1 pathway target genes other than ID2 in TCGA data cells of bladder cancer patients.
  • FIG. 5 shows the results of evaluating the expression levels of ID2, TFCP2L1 and CDK1 in bladder cancer cell lines 5637, HT1197, HT1376, and RT4 cell lines.
  • TFCP2L1 affects the transcription of ID2 in bladder cancer cell lines, HT1197 and HT1376 cell lines, by chromatin immunoprecipitation (ChIP) analysis.
  • FIG. 11 shows the results of evaluating the effect of the expression of TFCP2L1 and ID2 on invasive capacity in bladder cancer cell lines.
  • 16 is a result of evaluating the effect of apigenin, an ID2 activator, on tumorsphere formation ability and invasiveness in bladder cancer cell lines.
  • FIG. 17 shows administration of apigenin and RO-3306 to an orthotopic xenograft animal model in which bladder cancer was induced to evaluate the effect of administration of apigenin, an ID2 activator, and RO-3306, a CDK1 inhibitor, on bladder cancer.
  • apigenin an ID2 activator
  • RO-3306 a CDK1 inhibitor
  • 19 is a histological examination result of evaluation of tumor grade change according to administration of apigenin in a bladder cancer animal model.
  • 21 is a result of evaluating the effect of 4-hydroxychalcone, an ID2 activator, on bladder cancer cell lines.
  • the red box is Tumor (T)
  • the gray box is Normal (N).
  • 25 shows the results of evaluating the relevance of CDK1 and ID2 expression according to the pT category of bladder cancer.
  • 26 is a result of evaluating the effect on ID2 expression according to the treatment of apigenin and RO-3306 in bladder cancer cell lines.
  • 29 is a result of evaluating changes in tumor size according to administration of apigenin and RO-3306 in an orthotopic xenograft animal model in which bladder cancer was induced.
  • FIG. 30 is a histological examination result of evaluating changes in tumor grade according to administration of apigenin and RO-3306 in an orthotopic xenograft animal model in which bladder cancer was induced.
  • 31 is a result of evaluating the effect of administration of apigenin and RO-3306 on ID2, CDK1, and TFCP2L1 protein expression in an orthotopic xenograft animal model in which bladder cancer was induced.
  • the present invention relates to a CDK inhibitor or a pharmaceutically acceptable salt thereof; And it provides a pharmaceutical composition for preventing or treating bladder cancer comprising an ID2 activator or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the CDK inhibitors include RO-3306, CGP74514A, BEY-11707, ON-01500, R547, Sodium oxamate, Dinaciclib, BMS-265246, AZD5438, SU9516, Riviciclib hydrochloride, P276-00), AT7519, NU6027, etc., but is not limited thereto.
  • the ID2 activator is apigenin, isoliquiritigenin, 4-hydroxychalcone, diosmetin, biochanin A, luteolin and the like, but is not limited thereto.
  • the pharmaceutically acceptable salt refers to an acid addition salt formed by a pharmaceutically acceptable free acid
  • the pharmaceutically acceptable salt refers to a salt commonly used in the pharmaceutical industry, for example
  • an inorganic ion salt made of calcium, potassium, sodium or magnesium
  • an inorganic acid salt made of hydrochloric acid, nitric acid, phosphoric acid, hydrobromic acid, iodic acid, perchloric acid or sulfuric acid
  • the pharmaceutical composition of the present invention is prepared in unit dosage form or multi-dose by formulating using a pharmaceutically acceptable carrier according to a method that can be easily performed by those skilled in the art. It can be prepared by incorporating into a container.
  • the pharmaceutically acceptable carrier is one commonly used in formulation, and includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components.
  • the content of the additives included in the pharmaceutical composition is not particularly limited and may be appropriately adjusted within the range of content used in conventional formulations.
  • the pharmaceutical composition may be formulated as an aqueous solution, suspension, emulsion, etc. for injection, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, pasta agents, and cataplasma agents. It may be formulated in the form of one or more external preparations selected from the group consisting of agents.
  • the pharmaceutical composition of the present invention may further contain pharmaceutically acceptable carriers and diluents for formulation.
  • pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose and hydroxypropylcellulose, gelatin, alginates, and polyvinyl fibres.
  • binders such as rolidone, etc., lubricants such as talc, calcium stearate, hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone, crospovidone, surfactants such as polysorbates, cetyl alcohol, and glycerol; don't
  • the pharmaceutically acceptable carrier and diluent may be biologically and physiologically compatible with the subject.
  • diluents include, but are not limited to, saline, aqueous buffers, solvents and/or dispersion media.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method.
  • parenterally eg, intravenous, subcutaneous, intraperitoneal or topical application
  • it may be formulated into tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups or elixirs.
  • parenteral administration it may be formulated as an injection solution, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.
  • the dosage of the pharmaceutical composition of the present invention depends on the condition and weight of the patient, age, sex, health condition, dietary constitution specificity, the nature of the preparation, the severity of the disease, the administration time of the composition, the administration method, the administration period or interval, and the excretion rate. , And the range may vary depending on the type of drug, and may be appropriately selected by a person skilled in the art. For example, it may be in the range of about 0.1 to 10,000 mg/kg, but is not limited thereto, and may be divided and administered once or several times a day.
  • the pharmaceutical composition may be administered orally or parenterally (eg, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method.
  • the pharmaceutically effective amount and effective dose of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time and/or administration route of the pharmaceutical composition, and those skilled in the art can use the purpose Dosages effective for treatment can be easily determined and prescribed. Administration of the pharmaceutical composition of the present invention may be administered once a day, or may be divided into several administrations.
  • the present invention is a CDK inhibitor or a pharmaceutically acceptable salt thereof; and an ID2 activator or a pharmaceutically acceptable salt thereof as an active ingredient for concomitant administration for preventing or treating bladder cancer.
  • the CDK inhibitor or a pharmaceutically acceptable salt thereof; and ID2 activator or a pharmaceutically acceptable salt thereof may be formulated and administered in a mixed form, or individually formulated and administered simultaneously or sequentially.
  • the CDK inhibitor or a pharmaceutically acceptable salt thereof; And the ID2 activator or a pharmaceutically acceptable salt thereof may be administered in a weight ratio of 1: 10 to 1: 15, and specifically, the CDK inhibitor may be administered by intraperitoneal injection at 1 mg / kg to 10 mg / kg, More specifically, the CDK inhibitor RO-3306 or CGP74514A may be administered at 4 mg/kg, the ID2 activator may be administered by intraperitoneal injection at 5 mg/kg to 150 mg/kg, and more specifically, the ID2 activator Api Apigenin, diosmetin or 4-hydroxychalcone may be administered at 50 mg/kg.
  • BC bladder cancer
  • TCGA Cancer Genome Atlas
  • MIBC muscle-invasive bladder carcinomas
  • ID2 expression was activated by treatment with 40 ⁇ M apigenin (Sigma-Aldrich, Burlington, MA, USA), 4-hydroxychalcone (Sigma-Aldrich) and diosmetin (Sigma-Aldrich) for 24 hours, and 20 ⁇ M RO-3306 (Sigma-Aldrich) -Aldrich) and CGP74514A (Sigma-Aldrich) for 24 hours to inhibit CDK1 activity.
  • apigenin Sigma-Aldrich, Burlington, MA, USA
  • 4-hydroxychalcone Sigma-Aldrich
  • diosmetin Sigma-Aldrich
  • RO-3306 Sigma-Aldrich
  • CGP74514A Sigma-Aldrich
  • the corresponding open reading frame (ORF) or specific shRNA construct was transfected into pLEX307 (Addgene, plasmid #41392) and pLenti6/Block-iT lentivrial vector (Invitrogen, Waltham, MA, USA), respectively. ) was cloned into.
  • pDONR223_ID2_WT_V5 was used as Jesse Boehm & Matthew Meyerson & David Root (Addgene plasmid # 82960).
  • Lentivirus was produced using a four plasmid transfection system (Invitrogen) and concentrated using the Lenti-X Concentrator kit (Clontech, Mountain View, CA, USA). Gene expression and functional analysis were performed on day 4 after lentivirus infection. Information on each ORF and target sequence of each shRNA is shown in Tables 1 and 2 below.
  • Oligonucleotides base sequence human TFCP2L1 GCTCTTCAACGCCATCAAAGG
  • the human TFCP2L1 ORF cloned into the pCMV_3Tag-1 vector was transfected into HT1197 and HT1376 BC cells using Lipofectamine 2000 (Invitrogen). 24 h after transfection, cell extracts (1 X 10 7 Cross-linked chromatin isolated from cells) was cut. ChIP assays were performed using the Magna ChIP G kit (Millipore, Billerica, MA, USAA).
  • Oligonucleodes Forward primer Reverse primer human TFCP2L1 GCTCTTCAACGCCATCAAA CAGGGGCACTCGATTCTG human ID2 CAGCATCCCCCAGAACAAGAA CGATCTGCAGGTCCAAGATGT
  • Oligonucleodes (qChIP) Forward primer Reverse primer human ID2_#1 CTCCGATGGGTTGCAGTGAA CGGCAGCTCTAAAATCACAGCTA human ID2_#2 TGCAGCACGTCATCGACTACAT CTGGTGATGCAGGCTGACAA
  • Cell extracts (30 ⁇ g) were prepared in RIPA lysis buffer (Santa Cruz Biotechnology) supplemented with protease and phosphatase inhibitor cocktail (Roche, Indianapolis, IN, USA) and separated on a 12% SDS-PAGE gel.
  • ID2 NBP-88630; Novusbio, Centennial, CO, USA
  • TFCP2L1 OAAB09732; Aviva Systems Biology, San Diego, CA, USA
  • CDK1 sc-54 Santa Cruz
  • PARP 9542; Cell Signaling
  • Cleaved Caspase-3 9661; Cell Signaling
  • b-ACTIN A5441; Sigma-Aldrich
  • Flag-epitope F3165; Sigma-Aldrich
  • FITC annexin-V fluorescein isothiocyanate
  • PI propidium iodide
  • Cells were harvested by trypsinization, washed with PBS, resuspended in Annexin-V binding buffer (10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl 2 ) and labeled with Annexin-V FITC and PI. did FITC- and/or PI-labeled cell populations were quantified on a flow cytometer (BeckmanCoulter, Brea, CA, USA).
  • BC cells were cultured 1:1 in serum-free keratinocyte growth medium (Gibco, Waltham, MA, USA) and growth factor-reduced Matrigel (BD Biosciences, Mountain View, CA, USA). The cells were resuspended in a single cell suspension mixed at the same ratio and cultured on Ultra Low Attachment plates (Costar, Corning, NY, USA). The size of tumor spheres was measured for 7 days after the first culture. For quantitative analysis, the circumference of tumor spheres was measured in 8 randomly selected representative regions in each group using Image J software (National Institute of Mental Health, Bethesda, MD, USA).
  • BC cells were diluted to a density of 1 cell per well and cultured in 50 ⁇ L of culture medium. Fresh medium was added every 2 days, and the plated cells were cultured for up to 10 days, and the number of colonies was counted for quantitative analysis.
  • the upper chamber of a Transwell permeable support (Corning Inc, Corning, NY, USA) with an 8.0 ⁇ m pore polycarbonate membrane filter was coated with Matrigel (BD Biosciences) diluted in a 1:5 ratio.
  • BC cells were loaded into the upper chamber at a concentration of 2 x 10 4 cells/well in 100 ⁇ L serum-free DMEM, and a culture medium containing 3% FBS was filled into the lower chamber.
  • the cell invasion ability was evaluated by counting the number of cells that migrated to the bottom of the bay after culturing the cells in a 5% CO 2 incubator at 37° C. for 24 hours. Three fields of view (magnification, X 200) were randomly selected from each Transwell chamber and quantitatively analyzed.
  • mice were purchased from GEM Biosciences Inc. (Cheongju, Korea). 100 ⁇ l of 1.0 ⁇ 10 6 HT1376 BC cells were injected into the anterior wall of the bladder and the outer layer of the dome using a 500 ⁇ m syringe and a 26-gauge needle in mice adapted for 1 week at the animal laboratory of Asan Medical Center in Seoul.
  • bladders of xenograft mice were fixed with 4% paraformaldehyde for 1 day. After cryoprotection in 30% sucrose for 24 hours, each bladder was cut into 20 ⁇ m sections using a cryostat (Leica, Lussloch, Germany) and stained with hematoxylin and eosin (H&E).
  • H&E hematoxylin and eosin
  • bladders were stained with ID2 (NBP-88630; Novusbio), TFCP2L1 (OAAB09732; Aviva Systems Biology), CDK1 (ab131450; Abcam, Cambridge, MA, USA), CD44 (ab78960; Abcam) and Cytokeratin. 14 (KRT14; Ab7800).
  • Alexa Fluor 488-conjugated (A11001 and A11008) anti-mouse and anti-rabbit antibodies or Alexa Fluor 546-conjugated anti-rabbit antibody (A11010) were used as secondary antibodies (Molecular Probes). Nuclei were counterstained with 4',6-diamino-2-phenylindole (DAPI; D9542; Sigma-Aldrich). Three representative regions per slide were randomly selected. Stained samples were photographed using an inverted fluorescence microscope (EVOS® FL Color Imaging System, Life Technologies).
  • Quantitative results were statistically analyzed using one-way or two-way ANOVA with nonparametric Mann-Whitney test or Bonferroni post hoc test. All analyzes were performed using GraphPad Prism 7.0 software (GraphPad Software, La Jolla, CA, USA) and p ⁇ 0.05 was considered statistically significant.
  • the TCGA data set of BC patients was analyzed using the GEPIA and UCSC Xena project (http://xena.ucsc.edu/) web server, according to FIG. 1 , among the ID families, the expression of ID2 was higher in bladder cancer than in normal urinary tract epithelium.
  • the expression of ID2 tended to be suppressed as the tumor grade increased.
  • the ID2 transcript showed a tendency to significantly decrease in bladder cancer patients with pT2 or higher muscle invasion observed in the pT category tumor stage showing muscle invasion of the bladder.
  • the BMP family and GATA family which are urinary epithelial differentiation genes identified together with ID2 in the CDK1-TFCP2L1 pathway, in the TCGA data set of bladder cancer patients, according to FIG. 4, the BMP family has low expression in bladder cancer
  • GATA6 in the GATA family was significantly reduced in bladder cancer, and it was confirmed that it was significantly reduced in low-grade bladder cancer.
  • ID2 and TFCP2L1 in BC cells with different molecular classification features were compared to basal-like subtypes (5637 and HT1197), luminal-like subtypes (HT1376), and mixed subtypes (T24 and UMUC3) of muscle-invasive BC (MIBC). and the RT4 cell line, which is a model of non-muscle invasive BC.
  • the levels of ID2 and TFCP2L1 transcripts show opposite trends, and their mutual expression levels were analyzed by Western blot and immunofluorescence staining analysis. It was confirmed that a trend was shown.
  • ID2 protein was hardly detected in HT1197 and HT1367 BC cell lines with the highest TFCP2L1 protein content.
  • chromatin immunoprecipitation (ChIP) assay was performed in HT1197 and HT1367 BC cells containing the Flag-tagged TFCP2L1 (Flag-TFCP2L1) protein.
  • ChIP-qPCR analysis according to FIG. 6 , it was confirmed that TFCP2L1 binds to the promoter of the ID2 locus in the BC cell line.
  • FIG. 7 as it was confirmed that the expression of ID2 is inhibited by silencing TFCP2L1, the above results demonstrate that ID2 is a direct inhibitory target of TFCP2L1 in BC cells.
  • ID2 affects the cell proliferation and stem cell properties of BC cells by the CDK1-TFCP2L1 pathway was evaluated.
  • FIG. 8 the enhancement of ID2 expression in HT1376 and HT1197 BC cells inhibited the stimulation of cell proliferation by TFCP2L1 overexpression.
  • FIG. 9 showed that the formation of tumor spheres, which was increased by overexpression of TFCP2L1, was inhibited by enhanced expression of ID2.
  • FIG. 10 negative results of ID2 for TFCP2L1-induced self-renewal activity were observed in clonogenic limiting pyroxene assay.
  • FIG. 10 negative results of ID2 for TFCP2L1-induced self-renewal activity were observed in clonogenic limiting pyroxene assay.
  • trans-well chamber analysis showed that HT1376 and HT1197 BC cells with TFCP2L1 overexpression showed higher invasive capacity than control cells, but invasive capacity was impaired when ID2 was stimulated. These results demonstrate that ID2 is a target factor that inhibits TFCP2L1 to regulate the stem cell properties and invasive capacity of BC cells.
  • BC cells were treated with apigenin, a non-toxic dietary flavonoid that activates BMP signaling and ID2 induction, to determine cell growth, degree of apoptosis, and cell invasion. Changes in function were evaluated. According to FIG. 13, it was shown that the growth of BC cells decreased significantly as the treatment dose of apigenin increased. In addition, according to FIG. 14, when BC cells were treated with an apigenin activator, caspase-3 and poly-(ADP-ribose) polymerase (PARP) were cleaved. According to FIG.
  • apigenin a non-toxic dietary flavonoid that activates BMP signaling and ID2 induction
  • apigenin an ID2 activator, can be a new therapeutic agent for bladder cancer.
  • apigenin was administered to an orthotopic xenograft BC animal model in which HT1376 cells were transplanted into the outer layer of the bladder of NSG immunodeficient mice. appeared was evaluated. According to FIG. 17, apigenin was intraperitoneally injected 6 times at intervals of 4 days to the animal model. According to FIG. 18, tumor growth was inhibited by 74 ⁇ 6.13% in the group administered with apigenin. In addition, according to FIG. 19, it was confirmed that apigenin has a bladder cancer treatment effect regardless of the grade of the tumor in the histological examination. The above results demonstrate that apigenin, an ID2 activator, exhibits an antitumor effect alone in bladder cancer.
  • apigenin mediates anticancer activity not only through ID2 but also through several signaling pathways, to confirm once again that these results are the result of ID2 activity, diosmetin (a substance that activates the expression of another ID2 protein) Diosmetin) or 4-hydroxychalcone was used to confirm whether similar results to those of apigenin were obtained.
  • diosmetin a substance that activates the expression of another ID2 protein
  • 4-hydroxychalcone 4-hydroxychalcone
  • ID2 activators including apigenin have anticancer effects on bladder cancer.
  • CDK1 a top activator of TFCP2L1
  • ID2 the expression of CDK1 was higher in bladder cancer than in normal urinary tract epithelial tissue.
  • FIG. 23 consistent with ID2 expression, the higher the level of the CDK1 transcript, the higher the tumor grade of bladder cancer, the higher the CDK1 expression.
  • FIG. 24 high levels of CDK1 were associated with reduced ID2 expression in two independent TCGA cohorts.
  • inverse expression on CDK1 and ID2 appeared to be associated with pT category tumor stage.
  • ID2 expression was confirmed again using another CDK1 inhibitor (CGP74514A) that inhibits CDK1 expression.
  • CGP74514A CDK1 inhibitor that inhibits CDK1 expression.
  • FIG. 27 an increase in ID2 expression was confirmed in other CDK1 inhibitors (CGP74514A) and other ID2 activators (4-hydroxychalcone), similar to the results of RO-3306.

Landscapes

  • Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 CDK 억제제 및 ID2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물에 관한 것으로, 방광암 세포에서 요로상피 분화와 관련된 CDK1-TFCP2L1 경로 표적 중에서 ID2가 방광암의 종양 등급과 유의미한 관계가 있는 인자임을 확인하고, ID2 활성화제가 방광암의 치료 효과를 나타내는 것을 확인하고, CDK1 억제제와 ID2 활성화제를 병용 투여하는 경우 각각 단독 투여하는 경우에 비해 방광암의 세포자살을 유도하고 암세포의 침윤능이 현저히 억제되는 것을 확인하여 방광암의 크기 및 진행이 현저하게 억제되는 치료 효과가 나타나는 것을 확인함으로써, CDK 억제제 및 ID2 활성화제를 포함하는 조성물 및 병용투여 방법은 방광암의 예방 또는 치료를 위한 새로운 치료 수단으로 제공으로 제공된다.

Description

CDK 억제제 및 ID2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물
본 발명은 CDK 억제제 및 ID2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물에 관한 것이다.
방광암(bladder cancer, BC)은 전 세계적으로 10번째로 흔한 암이며, 2020년에는 약 573,278명의 새로운 방광암 환자가 발생하고, 212,536명 이상의 환자가 사망할 정도로 발병률 및 사망률이 높은 질환이다. 방광암은 높은 비율로 체세포 돌연변이를 특징으로 하며, 임상 및 병리학적 이질성을 나타낸다.
방광암은 침윤정도에 따라 크게 비침윤성(non-muscle invasive) 방광암과 침윤성(invasive) 방광암으로 구분된다. 비침윤성 방광암은 암이 근육층의 침범 없이 점막에 국한된 병변으로써 경요도 방광절제술(transurethral resection of bladder tumor) 시행 후 위험 인자 유무에 따라 방광내 항암제 또는 BCG를 주입함으로써 비교적 간단하게 치료가 가능하나, 암의 재발과 침윤성 암으로의 진행이 문제가 된다. 한편, 침윤성 방광암은 암이 근육층까지 침투한 상태를 말하는 것으로서, 이의 치료를 위하여는 근치적 방광적출술과 함께 복잡한 요로전환(urinary diversion)을 수행하여야 할 뿐 아니라, 환자에게 치명적인 결과를 초래할 수도 있다. 따라서, 일차치료 후 재발과 진행에 대한 예측과 조기발견 및 예방이 매우 중요하다.
방광암의 진단 및 치료를 위한 다양한 방법들이 개발되고 있음에도 불구하고, 현재까지 임상에서 사용되는 치료 방법으로는 수술, 화학요법 약물(메토트렉세이트, 빈크리스틴, 독소루비신, 시스플라틴 및 시토신) 및 생물학적 치료법(Bacillus Calmette-Guerin, 면역 및 비활성화 박테리아 용액)이 사용되고 있으나, 방광암의 재발 및 사망률이 높을 뿐만 아니라, 고비용에 심각한 부작용 및 다양한 합병증에 의해 치료 방법으로 제한되고 있는 상태이다. 따라서, 이러한 잦은 재발과 병기의 진행은 방광암에서 자주 제기되는 문제점이며 방광암의 재발 및 침윤성으로 진행되는 것을 효과적으로 예측할 수 있는 지표의 발견이나 치료법의 개발이 필요한 실정이다.
본 발명의 목적은 방광암에서 유효한 새로운 치료 표적을 발굴하기 위해 방광암에 주요 인자를 선별하고, 선별된 인자가 방광암의 치료 효과를 나타내는지 평가하여 치료 효과를 극대화할 수 있는 방광암의 예방 또는 치료 방법을 새롭게 제공하는 것이다.
본 발명은 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 방광암의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물을 제공한다.
본 발명에 따르면, 방광암 세포에서 요로상피 분화와 관련된 CDK1-TFCP2L1 경로 표적 중에서 ID2가 방광암의 종양 등급과 유의미한 관계가 있는 인자임을 확인하고, ID2 활성화제가 방광암의 치료 효과를 나타내는 것을 확인하고, CDK1 억제제와 ID2 활성화제를 병용 투여하는 경우 각각 단독 투여하는 경우에 비해 방광암의 세포자살을 유도하고 암세포의 침윤능이 현저히 억제되는 것을 확인하여 방광암의 크기 및 진행이 현저하게 억제되는 치료 효과가 나타나는 것을 확인함으로써, CDK 억제제 및 ID2 활성화제를 포함하는 조성물 및 병용투여 방법은 방광암의 예방 또는 치료를 위한 새로운 치료 수단으로 제공될 수 있다.
도 1은 방광암의 치료 표적으로 ID2의 발현 수준과 방광암에서의 관련성을 TCGA 데이터 세트로 분석한 결과이다. 빨간 박스는 Tumor(T)이고, 회색 박스는 정상(N)이다.
도 2는 방광암의 등급에 따라 ID2의 발현 수준의 관련성을 TCGA 데이터 세트로 분석한 결과이다.
도 3은 방광암의 pT 범주에 따라 ID2의 발현 수준의 관련성을 TCGA 데이터 세트로 분석한 결과이다.
도 4은 방광암 환자의 TCGA 데이터 세포에서 ID2 외의 다른 CDK1-TFCP2L1 경로 표적 유전자에 대한 발현을 확인한 결과이다.
도 5는 방광암 세포주인 5637, HT1197, HT1376, 및 RT4 세포주에서 ID2, TFCP2L1 및 CDK1의 발현 수준을 평가한 결과이다.
도 6는 방광암 세포주인 HT1197 및 HT1376 세포주에서 TFCP2L1이 ID2의 전사에 영향을 주는지 염색질 면역 침전(ChIP) 분석으로 평가한 결과이다.
도 7은 방광암 세포주인 HT1197 및 HT1376 세포주에서 TFCP2L1의 결실이 ID2의 발현에 미치는 영향을 평가한 결과이다.
도 8은 TFCP2L1 및 ID2의 발현이 방광암 세포주에서 세포 증식에 미치는 영향을 평가한 결과이다.
도 9은 TFCP2L1 및 ID2의 발현이 방광암 세포주에서 종양구 형성에 미치는 영향을 평가한 결과이다.
도 10는 TFCP2L1 및 ID2의 발현이 방광암 세포주에서 클론 생성에 미치는 영향을 평가한 결과이다.
도 11은 TFCP2L1 및 ID2의 발현이 방광암 세포주에서 침윤능에 미치는 영향을 평가한 결과이다.
도 12은 ID2의 발현 양상이 다른 두 그룹의 방광암 세포에서 ID2의 발현 값 변화에 따른 방광암의 성장과 기능 변화를 확인한 결과이다.
도 13은 ID2 활성화제인 아피제닌(apigenin)이 방광암 세포주에서 세포 성장에 미치는 영향을 평가한 결과이다.
도 14는 ID2 활성화제인 아피제닌(apigenin)이 방광암 세포주에서 카스파제-3 및 폴리-(ADP-리보스) 폴리머라제(PARP)에 미치는 영향을 평가한 결과이다.
도 15은 ID2 활성화제인 아피제닌(apigenin)이 방광암 세포주에서 세포자살 활성화에 미치는 영향을 평가한 결과이다.
도 16는 ID2 활성화제인 아피제닌(apigenin)이 방광암 세포주에서 종양구 형성 능력 및 침윤능에 미치는 영향을 평가한 결과이다.
도 17는 ID2 활성화제인 아피제닌(apigenin) 및 CDK1 억제제인 RO-3306의 투여가 방광암에 미치는 영향을 평가하기 위해 방광암이 유도된 동소 이종이식 동물모델에 아피제닌(apigenin) 및 RO-3306의 투여 방법을 나타내는 그림이다.
도 18은 방광암 동물 모델에서 아피제닌(apigenin) 투여에 따른 종양의 크기 변화를 평가한 결과이다.
도 19은 방광암 동물 모델에서 아피제닌(apigenin) 투여에 따른 종양의 등급 변화를 평가한 조직학 검사 결과이다.
도 20는 ID2 활성화제인 디오스메틴(diosmetin)이 방광암 세포주에서 미치는 영향을 평가한 결과이다.
도 21은 ID2 활성화제인 4-하이드록시칼콘(4-hydroxychalcone)이 방광암 세포주에서 미치는 영향을 평가한 결과이다.
도 22은 방광암의 치료 표적으로 CDK1의 발현 수준과 방광암에서의 관련성을 TCGA 데이터 세트로 분석한 결과이다. 빨간 박스는 Tumor(T)이고, 회색 박스는 정상(N)이다.
도 23는 방광암의 등급에 따라 CDK1의 발현 수준의 관련성을 TCGA 데이터 세트로 분석한 결과이다.
도 24은 CDK1 및 ID2 발현의 관련성을 TCGA 데이터 세트로 분석한 결과이다.
도 25은 방광암의 pT 범주에 따라 CDK1 및 ID2 발현의 관련성을 평가한 결과이다.
도 26는 방광암 세포주에서 아피제닌(apigenin) 및 RO-3306의 처리에 따른 ID2 발현에 미치는 영향을 평가한 결과이다.
도 27는 방광암 세포주에서 CGP74514A 및 4-하이드록시칼콘(4-hydroxychalcone) 처리에 따른 ID2의 발현을 확인한 결과이다.
도 28은 방광암 세포주에서 아피제닌(apigenin) 및 RO-3306의 처리에 따른 방광암 세포의 성장과 세포 사멸에 미치는 영향을 평가한 결과이다.
도 29는 방광암이 유도된 동소 이종이식 동물모델에서 아피제닌(apigenin) 및 RO-3306의 투여에 따른 종양의 크기 변화를 평가한 결과이다.
도 30는 방광암이 유도된 동소 이종이식 동물모델에서 아피제닌(apigenin) 및 RO-3306의 투여에 따른 종양의 등급 변화를 평가한 조직학 검사 결과이다.
도 31은 방광암이 유도된 동소 이종이식 동물모델에서 아피제닌(apigenin) 및 RO-3306의 투여에 따른 ID2, CDK1 및 TFCP2L1 단백질 발현에 미치는 영향을 평가한 결과이다.
본 명세서에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다. 또한, 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명 부분에서 상세히 그 의미를 기재할 것이다. 따라서 본 발명에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 발명의 전반에 걸친 내용을 토대로 정의되어야 한다.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.
수치 범위는 상기 범위에 정의된 수치를 포함한다. 본 명세서에 걸쳐 주어진 모든 최대의 수치 제한은 낮은 수치 제한이 명확히 쓰여 있는 것처럼 모든 더 낮은 수치 제한을 포함한다. 본 명세서에 걸쳐 주어진 모든 최소의 수치 제한은 더 높은 수치 제한이 명확히 쓰여 있는 것처럼 모든 더 높은 수치 제한을 포함한다. 본 명세서에 걸쳐 주어진 모든 수치 제한은 더 좁은 수치 제한이 명확히 쓰여 있는 것처럼, 더 넓은 수치 범위 내의 더 좋은 모든 수치 범위를 포함할 것이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명은 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 방광암의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 CDK 억제제는 RO-3306, CGP74514A, BEY-11707, ON-01500, R547, 옥사메이트 나트륨 (Sodium oxamate), 디나시클립(Dinaciclib), BMS-265246, AZD5438, SU9516, 리비시클립 염산염(Riviciclib hydrochloride, P276-00), AT7519, NU6027 등 일 수 있으나, 이에 제한되는 것은 아니다.
상기 ID2 활성화제는 아피제닌(apigenin), 이소리퀴리티제닌 (isoliquiritigenin), 4-하이드록시칼콘(4-hydroxychalcone), 디오스메틴(diosmetin), 비오카닌 A(biochanin A), 루테올린(luteolin) 등이 일 수 있으나, 이에 제한되는 것은 아니다.
상기 약학적으로 허용 가능한 염은 약학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염을 의미하고, 약학적으로 허용 가능한 염은 의약업계에서 통상적으로 사용되는 염을 의미하며, 예를 들어 칼슘, 포타슘, 소듐 또는 마그네슘 등으로 제조된 무기이온염, 염산, 질산, 인산, 브롬산, 요오드산, 과염소산 또는 황산 등으로 제조된 무기산염; 아세트산, 트라이플루오로아세트산, 시트르산, 말레산, 숙신산, 옥살산, 벤조산, 타르타르산, 푸마르산, 만델산, 프로피온산, 젖산, 글리콜산, 글루콘산, 갈락투론산, 글루탐산, 글루타르산, 글루쿠론산, 아스파르트산, 아스코르브산, 카본산 또는, 바닐릭산 등으로 제조된 유기산염; 메탄설폰산, 에탄설폰산, 벤젠설폰산, p-톨루엔설폰산 또는 나프탈렌설폰산 등으로 제조된 설폰산염; 글리신, 아르기닌, 라이신 등으로 제조된 아미노산염; 또는 트라이메틸아민, 트라이에틸아민, 암모니아, 피리딘, 피콜린 등으로 제조된 아민염 등이 있으나, 열거된 이들 염에 의해 본 발명에서 의미하는 염의 종류가 한정되는 것은 아니다.
본 발명의 약학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸 히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명에 있어서, 상기 약학적 조성물에 포함되는 첨가제의 함량은 특별히 한정되는 것은 아니며 통상의 제제화에 사용되는 함량 범위 내에서 적절하게 조절될 수 있다.
상기 약학적 조성물은 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립, 정제, 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제로 이루어진 군으로부터 선택되는 하나 이상의 외용제 형태로 제형화될 수 있다.
본 발명의 약학적 조성물은 제형화를 위해 추가로 있는 약학적으로 허용가능한 담체 및 희석제를 포함할 수 있다. 상기 약학적으로 허용가능한 담체 및 희석제는 전분, 당, 및 만니톨과 같은 부형제, 칼슘 포스페이트 등과 같은 충전제 및 증량제, 카르복시메틸셀룰로오스, 히드록시프로필셀룰로오스 등과 같은 셀룰로오스 유도체, 젤라틴, 알긴산염, 및 폴리비닐 피롤리돈 등과 같은 결합제, 활석, 스테아린산 칼슘, 수소화 피마자유 및 폴리에틸렌 글리콜과 같은 윤활제, 포비돈, 크로스포비돈과 같은 붕해제, 폴리소르베이트, 세틸알코올, 및 글리세롤 등과 같은 계면활성제를 포함하나, 이에 한정되지 않는다. 상기 약학적으로 허용가능한 담체 및 희석제는 대상체에게 생물학적 및 생리학적으로 친화적인 것일 수 있다. 희석제의 예로는 염수, 수용성 완충액, 용매 및/또는 분산제(dispersion media)를 들 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있다. 경구 투여일 경우, 정제, 트로키제 (troches), 로젠지 (lozenge), 수용성 현탁액, 유성 현탁액, 조제 분말, 과립, 에멀젼, 하드 캡슐, 소프트 캡슐, 시럽 또는 엘릭시르제 등으로 제형화될 수 있다. 비경구 투여일 경우, 주사액, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 연고, 도포용 파우더, 오일, 크림 등으로 제형화 될 수 있다.
본 발명의 약학적 조성물의 투여량은 환자의 상태 및 체중, 연령, 성별, 건강상태, 식이 체질 특이성, 제제의 성질, 질병의 정도, 조성물의 투여시간, 투여방법, 투여기간 또는 간격, 배설율, 및 약물 형태에 따라 그 범위가 다양할 수 있으며, 이 분야 통상의 기술자에 의해 적절하게 선택될 수 있다. 예컨대, 약 0.1 내지 10,000 mg/kg의 범위일 수 있으나 이제 제한되지 않으며, 하루 일회 내지 수회에 나누어 투여될 수 있다.
상기 약학적 조성물은 목적하는 방법에 따라 경구 투여되거나 비경구 투여(예를 들면, 정맥 내, 피하 내, 복강 내 또는 국소에 적용)될 수 있다. 본 발명의 약학적 조성물의 약학적 유효량, 유효 투여량은 약학적 조성물의 제제화 방법, 투여 방식, 투여 시간 및/또는 투여 경로 등에 의해 다양해질 수 있으며, 당해 기술 분야에서 통상의 지식을 가진 자는 목적하는 치료에 효과적인 투여량을 용이하게 결정하고 처방할 수 있다. 본 발명의 약학적 조성물의 투여는 하루에 1회 투여될 수 있고, 수회에 나누어 투여될 수도 있다.
또한, 본 발명은 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물을 제공한다.
상기 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염은 혼합된 형태로 제제화되어 투여되거나, 각각 제제화되어 동시적 또는 순차적으로 투여될 수 있다.
상기 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염의 중량비는 1 : 10 내지 1 : 15로 투여될 수 있으며, 구체적으로 CDK 억제제는 1 mg/kg 내지 10 mg/kg으로 복강 내 주사 투여될 수 있고, 보다 구체적으로 CDK 억제제인 RO-3306 또는 CGP74514A는 4 mg/kg으로 투여될 수 있으며, ID2 활성화제는 5 mg/kg 내지 150 mg/kg으로 복강 내 주사 투여될 수 있고 보다 구체적으로 ID2 활성화제인 아피제닌(apigenin), 디오스메틴(diosmetin) 또는 4-하이드록시칼콘(4-hydroxychalcone) 은 50 mg/kg으로 투여될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실험예 및 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실험예 및 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실험예 및 실시예에 한정되는 것은 아니다. 본 발명의 실험예 및 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
<실험예> 실험 재료 및 방법
하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.
1. 방광암(BC) 환자에 대한 임상 코호트 분석
The Cancer Genome Atlas(TCGA; https://cancergenome.nih.gov)에서 방광암(bladder cancer, BC) 환자에 대한 2개의 독립적인 임상 코호트를 사용하였다. 첫 번째 코호트는 131명의 고위험 근육 침윤성 방광암(muscle-invasive bladder carcinomas, MIBC) 환자에 관한 것이고, 두 번째는 412명의 MIBC 환자에 대한 다중 플랫폼 분석에 관한 것이다. 생존율, 종양 단계 및 등급을 포함한 임상 병릭학적 특징, 유전자 발현 데이터 세트는 UCSC Xenia 프로젝트 (http://xena.ucsc.edu/)에서 얻었다. Gene Expression Profiling Interactive Analysis(GEPIA; http://gepia.cancerpku.cn/index.html)를 사용하여 종양/비종양 차등 발현 및 쌍별 상관 유전자 발현 결과를 분석하였고, 이는 TCGA 및 Genotype Tissue Expression(GTEx; https://www.gtexportal.org/) 데이터 세트를 기반으로 빠르고 사용자 정의 가능한 기능을 제공하는 대화형 웹 기반 도구이다. BC 환자에 대한 두 번째 TCGA 연구에서 Prism 7.0을 사용하여 ID 계열 유전자의 높은(빨간색) 및 낮은(검은색) 발현 수준을 기반으로 한 Kaplan-Meier 생존 분석을 수행하였다. 이 TCGA 코호트의 유전자 발현 데이터세트를 종양 단계 및 등급에 기반한 차등 또는 짝 유전자 발현 분석에 사용하였다.
2. 세포 배양
인간 BC 세포주 T24, 5637, HT1197, HT1376 및 RT4는 10% 열-비활성화 FBS(Hyclone, Pittsburgh, PA, USA) 및 페니실린/스트렙토마이신(Cellgro, Pittsburgh, PA, USA)을 함유하는 Eagle's Minimum Essential(HT1197 및 HT1376용), McCoy's 5a Medium Modified(T24 및 RT4용) 및 RPMI-1640(ATCC37용) 배지(ATCC, Manassas, VA, USA)에서 배양되었다. 40 μM의 Apigenin(Sigma-Aldrich, Burlington, MA, USA), 4-hydroxychalcone(Sigma-Aldrich)과 diosmetin(Sigma-Aldrich)을 24시간 동안 처리하여 ID2 발현을 활성화시켰고, 20 μM RO-3306(Sigma-Aldrich)와 CGP74514A(Sigma-Aldrich)를 24시간 동안 처리하여 CDK1의 활성을 억제시켰다.
3. 이소성 발현 및 유전자 침묵
타겟 유전자의 이소성 발현 또는 침묵을 유도하기 위해, 상응하는 ORF(open reading frame) 또는 특정 shRNA construct를 각각 pLEX307 (Addgene, plasmid #41392) 및 pLenti6/Block-iT lentivrial vector (Invitrogen, Waltham, MA, USA)에 클로닝 하였다. 인간 ID2 ORF의 경우, pDONR223_ID2_WT_V5는 Jesse Boehm & Matthew Meyerson & David Root (Addgene plasmid # 82960)로 사용하였다. 렌티바이러스(Lentivirus)는 4개의 플라스미드 형질감염 시스템(Invitrogen)을 사용하여 생산하고, Lenti-X Concentrator kit (Clontech, Mountain View, CA, USA)를 사용하여 농축하였다. 렌티 바이러스 감염 후 4일 째에 유전자 발현 및 기능적 분석을 수행하였다. 각 shRNA의 각 ORF 및 표적 서열의 정보는 하기 표 1 및 2와 같다.
ORF constructs Source Identifier
pBluescriptR_human TFCP2L1 Dharmacon MHS6278-202806269
pDONR223 human ID2 Addgene 82960
Oligonucleotides (shRNA) 염기서열
human TFCP2L1 GCTCTTCAACGCCATCAAAGG
4. 염색질 면역 침전(ChIP) 분석 및 유전자 발현 분석
pCMV_3Tag-1 vector (Agilent Technologies, Santa Clara CA, USA)에 클로닝된 인간 TFCP2L1 ORF을 Lipofectamine 2000(Invitrogen)을 사용하여 HT1197 및 HT1376 BC 세포를 형질감염하였다. 형질감염 24 시간 후, 표준 설정(얼음에서 30초 휴식 간격이 있는 4번의 20초 펄스 조건)으로 Bioruptor Plus sonication device (Diagenode Inc., Denville, NJ, USA)을 사용하여 세포 추출물(1 X 107 세포)에서 분리된 가교 염색질을 절단하였다. ChIP 분석은 Magna ChIP G 키트(Millipore, Billerica, MA, USAA)를 사용하여 수행되었다.
실시간 정량 PCR(Real-time quantification PCR)를 사용하여 유전자 발현의 정량 분석을 수행하였다. QIAGEN RNeasy RNA 분리 키트(QIAGEN, Valencia, CA, USA)를 사용하여 총 RNA를 추출하고, Taqman Reverse Transcription Reagents(Applied Biosystems, Foster City, CA, USA)를 사용하여 50 ng 총 RNA를 역전사하였다. 역치 주기(Ct)는 2-DDCt 방법을 사용하여 표적 유전자의 상대 발현 수준을 결정하는 데 사용되었다. GAPDH의 발현을 내인성 대조군 유전자로 사용되었다. ChIP 및 유전자 발현 분석에 사용된 프라이머는 하기 표 3 및 4와 같다.
Oligonucleodes (qPCR) Forward primer Reverse primer
human TFCP2L1 GCTCTTCAACGCCATCAAA CAGGGGCACTCGATTCTG
human ID2 CAGCATCCCCCAGAACAAGAA CGATCTGCAGGTCCAAGATGT
Oligonucleodes (qChIP) Forward primer Reverse primer
human ID2_#1 CTCCGATGGGTTGCAGTGAA CGGCAGCTCTAAAATCACAGCTA
human ID2_#2 TGCAGCACGTCATCGACTACAT CTGGTGATGCAGGCTGACAA
5. 웨스턴 블롯 분석
세포 추출물(30 μg)을 프로테아제 및 포스파타제 억제제 칵테일(Roche, Indianapolis, IN, USA)이 보충된 RIPA 용해 완충액(Santa Cruz Biotechnology)으로 제조하고, 12% SDS-PAGE 겔에서 분리하였다. 표시된 단백질의 발현 수준은 다음 항체로 프로빙하여 평가하였다: ID2(NBP-88630; Novusbio, Centennial, CO, USA), TFCP2L1(OAAB09732; Aviva Systems Biology, San Diego, CA, USA), CDK1(sc-54; Santa Cruz), PARP(9542; Cell Signaling), Cleaved Caspase-3(9661; Cell Signaling), b-ACTIN(A5441; Sigma-Aldrich) 및 Flag-epitope (F3165; Sigma-Aldrich).
6. 면역 세포 화학(Immunocytochemistry) 분석
면역세포화학을 위해, 4% 파라포름알데히드(Sigma-Aldrich)로 고정된 인간 BC 세포를 ID2(NBP-88630; Novusbio) 또는 TFCP2L1(OAAB09732; Aviva Systems Biology)에 특이적인 항체로 염색하고, Alexa 488-접합된 항-토끼 항체(A11008, Molecular Probes, Grand Island, NY, USA)를 사용하여 시각화 하였다. 염색된 샘플은 도립 형광 현미경(EVOS® FL Color Imaging System, Life Technologies, Carlsbad, CA, USA)을 사용하여 사진 찍었다.
7. 세포 증식 및 세포자살(apoptosis) 분석
세포 증식 능력은 MTT 분석(Sigma-Aldrich)에 의해 결정되었다. 세포자살(Apoptotic)은 annexin-V fluorescein isothiocyanate (FITC) /propidium iodide (PI) 분석에 의해 분석되었다. 세포를 트립신화하여 수확하고, PBS로 세척한 후, 아넥신-V 결합 완충액(10 mM HEPES, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2)에 재현탁하여 아넥신-V FITC 및 PI로 표지하였다. FITC- 및/또는 PI-표지된 세포 집단을 유세포 분석기(BeckmanCoulter, Brea, CA, USA)에서 정량화 하였다.
8. 종양구(Tumor sphere) 형성 및 제한 희석(limiting dilution) 분석
종양구(tumor sphere)를 형성하기 위해, BC 세포를 무혈청 각질형성세포 성장 배지(Gibco, Waltham, MA, USA)와 성장 인자 감소 Matrigel(BD Biosciences, Mountain View, CA, USA)을 1:1 비율로 혼합한 단일 세포 현탁액에 재현탁하고, Ultra Low Attachment plates (Costar, Corning, NY, USA)에 배양하였다. 종양구의 크기는 첫 배양 후 7일 동안 측정되었다. 정량 분석을 위해, Image J software (National Institute of Mental Health, Bethesda, MD, USA)를 사용하여 각 그룹에서 무작위로 선택된 8개의 대표 영역에서 종양구의 둘레를 측정하였다.
제한 희석 분석을 위해 BC 세포를 웰당 1개 세포 밀도로 희석하고, 50 μL의 배양 배지에서 배양하였다. 2일 마다 새로운 배지를 첨가하여 도말한 세포를 10일까지 배양하고, 정량 분석을 위해 콜로니 수를 계산하였다.
9. in vitro 세포 침윤능 분석
8.0 μm 기공 폴리카보네이트 막 필터가 있는 Transwell 투과성 지지체(Corning Inc, Corning, NY, USA)의 상부 챔버를 1:5 비율로 희석된 Matrigel(BD Biosciences)로 코팅하였다. 100 μL 무혈청 DMEM에서 BC 세포를 2 x 104 세포/웰 농도로 상부 챔버에 로딩하고, 3% FBS를 함유하는 배양 배지를 하부 챔버에 채웠다. 세포 침윤능은 세포를 5% CO2 배양기에서 37℃에서 24 시간 동안 배양한 후, 만의 아래쪽으로 이동한 세포의 수를 계수하여 평가하였다. 각 Transwell 챔버에서 무작위로 3개의 시야(배율, X 200)를 선택하여 정량 분석하였다.
10. BC 세포의 동소 이식(Orthotopic implantation)(이종이식 xenograft)
본 실험에 수행된 모든 동물 실험은 울산대학교 의과대학 기관동물 관리위원회(IACUC-2020-12-209)의 승인을 받고 수행되었다. 8 주령 수컷 NOD/ShiLtJ-Prkdcem1AMCIl2rgem1AMC (NSGA) 마우스는 GEM Biosciences Inc.(한국 청주)에서 구입하였다. 서울 아산병원 동물실험실에서 1주일 동안 적응된 마우스에 500 μm 주사기와 26 게이지 바늘을 사용하여 방광의 전벽과 돔의 외층에 1.0 × 106 HT1376 BC 세포를 100 μl 만큼 주사하였다. BC 세포의 동소 이식 3주 후부터 마우스에 RO-3306(4 mg/kg) 및 아피제닌(apigenin)(50 mg/kg)의 단독 또는 조합을 4일 간격으로 6회 동안 복강내 주사하였다. BC 세포의 초기 투여 후 45일 동안 2일 마다 마우스 및 주사 부위를 모니터링 하였다. 종점에서 종양 크기를 측정하고, 조직학적 검사 또는 면역형광 염색 분석을 수행하기 위해 종양 부위를 절개하여 회수하였다. 마우스를 무작위로 처리군에 배정하고(N=5 또는 10), 세포 이식, 처리, 평가 및 일일 검사의 순서를 무작위로 지정하였다. 종양 크기 측정 및 조직학적 평가와 관련된 조사는 치료 그룹에 대한 블라인드 테스트로 진행되었다.
11. 조직학적 검사
조직학적 분석을 위해, 이종이식 마우스의 방광을 1일 동안 4% 파라포름알데하이드로 고정하였다. 30% 자당에서 24 시간 동안 동결 보호한 후, 각 방광을 cryostat(Leica, Lussloch, Germany)를 사용하여 20 μm 절편으로 절단하고, hematoxylin and eosin (H&E)으로 염색하였다. 면역형광(IF) 염색을 위해, 방광을 ID2(NBP-88630; Novusbio), TFCP2L1(OAAB09732; Aviva Systems Biology), CDK1(ab131450; Abcam, Cambridge, MA, USA), CD44(ab78960; Abcam) 및 Cytokeratin 14(KRT14; Ab7800)에 특이적인 항체로 염색하였다. Alexa Fluor 488-conjugated(A11001 및 A11008) 항-마우스 및 항-토끼 항체 또는 Alexa Fluor 546-conjugated 항-토끼 항체(A11010)를 이차 항체(Molecular Probes)로 사용하였다. 핵은 4',6-디아미노-2-페닐인돌(DAPI; D9542; Sigma-Aldrich)로 대조염색 하였다. 슬라이드당 3개의 대표적인 영역을 무작위로 선택하였다. 염색된 샘플은 도립 형광 현미경(EVOS® FL Color Imaging System, Life Technologies)을 사용하여 사진 촬영하였다.
12. 통계
정량적 결과는 비모수 Mann-Whitney 테스트 또는 Bonferroni 사후 테스트와 함께 일원 또는 양방향 ANOVA를 사용하여 통계적으로 분석되었다. 모든 분석은 GraphPad Prism 7.0 소프트웨어(GraphPad Software, La Jolla, CA, USA)를 사용하여 수행되었으며 p<0.05는 통계적으로 유의한 것으로 간주되었다.
실시예 1. 방광암(BC) 세포에서 치료 표적 선별
TFCP2L1의 침묵 또는 Thr177 인산화 null 돌연변이를 포함하는 TFCP2L1의 이소성 발현이 요로상피 분화(urothelial differentiation)를 자극하는 BMP, GATA 및 ID 패밀리를 포함하는 분화 유전자의 발현을 유도하는 것이 보고된 바 있다. 또한, 저용량 FK506에 의한 BMP 경로의 약리학적 활성화는 초기 진단시 비침윤성 요로상피암을 나타내는 환자의 70-80%에서 진행을 억제하는 데에 효과적인 것으로 보고되었다. 상기의 보고를 통해 방광암(BC)에서 ID 유전자가 임상적으로 중요한 인자일 가능성이 제시되고 있다.
ID 패밀리들 중에서 방광암의 주요 인자를 발굴하기 위해, GEPIA 및 UCSC Xena 프로젝트(http://xena.ucsc.edu/) 웹 서버를 사용하여 BC 환자의 TCGA 데이터 세트를 분석한 결과, 도 1에 따르면, ID 패밀리들 중에서 ID2의 발현이 정상 요로상피보다 방광암에서 높은 것으로 나타났다. 또한, TCGA 데이터 세트의 BC 환자에 대해서 ID2의 발현 수준에 따른 종양 등급을 비교한 결과, 도 2에 따르면, 종양 등급이 높을 수록 ID2의 발현이 억제되는 경향을 나타냈다. 특히, 도 3에 따르면, ID2 전사체는 방광의 근육 침범을 나타내는 pT 범주 종양 병기에서 근육 침범이 관찰되는 pT2 이상의 방광암 환자에서 유의하게 감소하는 경향을 나타냈다.
또한, CDK1-TFCP2L1 경로에서 ID2와 함께 확인된 요로상피 분화 유전자인 BMP family와 GATA family의 발현을 방광암 환자의 TCGA 데이터 세트에서 분석한 결과, 도 4에 따르면, BMP family는 방광암에서 발현이 낮게 떨어지는 반면, 방광암 등급에 따라 High-Low로 비교했을 때 유의적인 차이를 보이지 않은 반면, GATA family에서는 GATA6만 방광암에서 유의성 있게 발현이 감소되게 나오고, low 등급의 방광암에서 유의성 있게 감소되어 있는 것을 확인하였다. 상기 결과를 통해 CDK1-TFCP2L1 경로에서 확인된 요로상피 분화 유전자 중 방광의 암세포와 정상세포가 유의성 있게 유전자 발현 차이를 보이고, 고 위험성 등급에서 발현이 낮게 나타난 ID2가 주요인자라는 것을 입증한다.
실시예 2. 방광암(BC) 세포에서 치료 타겟으로서 ID2 평가
다른 분자 분류 기능을 가진 BC 세포에서 ID2 및 TFCP2L1의 내인성 발현 수준을 근육 침윤성 BC(MIBC)의 기저 유사 하위 유형(5637 및 HT1197), 관강 유사 하위 유형(HT1376), 혼합 하위 유형(T24 및 UMUC3) 및 비근육 침윤성 BC의 모델인 RT4 세포주를 포함한 다양한 분자 분류 특징과 비교하였다. 대부분의 BC 세포주에서 ID2 및 TFCP2L1 전사체의 수준은 상반되는 경향을 나타내고, 이들의 상호 발현 수준을 웨스턴 블롯 및 면역형광 염색 분석으로 분석한 결과, 도 5에 따르면, 단백질 수준에서 눈에 띄게 상반되는 경향을 나타내는 것을 확인하였다. 특히, ID2 단백질은 TFCP2L1 단백질 함량이 가장 높은 HT1197 및 HT1367 BC 세포주에서 거의 검출되지 않았다.
TFCP2L1이 ID2의 전사를 직접 억제하는지 확인하기 위해, Flag-tagged TFCP2L1(Flag-TFCP2L1) 단백질을 포함하는 HT1197 및 HT1367 BC 세포에서 염색질 면역 침전(ChIP) 분석을 수행하였다. ChIP-qPCR 분석 결과, 도 6에 따르면, BC 세포주에서 TFCP2L1이 ID2 유전자좌의 프로모터에 결합하는 것이 확인되었다. 또한, 도 7에 따르면, ID2의 발현이 TFCP2L1의 침묵에 의해 억제되는 것을 확인함에 따라, 상기 결과들은 ID2가 BC 세포에서 TFCP2L1의 직접적인 억제 표적임을 입증한다.
ID2가 CDK1-TFCP2L1 경로에 의한 BC 세포의 세포 증식 및 줄기세포 특성에 영향을 미치는지 여부를 평가하였다. 도 8에 따르면, HT1376 및 HT1197 BC 세포에서 ID2의 발현 강화는 TFCP2L1 과발현에 의한 세포 증식의 자극을 억제하는 것으로 나타났다. BC 세포의 줄기세포적 특성을 종양구 및 클론 생성능으로 조사한 결과, 도 9에 따르면, TFCP2L1 과발현에 의해 증가된 종양구 형성은 ID2의 발현 강화로 억제되는 것으로 나타났다. 나아가, 도 10에 따르면, TFCP2L1 유도 셀프-재생 활성에 대한 ID2의 부정적 결과는 클론 생성 제한 휘석 분석에서 관찰되었다. 또한, 도 11에 따르면, 트랜스-웰 챔버 분석은 TFCP2L1 과발현이 있는 HT1376 및 HT1197 BC 세포가 대조군 세포에 비해 침윤능이 높게 나타났으나, ID2가 자극된 경우 침윤능이 손상되는 것으로 나타났다. 상기 결과는 ID2가 BC 세포의 줄기세포 특성 및 침윤능을 조절하기 위한 TFCP2L1을 억제시키는 표적 인자임을 입증한다.
나아가, ID2의 발현 양상이 다른 두 그룹의 방광암 세포에서 ID2의 발현 값 변화에 따른 방광암의 성장과 기능의 변화를 확인하였다. 그 결과, 도 12에 따르면, ID2의 발현이 약하게 나오는 방광암세포(HT1197, HT1376)에 ID2를 과발현시키면 세포증식이 억제됨을 확인한 반면, ID2의 발현이 높게 나타나는 방광암세포(5637, RT4)에 ID2의 발현을 억제시키면 세포 증식이 증가됨을 확인하였다. ID2의 발현이 감소 되었을 때, 방광암 세포의 기능 (종양 형성, 침윤능)의 변화를 확인하였다. ID2의 발현이 감소된 두 방광암 세포 (5637, RT4) 모두에서 종양의 성장 크기와 개수가 증가된 것을 확인하였다. 또한, 침윤능에서도 ID2의 발현이 감소된 두 방광암 세포에서 증가된 것을 확인함. 따라서, ID2의 발현 억제가 방광암 세포의 성장과 전반적인 세포의 기능을 강화시킴을 확인하여 방광암(BC)에서 ID2가 치료 타켓임을 알 수 있었다.
실시예 3. ID2 활성화에 따른 방광암(BC)의 치료능 평가
ID2 활성화가 방광암의 치료 표적이 될 수 있는지를 검증하기 위해, BMP 신호전달 및 ID2 유도를 활성화하는 무독성 식이 플라보노이드인 아피제닌(apigenin)을 BC 세포에 처리하여 세포 성장, 세포 사멸 정도, 세포의 침윤능의 변화가 나타나는지 평가하였다. 도 13에 따르면, 아피제닌의 처리 용량이 증가함에 따라 BC 세포의 성장이 유의하게 감소하는 것으로 나타났다. 또한, 도 14에 따르면, BC 세포에 아피제닌 활성화제를 처리하자 카스파제-3 및 폴리-(ADP-리보스) 폴리머라제(PARP)가 절단되는 것으로 나타났다. 도 15에 따르면, 시간 의존적 방식으로 아피제닌을 처리한 결과 BC 세포의 세포자살이 활성화되는 것으로 나타났다. 또한, 도 16에 따르면, 아피제닌은 BC 세포의 종양구 형성 능력 및 침윤능을 현저하게 억제시키는 것으로 나타났다. 상기 결과는 ID2 활성화제인 아피제닌이 방광암의 새로운 치료제가 될 수 있음을 입증한다.
방광암에 대한 아피제닌(apigenin)의 치료 효과가 in vivo에서도 나타나는지 평가하기 위해, HT1376 세포가 NSG 면역 결핍 마우스의 방광 외층에 이식된 동소 이종이식 BC 동물 모델에 아피제닌(apigenin)을 투여하여 치료 효과가 나타나는지 평가하였다. 도 17에 따르면, 아피제닌(apigenin)은 동물 모델에 4일 간격으로 6회 복강 주사하였다. 도 18에 따르면, 아피제닌(apigenin)을 투여한 그룹에서 종양의 성장이 74±6.13% 억제되는 것으로 나타났다. 또한, 도 19에 따르면, 조직학 검사에서 종양의 등급에 관계없이 아피제닌(apigenin)의 방광암 치료 효과가 나타나는 것을 확인하였다. 상기 결과는 ID2 활성화제인 아피제닌(apigenin)이 방광암에서 단독으로도 항종양 효과를 나타내는 것을 입증한다.
아피제닌(apigenin)은 ID2뿐 아니라 여러 신호 경로를 통해 항암 활성을 매개하기 때문에, 이러한 결과가 ID2의 활성에 의한 결과라는 것을 한 번 더 확인하기 위해 다른 ID2 단백질 발현을 활성화시키는 물질인 디오스메틴(diosmetin) 또는 4-하이드록시칼콘(4-hydroxychalcone)을 이용하여 아피제닌(apigenin)과 유사한 결과가 나오는지 확인하였다. 그 결과, 도 20에 따르면, 디오스메틴(diosmetin)의 경우, 아피제닌(apigenin)과 유사하게 방광암 세포의 성장이 감소하고, 세포자살이 활성화되고, 종양 형성능이 감소됨을 확인하였다. 나아가, 도 21에 따르면, 4-하이드록시칼콘(4-hydroxychalcone)의 경우 역시, 아피제닌(apigenin)과 유사하게 방광암 세포의 성장이 감소하고, 세포자살이 활성화된 것을 확인함. 또한, 종양 형성능이 감소됨을 확인하였다.
따라서, 아피제닌(apigenin)를 포함한 ID2 활성화제는 방광암에 항암효과가 있음을 알 수 있었다.
실시예 4. 방광암(BC)에서 CDK1 및 ID2의 상호 발현의 중요성 평가
TFCP2L1의 상위 활성화제인 CDK1의 발현 여부가 아피제닌의 항종양 효과에 미치는 영향을 평가하였다. TCGA 코호트에서 CDK1의 발현과 ID2와의 상관관계를 평가하였다. 도 22에 따르면, CDK1의 발현은 정상 요로 상피 조직보다 방광암에서 더 높게 나타났다. 도 23에 따르면, ID2 발현과 일관되게, CDK1 전사체의 수준은 방광암의 종양 등급에 높을수록 CDK1의 발현이 높은 경향을 나타냈다. 또한, 도 24에 따르면, 두 개의 독립적인 TCGA 코호트에서 CDK1의 높은 수준은 ID2 발현 감소와 관련성이 있는 것으로 나타났다. 도 25에 따르면, CDK1 및 ID2 상의 역 발현은 pT 범주 종양 단계와 관련성이 있는 것으로 나타났다. 상기 결과는 CDK1 및 ID2의 잠재적 연관성이 방광암 환자에서 임상적으로 중요한 것을 입증한다.
실시예 5. CDK 억제제에 따른 ID2 발현 증가
CDK 억제가 방광암의 치료 표적이 될 수 있는지를 검증하기 위해, CDK1 억제제인 RO-3306을 BC 세포에 처리하여 ID2를 증가시키는지 여부를 확인하였다. 그 결과, 도 26에 따르면, 두 종류의 방광암 세포(HT1197, HT1376)에 CDK1 억제제 (RO-3306)와 아피제닌(apigenin)을 각각 처리했을 때, 두 방광암 세포 모두에서 아피제닌(apigenin)과 유사하게 ID2의 발현이 RNA와 단백질 수준에서 증가됨을 확인하였다.
또한, RO-3306이 처리된 방광암 세포에서 ID2의 증가가 CDK1 발현 억제에 의한 것인지 다시 확인하기 위해 CDK1의 발현을 억제시키는 다른 CDK1 억제제(CGP74514A)를 이용하여 ID2의 발현을 다시 확인하였다. 그 결과 도 27에 따르면, 다른 CDK1 억제제 (CGP74514A)와 다른 ID2 활성제(4-hydroxychalcone)에서도 RO-3306의 결과와 유사하게 ID2의 발현 증가가 확인되었다.
이러한 결과를 통해 방광암에서 CDK1과 ID2 사이의 잠재적 연관성을 확인하였다.
실시예 6. 방광암에서 아피제닌 및 RO-3306의 치료 효과 평가
CDK1 및 ID2 연관에 대한 임상 결과와 CDK 억제제에 따른 ID2 발현 증가의 세포 모델 실험 결과들을 토대로 방광암 세포 및 동물 모델에서 CDK1 억제제의 단독 또는 아피제닌과의 병용 투여가 방광암 치료 효과를 나타내는지 평가하였다. 아피제닌과 CDK1 억제제인 RO-3306의 조합이 방광암 치료에서 시너지 효과를 나타내는지 여부를 평가하였다.
도 28에 따르면, 아피제닌 또는 RO-3306를 저농도로 단독 처리는 세포 성장, 증식과 카스파제-3 및 PARP의 절단에 유의한 영향을 미치지 않았으나, 아피제닌 및 RO-3306의 병용 투여는 카스파제-3 및 PARP 절단을 유도하였다. 상기 결과는 아피제닌 또는 RO-3306의 단독 처리는 방광암 세포의 증식과 세포 자살을 유도하지 못하지만, 아피제닌 및 RO-3306의 병용 투여는 방광암 세포의 증식 억제와 세포자살을 유도하는 것을 입증한다.
RO-3306의 단독 또는 아피제닌과의 병용 투여로 인한 방광암 치료 효과가 in vivo에서도 나타나는지 평가하기 위해, HT1376 세포가 NSG 면역 결핍 마우스의 방광 외층에 이식된 동소 이종이식 BC 동물 모델에 RO-3306의 단독 또는 아피제닌과의 병용 투여 하였다. 도 29에 따르면, 종양 성장은 RO-3306의 단독 투여 및 아피제닌과의 병용투여에서 각각 66.8±2.48% 및 36.9±2.31% 억제되는 것으로 나타났다. 방광암에 대한 이종이식 모델에서 RO-3306 및 아피제닌의 병용 투여가 항종양 효과를 나타내는지 검증하기 위해 조직학적 분석을 수행하였다. 그 결과, 도 30에 따르면, 방광암의 크기 및 진행이 RO-3306 및 아피제닌의 병용 투여에서 현저하게 억제되는 것으로 나타났다. 또한, 도 31에 따르면, 대조군 및 RO-3306 단일 투여군에서는 ID2 단백질의 발현 수준이 낮고, CDK1 및 TFCP2L1 단백질이 높은 수준으로 나타났으나, RO-3306 및 아피제닌의 병용 투여에서는 ID2 단백질의 발현이 높고 CDK1 및 TFCP2L1 단백질의 발현이 억제되는 것으로 나타났다.
상기 결과는 CDK1-표적 억제제는 ID2 활성화제인 이피제닌의 항암 효과를 향상시키는 것을 확인하였으며, CDK1-표적 억제제 및 ID2 활성화제의 병용투여가 각각의 단독 투여에 비해 시너지 효과를 나타냄을 입증하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.

Claims (8)

  1. CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및
    ID2 활성화제 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 방광암의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 CDK 억제제는 RO-3306, CGP74514A, BEY-11707, ON-01500, R547, 옥사메이트 나트륨 (Sodium oxamate), 디나시클립(Dinaciclib, SCH727965), BMS-265246, AZD5438, SU9516, 리비시클립 염산염(Riviciclib hydrochloride, P276-00), AT7519, 및 NU6027로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 약학적 조성물.
  3. 제1항에 있어서, 상기 ID2 활성화제는 아피제닌(apigenin), 이소리퀴리티제닌 (isoliquiritigenin), 4-하이드록시칼콘(4-hydroxychalcone), 디오스메틴(diosmetin), 비오카닌 A(biochanin A), 및 루테올린(luteolin)으로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 약학적 조성물.
  4. CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및
    ID2 활성화제 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물.
  5. 제4항에 있어서, 상기 CDK 억제제 또는 이의 약학적으로 허용 가능한 염; 및 ID2 활성화제 또는 이의 약학적으로 허용 가능한 염은 혼합된 형태로 제제화되어 투여되거나, 각각 제제화되어 동시적 또는 순차적으로 투여되는 것을 특징으로 하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물.
  6. 제4항에 있어서, 상기 CDK 억제제의 투여 용량은 1 mg/kg 내지 10 mg/kg이고, ID2 활성화제의 투여 용량은 5 mg/kg 내지 150 mg/kg인 것을 특징으로 하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물.
  7. 제4항에 있어서, 상기 CDK 억제제는 RO-3306, CGP74514A, BEY-11707, ON-01500, R547, 옥사메이트 나트륨 (Sodium oxamate), 디나시클립(Dinaciclib, SCH727965), BMS-265246, AZD5438, SU9516, 리비시클립 염산염(Riviciclib hydrochloride, P276-00), AT7519, 및 NU6027로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물.
  8. 제4항에 있어서, 상기 ID2 활성화제는 아피제닌(apigenin), 이소리퀴리티제닌 (isoliquiritigenin), 4-하이드록시칼콘(4-hydroxychalcone), 디오스메틴(diosmetin), 비오카닌 A(biochanin A), 및 루테올린(luteolin)으로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는 방광암의 예방 또는 치료를 위한 병용투여용 조성물.
PCT/KR2022/014930 2021-10-05 2022-10-05 Cdk 억제제 및 id2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물 WO2023059040A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210131698A KR102658209B1 (ko) 2021-10-05 2021-10-05 Cdk 억제제 및 id2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물
KR10-2021-0131698 2021-10-05

Publications (1)

Publication Number Publication Date
WO2023059040A1 true WO2023059040A1 (ko) 2023-04-13

Family

ID=85803599

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/014930 WO2023059040A1 (ko) 2021-10-05 2022-10-05 Cdk 억제제 및 id2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물

Country Status (2)

Country Link
KR (1) KR102658209B1 (ko)
WO (1) WO2023059040A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160041920A (ko) * 2013-08-14 2016-04-18 노파르티스 아게 암의 치료를 위한 조합 요법
KR20200040763A (ko) * 2017-08-11 2020-04-20 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 암 전이의 치료를 위한 키나제의 표적화

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101557183B1 (ko) 2012-08-14 2015-10-02 충북대학교 산학협력단 방광암 예후 진단 마커
US10729692B2 (en) * 2017-02-26 2020-08-04 Institute For Cancer Research Dual inhibition of CDK and HSP90 destabilize HIF1alpha and synergistically induces cancer cell death

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160041920A (ko) * 2013-08-14 2016-04-18 노파르티스 아게 암의 치료를 위한 조합 요법
KR20200040763A (ko) * 2017-08-11 2020-04-20 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 암 전이의 치료를 위한 키나제의 표적화

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
HEO JINBEOM, LEE JINYOUNG, NAM YUN JI, KIM YONGHWAN, YUN HONGDUCK, LEE SEUNGUN, JU HYEIN, RYU CHAE-MIN, JEONG SEON MIN, LEE JINWON: "The CDK1/TFCP2L1/ID2 cascade offers a novel combination therapy strategy in a preclinical model of bladder cancer", EXPERIMENTAL & MOLECULAR MEDICINE, vol. 54, no. 6, 21 June 2022 (2022-06-21), pages 801 - 811, XP093056216, DOI: 10.1038/s12276-022-00786-0 *
HEO JINBEOM, NOH BYEONG‐JOO, LEE SEUNGUN, LEE HYE‐YEON, KIM YONGHWAN, LIM JISUN, JU HYEIN, YU HWAN YEUL, RYU CHAE‐MIN, LEE PETER C: "Phosphorylation of TFCP2L1 by CDK1 is required for stem cell pluripotency and bladder carcinogenesis", EMBO MOLECULAR MEDICINE, WILEY-BLACKWELL, US, vol. 12, no. 1, 9 January 2020 (2020-01-09), US , pages e10880, XP093056213, ISSN: 1757-4676, DOI: 10.15252/emmm.201910880 *
IIDA KEITARO, NAIKI TAKU, NAIKI‐ITO AYA, SUZUKI SHUGO, KATO HIROYUKI, NOZAKI SATOSHI, NAGAI TAKASHI, ETANI TOSHIKI, NAGAYASU YUKO,: "Luteolin suppresses bladder cancer growth via regulation of mechanistic target of rapamycin pathway", CANCER SCIENCE, JAPANESE CANCER ASSOCIATION, TOKYO, JP, vol. 111, no. 4, 1 April 2020 (2020-04-01), JP , pages 1165 - 1179, XP093056195, ISSN: 1347-9032, DOI: 10.1111/cas.14334 *
KIM JUNHO: "Discovery of bladder cancer progression suppression mechanism", MEDICAL TRIBUNE, 14 July 2022 (2022-07-14), XP093056224, Retrieved from the Internet <URL:http://www.medical-tribune.co.kr/news/articleView.html?idxno=108289> [retrieved on 20230621] *
MING-DER SHI;CHENG-KAI SHIAO;YI-CHIEH LEE;YUAN-WEI SHIH: "Apigenin, a dietary flavonoid, inhibits proliferation of human bladder cancer T-24 cells via blocking cell cycle progression and inducing apoptosis", CANCER CELL INTERNATIONAL, BIOMED CENTRAL, LONDON, GB, vol. 15, no. 1, 29 March 2015 (2015-03-29), GB , pages 33, XP021214829, ISSN: 1475-2867, DOI: 10.1186/s12935-015-0186-0 *
PAN QI, SATHE ANUJA, BLACK PETER C., GOEBELL PETER J., KAMAT ASHISH M., SCHMITZ-DRAEGER BERND, NAWROTH ROMAN: "CDK4/6 Inhibitors in Cancer Therapy: A Novel Treatement Strategy for Bladder Cancer", BLADDER CANCER, vol. 3, no. 2, 27 April 2017 (2017-04-27), pages 79 - 88, XP093056199, ISSN: 2352-3727, DOI: 10.3233/BLC-170105 *
RUBIO CAROLINA, MARTÍNEZ-FERNÁNDEZ MÓNICA, SEGOVIA CRISTINA, LODEWIJK IRIS, SUAREZ-CABRERA CRISTIAN, SEGRELLES CARMEN, LÓPEZ-CALDE: "CDK4/6 Inhibitor as a Novel Therapeutic Approach for Advanced Bladder Cancer Independently of RB1 Status", CLINICAL CANCER RESEARCH, ASSOCIATION FOR CANCER RESEARCH, US, vol. 25, no. 1, 1 January 2019 (2019-01-01), US, pages 390 - 402, XP093056208, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-18-0685 *
YI ZHU;YEQING MAO;HONG CHEN;YIWEI LIN;ZHENGHUI HU;JIAN WU;XIN XU;XIANGLAI XU;JIE QIN;LIPING XIE: "Apigenin promotes apoptosis, inhibits invasion and induces cell cycle arrest of T24 human bladder cancer cells", CANCER CELL INTERNATIONAL, BIOMED CENTRAL, LONDON, GB, vol. 13, no. 1, 1 June 2013 (2013-06-01), GB , pages 54, XP021152259, ISSN: 1475-2867, DOI: 10.1186/1475-2867-13-54 *

Also Published As

Publication number Publication date
KR20230048823A (ko) 2023-04-12
KR102658209B1 (ko) 2024-04-18

Similar Documents

Publication Publication Date Title
EP3533449B1 (en) Selective inhibitor of exon 20 insertion mutant egfr
KR19990007899A (ko) 유출 펌프 억제제
JP2009091370A (ja) 細胞死を調節する細胞障害性因子
WO2020085642A1 (ko) N-1h-벤지미다졸-2-일-3-(1h-피롤-1-일) 벤자미드를 유효성분으로 함유하는 암 예방 또는 치료용 약학적 조성물
CN113967211B (zh) 盐酸石蒜碱硫酯在制备抗冠状病毒药物中的应用
US11364219B2 (en) Methods and pharmaceutical compositions for treating microbiome dysregulations associated with circadian clock disruption
US8889672B2 (en) Compounds, formulations, and methods of protein kinase C inhibition
WO2018155921A1 (ko) 고시폴 및 펜포르민을 유효성분으로 포함하는 췌장암 예방 및 치료용 약학적 조성물
WO2023059040A1 (ko) Cdk 억제제 및 id2 활성화제를 포함하는 방광암의 예방 또는 치료용 약학 조성물
CN109715158A (zh) 用于治疗核糖体障碍和核糖体病的钙调蛋白抑制剂、Chk2抑制剂和RSK抑制剂
WO2019172681A1 (ko) 비소세포폐암의 표피성장인자 수용체 표적 항암제에 대한 민감성 증진용 조성물
WO2021241862A1 (ko) 이노시톨 다인산 멀티키나아제 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약제학적 조성물
WO2021075853A1 (ko) Emp3 억제제를 포함하는 암 줄기세포 성장 억제용 조성물 및 그 용도
WO2021167175A1 (ko) 엠토르 신호전달 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약제학적 조성물
WO2020101212A1 (ko) 편도 유래 중간엽 줄기세포의 조정 배지를 포함하는 암 전이 억제용 조성물
WO2017142348A1 (ko) 폴리페놀 화합물을 유효성분으로 포함하는 암 치료용 약학조성물
WO2020213938A1 (ko) 사포닌을 유효성분으로 포함하는 암 치료용 약학조성물
Chatterjee et al. Activity of ROCKII not ROCKI promotes pulmonary metastasis of melanoma cells via modulating Smad2/3-MMP9 and FAK-Src-VEGF signalling
WO2018056620A1 (en) Combined composition for preventing or treating cancer comprising a benzophenone thiazole derivatives as a vda and topoisomerase inhibitor
WO2020054981A1 (ko) 2-(3-[2-(1-시클로헥센-1-일)에틸]-6,7-디메톡시-4-옥소-3,4-디히드로-2-퀴나졸리닐술파닐)-n-(4-에틸페닐)부탄아미드를 유효성분으로 포함하는 암 치료 또는 예방용 조성물
WO2023075122A1 (ko) 대장암의 치료 및 전이 억제용 약학적 조성물 및 이의 용도
WO2021075645A1 (ko) 니클로사미드 및 메트포르민을 포함하는 가족성 선종성 용종증 예방 또는 치료용 약학적 조성물
WO2023204640A1 (ko) 헬리코박터 파일로리에 의한 위 점막 손상 관련 질환의 예방 또는 치료용 약학적 조성물 및 헬리코박터 파일로리 감염의 예방 또는 치료용 유효성분의 스크리닝 플랫폼
CN114129586B (zh) 用于治疗胰腺癌的药物组合物
WO2022025709A1 (ko) 2,3,5-치환된 싸이오펜 화합물의 위장관기질종양 예방, 개선 또는 치료 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22878861

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE