WO2023026994A1 - ヒトトランスフェリンレセプター結合ペプチド-薬物コンジュゲート - Google Patents
ヒトトランスフェリンレセプター結合ペプチド-薬物コンジュゲート Download PDFInfo
- Publication number
- WO2023026994A1 WO2023026994A1 PCT/JP2022/031434 JP2022031434W WO2023026994A1 WO 2023026994 A1 WO2023026994 A1 WO 2023026994A1 JP 2022031434 W JP2022031434 W JP 2022031434W WO 2023026994 A1 WO2023026994 A1 WO 2023026994A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- amino acid
- peptide
- exon
- salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- A61K38/1719—Muscle proteins, e.g. myosin or actin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
- A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
- A61K48/0033—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being non-polymeric
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/314—Phosphoramidates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3233—Morpholino-type ring
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3513—Protein; Peptide
Definitions
- the present invention provides a conjugate (hereinafter also referred to as a complex) containing a peptide capable of binding to human transferrin receptor (hTfR) and a drug (a compound containing an oligonucleotide for producing at least partially functional dystrophin protein). Regarding.
- the present invention also relates to a conjugate comprising a muscle tissue-directed peptide and a drug. Furthermore, the present invention relates to a medicament containing said conjugate.
- Duchenne muscular dystrophy is an X-linked recessive muscle disease in which mutations in the dystrophin gene result in the inability to produce functional dystrophin protein.
- the dystrophin protein is involved in muscle cell membrane stability and has the function of making muscle cells less likely to break.
- dystrophin deficiency makes the sarcolemma susceptible to muscle contraction damage, resulting in muscle cell death and concomitant inflammation, muscle fibrosis, and decreased muscle function.
- the dystrophin gene consists of 79 exons, and the protein encoded by it consists of 3685 amino acids and has a molecular weight of 427 kDa. Both ends are essential for its function, but the part in the middle is a repetition of the basic structure.
- the dystrophin gene is affected by deletion or duplication of exon units, insertion or deletion of a single nucleotide, mutation of a splice site, etc., causing the reading frame of a codon to shift (out-of-frame mutation), or due to a single nucleotide substitution.
- a stop codon appears in the middle, translation stops, and a dystrophin protein lacking the C-terminal region is synthesized, but is rapidly degraded due to its unstable structure.
- Exon skipping is used as a treatment for Duchenne muscular dystrophy. Skip reading frame shifts caused by out-of-frame mutations using antisense oligonucleic acid (ASO) to read one or more exons, or if a nonsense mutation causes a premature stop codon, the mutation
- ASO antisense oligonucleic acid
- the number of deleted bases at the mRNA level Exon skipping is a therapeutic strategy that attempts to alleviate Duchenne muscular dystrophy by correcting the reading frame by increasing the number of multiples of 3 to produce a partially functional dystrophin protein.
- the present invention enables drugs (compounds including oligonucleotides for producing at least partially functional dystrophin protein) to be delivered to muscle tissue, such as cardiac muscle and skeletal muscle, and efficiently introduced into muscle cells.
- the purpose is to provide a novel drug delivery system (DDS) technology. More specifically, the present invention provides a conjugate comprising a muscle tissue-directed peptide and a drug (compound comprising an oligonucleotide for producing at least partially functional dystrophin protein). for the purpose.
- DDS drug delivery system
- the present invention provides a conjugate comprising a muscle tissue-directed peptide and a drug (compound comprising an oligonucleotide for producing at least partially functional dystrophin protein). for the purpose.
- a further object of the present invention is to provide a medicament containing the above conjugate.
- the present inventors have found that a compound comprising a peptide having a specific structure and an oligonucleotide for producing an at least partially functional dystrophin protein, We found that conjugates linked directly or via a linker have excellent muscle cell directivity. The present inventors have completed the present invention as a result of further studies based on these findings.
- the present invention provides the following.
- Conjugates or salts thereof containing: (1) a peptide that binds to the transferrin receptor, Amino acid sequence set forth in SEQ ID NO: 1 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Ser-Cys); or 1 or more and 10 or less in the amino acid sequence set forth in SEQ ID NO: 1 Peptides comprising amino acid sequences with amino acid residue substitutions, deletions, additions and/or insertions, and (2) A compound comprising an oligonucleotide for producing an at least partially functional dystrophin protein.
- [1-1] a peptide that binds to the transferrin receptor,
- the amino acid sequence set forth in SEQ ID NO: 296 (Ala-Val-MeF-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeY-Cys); or in the amino acid sequence set forth in SEQ ID NO: 296
- [1-2] a peptide that binds to the transferrin receptor, The amino acid sequence set forth in SEQ ID NO: 296; or a peptide having an amino acid sequence having substitutions, deletions, additions and/or insertions of 1 to 5 amino acid residues in the amino acid sequence set forth in SEQ ID NO: 296.
- [1-3] a peptide that binds to the transferrin receptor, A peptide having an amino acid sequence set forth in SEQ ID NO: 296; The conjugate or salt thereof according to any one of [1], [1-1] and [1-2] above.
- the third amino acid residue of SEQ ID NO: 296 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 296 is an optionally modified tryptophan (Trp); the seventh amino acid residue of SEQ ID NO: 296 is optionally modified tyrosine (Tyr); the eighth amino acid residue of SEQ ID NO: 296 is an optionally modified tyrosine (Tyr);
- the 11th amino acid residue of SEQ ID NO: 296 is optionally modified arginine (Arg) or optionally modified lysine (Lys),
- the 12th amino acid residue of SEQ ID NO: 296 is optionally modified arginine (Arg) or optionally modified lysine (Lys),
- the 13th amino acid residue of SEQ ID NO: 296 is optionally modified tyrosine (Tyr) or optionally modified phenylalanine (Phe),
- the conjugate or salt thereof according to any one amino acid residue of SEQ ID NO:
- a peptide that binds to the transferrin receptor is phenylalanine (Phe), methylated phenylalanine (MeF), or N-methyl-3-chloro-L-phenylalanine (MeF3C); the fifth amino acid residue of SEQ ID NO: 296 is tryptophan (Trp) or methylated tryptophan (MeW); the seventh amino acid residue of SEQ ID NO: 296 is tyrosine (Tyr), the eighth amino acid residue of SEQ ID NO: 296 is tyrosine (Tyr) or (S)-2-amino-3-(4-methoxyphenyl)propanoic acid (F4OMe); the 11th amino acid residue of SEQ ID NO: 296 is arginine (Arg) or lysine (Lys); the 12th amino acid residue of SEQ ID NO: 296 is arginine (Arg) or D-
- [1-7] a peptide that binds to the transferrin receptor, The amino acid sequence set forth in SEQ ID NO: 300 (Ala-Val-MeF-Val-MeW-Asn-Tyr-Tyr-Ile-Ile-Lys-Arg-Tyr-MeY-Cys), The conjugate or salt thereof according to [1] above.
- the peptide that binds to the transferrin receptor is a peptide consisting of a sequence of 1st to 15th amino acids and having a cyclic structure at the amino acid sequence site.
- exon is exon 7, exon 8, exon 9, exon 19, exon 23, exon 44, exon 45, exon 46, exon 50, exon 51, exon 52, exon 53, exon 55, or any combination of these exons
- the conjugate or salt thereof according to [2] above which is selected from [3-1] The conjugate or salt thereof according to [3] above, wherein the exon is exon 44.
- [4] The above [1] to [3], [1-1] to [1-10], wherein the sugar moiety and/or the phosphate linkage moiety of at least one nucleotide constituting the compound containing the oligonucleotide is modified.
- the conjugate or salt thereof according to any one of [3-1] and [3-2].
- [5-1] [1] to [5], [1-1] to [1-10], [3-1] and [ 3-2], or a salt thereof.
- [5-2] The above [1] to [5], [1-1] to [1-10], [3-1], [ 3-2] and [5-1] the conjugate or a salt thereof.
- [6] Any one of [5], [5-1] and [5-2] above, wherein the antisense oligonucleotide comprises a sequence complementary to 12 or more contiguous nucleotides in the target region of dystrophin mRNA.
- the conjugate or a salt thereof according to.
- the target region of the dystrophin mRNA is TACAAGAACACCTTCAGAACCGGAGGCAACAGTTG (SEQ ID NO: 647) The conjugate or salt thereof according to [6] above.
- a compound comprising the oligonucleotide, an antisense oligonucleotide; and a second nucleic acid strand complementary to all or part of the antisense oligonucleotide;
- the antisense oligonucleotide is a compound consisting of a nucleic acid complex annealed to the second nucleic acid strand;
- a method for preventing or treating Duchenne muscular dystrophy in a mammal comprising administering the conjugate according to any one of [6-5] or a salt thereof to the mammal.
- the peptides are of the following groups: (I) replacement of the first alanine residue of SEQ ID NO: 1 with an aliphatic amino acid or a methylated aliphatic amino acid; (II) replacement of the second valine residue of SEQ ID NO: 1 with a basic amino acid residue or a methylated basic amino acid residue; (III) Substitution of the third phenylalanine residue of SEQ ID NO: 1 with an aromatic amino acid residue, a methylated aromatic amino acid residue, an amino acid residue with an aromatic ring added, or an amino acid residue with a condensed ring added; (IV) replacement of the 4th valine residue of SEQ ID NO: 1 with a methylated valine residue; (V) the aromatic amino acid residue, methyltryptophan residue, methylated aromatic amino acid residue, aromatic ring-added amino acid residue, or condensed ring-added amino acid residue of the 5th tryptophan residue of SEQ ID NO: 1 Substitution to groups; (VI)
- the peptide is a peptide comprising the amino acid sequence set forth in SEQ ID NO: 2 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeTyr-Cys); The following groups in the amino acid sequence set forth in SEQ ID NO: 2: (I) replacement of the first alanine residue of SEQ ID NO: 2 with an aliphatic amino acid or a methylated aliphatic amino acid; (II) replacement of the second valine residue of SEQ ID NO: 2 with a basic amino acid residue or a methylated basic amino acid residue; (III) Substitution of the third phenylalanine residue of SEQ ID NO: 2 with an aromatic amino acid residue, a methylated aromatic amino acid residue, an amino acid residue with an aromatic ring added, or an amino acid residue with a condensed ring added; (IV) replacement of the 4th valine residue of SEQ ID NO: 2 (
- the peptide Peptide A is a peptide with a length of 10 containing the amino acid sequence set forth in positions 1 to 10 of SEQ ID NO: 18 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Val-Ser-Cys).
- peptide A Assuming more than 17 or less peptides, peptide A, A peptide having an amino acid sequence having substitutions, deletions, and/or insertions of 1 to 6 amino acid residues in peptide A, A peptide having an amino acid sequence in which any one of the 2nd, 3rd, 5th, 8th, and 10th amino acid residues of SEQ ID NO: 18 is substituted in peptide A, and peptide A, the second amino acid residue of SEQ ID NO: 18 is optionally modified valine (Val) or optionally modified glutamic acid (Glu); the third amino acid residue of SEQ ID NO: 18 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 18 is an optionally modified tryptophan (Trp); The eighth amino acid residue of SEQ ID NO: 18 is optionally modified tyrosine (Tyr), a peptide in which the tenth amino acid residue of SEQ ID NO: 18 is optionally modified isoleu
- the peptide is Peptide B comprises the amino acid sequence set forth in positions 1 to 10 of SEQ ID NO: 15 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Val-Pro-Arg-Asp-Cys); If the peptide length is 10 or more and 19 or less, peptide B, A peptide having an amino acid sequence with 1 to 5 amino acid residue substitutions, deletions, and/or insertions in peptide B, A peptide having an amino acid sequence in which any one of the 2nd, 3rd, 5th, 8th, and 10th amino acid residues of SEQ ID NO: 15 is substituted in peptide B, and peptide B, the second amino acid residue of SEQ ID NO: 15 is optionally modified valine (Val) or optionally modified glutamic acid (Glu); the third amino acid residue of SEQ ID NO: 15 is optionally modified phenylalanine (Phe) or tryptophan (Trp);
- the peptide is Peptide C has the amino acid sequence described in 1st to 10th of SEQ ID NO: 214 (MeA-Val-MeF3C-Val-MeW-Asn-Tyr-F4OMe-Ile-Ile-Arg-Arg-Phe-MeY-Cys) If the peptide length is 11 or more and 19 or less, including peptide C, A peptide having an amino acid sequence having substitutions, deletions, and/or insertions of 1 to 5 amino acid residues in peptide C, A peptide having an amino acid sequence in which any one of amino acid residues 1, 3, 5, and 8 of SEQ ID NO: 214 is substituted in peptide C, and peptide C,
- the first amino acid residue of SEQ ID NO: 214 is optionally modified alanine (Ala) or optionally modified glutamic acid (Glu), the third amino acid residue of SEQ ID NO: 214 is optionally modified phenylalanine (Phe); the fifth amino
- the peptide Peptide D has the amino acid sequence described in 1st to 10th of SEQ ID NO: 219 (Ala-Glu-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeY-Cys) If the peptide length is 11 or more and 19 or less, including peptide D, A peptide having an amino acid sequence having substitutions, deletions, and/or insertions of 1 to 5 amino acid residues in peptide D, A peptide having an amino acid sequence in which any one of the 2nd, 3rd, 5th, 8th, and 10th amino acid residues of SEQ ID NO: 219 is substituted in peptide D, and in peptide D,
- the second amino acid residue of SEQ ID NO: 219 is optionally modified valine (Val), optionally modified glutamic acid (GIu), optionally modified arginine (Arg), optionally modified lysine (Lys ), optional
- the peptide Peptide E has the amino acid sequence described in 1st to 15th of SEQ ID NO: 296 (Ala-Val-MeF-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeY-Cys) If the peptide length is 15 or more and 18 or less, including Peptide E, or the conjugate according to [1] above, which is a peptide having an amino acid sequence having 1 to 10, or 1 to 5 amino acid residue substitutions, deletions, and/or insertions in peptide E. Gate or its salt.
- the third amino acid residue of SEQ ID NO: 296 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 296 is an optionally modified tryptophan (Trp); the seventh amino acid residue of SEQ ID NO: 296 is optionally modified tyrosine (Tyr); the eighth amino acid residue of SEQ ID NO: 296 is an optionally modified tyrosine (Tyr);
- the 11th amino acid residue of SEQ ID NO: 296 is optionally modified arginine (Arg) or optionally modified lysine (Lys),
- the 12th amino acid residue of SEQ ID NO: 296 is optionally modified arginine (Arg) or optionally modified lysine (Lys), The conjugate according to [12A] above or its salt.
- the third amino acid residue of SEQ ID NO: 296 is phenylalanine (Phe), methylated phenylalanine (MeF), or N-methyl-3-chloro-L-phenylalanine (MeF3C);
- the fifth amino acid residue of SEQ ID NO: 296 is tryptophan (Trp) or methylated tryptophan (MeW);
- the seventh amino acid residue of SEQ ID NO: 296 is tyrosine (Tyr)
- the eighth amino acid residue of SEQ ID NO: 296 is tyrosine (Tyr) or (S)-2-amino-3-(4-methoxyphenyl)propanoic acid (F4OMe)
- the 11th amino acid residue of SEQ ID NO: 296 is arginine (Arg) or lysine (Lys);
- the 12th amino acid residue of SEQ ID NO: 296 is arginine (Arg) or D-type arginine (
- [16A] the peptide consisting of the amino acid sequence of any of SEQ ID NOS: 3-200; The conjugate or salt thereof according to [1] above, which is a peptide consisting of an amino acid sequence having chloroacetyl-Ala at the N-terminus of any of the amino acid sequences of SEQ ID NOs: 3 to 200.
- [16B] the peptide consisting of the amino acid sequence of SEQ ID NO: 296 or 300; The conjugate or salt thereof according to [1] above, which is a peptide consisting of the amino acid sequence of SEQ ID NO: 296 or 300, in which the N-terminus is chloroacetyl-Ala.
- [17A] the peptide The amino acid sequence set forth in any one of SEQ ID NOs: 1 to 200, 203 to 552, 645 and 723 to 725, or a complex of said amino acid sequence and a linker, comprising the 1st to 10th amino acid sequences, wherein the amino acid sequence site has a cyclic structure
- the above [1] which is a peptide comprising the amino acid sequence set forth in SEQ ID NO: 296 or 300 or a complex of the amino acid sequence and a linker at positions 1 to 10, wherein the amino acid sequence site has a cyclic structure. conjugates or salts thereof.
- [18A] the peptide 1 to 15 in the amino acid sequence set forth in any one of SEQ ID NOs: 2, 9, 21-148, 159-200, 213-448, 450-552, 645 and 723-725 or a complex of said amino acid sequence and a linker
- the peptide is The above [17B], which is a peptide consisting of the 1st to 15th amino acid sequences in the amino acid sequence set forth in SEQ ID NO: 296 or 300 or a complex of said amino acid sequence and a linker, wherein the amino acid sequence site has a cyclic structure or a salt thereof.
- [19A] The conjugate or salt thereof according to any one of [1] and [2A] to [18A] and [16B] to [18B] above, wherein the peptide is a cyclic peptide.
- [20A] The conjugate or salt thereof according to the above [17A], [18A], [17B] or [18B], wherein the peptide consists of 15 amino acid residues.
- [22A] The conjugate or salt thereof according to [1] above, comprising a linker having a length of 1 to 15 amino acids and containing one or more selected from glycine (Gly) and serine (Ser).
- [23A] The conjugate or salt thereof according to [22A] above, wherein the N-terminus of the linker is optionally modified cysteine (Cys) or optionally modified lysine (Lys).
- [24A] The conjugate or salt thereof according to [1] above, comprising a linker having an amino acid length of 1 or more and 5 or less and containing one or more selected from D-glutamic acid (de) and methylated glycine (MeG).
- [25A] The conjugate or salt thereof according to [24A] above, wherein the N-terminus of the linker is optionally modified Cys or optionally modified lysine (Lys).
- [26A] The conjugate or salt thereof according to [1] above, comprising a PEG linker containing polyethylene glycol (PEG) or a derivative of polyethylene glycol.
- PEG linker further comprises one or more selected from glycine (Gly), serine (Ser), glutamic acid (Glu), arginine (Arg) and lysine (Lys), or a salt thereof .
- the N-terminus of the linker is optionally modified cysteine (Cys) or optionally modified lysine (Lys).
- [29A] The conjugate or salt thereof according to [1] above, comprising a linker having an amino acid sequence shown by any of SEQ ID NOS:553-644.
- [30A] polyethylene glycol (PEG), G linker, GS linker, or The conjugate or salt thereof according to [1] above, comprising a linker having an amino acid sequence represented by any one of SEQ ID NOs: 553 to 644.
- a conjugate of a peptide such as a peptide that binds to the human transferrin receptor (hTfR) or a peptide that has a tropism to muscle tissue, and a drug, etc. can provide
- the conjugates of the invention are (1) a peptide that binds to the transferrin receptor, The amino acid sequence set forth in SEQ ID NO: 1; or a peptide comprising an amino acid sequence having substitutions, deletions, additions and/or insertions of 1 to 10 amino acid residues in the amino acid sequence set forth in SEQ ID NO: 1, and (2) including compounds comprising oligonucleotides for producing at least partially functional dystrophin protein;
- the peptide and the compound containing the oligonucleotide may be bound directly or through a linker, but are preferably bound through a linker.
- Transferrin Receptor Transferrin receptor is a receptor that binds to transferrin, which is a protein that is contained in blood plasma and binds to iron ions, and has the function of taking it into cells.
- the transferrin receptor is expressed on various cells such as reticulocytes, placental trophoblasts and lymphocytes, and its expression on tumor cells in particular has been suggested.
- the transferrin receptor has the property of triggering endocytosis of cells by stimulating the binding of iron ions in plasma. Research is underway to pass In this specification, the human form of transferrin receptor is referred to as human TfR, hTfR, or simply TfR, unless otherwise specified.
- Peptide that binds to transferrin receptor means specifically binding to transferrin receptor. Affinity is expressed by the equilibrium constant (KD) for the dissociation of transferrin receptor and binding peptide, which is a measure of the strength of binding between transferrin receptor and binding peptide. The strength of binding between binding peptides becomes stronger (alternatively, affinity can be expressed as an affinity constant (KA), which is 1/KD). As will be apparent to those skilled in the art (e.g., based on the further disclosure herein), affinity can be determined in a manner known per se, depending on the type and nature of the binding substance. is.
- Avidity is also a measure of the strength of binding between the transferrin receptor and the binding peptide. Avidity is related to both the affinity between the transferrin receptor and its binding site on the binding peptide and the number of relevant binding sites present on the binding molecule. Further, although type I and type II transferrin receptors are known, type I (Gene ID: 7037) is preferred as the transferrin receptor in the present invention.
- Specific binding of a transferrin receptor to a binding peptide can be determined, for example, by surface plasmon resonance (SPR) assays, Scatchard analysis and/or radioimmunoassays (RIA), enzyme immunoassays (EIA) and sandwich competition as described herein. It can be determined in any suitable manner known per se, including competitive binding assays such as assays, as well as different variants thereof known per se in the art.
- SPR surface plasmon resonance
- RIA radioimmunoassays
- EIA enzyme immunoassays
- sandwich competition as described herein. It can be determined in any suitable manner known per se, including competitive binding assays such as assays, as well as different variants thereof known per se in the art.
- BBB blood-brain barrier
- Brain-related disease is a disease caused by some abnormality in the brain, such as a central nervous system (CNS) disease.
- CNS central nervous system
- brain-related diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, prion disease, Huntington's disease, lysosomal storage disease, central nervous system disorders, tumors of the central nervous system including brain tumors, cerebral ischemia, diseases involving brain damage, These include traumatic central nervous system disorders, viral and bacterial central nervous system disorders, and disorders affecting the mind, such as schizophrenia and depression.
- Muscle tissue oriented to muscle tissue may be any of cardiac muscle, skeletal muscle and smooth muscle. Particularly preferred muscle tissue is cardiac muscle or skeletal muscle. Having tropism to muscle tissue means having a property of being specifically and efficiently transferred to muscle tissue.
- Neuromuscular disease refers to diseases in which motor disorders such as muscle weakness are caused by lesions of nerves or muscles in the brain, spinal cord, peripheral nerves, and the like.
- Examples of neuromuscular diseases include, but are not limited to, spinocerebellar degeneration, amyotrophic lateral sclerosis, myasthenia gravis, muscular dystrophies (eg, Duchenne muscular dystrophy, Becker muscular dystrophy), polymyositis, hereditary myopathy, Neuromuscular disease, muscular atrophy, drug-induced myopathy, acute heart failure, chronic heart failure, myocardial infarction, chronic fatigue syndrome, mitochondrial disease, mitochondrial respiratory chain complex disorder and Guillain-Barré syndrome.
- Peptides with cell-permeability are described in, for example, Japanese Patent No. 6478632, Japanese Patent No. 6708770, WO2009/147368, WO2013/030569, and WO2015/022504 (peptides with cell-permeability). As such, it is publicly known. Peptides with cell-permeability are then taken up into cells. Therefore, the complex of the present invention may further contain a cell-permeable peptide. By using the complex of the present invention, which further contains a cell-permeable peptide, it becomes possible to deliver the target active ingredient into cells, for example, to deliver nucleic acid drugs into cells.
- Pip7a, Pip7b, Pip7b2, Pip7c, Pip7c2, Pip8a, Pip8b, Pip8c, Pip8c2, Pip8d, Pip9b, Pip9b2, Pip9c, pip9c2, Pip9c3, pip9d disclosed in WO2013/030569 are preferred as peptides having cell permeability.
- Pip9d2 or any combination thereof (preferably Pip7a, Pip7b, Pip7b2, Pip7c, Pip7c2, Pip8a, Pip8b, Pip8c, Pip8c2, Pip8d, Pip9b, Pip9b2, Pip9c, pip9c2, Pip9c3, pip9d or Pip9d2) . More preferred are Pip9b, Pip9b2, Pip9c, Pip9d, Pip9d2 or any combination thereof (preferably Pip9b, Pip9b2, Pip9c, Pip9d or Pip9d2). More preferably, it is Pip9b2.
- Pip9b2 has the following structure.
- Peptide refers to a structure in which a plurality of amino acids are continuous, and includes polypeptides and proteins.
- amino acids refer not only to naturally occurring amino acids (natural amino acids) that are incorporated into peptide chains after mRNA is translated in cells, but also to naturally occurring amino acids that can form part of peptide chains through peptide bonds. It also includes amino acids that do not exist in (unnatural amino acids). Amino acids may be those that are artificially synthesized or those that exist in nature.
- a peptide in which a cyclic portion is formed by cyclization after synthesis also referred to as a cyclic peptide
- a peptide obtained by further chemically modifying the peptide are also included in the peptide.
- a cyclic peptide is a peptide in which two amino acids separated by one or more amino acid residues are bound to each other in the amino acid sequence, so that all or part of the peptide becomes cyclic. Say what you have.
- the bond type between the two amino acids an amide bond between the carboxyl group of one amino acid and the amino group of the other amino acid, and a bond between the carboxyl group of one amino acid and the other amino acid
- a thioether bond between thiol groups, a thiol bond between a thiol group of one amino acid and a thiol group of the other amino acid, a cyclic structure formed by lactam ring formation or macrocyclization reaction, and a lasso peptide-like structure and the like are also included in the cyclic peptides.
- the amide bond is not limited to one formed by bonding the carboxyl group of one amino acid and the amino group of the other amino acid; As a result, it suffices if they are bound by an amide bond. The same is true for other bond types. That is, in the present application, the cyclic peptide may have a linear portion as long as a portion thereof forms a cyclic structure.
- amino acids may be modified for cyclization of the peptide.
- Such partially modified amino acids are also included in the amino acids of the present application.
- adding a chloroacetyl group to an amino acid located at the N-terminus and binding to a cysteine residue in a peptide for cyclization include various (natural/non-natural) amino acids to which a chloroacetyl group has been added. are also included in the amino acids of the present application.
- Unnatural amino acids refer to compounds other than natural amino acids that have the properties of amino acids.
- ⁇ -amino acids ⁇ -amino acids, ⁇ -amino acids, L-amino acids, D-amino acids (also referred to as D-amino acids), amino acid mutants, chemically modified amino acids such as amino acid derivatives, norleucine, ⁇ - Examples include amino acids such as alanine, ornithine, etc., which do not form protein constituents in vivo.
- Amino acid derivatives having a structure and the like can be mentioned. Examples of unnatural amino acids and abbreviations used herein are shown below. The CAS reference number or supplier is given in parenthesis, and the synthesis example number for newly synthesized ones. Special amino acids are not limited to these. For example, those having structures in which one or more of the hydrogen atoms in these molecules are substituted with alkyl groups are also special amino acids.
- an amino acid having Me or N-Me before the amino acid name indicates an N-methyl amino acid unless otherwise specified.
- an N-methylated amino acid of alanine (Ala or A) is indicated as MeAla, N-MeAla, MeA or N-MeA.
- an amino acid that is a one-letter amino acid notation and preceded by d indicates a D-amino acid.
- the D-amino acid of alanine (Ala or A) is indicated as da.
- Those without a CAS number or a description of where to purchase them can be purchased as general reagents.
- the following amino acids can be used in peptide synthesis by Fmoc-protecting the alpha amino group by a known method.
- the peptide in the present invention is the amino acid sequence set forth in SEQ ID NO: 1 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Ser-Cys); or in the amino acid sequence set forth in SEQ ID NO: 1
- a peptide comprising an amino acid sequence having 1 or more and 10 or less amino acid residue substitutions, deletions, additions and/or insertions.
- the peptide is a peptide that binds to the transferrin receptor.
- a preferred example of this peptide is a peptide directed to muscle tissue.
- the number of amino acids substituted, deleted, added and/or inserted into the peptide sequence may be 1 or more and 10 or less, with a lower limit of 1.
- the upper limit is 10, 9, 8, 7, 6, 5, 4, 3, 2 and the minimum is 1.
- Such amino acid substitutions are preferably conservative amino acid substitutions.
- Conservative Amino Acid Substitution means a substitution with a functionally equivalent or similar amino acid. In general, substitutions within a group can be considered conservative in structure and function. However, as will be apparent to those skilled in the art, the role played by a particular amino acid residue can be determined by its implications in the three-dimensional structure of the molecule containing that amino acid. For example, cysteine residues can have a less polar, oxidized (disulfide) form compared to their reduced (thiol) form. The long aliphatic portion of the arginine side chain may constitute structurally and functionally important features.
- Conservative amino acid substitutions include specific substitutions based on side chain similarity (Lenininger, Biochemistry, Second Revised Edition, 1975, pp. 73-75: L. Lehninger, Biochemistry, 2nd edition , pp 73-75, Worth Publisher, New York (1975)) and typical permutations.
- Preferred examples of this peptide are the following groups: (I) replacement of the first alanine residue of SEQ ID NO: 1 with an aliphatic amino acid or a methylated aliphatic amino acid; (II) replacement of the second valine residue of SEQ ID NO: 1 with a basic amino acid residue or a methylated basic amino acid residue; (III) substitution of the third phenylalanine residue of SEQ ID NO: 1 with an aromatic amino acid residue, a methylated aromatic amino acid residue, an amino acid residue with an aromatic ring added, or an amino acid residue with a condensed ring added; (IV) replacement of the 4th valine residue of SEQ ID NO: 1 with a methylated valine residue; (V) an aromatic amino acid residue, a methyltryptophan residue, a methylated aromatic amino acid residue, an aromatic ring-added amino acid residue, or a condensed ring-added amino acid residue of the 5th tryptophan residue of SEQ ID NO: 1 Substitution to
- Naturally occurring amino acids can be divided into the following groups based on the nature of their common side chains.
- non-polar amino acid group alanine (hereinafter referred to as “Ala” or simply “A”), valine (hereinafter referred to as “Val” or simply “V”), leucine (hereinafter referred to as “Leu” or simply “ L”), isoleucine (hereinafter referred to as “Ile” or simply “I”), proline (hereinafter referred to as “Pro” or simply “P”), phenylalanine (hereinafter referred to as “Phe” or simply “F” ), tryptophan (hereinafter referred to as “Trp” or simply “W”), methionine (hereinafter referred to as “Met” or simply “M”)
- Al alanine
- valine hereinafter referred to as “Val” or simply “V”
- Leu leucine
- Ile isoleucine
- Pro hereinafter referred to as
- Hydrophobic amino acid group Norleucine, Met, Ala, Val, Leu, Ile
- Neutral hydrophilic amino acid group Cys, Ser, Thr, Asn, Gln
- acidic amino acid group Asp
- Glu (4) basic amino acid group: His, Lys, Arg
- a group of amino acids that influence the orientation of the backbone Gly, Pro (6) aromatic amino acid group: Trp, Tyr, Phe
- Each group also includes unnatural amino acids such as N-methylated amino acids.
- a preferred example of this peptide is a peptide comprising the amino acid sequence set forth in SEQ ID NO: 2 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeTyr-Cys). be.
- Preferred examples of this peptide are the following groups in the amino acid sequence set forth in SEQ ID NO:2: (I) replacement of the first alanine residue of SEQ ID NO: 2 with an aliphatic amino acid or a methylated aliphatic amino acid; (II) replacement of the second valine residue of SEQ ID NO: 2 with a basic amino acid residue or a methylated basic amino acid residue; (III) Substitution of the third phenylalanine residue of SEQ ID NO: 2 with an aromatic amino acid residue, a methylated aromatic amino acid residue, an amino acid residue with an aromatic ring added, or an amino acid residue with a condensed ring added; (IV) replacement of the 4th valine residue of SEQ ID NO: 2 with a methylated valine residue; (V) Substitution of the fifth tryptophan residue of SEQ ID NO: 2 with an aromatic amino acid residue, a methylated aromatic amino acid residue, an amino acid residue with an aromatic ring added, or an amino acid residue with a conden
- this peptide is peptide A as described in positions 1 to 10 of SEQ ID NO: 18 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Val-Ser-Cys). If a peptide containing an amino acid sequence and having a peptide length of 10 or more and 17 or less, Peptide A, or Peptide A, which has an amino acid sequence having substitutions, deletions, and/or insertions of 1 to 6 amino acid residues.
- a peptide having an amino acid sequence in which any one of the 2nd, 3rd, 5th, 8th, and 10th amino acid residues of SEQ ID NO: 18 is substituted in peptide A may be used.
- amino acid residue is substituted means that a specific amino acid residue is substituted with another amino acid residue that may be modified.
- the second amino acid residue of SEQ ID NO: 18 is optionally modified valine (Val) or optionally modified glutamic acid (Glu); the third amino acid residue of SEQ ID NO: 18 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 18 is an optionally modified tryptophan (Trp); The eighth amino acid residue of SEQ ID NO: 18 is optionally modified tyrosine (Tyr), The 10th amino acid residue of SEQ ID NO: 18 may be optionally modified isoleucine (Ile) or optionally modified valine (Val).
- May be modified means that known amino acid modifications and alterations may be made. Examples of modifications are N-methylation, amino acid modifications with the abbreviations described below, modifications (conversions) to the D-form, and conversions to known derivatives of the amino acid in question.
- This peptide preferably has a peptide length of 11 or more and 13 or less.
- the second amino acid residue of SEQ ID NO: 18 is Val or Glu
- the third amino acid residue of SEQ ID NO: 18 is Phe or MeF3C
- the fifth amino acid residue of SEQ ID NO: 18 is Trp or MeTrp
- the eighth amino acid residue of SEQ ID NO: 18 is Tyr or F4OMe
- a peptide in which the tenth amino acid residue of SEQ ID NO: 18 is Ile or Val may be used.
- this peptide is a peptide having the following amino acid sequence at the N-terminus of Peptide A: the 11th amino acid residue of SEQ ID NO: 18 is Ser or His; A peptide in which the 12th amino acid residue of SEQ ID NO: 18 is Cys or Hgl may be used.
- this peptide is peptide B linked to positions 1-10 of SEQ ID NO: 15 (Ala-Val-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Val-Pro-Arg-Asp-Cys). If a peptide having a length of 10 or more and 19 or less containing the amino acid sequence described in the second, Peptide B, or Peptide B having an amino acid sequence in which 1 to 5 amino acid residue substitutions, deletions, and/or insertions are present.
- a peptide having an amino acid sequence in which any one of the 2nd, 3rd, 5th, 8th, and 10th amino acid residues of SEQ ID NO: 15 is substituted in peptide B may be used.
- the second amino acid residue of SEQ ID NO: 15 is optionally modified valine (Val) or optionally modified glutamic acid (Glu);
- the third amino acid residue of SEQ ID NO: 15 is optionally modified phenylalanine (Phe) or tryptophan (Trp);
- the fifth amino acid residue of SEQ ID NO: 15 is an optionally modified tryptophan (Trp);
- the eighth amino acid residue of SEQ ID NO: 15 is optionally modified tyrosine (Tyr)
- the 10th amino acid residue of SEQ ID NO: 15 may be optionally modified isoleucine (Ile) or optionally modified valine (Val).
- These peptides may have a peptide length of 13 or more and 15 or less.
- the second amino acid residue of SEQ ID NO: 15 is Val or Glu
- the third amino acid residue of SEQ ID NO: 15 is Phe, Trp or MeF3C
- the fifth amino acid residue of SEQ ID NO: 15 is Trp or MeTrp
- the eighth amino acid residue of SEQ ID NO: 15 is Tyr, Phe or F4OMe
- a peptide in which the tenth amino acid residue of SEQ ID NO: 15 is Ile or Val may also be used.
- this peptide is a peptide having the following amino acid sequence at the N-terminus of peptide B: the 11th amino acid residue of SEQ ID NO: 15 is Pro; the 12th amino acid residue of SEQ ID NO: 15 is Arg; the 13th amino acid residue of SEQ ID NO: 15 is Glu, Asn, Asp, His, Gln or MeTrp; A peptide in which the 14th amino acid residue of SEQ ID NO: 15 is Cys may be used.
- peptide C is peptide C at position 1 of SEQ ID NO: 214 (MeA-Val-MeF3C-Val-MeW-Asn-Tyr-F4OMe-Ile-Ile-Arg-Arg-Phe-MeY-Cys). Assuming a peptide with a length of 11 or more and 19 or less, which contains the amino acid sequence described in 10th to 10th, Peptide C, or Peptide C having an amino acid sequence in which 1 to 5 amino acid residue substitutions, deletions, and/or insertions are present.
- a peptide having an amino acid sequence in which any one of the 1st, 3rd, 5th, and 8th amino acid residues of SEQ ID NO: 214 is substituted in peptide C may be used.
- the first amino acid residue of SEQ ID NO: 214 is optionally modified alanine (Ala) or optionally modified glutamic acid (Glu), the third amino acid residue of SEQ ID NO: 214 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 214 is an optionally modified tryptophan (Trp); A peptide in which the eighth amino acid residue of SEQ ID NO:214 is an optionally modified tyrosine (Tyr).
- These peptides preferably have a peptide length of 15 or more and 18 or less.
- the first amino acid residue of SEQ ID NO: 214 is Ala, Aib, Abu, Glu, Gly, Ser, Phe, Pro or MeA, particularly preferably Ala or MeA;
- the third amino acid residue of SEQ ID NO: 214 is Phe, F3C, F2C, F2OMe, F4C, Cha, MeF, MeF35dC, MeF4F, MeF4Ome, MeNal1, Me3Py, Me4Py, Me3OMe, MeF3COO, MeF3F, Glu, Epyrl2RCOO, Dpyrl2RCOO or MeF3C, particularly preferably Phe, MeF or MeF3C,
- the fifth amino acid residue of SEQ ID NO: 214 is Trp, MeW, aMeW, dp, F3C, F3F, F3OMe, F4C, F4F, Hph, MemBph, MeNal1, MeNal2, MeoBph, W4
- this peptide has the following amino acid sequence at the N-terminus of Peptide C:
- the 11th amino acid residue of SEQ ID NO: 214 is Arg, Ala, Asp, Gly, Glu, Lys, MeK, MeR, Dap, Dap, Abu, Aib, Hly, dorn, aMeK, A1Me4pip, KCOpipzMe, F4G, Nle, Nva or Orn, particularly preferably Lys or Arg
- the 12th amino acid residue of SEQ ID NO: 214 is Lys, Arg, dr, Tyr, F4G, Orn, Hly, da, Cit, Dap or Dab, particularly preferably Lys, Arg or dr
- the 13th amino acid residue of SEQ ID NO: 214 is Ala, Phe, Asn, Tyr, or pHPeG, particularly preferably Phe or Tyr;
- the 14th amino acid residue of SEQ ID NO: 214 is MeTyr, Tyr,
- peptide D is peptide D at position 1 of SEQ ID NO: 219 (Ala-Glu-Phe-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeY-Cys). Assuming a peptide with a length of 11 or more and 19 or less, which contains the amino acid sequence described in 10th to 10th, Peptide D, or Peptide D having an amino acid sequence in which 1 to 5 amino acid residue substitutions, deletions, and/or insertions are present.
- a peptide having an amino acid sequence in which any one of the 2nd, 3rd, 5th, 8th, and 10th amino acid residues of SEQ ID NO: 219 is substituted in peptide D may be used.
- the second amino acid residue of SEQ ID NO: 219 is optionally modified valine (Val), optionally modified glutamic acid (GIu), optionally modified arginine (Arg), optionally modified lysine (Lys ), optionally modified aspartic acid (Asp), or optionally modified phenylalanine (Phe), the third amino acid residue of SEQ ID NO: 219 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 219 is an optionally modified tryptophan (Trp); The eighth amino acid residue of SEQ ID NO: 219 is optionally modified tyrosine (Tyr), The 10th amino acid residue of SEQ ID NO: 219 may be optionally modified isoleucine (Ile), optionally modified glutamic acid (Glu), or optionally modified lysine (Lys).
- These peptides preferably have a peptide length of 15 or more and 18 or less.
- the second amino acid residue of SEQ ID NO: 219 is Val, Glu, Ala, Arg, Lys, Asp, Phe, Dap, Har, Abu, Nva, AcPr, AtbAhp or Hgl, particularly preferably Glu or Val
- the third amino acid residue of SEQ ID NO: 219 is Phe, F3C, F2C, F2OMe, F4C, Cha, MeF, MeF35dC, MeF4F, MeF4Ome, MeNal1, Me3Py, Me4Py, Me3OMe, MeF3COO, MeF3F, Glu, Epyrl2RCOO, Dpyrl2RCOO or MeF3C, particularly preferably Phe, MeF or MeF3C
- the fifth amino acid residue of SEQ ID NO: 219 is Trp, MeW, aMeW, dp, F3C, F3F, F3OMe, F4C, F4F, Hph, MemB
- this peptide is a peptide having the following amino acid sequence at the N-terminus of peptide D:
- the 11th amino acid residue of SEQ ID NO: 219 is Arg, Ala, Asp, Gly, Glu, Lys, MeK, MeR, Dap, Dap, Abu, Aib, Hly, dorn, aMeK, A1Me4pip, KCOpipzMe, F4G, Nle, Nva or Orn, particularly preferably Lys or Arg
- the 12th amino acid residue of SEQ ID NO: 219 is Lys, Arg, dr, Tyr, F4G, Orn, Hly, da, Cit, Dap or Dab, particularly preferably Lys, Arg or dr
- the 13th amino acid residue of SEQ ID NO: 219 is Ala, Phe, Asn, Tyr, or pHPeG, particularly preferably Phe or Tyr;
- the 14th amino acid residue of SEQ ID NO: 219 is Me
- peptide E is peptide E at position 1 of SEQ ID NO: 296 (Ala-Val-MeF-Val-Trp-Asn-Tyr-Tyr-Ile-Ile-Arg-Arg-Tyr-MeY-Cys). If a peptide having a length of 15 or more and 18 or less containing the amino acid sequence described in ⁇ 15th, Peptide E, or a peptide having an amino acid sequence in which 1 to 10 or 1 to 5 amino acid residue substitutions, deletions, and/or insertions are present in peptide E.
- a peptide having an amino acid sequence in which any one of the 3rd, 5th, 7th, 8th, 11th, 12th, and 13th amino acid residues of SEQ ID NO: 296 is substituted in peptide E may be used.
- the third amino acid residue of SEQ ID NO: 296 is optionally modified phenylalanine (Phe); the fifth amino acid residue of SEQ ID NO: 296 is an optionally modified tryptophan (Trp); the seventh amino acid residue of SEQ ID NO: 296 is an optionally modified tyrosine (Tyr); the eighth amino acid residue of SEQ ID NO: 296 is an optionally modified tyrosine (Tyr);
- the 11th amino acid residue of SEQ ID NO: 296 is optionally modified arginine (Arg) or optionally modified lysine (Lys),
- the 12th amino acid residue of SEQ ID NO: 296 is optionally modified arginine (Arg) or optionally modified lysine (Lys),
- a peptide in which the 13th amino acid residue of SEQ ID NO:296 is either optionally modified tyrosine (Tyr) or optionally modified phenylalanine (Phe).
- the third amino acid residue of SEQ ID NO: 296 is Phe, F3C, F2C, F2OMe, F4C, Cha, MeF, MeF35dC, MeF4F, MeF4Ome, MeNal1, Me3Py, Me4Py, Me3OMe, MeFCOO, MeF3F, Glu, Epyrl2RCOO, Dpyrl2RCOO or MeF3C, particularly preferably Phe, MeF or MeF3C
- the fifth amino acid residue of SEQ ID NO: 296 is Trp, MeW, aMeW, dp, F3C, F3F, F3OMe, F4C, F4F, Hph, MemBph, MeNal1, MeNal2, MeoBph, W4OMe, W1Et, W1Et7Cl, W1iPr, Yph, W1Pr, W5C, W5F, W1aa, W1EtOH
- this peptide has the following amino acid sequence at the N-terminus of Peptide E:
- the 14th amino acid residue of SEQ ID NO: 296 is MeTyr, Tyr, Phe, Ala, aMeY, Glu, Gly, Arg, Val, MeoBphMeBph, MeF, MemBph, MeNal1, MeNal2, MeoBph, MeW or pHPeG, particularly preferably Phe or MeW
- a peptide in which the 15th amino acid residue of SEQ ID NO:296 is Cys or Hgl.
- the third amino acid residue of SEQ ID NO: 296 is phenylalanine (Phe), methylated phenylalanine (MeF), or N-methyl-3-chloro-L-phenylalanine (MeF3C);
- the fifth amino acid residue of SEQ ID NO: 296 is tryptophan (Trp) or methylated tryptophan (MeW);
- the seventh amino acid residue of SEQ ID NO: 296 is tyrosine (Tyr)
- the eighth amino acid residue of SEQ ID NO: 296 is tyrosine (Tyr) or (S)-2-amino-3-(4-methoxyphenyl)propanoic acid (F4OMe)
- the 11th amino acid residue of SEQ ID NO: 296 is arginine (Arg) or lysine (Lys);
- the 12th amino acid residue of SEQ ID NO: 296 is arginine (Arg) or D-arginine (dr);
- a preferred example of this peptide is a peptide consisting of any of the amino acid sequences of SEQ ID NOs: 3 to 200, or of any of the amino acid sequences of SEQ ID NOs: 3 to 200 in which the N-terminus is chloroacetyl-Ala.
- Preferred examples of this peptide consist of the amino acid sequence of any of SEQ ID NOs: 296, 300, 724, 725, or any amino acid sequence of SEQ ID NOs: 296, 300, 724, 725 with chloroacetyl-Ala at the N-terminus.
- a more preferred example of this peptide is a peptide consisting of the amino acid sequence of SEQ ID NO: 296 or 300, or of the amino acid sequence of SEQ ID NO: 296 or 300 in which the N-terminus is chloroacetyl-Ala.
- preferred examples of this peptide consist of the amino acid sequence of any of SEQ ID NOs: 3-200 set forth in Tables 14-16 below, or SEQ ID NOs: 3-200 set forth in Tables 14-16 below.
- Preferred examples of this peptide consist of the amino acid sequence of any of SEQ ID NOs: 296, 300, 724, 725, or any amino acid sequence of SEQ ID NOs: 296, 300, 724, 725 with chloroacetyl-Ala at the N-terminus.
- a more preferred example of this peptide is a peptide consisting of the amino acid sequence of SEQ ID NO: 296 or 300, or of the amino acid sequence of SEQ ID NO: 296 or 300 in which the N-terminus is chloroacetyl-Ala.
- a preferred example of this peptide is any of the peptides described above and is a cyclic peptide.
- a preferred example of this peptide is the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 200, 203 to 552, 645 and 723 to 725, or a complex of the amino acid sequence and a linker (linker-attached peptide described later). , wherein the amino acid sequence site has a cyclic structure.
- a more preferred example of this peptide is the amino acid sequence set forth in any one of SEQ ID NOs: 296, 297, 300, 499, 501, 547, 548, 645, 723, 724, and 725, or a complex of the amino acid sequence and a linker (described later). (linker-added peptide of )), wherein the amino acid sequence site has a cyclic structure.
- a more preferred example of this peptide comprises the amino acid sequence set forth in SEQ ID NO: 296 or 300, or a complex of said amino acid sequence and a linker (linker-added peptide described later), the first to tenth amino acid sequence, It is a peptide whose sequence site has a cyclic structure.
- a particularly preferred example of this peptide is the amino acid sequence set forth in any one of SEQ ID NOs: 2, 9, 21-148, 159-200, 213-448, 450-552, 645 and 723-725, or a combination of said amino acid sequence and a linker. It is a peptide consisting of the 1st to 15th amino acid sequences in the complex (linker-attached peptide described later) and having a cyclic structure at the amino acid sequence site.
- a particularly preferred example of this peptide is the amino acid sequence set forth in any one of SEQ ID NOs: 296, 297, 300, 499, 501, 547, 548, 645, 723, 724, and 725, or a complex of the amino acid sequence and a linker (described later).
- a more particularly preferred example of this peptide is a peptide consisting of the 1st to 15th amino acids in the amino acid sequence shown in SEQ ID NO: 296 or 300 and having a cyclic structure at the amino acid sequence site.
- this peptide are the amino acid sequences set forth in any of SEQ ID NO: 1, SEQ ID NOs: 2-200, 203-552, 645 and 723-725 set forth in Tables 14-19 below, or It is a peptide containing the 1st to 10th amino acid sequences of a complex of the amino acid sequence and a linker (linker-attached peptide described later) and having a cyclic structure at the amino acid sequence site.
- a more preferred example of this peptide is the amino acid sequence set forth in any of SEQ ID NOS: 296, 297, 300, 499, 501, 547, 548, 645, 723, 724, 725 set forth in Tables 17-19 below, or the It is a peptide containing the 1st to 10th amino acid sequences of a complex of an amino acid sequence and a linker (linker-attached peptide described later) and having a cyclic structure at the amino acid sequence site.
- a more preferred example of this peptide is the amino acid sequence set forth in SEQ ID NO: 296 or 300, or the amino acid sequence set forth in any of SEQ ID NOs: 297, 499, 501 and 547 in Tables 17-19 below and a linker. It is a peptide containing the 1st to 10th amino acid sequences of the complex (linker-added peptide described below) and having a cyclic structure at the amino acid sequence site.
- this peptide are those set forth in any of SEQ ID NOs: 2, 9, 21-148, 159-200, 213-448, 450-552, 645 and 723-725 set forth in Tables 14-19 below.
- a peptide consisting of the 1st to 15th amino acid sequences in an amino acid sequence or a complex of said amino acid sequence and a linker (linker-attached peptide described later) and having a cyclic structure at the amino acid sequence site.
- a particularly preferred example of this peptide is the amino acid sequence set forth in any of SEQ ID NOs: 296, 297, 300, 499, 501, 547, 548, 645, 723, 724, 725 set forth in Tables 17-19 below, or the It is a peptide consisting of the 1st to 15th amino acid sequences in a complex of an amino acid sequence and a linker (linker-attached peptide to be described later) and having a cyclic structure at the amino acid sequence site.
- a more particularly preferred example of this peptide is a peptide having a cyclic structure consisting of the amino acid sequence set forth in any one of SEQ ID NOs: 296, 300, 724 and 725, or a complex of said amino acid sequence and a linker (linker-added peptide described later).
- a most preferred example of this peptide is a peptide having a cyclic structure consisting of the amino acid sequence of SEQ ID NO: 296 or 300, or a complex of said amino acid sequence and a linker (linker-added peptide to be described later).
- this peptide include peptides having a cyclic structure consisting of the amino acid sequence set forth in any one of SEQ ID NOs: 296, 300, 724 and 725, and those set forth in Tables 17-19 below. It is a complex of the amino acid sequence of any one of SEQ ID NOs: 297, 499, 501, 547, 548, 645 and 723 and a linker (linker-added peptide to be described later).
- this peptide are peptides having a cyclic structure consisting of the amino acid sequence set forth in SEQ ID NO: 296 or 300, and SEQ ID NOS: 297, 499, 501 or 547 and a linker (linker-added peptide described later).
- a cyclic peptide refers to a peptide in which two amino acids are bonded and all or part of the peptide is cyclic.
- peptides in which amino acids in a peptide form a crosslinked structure those in which a cyclic structure is formed by lactam ring formation or macrocyclization reaction, and those having a lasso peptide-like structure are also included. That is, in the present application, the cyclic peptide may have a linear portion as long as a portion thereof forms a cyclic structure.
- Peptides generally have poor metabolic stability in vivo, and their large size makes it difficult to permeate cell membranes.
- a method of cyclizing a peptide has been taken to address such a problem.
- Peptide cyclization improves protease resistance, improves metabolic stability, and restricts conformational changes, suggesting increased rigidity, membrane permeability, and target protein affinity. It has been.
- Cyclization method Peptide cyclization can be performed according to a known method. For example, but not limited to, by designing the peptide to contain two or more cysteine residues, it can form a cyclic structure through disulfide bonds after translation.
- a peptide having a chloroacetyl group at the N-terminus was synthesized by reprogramming technology of the genetic code. , can also be cyclized by placing a cysteine residue in the peptide.
- Cyclization can also be achieved by synthesizing a peptide having a cycloamide at its N-terminus and placing an Hgl residue in the peptide. As described above, any known cyclization method can be used without particular limitation.
- a preferred example of this peptide is any of the peptides described above, consisting of 15 amino acid residues.
- the number of amide bonds (number and length of amino acids) of the long peptide and the peptide site is not particularly limited, but the total amino acid residue (if the substance bound to the peptide or the linker that binds the substance and the peptide contains amino acids, , excluding those amino acids) is preferably within 20 residues.
- the number of amino acids is 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, and preferably 19 or less, 18 or less, 17 or less, 16 or less, 15 or less.
- the conjugate (complex) of the present invention contains a peptide and a drug, and the peptide and drug are preferably bound via a linker.
- the peptide-drug linker is conjugated to the linker of the peptide containing the linker (hereinafter also referred to as a linker-attached peptide) and the drug, an oligonucleotide for producing an at least partially functional dystrophin protein. and the linker may be formed by chemical bonding through any suitable reactive group.
- a peptide containing a linker may be linked to a linker attached to the 5' end, 3' end, or both ends of the antisense strand and/or the sense strand.
- the antisense strand is ligated with a linker attached to the 5' end, 3' end, or both ends, preferably a linker attached to the 5' end. is.
- the sense strand is ligated with a linker attached to the 5' end, 3' end, or both ends, preferably a linker attached to the 5' end. be.
- a peptide containing a linker is ligated with a linker attached to nucleotides within the antisense and/or sense strands.
- the linker-containing peptide is ligated with the linker attached to a nucleotide within the antisense strand. In one embodiment, the linker-containing peptide is linked to a linker that is attached to a nucleotide that is attached to a nucleotide within the sense strand.
- the antisense strand and/or the sense strand comprise two or more peptides containing linkers, which may be (1) linked at multiple positions on the antisense strand, and (2) at multiple positions on the sense strand. and/or (3) linked as a group at one position on the antisense strand and/or the sense strand.
- One peptide containing a linker may be ligated to each of the 5' and 3' ends of the antisense strand and/or the sense strand.
- the antisense strand and/or the sense strand may have a linker attached to the 5' end, the 3' end, or both ends thereof, and a peptide containing the linker, as well as a cell-permeable peptide linked thereto. .
- a linker attached to the 5′ end, 3′ end, or both ends of the antisense strand is further linked to a cell-permeable peptide, preferably to the 5′ end.
- a peptide having cell-permeability is further linked.
- a linker attached to the 5' end, 3' end, or both ends of the sense strand is further linked to a cell-permeable peptide, preferably attached to the 5' end. It is a linker further linked with a peptide having cell-permeability.
- a linker that binds to the nucleotides inside the antisense strand and/or the sense strand and a peptide that has cell-permeability are further linked.
- the cell-permeable peptide is further ligated to a linker attached to nucleotides within the antisense strand.
- a linker attached to nucleotides within the sense strand is further ligated to a cell-permeable peptide.
- the antisense strand and/or the sense strand contain two or more cell-permeable peptides, which may be (1) linked to multiple positions on the antisense strand, and (2) multiple peptides on the sense strand. and/or (3) may be linked as a group at one position on the antisense strand and/or the sense strand.
- One cell-permeable peptide may be ligated to each of the 5' and 3' ends of the antisense strand and/or the sense strand.
- Pip7a, Pip7b, Pip7b2, Pip7c, Pip7c2, Pip8a, Pip8b, Pip8c, Pip8c2, Pip8d, Pip9b, Pip9b2, Pip9c, pip9c2, Pip9c3, Pip9d2d disclosed in WO2013030569 are preferred as peptides having cell permeability. or any combination thereof. More preferred are Pip9b, Pip9b2, Pip9c, Pip9d, Pip9d2 or any combination thereof. More preferably, it is Pip9b2.
- Pip9b2 has the following structure.
- Peptides or peptides containing linkers may be linked to peptides that have cell-permeability.
- the peptide or linker-containing peptide in the present invention is linked to the N-terminus of a cell-penetrating peptide or to the interior thereof, more preferably to the N-terminus.
- the peptide or linker-containing peptide of the present invention is linked internally to a cell-permeable peptide.
- linker-added peptide is described below.
- An example of the linker in the linker-added peptide has an amino acid length of 1 or more and 15 or less, and the linker contains one or more selected from glycine (Gly) and serine (Ser).
- a preferred example of this linker is cysteine (Cys) whose N-terminus may be modified or lysine (Lys) which may be modified.
- linker in the linker-added peptide has an amino acid length of 1 to 5 and contains one or more selected from D-glutamic acid (de) and methylated glycine (MeG).
- linker is cysteine (Cys) whose N-terminus may be modified or lysine (Lys) which may be modified.
- a linker in a linker-attached peptide is a PEG linker comprising polyethylene glycol (PEG) or derivatives of polyethylene glycol.
- PEG polyethylene glycol
- Derivatives of polyethylene glycol include all known PEG linkers.
- the PEG linker further contains one or more selected from glycine (Gly), serine (Ser), glutamic acid (Glu), arginine (Arg) and lysine (Lys).
- Gly glycine
- Ser serine
- Glu glutamic acid
- Arg arginine
- Lys lysine
- cysteine (Cys) whose N-terminus may be modified or lysine (Lys) which may be modified.
- linker in a linker-added peptide is a linker having a sequence shown by any of SEQ ID NOs: 553-644 shown in Table 20 below.
- a preferred example of the linker in the linker-added peptide is polyethylene glycol (PEG),
- PEG polyethylene glycol
- a G linker that is a peptide linker composed of Gly or MeG, a GS linker that is a peptide linker composed of Gly or MeG and Ser, or an amino acid sequence represented by any of SEQ ID NOs: 553 to 644 shown in Table 20 below. is a linker.
- linker-added peptides include linker-added peptides shown in Tables 15 to 19 below, linkers shown in Table 20 below, and linker-added peptides derived from peptides shown in Tables 14, 17 and 18 below. be done.
- the attached sequence listing shows the amino acid sequence of the peptide portion in the linker-added peptide of each SEQ ID NO.
- linker-added peptides include the following.
- the azide group (-N 3 ) at the end of the linker-added peptide of the specific example above is bound to the 5' end, 3' end, both ends, or the interior of the oligonucleotide, antisense strand and/or sense strand. chemically bond with the reactive group of the linker to form a peptide-drug linker.
- the antisense strand is ligated with a linker attached to the 5' end, 3' end, or both ends, preferably a linker attached to the 5' end. is.
- the sense strand is ligated with a linker attached to the 5' end, 3' end, or both ends, preferably a linker attached to the 5' end. be.
- a linker (also referred to as a cross-linker), as used herein, denotes an intermolecular linkage between a peptide that binds to the transferrin receptor and a drug to be delivered to muscle tissue, and is any linker known or described herein. good.
- said linker is, for example, a chemical linker, a fatty acid linker, a peptide linker (polypeptide linker). It may also be a complex such as a chemical linker and a peptide linker. For example, it may be a linker structure having both PEG and an amino acid residue or peptide moiety, such as SEQ ID NO: 616 or SEQ ID NO: 627, shown in Table 20 below.
- the linker may, for example, dissociate or separate depending on the environment or conditions, or may maintain a stable structure.
- the linker may be a chemical linker.
- Chemical linkers include, but are not limited to, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene and/or Including substituted or unsubstituted heteroarylene.
- Peptides and linkers can also be conjugated via sulfhydryl groups, amino groups (amines), and/or carbohydrates or any suitable reactive group. Homobifunctional and heterobifunctional cross-linkers (conjugation agents) are available from many commercial sources.
- Cross-linkers may comprise flexible arms, eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 carbon atoms.
- Examples of cross-linkers include BSS3 (bis(sulfosuccinimidyl)suberate), NHSS/EDC (N-hydroxysuccinimide and N-ethyl-(dimethylaminopropyl)carbodiimide), sulfo-EMCSS ([Ne- maleimidocaproic acid]hydrazide), hydrazides, and SSATA (N-succinimidyl-SS-acetylthioacetic acid).
- a preferred example of the chemical linker is a PEG (Polyethyleneglycol) linker.
- the PEG linker can be a PEG linker consisting of 1-24 ethylene glycol units.
- the linker may be a fatty acid linker containing a divalent chemical moiety derived from a fatty acid.
- a fatty acid linker can be a linker with 12-aminododecanoic acid.
- a peptide linker comprises at least one amino acid (eg, a peptide of at least 2, 3, 4, 5, 6, 7, 10, 15, 20, 25, 40 or 50 amino acids).
- the linker is a single amino acid (eg, any natural amino acid such as Cys).
- the sequence [Gly-Gly-Gly-Gly-Ser (SEQ ID NO:726)]n, where n is 1, 2, as described in US Pat. No. 7,271,149. 3, 4, 5 or 6) are used.
- serine-rich peptide linkers are used, such as those described in US Pat. No. 5,525,491.
- Serine-rich peptide linkers of the formula [X-X-X-X-Gly]y, where up to two of the Xs are Thr, the remaining Xs are Ser, and y is 1-5 ) (eg, [Ser-Ser-Ser-Ser-Gly (SEQ ID NO: 727)] y (where y is 2 or more)).
- the linker is a single amino acid (eg, any amino acid such as Gly or Ala).
- Linkers that can be cleaved under specific environments and conditions include N-acyl hydrazones, disulfides, Val-Cit (valine-citrulline- p-aminobenzyl alcohol) and the like.
- linkers such as WO2021/054370, WO2020/209285, WO2020/028832, WO2017/221883, WO2012/150960, J.Am.Chem.Soc., 2021, 143, 3416-3429, Antibodies 2020, Linkers described in 9, 2, etc. are included.
- the linker of the above-mentioned linker-added peptide is bound to the 5′ end, 3′ end, both ends, or internal linkers of the oligonucleotide, antisense strand and/or sense strand are bound.
- the antisense strand is ligated with a linker attached to the 5' end, 3' end, or both ends, preferably a linker attached to the 5' end.
- the sense strand is ligated with a linker attached to the 5' end, 3' end, or both ends, preferably a linker attached to the 5' end. be.
- the peptides of the present invention can be produced by known peptide production methods such as chemical synthesis methods such as liquid phase methods, solid phase methods, hybrid methods combining liquid phase methods and solid phase methods, and genetic recombination methods.
- the hydroxyl group of a resin having a hydroxyl group and the carboxyl group of the first amino acid (usually the C-terminal amino acid of the target peptide) whose ⁇ -amino group is protected with a protecting group are esterified.
- Known dehydration condensation agents such as 1-mesitylenesulfonyl-3-nitro-1,2,4-triazole (MSNT), dicyclohexylcarbodiimide (DCC) and diisopropylcarbodiimide (DIPCDI) can be used as the esterification catalyst.
- the protecting group of the ⁇ -amino group of the first amino acid is eliminated, and a second amino acid having all functional groups other than the carboxy group of the main chain protected is added to activate the carboxy group. , joins the first and second amino acids. Furthermore, the ⁇ -amino group of the second amino acid is deprotected, a third amino acid with all functional groups other than the carboxy group of the main chain protected is added, the carboxy group is activated, and the second and A third amino acid is attached. After repeating this process and synthesizing a peptide of the desired length, all functional groups are deprotected.
- Resins for solid-phase synthesis include Merrifield resin, MBHA resin, Cl-Trt resin, SASRIN resin, Wang resin, Rink amide resin, HMFS resin, Amino-PEGA resin (Merck), HMPA-PEGA resin (Merck), and the like. is mentioned. These resins can be used after washing with a solvent (dimethylformamide (DMF), 2-propanol, methylene chloride, etc.).
- a solvent dimethylformamide (DMF), 2-propanol, methylene chloride, etc.
- ⁇ -amino-protecting groups examples include benzyloxycarbonyl (Cbz or Z) group, tert-butoxycarbonyl (Boc) group, fluorenylmethoxycarbonyl (Fmoc) group, benzyl group, allyl group, allyloxycarbonyl (Alloc ) groups and the like.
- Cbz groups can be deprotected by hydrofluoric acid, hydrogenation, etc.
- Boc groups can be deprotected by trifluoroacetic acid (TFA)
- Fmoc groups can be deprotected by treatment with piperidine.
- ⁇ -carboxy group methyl ester, ethyl ester, benzyl ester, tert-butyl ester, cyclohexyl ester and the like can be used.
- hydroxy groups of serine and threonine can be protected with benzyl groups and tert-butyl groups
- hydroxy groups of tyrosine can be protected with 2-bromobenzyloxycarbonyl groups and tert-butyl groups.
- Amino groups of lysine side chains and carboxy groups of glutamic acid and aspartic acid can be protected in the same manner as ⁇ -amino and ⁇ -carboxy groups.
- Condensing agents include, for example, dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIPCDI), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC or WSC), (1H-benzotriazol-1-yloxy)tris (dimethylamino)phosphonium hexafluorophosphate (BOP), 1-[bis(dimethylamino)methyl]-1H-benzotriazolium-3-oxide hexafluorophosphate (HBTU) and the like.
- DCC dicyclohexylcarbodiimide
- DIPCDI diisopropylcarbodiimide
- EDC or WSC 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
- BOP 1-[bis(dimethylamino)methyl]-1H-benzotriazolium-3-oxide
- Cleavage of the peptide chain from the resin can be performed by treatment with an acid such as TFA or hydrogen fluoride (HF).
- an acid such as TFA or hydrogen fluoride (HF).
- Peptide production by genetic recombination can be carried out using a nucleic acid encoding the peptide of the present invention.
- a nucleic acid encoding a peptide in the present invention may be either DNA or RNA.
- Nucleic acids encoding the peptides of the present invention can be prepared by known methods or methods based thereon. For example, it can be synthesized by an automated synthesizer. In order to insert the obtained DNA into a vector, a restriction enzyme recognition site may be added, or a base sequence encoding an amino acid sequence for excising the resulting peptide chain with an enzyme may be incorporated.
- the nucleic acid may also contain a nucleic acid encoding the cell-permeable peptide.
- a chimeric protein expression method can be used in which the peptide of interest is expressed as a chimeric peptide with another peptide.
- a nucleic acid encoding a peptide of interest and a peptide binding thereto is used as the nucleic acid.
- an expression vector is prepared using the nucleic acid encoding the peptide of the present invention.
- the nucleic acid can be inserted downstream of the promoter of the expression vector as it is, or after digestion with a restriction enzyme, addition of a linker, or the like.
- Vectors include Escherichia coli-derived plasmids (pBR322, pBR325, pUC12, pUC13, pUC18, pUC19, pUC118, pBluescript II, etc.), Bacillus subtilis-derived plasmids (pUB110, pTP5, pC1912, pTP4, pE194, pC194, etc.), yeast-derived plasmids ( pSH19, pSH15, YEp, YRp, YIp, YAC, etc.), bacteriophage (e phage, M13 phage, etc.), virus (retrovirus, vaccinia virus, adenovirus, adeno-associated virus (AAV), cauliflower mosaic virus, tobacco mosaic virus) , baculovirus, etc.), cosmids, and the like.
- Escherichia coli-derived plasmids pBR322, pBR325, pUC12,
- a promoter can be appropriately selected according to the type of host.
- the host is an animal cell, for example, SV40 (simian virus 40)-derived promoters and CMV (cytomegalovirus)-derived promoters can be used.
- the host is E. coli, trp promoter, T7 promoter, lac promoter, etc. can be used.
- the expression vector encodes a DNA replication origin (ori), selection marker (antibiotic resistance, auxotrophy, etc.), enhancer, splicing signal, poly A addition signal, tag (FLAG, HA, GST, GFP, etc.) It is also possible to incorporate a nucleic acid or the like that does.
- an appropriate host cell is transformed with the above expression vector.
- the host can be appropriately selected in relation to the vector, and for example, E. coli, Bacillus subtilis, Bacillus), yeast, insects or insect cells, animal cells and the like are used.
- Animal cells that can be used include, for example, HEK293T cells, CHO cells, COS cells, myeloma cells, HeLa cells, and Vero cells. Transformation can be carried out according to known methods such as the lipofection method, calcium phosphate method, electroporation method, microinjection method and particle gun method, depending on the type of host.
- the peptide of interest is expressed by culturing the transformant according to a conventional method.
- Purification of the peptide from the culture of the transformant is carried out by collecting the cultured cells, suspending them in an appropriate buffer, disrupting the cells by sonication, freezing and thawing, and crudely extracting them by centrifugation or filtration. get the liquid If the peptide is secreted into the culture medium, the supernatant is collected. Purification from crude extracts or culture supernatants is also performed by known methods or similar methods (e.g., salting out, dialysis, ultrafiltration, gel filtration, SDS-PAGE, ion exchange chromatography, affinity chromatography, reversed-phase high-performance liquid chromatography, etc.). The resulting peptide may be converted from the free form to a salt or from the salt to the free form by a known method or a method analogous thereto.
- the translation synthesis system may be a cell-free translation system.
- Cell-free translation systems include, for example, ribosomal proteins, aminoacyl-tRNA synthetase (ARS), ribosomal RNA, amino acids, rRNA, GTP, ATP, translation initiation factor (IF) elongation factor (EF), termination factor (RF), and ribosomes. Includes regeneration factors (RRFs), as well as other factors required for translation.
- Escherichia coli extract or wheat germ extract may be added to increase expression efficiency.
- rabbit erythrocyte extract or insect cell extract may be added.
- a system containing RNA polymerase may also be used for transcription from gene DNA.
- Examples of commercially available cell-free translation systems derived from Escherichia coli include RTS-100 (registered trademark) from Roche Diagnostics, PURE SYSTEM from Gene Frontier, and PURE Express In Vitro Protein Synthesis Kit from NEW ENGLAND Biolabs.
- RTS-100 registered trademark
- PURE SYSTEM from Gene Frontier
- PURE Express In Vitro Protein Synthesis Kit from NEW ENGLAND Biolabs.
- As a system using a wheat germ extract those manufactured by ZoiGene, Cellfree Science, etc. can be used.
- a cell-free translation system can obtain an expression product in a highly pure form without purification.
- artificial aminoacyl-tRNA obtained by linking (acylating) a desired amino acid or hydroxy acid to tRNA may be used instead of aminoacyl-tRNA synthesized by natural aminoacyl-tRNA synthetase.
- aminoacyl-tRNAs can be synthesized using artificial ribozymes. Examples of such ribozymes include flexizyme (H. Murakami, H. Saito, and H. Suga, (2003), Chemistry & Biology, Vol. 10, 655-662; H. Murakami, D. Kourouklis, and H. Suga). H. Murakami, A. Ohta, H. Ashigai, H.
- a desired codon can be translated in association with the desired amino acid or hydroxy acid.
- a special amino acid may be used as the desired amino acid.
- the unnatural amino acids required for cyclization as described above can also be introduced into the connecting peptide by this method.
- a preferred strategy is based on the combination of the Fmoc group, which temporarily protects the ⁇ -amino group and allows selective removal by base, and a protective group that temporarily protects the side-chain functional group and is stable to de-Fmoc conditions. .
- the selection of such general peptide side chains is described in Peptide Synthesis and Applications, 2nd edition, supra; B. Fields, R. L. Noble, Solid Phase Peptide Synthesis Utilizing 9-Fluorenylmethoxycarbonyl Amino Acids, Int. J. Peptide Protein Res.
- preferred peptide side chain protecting groups include Boc and Mtt groups for amino groups such as lysine, and tert-butyl groups for carboxyl groups of glutamic acid and aspartic acid. , and also the Trt and Mmt groups for the cysteine thiol group.
- the peptides and analogues thereof described in the present invention can be synthesized in a stepwise manner on solid-phase resins as described above.
- the C-terminal amino acid used and all amino acids and peptides used in the synthesis must have the ⁇ -amino protecting group selectively removed during the synthesis process.
- the C-terminal carboxyl group of a peptide whose N-terminus is appropriately protected with Fmoc or the like or the C-terminal carboxyl group of an amino acid protected with Fmoc is converted to an activated ester with an appropriate reagent and then solidified. Start by adding to an amino group on the phase resin.
- Subsequent elongation of the peptide chain can be achieved by successively repeating removal of the N-terminal protecting group (Fmoc group) and subsequent condensation of the protected amino acid derivative according to the amino acid sequence of the target peptide. In addition, these can release the target peptide at the final stage.
- Fmoc group N-terminal protecting group
- these can release the target peptide at the final stage.
- Teixeira W. et al. E. Benckhuijsen, P. E. de Koning, A. R.I. P. M. Valentijn, J. W. Drijfhout, Protein Pept. Lett. , 2002, 9, 379-385.
- a typical example is TFA/Water/TIS/DODT (volume ratio 92.5:2.5:2.5:2.5).
- Synthesis of the peptide analogs described herein can be performed using a single or multi-channel peptide synthesizer, such as the CEM Liberty Blue synthesizer or the Biotage Syro I synthesizer.
- Condensing agents include, for example, dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIPCDI), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC or WSC), (1H-benzotriazol-1-yloxy)tris (dimethylamino)phosphonium hexafluorophosphate (BOP), 1-[bis(dimethylamino)methyl]-1H-benzotriazolium-3-oxide hexafluorophosphate (HBTU) and the like.
- DCC dicyclohexylcarbodiimide
- DIPCDI diisopropylcarbodiimide
- EDC or WSC 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
- BOP 1-[bis(dimethylamino)methyl]-1H-benzotriazolium-3-oxide
- Drug A drug in the present invention is a compound comprising an oligonucleotide for producing at least partially functional dystrophin protein (hereinafter also referred to as "a compound comprising an oligonucleotide of the present invention").
- the dystrophin gene which is responsible for Duchenne and Becker muscular dystrophies and X-linked dilated cardiomyopathy, is a large gene located in Xp21.1 and consists of 79 exons. Abnormalities in the dystrophin gene, for example, according to Muscle & Nerve 2006; Minor mutations such as insertions and deletions account for 20%, and other mutations such as abnormal splice sites (eg, natural exon skipping) account for 1%. These mutations either shift the reading frame of the codons (out-of-frame mutations) or cause premature stop codons due to nonsense mutations that halt translation prematurely, failing to produce a functional dystrophin protein, and leading to Duchenne muscular dystrophy. develop.
- the dystrophin protein contains an N-terminal actin-binding domain (encoded by exons 2-8), a central rod domain (exons 9-61) containing 24 spectrin-like repeat units (SLRs), and a dystroglycan-binding site. It consists of a cysteine-rich (CR) domain (exons 62-70) and a C-terminal (CT) domain containing the ⁇ -syntrophin binding site, the actin binding domain, CR and CT domains being essential for dystrophin function, whereas The central rod domain retains partial dystrophin function even when part of the 24 SLRs is deleted.
- CR cysteine-rich
- CT C-terminal domain
- reading frame shifts caused by out-of-frame mutations are skipped over one or more exons, preferably exons encoding the central rod domain (exon skipping), or induce cryptic splicing (exon inclusion).
- exons preferably exons encoding the central rod domain (exon skipping), or induce cryptic splicing (exon inclusion).
- the reading frame is modified by multiplying the total number of deleted or duplicated bases by a multiple of 3, an at least partially functional dystrophin protein can be produced.
- a nonsense mutation causes a premature stop codon
- skip the exon containing the mutation if the number of bases in the exon is not a multiple of 3, skip the adjacent exons and is a multiple of 3
- the premature stop codon can be removed to produce an at least partially functional dystrophin protein.
- the "compound comprising an oligonucleotide for producing an at least partially functional dystrophin protein” in the conjugates of the invention hybridizes to a specific nucleotide sequence in the dystrophin-encoding pre-mRNA to target and Oligonucleotides that alter the splicing of multiple exons, resulting in an mRNA encoding an at least partially functional dystrophin protein.
- Such oligonucleotides include nucleotide sequences complementary to the sequences of the 5' or 3' splice sites of the target exon in the pre-mRNA, or to cis sequences that promote or inhibit splicing within the target exon, and Oligonucleotides capable of altering the splicing of .
- nucleic acid or “nucleic acid molecule” as used herein may refer to a monomeric nucleotide or nucleoside, or may refer to an oligonucleotide composed of multiple monomers.
- nucleic acid strand or “strand” are also used herein to refer to oligonucleotides. Nucleic acid strands may be prepared by chemical synthetic methods (e.g., using automated synthesizers) or by enzymatic processes (e.g., without limitation, polymerase, ligase, or restriction reactions) into full or partial strands. can be made.
- nucleoside as used herein is a combination of a base and a sugar.
- the nucleobase (also known as base) portion of a nucleoside is usually a heterocyclic base portion.
- nucleotide further includes a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to the 2', 3', or 5' hydroxyl moieties of the sugar.
- oligonucleotide refers to a linear oligomer formed by covalently linking several to several tens of hydroxyl groups and phosphate groups of sugar moieties between adjacent nucleotides. Within the oligonucleotide structure, the phosphate moieties are generally considered to form the internucleoside linkages of the oligonucleotide. “Modified oligonucleotide” means an oligonucleotide in which the sugar moiety and/or base moiety and/or phosphate group moiety (internucleoside linkage) of at least one nucleotide residue constituting the oligonucleotide is modified. Specific aspects of these modifications are described below.
- Oligonucleotides may contain natural and/or non-natural nucleotides.
- Natural nucleotides include deoxyribonucleotides found in DNA and ribonucleotides found in RNA.
- Deoxyribonucleotides and ribonucleotides are sometimes referred to as “DNA nucleotides” and “RNA nucleotides,” respectively.
- Naturally occurring nucleosides may contain modified bases. In one embodiment, natural nucleosides do not contain modified bases.
- Non-natural nucleotide refers to any nucleotide other than natural nucleotides, including modified nucleotides.
- non-naturally occurring nucleoside refers to any nucleoside other than a naturally occurring nucleoside, including modified nucleosides.
- modified nucleotide is meant a nucleotide having any one or more of modified sugar moieties, modified internucleoside linkages, and modified nucleobases.
- Modified nucleoside means a nucleoside having a modified sugar moiety and/or modified nucleobase.
- Nucleic acid strands comprising unnatural oligonucleotides are often used for desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity. , is preferred over the native form.
- nucleobase or “base” includes both modified and unmodified nucleic acid bases (bases) unless otherwise specified.
- the purine base can be either modified or unmodified purine base.
- the pyrimidine base may be a modified or unmodified pyrimidine base.
- modified nucleobase or “modified base” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil.
- Unmodified nucleobase or “unmodified base” (“natural nucleobase”) means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) , and uracil (U).
- modified nucleobases include 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine or N4-methylcytosine; N6-methyladenine or 8-bromoadenine; 2-thio-thymine; N2-methylguanine or 8-bromoguanine; Inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine and the like.
- the bases are, for example, 2-aminoadenine, alkyl derivatives such as 6-methylated purine; alkyl derivatives such as 2-propylated purine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; -azouracil, 6-azocytosine and 6-azothymine; 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; Thiolated, thioalkylated, hydroxylated and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 7-methylguanine; 5-substituted pyrimidines; 6-azapyrimidines; -6, and O-6 substituted purines (including 2-aminopropyladenine); 5-propynyluracil and 5-prop
- the "compound comprising an oligonucleotide for producing an at least partially functional dystrophin protein” comprises an oligonucleotide that induces exon skipping of the dystrophin gene.
- DMD dystrophin gene
- DMD encodes the dystrophin protein, a major component of the dystrophin-glycoprotein complex that bridges the extracellular matrix with the internal cytoskeleton of muscle cells, particularly muscle fibers.
- DMD deletions, duplications, and point mutations cause dystrophinopathies, including Duchenne muscular dystrophy, Becker muscular dystrophy, and cardiomyopathy.
- this gene has many different transcriptional variants and protein isoforms.
- the dystrophin gene is a human (Gene ID: 1756), non-human primate (e.g., Gene ID: 465559), or rodent gene (e.g., Gene ID: 13405; Gene ID: 24907 ).
- rodent gene e.g., Gene ID: 13405; Gene ID: 24907 .
- multiple human transcript variants e.g., annotated in GenBank RefSeq Accession Numbers: NM_000l09.3, NM_004006.2, NM_004009.3, NM_0040l0.3 and NM_0040l 1.3
- the dystrophin gene is preferably a human dystrophin gene.
- the dystrophin is preferably human dystrophin.
- the target exon to be skipped in the present invention is not particularly limited as long as the skipped target exon results in the production of at least partially functional dystrophin protein-encoding mRNA. can be selected as appropriate.
- skipping exon 51 results in (2 ) for DMD lacking exons 43-52, 45-52, 47-52, 48-52, 49-52, 50-52, or 52, by skipping exon 53;
- skipping exon 45 results in (4) exon 35- (5) for DMDs lacking exons 45 or 47-54, skipping exon 46; (6) for DMDs lacking exons 51, 51-53, or 51-55, by skipping exon 50, (7) exons 51, 53, or 53-55
- skipping exon 52 can result in
- DMD mutations are disclosed, for example, in Flanigan KM, et ah, Mutational spectrum of DMD mutations in dystrophinopathy patients: Application of modern diagnostic techniques to a large cohort. 2009 Dec; 30(12): 1657-66, the contents of which are incorporated herein by reference in their entirety.
- the target exons to be skipped in the present invention are exon 7, exon 8, exon 9, exon 19, exon 23, exon 44, exon 45, exon 46, exon 50, exon 51, exon 52, exon 53, exon 55, or any combination of these exons. More preferably, the target exon is exon 44, exon 45, exon 46, exon 50, exon 51, exon 53, or exon 55, more preferably exon 44, exon 45, or exon 53, particularly preferably exon 53. can be In another embodiment, it may be exon 44. In another embodiment, it may be exon 45. In another embodiment, it may be exon 46.
- Oligonucleotides that skip the target exon include, for example, nucleotides complementary to the sequence of the 5' or 3' splice site of the target exon in pre-mRNA, or the splicing promoting sequence (exon splicing enhancer; ESE) inside the target exon. Oligonucleotides containing sequences are included. Preferably, said oligonucleotide comprises a nucleotide sequence complementary to the sequence of all or part of the ESE of the target exon.
- the nucleotide sequence of each exon of the human dystrophin gene is known (GenBank accession No. NM_004006), and one of ordinary skill in the art can identify the ESEs in each target exon based on the sequence information, for example from Cold Spring Harbor Laboratory. It can be easily predicted using the provided ESE search software "ESE finder".
- a suitable target even if the target exon is human exon 7, exon 8, exon 9, exon 19, exon 23, exon 44, exon 45, exon 46, exon 50, exon 51, exon 52, exon 55.
- the sequences are described in various publications (e.g., Wilton S.D. et al., Mol.
- the target exon is human exon 53 (the nucleotide sequence of exon 53 of the wild-type human dystrophin gene is shown in SEQ ID NO:646): (SEQ ID NO: 646) ttgaaagaat tcagaatcag tgggatgaag tacaagaaca ccttcagaac cggaggcaac agttgaatga aatgttaag gattcaacac aatggctgga agctaagga gaagctgagc aggtcttagg acaggccaga gccaagcttg agtcatggaa ggagggtccc tatacagtag atgcaatcca aaagaaaatc acagaaacca ag
- GAACACCTTCAGAACCGGAGGCAAC (SEQ ID NO: 648; nucleotide sequence of exon 53, nucleotides 36-60 (Golodirsen's target sequence)), GAACACCTTCAGAACCGGAGG (SEQ ID NO: 649; nucleotide sequence from exon 53, nucleotides 36-56 (Viltolarsen's target sequence)) can be mentioned.
- the target exon is human exon 44 (the nucleotide sequence of exon 44 of the wild-type human dystrophin gene is shown in SEQ ID NO:650): (SEQ ID NO: 650) gcgatttgac agatctgttg agaaatggcg gcgttttcat tatgatataa agatatttaa tcagtggcta acagaagctg aacagttttct cagaaagaca caaattcctg agaattggg A sequence consisting of -1 to 44th nucleotides from the 5' end: GGCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTATG (SEQ ID NO: 651); or a sequence consisting of nucleotides 58-115 from the 5' end: TAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACAAATTCC
- TGAGAAATGGCGGC SEQ ID NO: 653; 19th to 32nd exon 44
- AAATGGCGGCGT SEQ ID NO: 654; 23rd to 34th exon 44
- GAAATGGCGGCG SEQ ID NO: 655; 22nd to 33rd exon 44
- CTCAGAAAGACAC SEQ ID NO: 656; exon 44 positions 89-101
- GTGGCTAACAGA SEQ ID NO: 657; exon 44 positions 64-75
- AGTGGCTAAC AG SEQ ID NO: 658; exon 44 position 63 ⁇ 74
- GTGGCTAACAGAAG SEQ ID NO: 659; exon 44, positions 64-77
- AGAAAGACAC AA SEQ ID NO: 660; exon 44, positions 92-103
- two non-contiguous and non-overlapping sequences of SEQ ID NOs:653 and 657, SEQ ID NOs:654 and 658, SEQ ID NOs:655 and 659, and SEQ ID NOs:656 and 660 can be targeted regions.
- nucleotides 9 to 34 from the 5' end of exon 44 ACAGATCTGTTGAGAAATGGCGGCGT (SEQ ID NO: 661); or a sequence consisting of nucleotides 24-49 from the 5' end of exon 44: AATGGCGGCGTTTTCATTATGATATA (SEQ ID NO: 662) All or a partial sequence of 10 or more consecutive nucleotides can be used as a target sequence (see, for example, WO 2013/100190).
- the target exon is human exon 45 (the nucleotide sequence of exon 45 of the wild-type human dystrophin gene is shown in SEQ ID NO:663): (SEQ ID NO: 663) gaactccagg atggcattgg gcagcggcaa actgttgtca gaacattgaa tgcaactggg gaagaaataa ttcagcaatc ctcaaaaca gatgccagta ttctacagga aaattggga agcctgaatc tgcggtggca ggaggtctgc aaacagctgtgc aacagctgt cagacagaaa aaagag
- the target sequence can also be the entire or a continuous
- a sequence consisting of nucleotides 9 to 34 from the 5' end of exon 45 GGATGGC ATTGGGCAGC GGCAAACTG (SEQ ID NO: 667);
- the target sequence can also be the entire or a continuous partial sequence of 10 or more nucleotides (see, eg, US 7,902,160).
- a sequence consisting of the 14th to 28th nucleotides from the 5' end: GCATTGGGCAGCGGC (SEQ ID NO: 668); Sequence consisting of 9th to 26th nucleotides from the 5' end: GGATGGCATTGGGCAGCG (SEQ ID NO: 669; target sequence of Renadirsen); or Sequence consisting of 9th to 26th nucleotides from the 5' end: TTGGGCAGC GGCAAACTG (SEQ ID NO: 670) can be mentioned.
- a sequence consisting of -3 to 19 nucleotides from the 5' end: CAGGAACTCCAGGATGGCATTG (SEQ ID NO: 672; Casimersen's target sequence) can be mentioned.
- nucleotides ⁇ 3 to 32 from the 5′ end of exon 45 CAGGAACTCCAGGATGGCATTGGGCAGCGGCAAAC (SEQ ID NO: 673) All or a partial sequence of 10 or more consecutive nucleotides can be used as a target sequence (see, for example, WO 2013/100190).
- the target exon is human exon 46 (the nucleotide sequence of exon 46 of the wild-type human dystrophin gene is shown in SEQ ID NO:674): (SEQ ID NO: 674) gctagaagaa caaaagaata tcttgtcaga atttcaaaga gatttaaatg aatttgtttt atggttggag gaagcagata acattgctag tatcccactt gaacctggaaa aagagcagca actaaaagaa aagcttgagc aagtcaag
- a subsequence of 10-35 nucleotides contiguous within can be the target sequence (see, eg, US 8,552,172
- any of the following sequences can be mentioned as the target sequence.
- TATCCCACTTGAACCTGGAAAAGAGCAGCA (SEQ ID NO: 676; nucleotide sequence of exon 46, nucleotides 91-120) TTGAACCTGGAAAAGAGCAGCAACTAAAAG (SEQ ID NO: 677; nucleotide sequence of exon 46, nucleotides 99-128) CCTGGAAAAGAGCAGCAACTAAAAGAAAAG (SEQ ID NO: 678; nucleotide sequence of exon 46, nucleotides 104-133) CACTTGAACCTGGAAAAGAGCAGCAACTAA (SEQ ID NO: 679; nucleotide sequence from exon 46, nucleotides 96-125)
- the target exon is human exon 50 (the nucleotide sequence of exon 50 of the wild-type human dystrophin gene is shown in SEQ ID NO:680): (SEQ ID NO: 680) aggaagttag aagatctgag ctctgagtgg aaggcggtaa accgtttact tcaagagctg aggcaaagc agcctgacct agctcctgga ctgaccacta ttggagcctg taagtatact ggatcccat
- a sequence consisting of nucleotides 105 to 129 from the 5' end (110 to 129 is the sequence of intron 50): agcctg taagtatact ggatcccat (SEQ ID NO: 681) All or a partial sequence of 10 or more consecutive nucleotides can be used as a target sequence (SEQ
- the target exon is human exon 51 (the nucleotide sequence of exon 51 of the wild-type human dystrophin gene is shown in SEQ ID NO:682): (SEQ ID NO: 682) ctcctactca gactgttact ctggtgacac aacctgtggt tactaaggaa actgccatct ccaaactaga aatgccatct tccttgatgt tggaggtacc tgctctggca gatttcaacc gggcttggac agaacttacc gactggctttt ctgcttga tcaagttata aaatcacaga gggtgatggt gggtgacctt gaggatatca acgagatgat catcaagcag aagag A sequence consisting of nucleotides 66 to 95 from the 5' end: CTAGAAATGCCATCT
- AGAAATGCCATCTTCCTTGA SEQ ID NO: 684
- AGAAATGCCATCTTCCTTGA SEQ ID NO: 684; target sequence of Drisapersen.
- the target exon is human exon 55 (the nucleotide sequence of exon 55 of the wild-type human dystrophin gene is shown in SEQ ID NO:685): (SEQ ID NO: 685) ggtgagtgag cgagaggctg ctttggaaga aactcataga ttactgcaac agttcccct ggacctggaa aagttttcttg cctggcttac agaagctgaaacaactgcca atgtcctaca ggatgctacc cgtaaggaaa ggctctaga agactccaag ggaggtaaag agctgatgaa acaatggcaa A sequence consisting of -2 to 36 nucleotides from the 5' end: AGGGTGAGTGAGCGAGAGGCTGCTTTGGAAGAAAACTCA
- exon 44, exon 45, exon 46, exon 50, exon 51, exon 53, or exon 55 is the target exon
- exon 44, exon 45, exon 46, exon 50, exon 51, exon 53, or exon 55 is the target exon
- exon 51, exon 53, or exon 55 is the target exon
- oligonucleotide capable of skipping this is described in detail.
- those skilled in the art can design and synthesize suitable oligonucleotides that similarly target them.
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more continuous partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping nucleotide sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; (c) in exon 45, (i) all or
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more continuous partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping nucleotide sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; (c) in exon 45, (i) all or
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more continuous partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping nucleotide sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; (c) in exon 45, (i) all or
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more consecutive partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; (c) in exon 45, (i) the entire or continuous partial sequence of
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more consecutive partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; (c) in exon 45, (i) the entire or continuous partial sequence of
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more consecutive partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; contains a nucleotide sequence complementary to
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 53, for example, all or 10 or more consecutive partial nucleotide sequences of the nucleotide sequence represented by SEQ ID NO: 647, preferably the nucleotide sequence represented by SEQ ID NO: 648 or 649; (b) in exon 45, (i) all or a continuous partial sequence of 10 or more nucleotides of the nucleotide sequence represented by SEQ ID NO: 664, the nucleotide sequence represented by SEQ ID NO: 665 or 666, (ii) sequence All or a continuous partial sequence of 10 or more nucleotides of the nucleotide sequence represented by number 667, preferably the nucleotide sequence represented by SEQ ID NO: 668, 669 or 670, or (iii) the nucleotide represented by SEQ ID NO: 671 (iv) all or a continuous partial sequence of 10 or more nucleotides
- the oligonucleotide that causes the target exon to be skipped comprises (a) in exon 44, (i) a partial sequence of 10 to 35 consecutive nucleotides in the nucleotide sequence represented by SEQ ID NO: 651 or 652, preferably SEQ ID NO: 653, 654, 655, SEQ ID NO: two non-contiguous and non-overlapping sequences selected from the nucleotide sequences represented by 656, 657, 658, 659 and 660, or (ii) all or 10 contiguous nucleotides of the nucleotide sequence represented by SEQ ID NO: 661 or 662 subsequences of the above; (b) in exon 45, (i) the entire or continuous partial sequence of 10 or more nucleotides of the nucleotide sequence represented by SEQ ID NO: 664, the nucleotide sequence represented by SEQ ID NO: 665 or 666, (ii) the sequence All or a continuous partial sequence of 10 or more nucle
- Compounds containing oligonucleotides constituting the conjugate of the present invention are not only single-stranded oligonucleotides consisting of the antisense strand, but also oligonucleotides containing a nucleotide sequence complementary to all or part of the antisense strand sequence.
- a double-stranded oligo formed by a strand herein, an oligonucleotide strand containing a nucleotide sequence complementary to the antisense strand sequence is also referred to as the "sense strand of the present invention" and the above-described single-stranded oligonucleotide including nucleotides).
- the length of the entire antisense strand is, for example, 10 to 35 nucleotides, preferably 12 to 35 nucleotides, more preferably 15 to 30 nucleotides, still more preferably 20 to 30 nucleotides, particularly preferably 20 to 25 nucleotides. Nucleotide length can be mentioned. In another embodiment, the length of the entire antisense strand, including the nucleotide sequence complementary to the target sequence, is 15-35 nucleotides, more preferably 20-35 nucleotides, still more preferably 25-35 nucleotides. can be mentioned.
- the length of the entire antisense strand can be 12-20 nucleotides long, more preferably 15-20 nucleotides long.
- the length of the entire antisense strand is, for example, 9 to 50 nucleotides long, 10 to 40 nucleotides long, 11 to 35 nucleotides long, 12 to 35 nucleotides long, or 12 to 30 nucleotides long, 14 to 30 nucleotides long, 16 to 30 nucleotides long, or 18-25 nucleotides long, or 4-25 nucleotides long, 8-20 nucleotides long, 7-20 nucleotides long, 8-16 nucleotides long, 8-12 nucleotides long, 8-10 nucleotides long good too.
- the length of the entire antisense strand is 9-35 nucleotides in length, 10-35 nucleotides in length, 11-35 nucleotides in length, 12-35 nucleotides in length, 12-30 nucleotides in length, 12-25 nucleotides in length, or It is 12-22 nucleotides long. In one embodiment, the length of the entire antisense strand is 13-35 nucleotides long, 16-30 nucleotides long, 18-30 nucleotides long, 20-30 nucleotides long or 20-25 nucleotides long.
- the length of "consecutive nucleotides” is not particularly limited, but is at least 8 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides. , at least 16 nucleotides in length, at least 17 nucleotides in length, at least 18 nucleotides in length, at least 19 nucleotides in length, or at least 20 nucleotides in length.
- the length of "consecutive nucleotides” is 50 nucleotides or less, 45 nucleotides or less, 40 nucleotides or less, 35 nucleotides or less, 30 nucleotides or less, 28 nucleotides or less, 26 nucleotides or less, or 24 nucleotides or less. , 22 nucleotides or less in length, 20 nucleotides or less in length.
- the length of "consecutive nucleotides” is, for example, 9 to 50 nucleotides, 10 to 40 nucleotides, 11 to 35 nucleotides, 12 to 35 nucleotides, or 12 to 30 nucleotides, 14 to 30 nucleotides, 16-30 nucleotides long, or 18-25 nucleotides long, or 4-25 nucleotides long, 8-20 nucleotides long, 7-20 nucleotides long, 8-16 nucleotides long, 8-12 nucleotides long, 8-10 nucleotides long There may be.
- the length of "consecutive nucleotides” is 9-35 nucleotides, 10-35 nucleotides, 11-35 nucleotides, 12-35 nucleotides, 12-30 nucleotides, 12-25 nucleotides. long or 12-22 nucleotides long. In one embodiment, the length of "consecutive nucleotides” is 13-35 nucleotides, 16-30 nucleotides, 18-30 nucleotides, 20-30 nucleotides or 20-25 nucleotides in length.
- the length of "consecutive nucleotides” is, for example, 10 to 35 nucleotides, preferably 12 to 30 nucleotides, more preferably 15 to 25 nucleotides, still more preferably 20 to 25 nucleotides. can include, but are not limited to.
- the length of "consecutive nucleotides” can include 15-35 nucleotides in length, more preferably 20-35 nucleotides in length, and even more preferably 20-30 nucleotides in length.
- the length of "consecutive nucleotides” can include 12-20 nucleotides in length, more preferably 15-20 nucleotides in length.
- the antisense strand of the invention comprises nucleotides (sequences) other than the nucleotide sequence complementary to the target sequence
- said nucleotides (sequences) are exons 7, exons 8, exons outside said target sequence. 9, exon 19, exon 23, exon 44, exon 45, exon 46, exon 50, exon 51, exon 52, exon 53 or exon 55 nucleotides (sequences).
- the target exon is exon 44, exon 45, exon 46, exon 50, exon 51, exon 53, or exon 55, more preferably exon 44, exon 45, or exon 53, particularly preferably exon 53.
- it may be exon 44.
- it may be exon 45.
- the compounds comprising the oligonucleotides of the present invention target, as antisense strands, two partial nucleotide sequences that are neither contiguous nor overlapping within the same exon (i.e., are complementary to said nucleotide sequences respectively).
- the length of each partial nucleotide sequence is less than 10 nucleotides in length, e.g., 7, 8 Or it may be 9 nucleotides long.
- the upper limit of the length of each partial nucleotide sequence is not particularly limited, it may be, for example, 20 nucleotides or less, preferably 15 nucleotides or less.
- the complementarity of the "complementary nucleotide sequence" in the antisense strand of the present invention to the target sequence is not particularly limited as long as it is 80% or more, preferably 90%. % or more, more preferably 95% or more (eg, 95%, 96%, 97% or more), particularly preferably 100%.
- the complementarity of individual bases is not limited to forming Watson-Crick base pairs with target bases, but forms Hoogsteen base pairs and Wobble base pairs. including doing.
- Complementarity of the "complementary nucleotide sequence" in the sense strand of the present invention to the antisense strand sequence is not particularly limited as long as it is 80% or more with all or part of the antisense strand sequence, preferably 90%. or more, more preferably 95% or more (eg, 95%, 96%, 97% or more), particularly preferably 100%.
- the "complementary nucleotide sequence” may be a sequence that is fully complementary (i.e., hybridizes without mismatches) to the target sequence or antisense strand sequence, as well as sequences that exons under physiological conditions in mammalian cells. As long as skipping can be induced, even a sequence containing 1 to several (e.g., 1, 2, 3, 4, 5, 6) nucleotide mismatches, preferably 1 to 3 nucleotides, more preferably 1 or 2 nucleotide mismatches good.
- the "complementary nucleotide sequence” is a nucleotide sequence that hybridizes with the target sequence or antisense strand sequence under stringent conditions.
- stringent conditions are, for example, conditions described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999, e.g., 6 ⁇ SSC (sodium chloride/sodium citrate )/45°C, followed by one or more washes in 0.2 x SSC/0.1% SDS/50-65°C. Bridization conditions can be selected as appropriate.
- a compound comprising an oligonucleotide of the invention comprises any of the following nucleotide sequences as a sequence complementary to a target sequence in exon 53 of the human dystrophin gene (sequence in the antisense strand).
- GTTGCCTCCG GTTCTGAAGG TGTTC SEQ ID NO: 687: sequence perfectly complementary to nucleotide sequence 36-60 of exon 53
- CCTCCG GTTCTGAAGG TGTTC SEQ ID NO: 688: sequence perfectly complementary to nucleotide sequence 36-56 of exon 53
- a compound comprising an oligonucleotide of the invention comprises any of the following nucleotide sequences as a sequence complementary to a target sequence in exon 44 of the human dystrophin gene (sequence in the antisense strand): (See, for example, WO 2015/194520).
- GTGTCTTTCTGAGCCGCCATTTCTCA SEQ ID NO: 689)
- TCTGTTAGCCACGCCCGCCATTT SEQ ID NO: 690
- CTGTTAGCCACTCGCCGCCATTTC SEQ ID NO: 691)
- TTGTCTTTCTTCTGTTAGCCAC SEQ ID NO: 692
- a compound comprising an oligonucleotide of the invention comprises any of the following nucleotide sequences as a sequence complementary to a target sequence in exon 45 of the human dystrophin gene (sequence in the antisense strand): (See, for example, US 8,324,371). CAGTTTGCCGCTGCCCAATGCCATCCTGGA (SEQ ID NO: 693) TTGCCGCTGCCCAATGCCATCCTGGAGTTC (SEQ ID NO: 694)
- a compound comprising an oligonucleotide of the invention comprises any of the following nucleotide sequences as a sequence complementary to a target sequence in exon 45 of the human dystrophin gene (sequence in the antisense strand): (See, for example, US 7,902,160).
- GCCGCTGCCCAATGC SEQ ID NO: 695)
- CGCTGCCCAATGCCATCC SEQ ID NO: 696; Renadirsen's sequence
- CAGTTTGCCGCTGCCCAA SEQ ID NO: 697
- a compound comprising an oligonucleotide of the invention comprises any of the following nucleotide sequences as a sequence complementary to a target sequence in exon 45 of the human dystrophin gene (sequence in the antisense strand): (See, for example, US 8,524,880).
- CCAATGCCATCCTGGAGTTCCTGTAA SEQ ID NO: 698)
- CAATGCCATCCTGGAGTTCCTG SEQ ID NO: 699; Casimersen's sequence
- a compound comprising an oligonucleotide of the invention comprises any of the following nucleotide sequences as a sequence complementary to a target sequence in exon 46 of the human dystrophin gene (sequence in the antisense strand): (See, for example, US 8,552,172).
- TGCTGCTCTTTTCCAGGTTCAAGTGGGATA SEQ ID NO: 700
- CTTTTAGTTGCTGCTCTTTTCCAGGTTCAA SEQ ID NO: 701
- CTTTCTTTTAGTTGCTGCTCTTTTCCAGG SEQ ID NO: 702
- TTAGTTGCTGCTCTTTTCCAGGTTCAAGTG SEQ ID NO: 703
- sequence in the antisense strand complementary to the target sequence in exon 50 of the human dystrophin gene is disclosed in WO 2013/100190.
- a compound comprising an oligonucleotide of the invention comprises the following nucleotide sequence as a sequence complementary (sequence in the antisense strand) to a target sequence in exon 51 of the human dystrophin gene (e.g. See US 9,018,368).
- CTCCAACATCAAGGAAGATGGCATTTCTAG SEQ ID NO: 704; Eteplirsen's sequence
- compounds comprising oligonucleotides of the invention contain the following nucleotide sequences as sequences complementary (sequences in the antisense strand) to target sequences in exon 51 of the human dystrophin gene.
- TCAAGGAAGATGGCATTTCT SEQ ID NO: 705; Drisapersen's sequence
- sequence in the antisense strand complementary to the target sequence in exon 55 of the human dystrophin gene is disclosed in WO 2013/100190.
- a compound comprising an oligonucleotide of the invention comprises the following nucleotide sequence as a sequence complementary (sequence in the antisense strand) to a target sequence in exon 23 of the mouse dystrophin gene. GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO: 706)
- the base thymine (T) may be uracil (U).
- the base cytosine (C) may be 5-methylcytosine.
- Constituent units of the antisense strand and sense strand of the present invention include, for example, ribonucleotides and deoxyribonucleotides. These nucleotides may be modified (modified nucleotide residues may be referred to as “modified nucleotide residues") or unmodified (unmodified nucleotide residues may be referred to as "unmodified nucleotide residues"). (sometimes referred to as "residue").
- the antisense strand and sense strand of the present invention may be composed of those having a non-ribose phosphate backbone as described below. As used herein, such substitutions to strands having a non-ribose phosphate backbone are also considered to be included in nucleotide modifications.
- the nucleotide residues contain sugars, bases and phosphates as building blocks. Ribonucleotides have the ribose residue as the sugar and replace adenine (A), guanine (G), cytosine (C), 5-methylcytosine (mC) and uracil (U) with thymine (T) as the bases.
- the deoxyribonucleotide residues have deoxyribose residues as sugars and adenine (dA), guanine (dG), cytosine (dC), 5-methylcytosine (dmC) as bases. and thymine (dT) (which can also be replaced by uracil (dU)).
- nucleotides having adenine, guanine, (5-methyl)cytosine, uracil, and thymine are sometimes referred to as adenine nucleotide, guanine nucleotide, (5-methyl)cytosine nucleotide, uracil nucleotide, and thymine nucleotide, respectively.
- the unmodified nucleotide residues are, for example, the same or substantially the same as those naturally occurring in each component, and preferably the same or substantially the same as those naturally occurring in the human body. .
- modified nucleotide residue for example, any component of the unmodified nucleotide residue may be modified.
- modification includes, for example, substitution, addition and/or deletion of the constituent elements, substitution, addition and/or deletion of atoms and/or functional groups in the constituent elements.
- modified nucleotide residue include naturally occurring nucleotide residues, artificially modified nucleotide residues, and the like.
- Limbach et al. (1994, Summary: the modified nucleosides of RNA, Nucleic Acids Res. 22:2183-2196 can be referred to, for example.
- the modified nucleotide residue includes, for example, alternative residues of the nucleotide.
- Modified sugar refers to a sugar that has a substitution and/or any change from the natural sugar moiety (i.e., sugar moieties found in DNA (2'-H) or RNA (2'-OH));
- a “sugar modification” refers to a substitution and/or any change from a naturally occurring sugar moiety.
- Nucleic acid strands may optionally contain one or more modified nucleosides, including modified sugars.
- a “sugar modified nucleoside” refers to a nucleoside having a modified sugar moiety. Such sugar-modified nucleosides may confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to nucleic acid chains.
- nucleosides include chemically modified ribofuranose ring moieties.
- chemically modified ribofuranose rings include, but are not limited to, addition of substituents (including 5' and 2' substituents), bridging of non-geminal ring atoms to form bicyclic nucleic acids (bridged nucleic acids, BNA ), S, N(R), or C(R1)(R2) of the ribosyl ring oxygen atom (R, R1 and R2 each independently represent H, C1-C12 alkyl, or a protecting group) and combinations thereof.
- a "bicyclic nucleoside” refers to a modified nucleoside containing a bicyclic sugar moiety. Nucleic acids containing bicyclic sugar moieties are commonly referred to as bridged nucleic acids (BNAs). Nucleosides containing a bicyclic sugar moiety are sometimes referred to as “bridged nucleosides" or "BNA nucleosides.””Bridgingnucleosides" or “BNA nucleosides” include, for example, methyleneoxy(4'-CH2 - O-2') BNA nucleosides (LNA nucleosides, also known as 2',4'-BNA nucleosides) (e.g.
- a "cationic nucleoside” is defined as, at a certain pH (e.g., human physiological pH (about 7.4), pH of the delivery site (e.g., organelle, cell, tissue, organ, organism, etc.), etc.) A modified nucleoside that exists as a cationic form as compared to a neutral form (such as the neutral form of a ribonucleoside).
- Cationic nucleosides may contain one or more cationic modifying groups at any position of the nucleoside.
- the cationic nucleosides are 2'-Amino-LNA nucleosides (e.g.
- aminoalkyl modified nucleosides e.g. 2'-O-methyl nucleoside and 4'-CH2CH2CH2NH2 nucleoside
- aminoalkyl modified nucleosides e.g. 2'-O-methyl nucleoside and 4'-CH2CH2CH2NH2 nucleoside
- a bicyclic nucleoside having a methyleneoxy (4'-CH2-O-2') bridge is sometimes referred to as an LNA nucleoside.
- sugar modified nucleosides include, but are not limited to, 5'-vinyl, 5'-methyl (R or S), 5'-allyl (R or S), 4'-S, 2'-F ( 2'-fluoro group), 2'-OCH3 (2'-OMe group or 2'-O-methyl group), and 2'-O(CH2)2OCH3 nucleosides, bicyclic nucleosides, cationic nucleosides, peptide nucleic acid nucleosides is mentioned.
- a "2'-modified sugar” means a furanosyl sugar modified at the 2' position.
- a nucleoside containing a 2'-modified sugar is sometimes referred to as a "2'-sugar modified nucleoside".
- the base portion of the sugar modified nucleoside may be a modified base. Preferred is 5-methylcytosine.
- nucleobase moiety (natural, modified, or a combination thereof) may be retained for hybridization with suitable nucleic acid targets.
- nucleotides in the same strand can independently undergo different modifications.
- the same nucleotide may also have modified internucleoside linkages (e.g. phosphorothioate linkages) and modified sugars (e.g. 2'-O-methyl modified sugars or bicyclic sugar).
- modified nucleobases e.g, 5-methylcytosine
- modified sugars e.g, 2'-O-methyl modified sugars or bicyclic sugars.
- the number, type and position of non-natural nucleotides in the nucleic acid chain can affect the antisense effect provided by the nucleic acid complex.
- the selection of modifications may vary depending on the sequence of the target gene, etc., but those skilled in the art should refer to the literature related to antisense methods (for example, WO 2007/143315, WO 2008/043753, and WO 2008/049085).
- the preferred embodiment can be determined by reference.
- the measured value thus obtained is not significantly lower than the measured value of the nucleic acid complex before modification (e.g., When the measured value obtained after modification is 70% or more, 80% or more, or 90% or more of the measured value of the nucleic acid complex before modification), the relevant modification can be evaluated.
- Modification of the nucleotide residue includes, for example, modification of the sugar-phosphate backbone (the backbone also includes bases) (hereinafter referred to as sugar-phosphate backbone).
- the ribose residue when the sugar is ribose, for example, the ribose residue can be modified.
- the ribose residue for example, can be modified at the 2'-position carbon (hereinafter also referred to as 2'-substitution modification), specifically, for example, the hydroxyl group bonded to the 2'-position carbon is modified with a methyl group Hydroxyl groups can be replaced by hydrogen or halogen such as fluoro. Further, by substituting hydrogen for the hydroxyl group at the 2'-position carbon, the ribose residue can be substituted with deoxyribose.
- Said ribose residues may, for example, be stereoisomerically substituted, for example substituted by arabinose residues.
- nucleic acid in which the hydroxyl group bonded to the 2'-position carbon of the sugar is modified with a methoxy group is sometimes referred to as a 2'-OMe modified nucleic acid.
- the 2′-position substituent is preferably —O(CH 2 ) 2 CH 3 .
- a nucleic acid in which the hydroxyl group bonded to the 2'-position carbon is replaced with -O( CH2 ) 2CH3 is sometimes referred to as a 2'-MOE modified nucleic acid.
- Rm and Rn are independently H or substituted or unsubstituted C1 - C10 alkyl.
- Base represents a base.
- the sugar phosphate backbone may be substituted, for example, with a non-ribose phosphate backbone having non-ribose residues (which shall also include non-deoxyribose residues) and/or non-phosphates, such substitutions is also included in the modification of the sugar phosphate backbone.
- the non-ribose phosphate skeleton include uncharged sugar phosphate skeletons.
- the nucleotide substitutes substituted on the non-ribose phosphate backbone include morpholino substitutes, cyclobutyl substitutes, pyrrolidine substitutes, etc., preferably morpholino substitutes.
- a morpholino substitute is a non-ribose phosphate backbone with a group represented by the following general formula as a constituent unit.
- X 1 represents -CH 2 R 1 , -O-CH 2 R 1 , -S-CH 2 R 1 , -NR 2 R 3 or F;
- R 1 represents H, alkyl (e.g. C1 - C10 alkyl);
- R 2 and R 3 are the same or different and are H, alkyl (e.g. C 1 -C 10 alkyl), cycloalkyl (e.g. C 3 -C 10 cycloalkyl), or aryl (e.g. C 6 -C 14 aryl);
- Y 1 represents O, S, CH 2 or NR 1 ;
- Y 2 represents O, S or NR 1 ;
- Z represents O or S;
- the morpholino substitute is preferably phosphorodiamidate morpholino having a group represented by the following formula as a structural unit,
- Phosphorodimethylamidate morpholinos are sometimes referred to as morpholino nucleic acids.
- Morpholino substitutes can be produced, for example, according to International Publication No. 1991/009033 or International Publication No. 2009/064471.
- phosphorodiamidate morpholinos can be prepared according to the methods described in WO 2009/064471.
- substitutes include, for example, artificial nucleic acids.
- PNA peptide nucleic acid
- nucleic acid containing a bicyclic sugar moiety also referred to as BNA: Bridged Nucleic Acid
- tricyclo-DNA tricyclo-DNA
- a bicyclic sugar may be a sugar in which the 2' and 4' carbon atoms are bridged by two or more atoms. Examples of bicyclic sugars are known to those of skill in the art.
- BNAs bicyclic sugar containing nucleic acids
- One subgroup of bicyclic sugar containing nucleic acids (BNAs) is 4'-( CH2 ) p -0-2', 4-'( CH2 ) p - CH2-2 ', 4'-( CH2 ) p -S-2',4'-( CH2 ) p - OCH20-2',4'-( CH2 ) n -N( R3 )-0-( CH2 ) m -2 '[wherein p, m and n represent an integer of 1 to 4, an integer of 0 to 2, and an integer of 1 to 3, respectively; and R 3 is a hydrogen atom, an alkyl group, an alkenyl group, a Represents an alkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group, and a unit substituent (fluorescent or chemiluminescent labeling molecule, functional
- R is a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, an optionally branched or ring-forming alkenyl group having 2 to 7 carbon atoms, It represents an aryl group having 3 to 12 carbon atoms which may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may contain a heteroatom, or an amino group-protecting group for nucleic acid synthesis.
- R is a hydrogen atom, methyl group, ethyl group, n-propyl group, isopropyl group, phenyl group or benzyl group, more preferably R is a hydrogen atom or a methyl group.
- B or Base represents a base.
- Tricyclo-DNA is an artificial nucleic acid whose constituent units are groups represented by the following general formula.
- a peptide nucleic acid is a non-ribose phosphate backbone with a group represented by the following general formula as a structural unit.
- Peptide nucleic acids can be produced, for example, according to the following literature. 1) P. E. Nielsen, M. Egholm, R. H. Berg, O. Buchardt, Science, 254, 1497 (1991) 2) M. Egholm, O. Buchardt, P. E. Nielsen, R. H. Berg, Jacs. , 114, 1895 (1992) 3) K. L. Dueholm, M. Egholm, C. Behrens, L. Christensen, H. F. Hansen, T. Vulpius, K. H. Petersen, R. H. Berg, P. E. Nielsen, O. Buchardt, J. Org. Chem. , 59,5767 (1994) 4) L.
- modified internucleoside linkage refers to an internucleoside linkage having a substitution or any change from a naturally occurring internucleoside linkage (ie, phosphodiester linkage).
- Modified internucleoside linkages include internucleoside linkages containing a phosphorus atom and internucleoside linkages without a phosphorus atom.
- the internucleoside linkage may be a modified internucleoside linkage.
- internucleoside linkages may include modified internucleoside linkages in which the phosphate group is modified. In the sugar phosphate backbone, the phosphate group closest to the sugar residue is called the ⁇ phosphate group.
- the alpha phosphate group is negatively charged and the charge is evenly distributed over the two oxygen atoms that are not bound to the sugar residue.
- the two oxygen atoms that are not linked to the sugar residue in the phosphodiester bond between nucleotide residues are hereinafter also referred to as "non-linking oxygen”. say.
- the two oxygen atoms linking the sugar residue in the phosphodiester bond between said nucleotide residues are hereinafter referred to as "linking oxygens”.
- the ⁇ -phosphate group is preferably modified, for example, to be uncharged or modified to have an asymmetric charge distribution at the non-bonded oxygen.
- the modified internucleoside linkage may, for example, replace the non-bonding oxygen.
- the oxygen is, for example, any of S (sulfur), Se (selenium), B (boron), C (carbon), H (hydrogen), N (nitrogen) and OR (R is an alkyl group or an aryl group) and is preferably substituted by S.
- Either one or both of the non-bonding oxygens may be substituted, preferably either one or both are substituted with S.
- the modified internucleoside linkages include, for example, phosphodiester linkages, phosphorothioate linkages, phosphorodithioate linkages, phosphoroselenate linkages, phosphotriester linkages (methylphosphotriester linkages described in US Pat. No.
- ethylphosphotriester linkage alkylphosphonate linkage (e.g., methylphosphonate linkage as described in US Pat. , a boranophosphate linkage, a boranophosphate ester linkage, a modified internucleoside linkage having a cyclic guanidine moiety (e.g., a modified internucleoside linkage represented by formula (II) below:
- guanidine moiety substituted with 1-4 C 1-6 alkyl groups e.g., a modified internucleoside linkage comprising a tetramethylguanidine (TMG) moiety (e.g., a modification represented by formula (III) below Internucleoside linkage:
- modified internucleoside linkages and phosphoramidate linkages used in self-neutralizing nucleic acids (ZONs) as described in WO2016/081600.
- a phosphorothioate linkage refers to a modified internucleoside linkage in which a sulfur atom replaces the non-bridging oxygen atom of a phosphodiester linkage. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.
- the modified internucleoside linkages are preferably linkages that are more resistant to nucleases than naturally occurring phosphodiester linkages.
- a phosphorothioate bond, a phosphorodithioate bond, and a modified internucleoside bond represented by the above formula (III) are preferred, more preferably a phosphorothioate bond, and a modified internucleoside bond represented by the above formula (III) A bond, more preferably a phosphorothioate bond.
- the modified internucleoside linkage may be chiral-controlled (hereinafter also referred to as chiral-controlled phosphate backbone or chiral-controlled modified phosphate backbone).
- “Chirally controlled” is intended to exist in a single diastereomer about a chiral center, eg, a chiral bound phosphorus.
- Chirally controlled and modified internucleoside linkages may be completely chirally pure or highly chirally pure, e.g. It may have a chiral purity of %de, 99.9% de, or higher.
- chiral purity refers to the proportion of one diastereomer in a mixture of diastereomers, expressed as diastereomeric excess (% de), (diastereomer of interest minus other diastereomer Defined as (stereomers)/(total diastereomers) ⁇ 100 (%).
- modified chirally-controlled internucleoside linkages phosphorothioate linkages chirally-controlled in the Rp or Sp configuration, guanidine moieties substituted with 1-4 C1-6 alkyl groups (e.g., tetramethylguanidine (TMG) ) moiety; see, e.g., Alexander A. Lomzov et al., Biochem Biophys Res Commun., 2019, 513(4), 807-811).
- TMG tetramethylguanidine
- a modified internucleoside linkage containing a cyclic guanidine moiety eg, a modified internucleoside linkage represented by formula (II) above).
- the phosphate group may be substituted with a phosphorus-free linker.
- the linker include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylene Examples include dimethylhydrazo and methyleneoxymethylimino, preferably methylenecarbonylamino group and methylenemethylimino group.
- the phosphate group may be replaced with other non-phosphate containing linkers. Examples of such linkers include those described in "Med. Chem. Commun., 2014, 5, 1454-1471".
- 1/2 or more, more preferably 2/3 or more of the internucleoside linkages contained in the compound containing the oligonucleotide of the present invention are modified with one or more of the above phosphate groups, More preferably, all internucleoside linkages are modified internucleoside linkages.
- 13 or more, preferably 18 or more, more preferably all internucleoside linkages are modified internucleoside linkages, such as phosphorothioate linkages, phosphorodithioate linkages, the above formula (III)
- a modified internucleoside linkage represented by is preferred, more preferably a phosphorothioate linkage, a modified internucleoside linkage represented by the above formula (III), and still more preferably a phosphorothioate linkage.
- the modified internucleoside linkage is a modified internucleoside linkage represented by formula (III) above. Substitution of non-bonding oxygens of phosphodiester linkages with sulfur atoms is important in improving nuclease resistance and tissue distribution of compounds, including oligonucleotides.
- the compound containing the oligonucleotide of the present invention for example, at least one nucleotide residue at the 3' end and 5' end of the oligonucleotide may be modified.
- the modification may be, for example, either one or both of the 3' end and the 5' end.
- the modification is, for example, as described above, and is preferably performed on the terminal phosphate group.
- the phosphate group may, for example, be modified entirely or one or more atoms in the phosphate group may be modified. In the former case, for example, the entire phosphate group may be substituted or deleted.
- Modification of the terminal nucleotide residue includes, for example, addition of other molecules.
- the other molecules include labeling substances to be described later and functional molecules such as protective groups.
- the protecting group include S (sulfur), Si (silicon), B (boron), an ester-containing group, and the like.
- a functional molecule such as the labeling substance can be used, for example, for detection of a compound containing the oligonucleotide of the present invention.
- the other molecule may be added, for example, to the phosphate group of the nucleotide residue, or may be added to the phosphate group or the sugar residue via a spacer.
- the terminal atom of the spacer can be added or substituted, for example, to the binding oxygen of the phosphate group, or O, N, S or C of a sugar residue.
- the binding site of the sugar residue is preferably, for example, C at the 3'-position or C at the 5'-position, or an atom that binds to these.
- Said spacer may also be added or substituted, for example, at the terminal atom of a nucleotide substitute such as said PNA.
- the spacer is not particularly limited, and examples thereof include -( CH2 ) n- , -( CH2 ) nN- , -( CH2 )nO-, -( CH2 ) nS- , O( CH2 CH 2 O) n CH 2 CH 2 OH, abasic sugars, amides, carboxys, amines, oxyamines, oxyimines, thioethers, disulfides, thioureas, sulfonamides, morpholinos and the like, as well as biotin and fluorescein reagents and the like. good.
- the molecule added to the terminal may be, for example, a dye, an intercalating agent (e.g., acridine), a cross-linking agent (e.g., psoralen, mitomycin C), a porphyrin (TPPC4, texaphyrin, sapphirin), a polycyclic Aromatic hydrocarbons (e.g. phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic carriers (e.g.
- an intercalating agent e.g., acridine
- a cross-linking agent e.g., psoralen, mitomycin C
- a polycyclic Aromatic hydrocarbons e.g. phenazine, dihydrophenazine
- artificial endonucleases e.g. EDTA
- lipophilic carriers e.g.
- a compound comprising an oligonucleotide of the invention may be modified at the 5' end of the oligonucleotide, for example with a phosphate group or a phosphate group analogue.
- the phosphate group is, for example, 5′ monophosphate ((HO) 2 (O)PO-5′), 5′ diphosphate ((HO) 2 (O)POP(HO)(O)-O- 5′), 5′ triphosphate ((HO) 2 (O)PO-(HO)(O)POP(HO)(O)-O-5′), 5′-guanosine cap (7-methylation or unmethylated, 7m-GO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'), 5'-adenosine cap (Appp), optional Modified or unmodified nucleotide cap structure (NO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'
- the base is not particularly limited, and may be, for example, a natural base, a non-natural base, an unmodified base, or a modified base.
- the base may be, for example, naturally derived or synthetic.
- As the base for example, common bases, modified analogues thereof, universal bases and the like can be used.
- Examples of the base include purine bases such as adenine and guanine, and pyrimidine bases such as cytosine, 5-methylcytosine, uracil and thymine.
- Other bases include inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine and the like.
- the bases are, for example, 2-aminoadenine, alkyl derivatives such as 6-methylated purine; alkyl derivatives such as 2-propylated purine; 5-halouracil and 5-halocytosine; 5-propynyluracil and 5-propynylcytosine; -azouracil, 6-azocytosine and 6-azothymine; 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil; Thiolated, thioalkylated, hydroxylated and other 8-substituted purines; 5-trifluoromethylated and other 5-substituted pyrimidines; 7-methylguanine; 5-substituted pyrimidines; 6-azapyrimidines; -6, and O-6 substituted purines (including 2-aminopropyladenine); 5-propynyluracil and 5-prop
- modified nucleotide residue may contain, for example, a residue lacking a base, that is, an abasic sugar phosphate backbone.
- residues described in WO 2004/080406 can be used, and the present invention can refer to these documents.
- the conjugate of the present invention may form salts with inorganic bases, organic bases, inorganic acids, organic acids, and the like.
- salts with inorganic bases include alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts; and aluminum salts and ammonium salts.
- salts with the above organic bases include trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N,N'-dibenzylethylenediamine, tris(hydroxymethyl)aminomethane, and meglumine. and salt.
- salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid.
- salts with the above organic acids include formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p- Salts with toluenesulfonic acid are mentioned.
- pharmacologically acceptable salts are preferred, and sodium salts are more preferred.
- a conjugate of the invention may be labeled, for example, with a labeling substance.
- the labeling substance is not particularly limited, and examples thereof include fluorescent substances, dyes, isotopes, and the like.
- the fluorescent substance include fluorophores such as pyrene, TAMRA, fluorescein, Cy3 dye, and Cy5 dye.
- the dyes include Alexa dyes such as Alexa488.
- the isotope include stable isotopes and radioactive isotopes, preferably stable isotopes. The stable isotope has, for example, less risk of radiation exposure and does not require a dedicated facility, so it is easy to handle and can reduce costs.
- the stable isotope does not change the physical properties of the labeled compound, and is excellent as a tracer.
- the stable isotope is not particularly limited, and examples thereof include 2H , 13C , 15N , 17O , 18O , 33S , 34S and 36S .
- a compound containing the oligonucleotide of the present invention can be produced by a chemical synthesis method known per se. Examples include the phosphoramidite method and the H-phosphonate method.
- the chemical synthesis method is performed using, for example, a commercially available automatic nucleic acid synthesizer (e.g., FOCUS (Aapptec), AKTA oligopilot plus 10/100 (GE Healthcare), nS-8II (Gene Design Co., Ltd.), etc.).
- a commercially available automatic nucleic acid synthesizer e.g., FOCUS (Aapptec), AKTA oligopilot plus 10/100 (GE Healthcare), nS-8II (Gene Design Co., Ltd.), etc.
- amidites for example, commercially available amidites such as RNA Phosphoramidites (2'-O-TBDMSi, trade name, Sansenri Pharmaceutical Co., Ltd.), ACE amidite and TOM amidite, CEE amidite, CEM amidite, TEM amidite, etc. can be used.
- an annealing buffer for example, It can be produced by mixing both in 10 mM Tris-HCl buffer (pH 7.5, 20 mM NaCl), heat denaturation at 90°C, and slowly cool and anneal.
- outsource production to a third party e.g., Gene Design Co., Ltd., Hokkaido System Science, Nitto, Promega, Takara, Japan Bio Service, Wuxi, Wuxi STA, or Gene Tools
- a third party e.g., Gene Design Co., Ltd., Hokkaido System Science, Nitto, Promega, Takara, Japan Bio Service, Wuxi, Wuxi STA, or Gene Tools
- the antisense strand containing the nucleotide sequence complementary to the target sequence can be a totalmer, mixmer, or gapmer as one embodiment. Total mers or mix mers are preferred. Total mers are more preferred.
- Totalmers are nucleoside-modified oligonucleotides in which all the nucleosides present in the oligonucleotide are modified nucleosides.
- a totalmer may contain only one type of nucleoside modification, e.g. fully 2'-MOE modified oligonucleotides, fully 2'-MCE modified oligonucleotides, fully 2'-OMe modified oligonucleotides, fully LNA modified oligonucleotides.
- oligonucleotides may include mixtures of different nucleoside modifications, eg, mixtures of LNA nucleosides and 2'-MOE nucleosides.
- a totalmer may include one or two 3' terminal LNA nucleosides. In some embodiments, a totalmer can contain any number of species of modified nucleosides.
- a mix mer mix mer is an oligonucleotide containing both a nucleoside in which the sugar moiety of the nucleoside is modified (hereinafter referred to as sugar-modified nucleoside) and a nucleoside in which the sugar moiety of the nucleoside is DNA (hereinafter referred to as DNA nucleoside), , the oligonucleotide does not contain more than 4 consecutive DNA nucleosides.
- Mixmers are, for example, 2'-O-alkyl, 2'-O-methyl (2'-OMe), 2'-alkoxy, 2'-O-methoxyethyl (2'-MOE), 2'-MCE, May be designed to include affinity-enhancing sugar modified nucleosides, such as 2'-amino, 2'-fluoro, and 2'-F-ANA nucleosides, as well as LNA.
- affinity-enhancing sugar modified nucleosides such as 2'-amino, 2'-fluoro, and 2'-F-ANA nucleosides, as well as LNA.
- Mixmers composed of DNA nucleosides and 2'-substituted modified nucleosides are referred to herein as "2'-substituted modified nucleic acid/DNA mixmers".
- Mixmers composed of DNA nucleosides and 2'-MOE modified nucleosides are referred to as "2'-MOE/DNA mixmers".
- Mixmers composed of DNA nucleosides and 2'-MCE modified nucleosides are referred to as “2'-MCE/DNA mixmers”.
- Mixmers composed of DNA nucleosides and bridging nucleosides are termed "BNA/DNA mixmers”.
- Bridging nucleosides may include modified nucleobases (eg, 5-methylcytosine).
- LNA/DNA mixmers Mixmers composed of naturally occurring deoxyribonucleosides and LNA nucleosides are referred to herein as "LNA/DNA mixmers”.
- Mixmers are not necessarily restricted to containing only two nucleosides.
- Mixmers can contain any number of species of nucleosides, whether unmodified or modified nucleosides. In some embodiments, a mixmer does not contain more than 3 consecutive DNA nucleosides. In some embodiments, mixmers do not contain more than 2 consecutive DNA nucleosides. In some embodiments, mixmers are sugar phosphates modified at two or more (preferably three or more, more preferably four or more, particularly preferably five or more) consecutive sugar moieties such as LNAs. It does not include the region consisting of the skeleton.
- the 5' and 3' wing regions of the gapmer-type antisense strand are each independently 2-5 nucleotides long. Also, the length of the deoxy gap region of the gapmer-type antisense strand is 7 to 10 nucleotides.
- the gapmer-type antisense strand preferably has a modified sugar moiety in at least one nucleoside constituting the 5' and 3' wing regions.
- Sugar modification includes, for example, 2'-OMe, 2'-MOE, 2'-MCE, and modification with the above-described cross-linked nucleic acids (eg, LNA, AmNA, GuNA, scpBNA).
- LNA Long Term Evolution
- AmNA AmNA
- GuNA GuNA
- scpBNA scpBNA
- LNA gapmer LNA gapmer is a gapmer oligonucleotide in which at least one of the affinity-enhancing modified nucleosides in the wings is an LNA-modified nucleoside (hereinafter also referred to as LNA nucleoside).
- the LNA gapmer is an LNA gapmer, wherein the 3' terminal nucleoside of the oligonucleotide is an LNA nucleoside.
- the two 3'-most nucleosides of the oligonucleotide are LNA nucleosides.
- both the 5' and 3' wings of the LNA gapmer comprise LNA nucleosides
- the nucleoside-modified oligonucleotide is an LNA oligonucleotide, such as a gapmer oligonucleotide
- all nucleosides of oligonucleotides are either LNA nucleosides or DNA nucleosides.
- mixed wing gapmers or mixed wing gapmers means that at least one of the wing regions comprises at least one LNA nucleoside and at least one non-LNA modified nucleoside, e.g. at least one 2' substitution.
- modified nucleosides such as 2'-O-alkyl, 2'-O-methyl (2'-OMe), 2'-alkoxy, 2'-O-methoxyethyl (2'-MOE), 2'-MCE, 2 It refers to LNA gapmers, including '-amino, 2'-fluoro, and 2'-F-ANA nucleosides, and the like.
- mixed wing gapmers have one wing (e.g., 5' or 3') comprising only 2'-substituted modified nucleosides and the other wing comprising 2'-substituted modified nucleosides and optionally LNA nucleosides.
- Has wings eg, 3' or 5'.
- mixed wing gapmers include LNA nucleosides and 2'-MOE nucleosides in the wings.
- mixed wing gapmers include LNA nucleosides and 2'-MCE nucleosides in the wings.
- the antisense strand of the present invention when it is a total mer, it is preferably a fully 2'-MOE modified oligonucleotide, a fully 2'-MCE modified oligonucleotide, a fully 2'-O-methyl modified oligonucleotide. , fully LNA-modified oligonucleotides, fully morpholino-modified oligonucleotides, or fully peptide nucleic acid-modified oligonucleotides.
- they are fully 2'-MOE modified oligonucleotides, fully 2'-MCE modified oligonucleotides or fully morpholino modified oligonucleotides (preferably PMO, more preferably fully phosphorodimethylamidate morpholino modified oligonucleotides).
- PMO more preferably fully phosphorodimethylamidate morpholino modified oligonucleotides
- a completely 2'-MOE modified oligonucleotide or a completely 2'-MCE modified oligonucleotide can be preferably used.
- the antisense strand of the present invention is a total mer such as a fully 2'-MOE modified oligonucleotide, a fully 2'-MCE modified oligonucleotide, a fully 2'-OMe modified oligonucleotide, a fully LNA modified oligonucleotide, or if it is a mixmer, the sugar phosphate backbone has at least one (e.g., 2 or more, 4 or more, 6 or more, 8 or more, 10 or more, 12 or more, 16 or more) modified nucleosides It is preferred to include interlinkages. More preferably, all internucleoside linkages of the sugar phosphate backbone are modified internucleoside linkages.
- the modified internucleoside linkage is preferably a phosphorothioate linkage, a phosphorodithioate linkage, or a modified internucleoside linkage represented by the formula (III), more preferably a phosphorothioate linkage, or a modified nucleoside represented by the formula (III). It is an interlinkage, more preferably a phosphorothioate bond.
- the modified internucleoside linkage is a modified internucleoside linkage represented by formula (III) above.
- the antisense strand of the invention comprises 2'-MOE modified nucleosides (also referred to herein as 2'-MOE phosphorothioate nucleotides) connected through a phosphorothioate backbone. , or consisting of.
- One embodiment further comprises modified, preferably 2'-MOE modified nucleosides, more preferably oligonucleotides further comprising 2'-MOE phosphorothioate nucleotides, particularly preferably 2'-MOE phosphorothioate nucleotides. It may be an oligonucleotide serving as a basic skeleton (hereinafter also referred to as a completely 2'-MOE phosphorothioate-modified oligonucleotide).
- the antisense strand of the invention comprises 2'-MCE modified nucleosides (also referred to herein as 2'-MCE phosphorothioate nucleotides) connected through a phosphorothioate backbone. or consist of.
- One embodiment further comprises modified, preferably 2'-MCE modified nucleosides, more preferably oligonucleotides further comprising 2'-MCE phosphorothioate nucleotides, particularly preferably 2'-MCE phosphorothioate nucleotides. It may be an oligonucleotide serving as a basic skeleton (hereinafter also referred to as a completely 2'-MCE phosphorothioate-modified oligonucleotide).
- the antisense strand of the invention is a hybrid oligonucleotide comprising 2'-MOE phosphorothioate nucleotides and LNA.
- This particular oligonucleotide contains better sequence specificity compared to equivalents whose sugar moieties consist solely of LNA modifications, and improved potency compared to fully 2'-MOE phosphorothioate modified oligonucleotides.
- the antisense strand of the invention is a hybrid oligonucleotide comprising 2'-MCE phosphorothioate nucleotides and LNA.
- This particular oligonucleotide contains better sequence specificity compared to equivalents in which the sugar moieties consist solely of LNA modifications, and improved potency compared to fully 2'-MCE phosphorothioate modified oligonucleotides.
- the antisense strand of the invention is a 2'-substitution modified nucleic acid/DNA mixmer or a BNA/DNA mixmer, preferably a 2'-MOE/DNA mixmer, a 2'-MCE/ DNA mixmer or LNA/DNA mixmer, more preferably 2'-MOE/DNA mixmer or 2'-MCE/DNA mixmer, particularly preferably 2'-MOE/DNA mixmer .
- 2'-MCE/DNA mixmers are particularly preferred.
- a completely morpholino-modified oligonucleotide which is a particularly preferred embodiment of the antisense strand of the present invention, is an oligonucleotide having a group represented by the following general formula as a structural unit.
- the fully morpholino-modified oligonucleotide is preferably a fully phosphorodiamidate morpholino-modified oligonucleotide (also referred to as PMO in this specification) having a group represented by the following formula as a constituent unit,
- R 2 and R 3 are alkyl (e.g., C 1 -C 10 alkyl), Base is as defined above)
- a completely phosphorodimethylamidate morpholino-modified oligonucleotide having a group represented by the following formula (phosphorodimethylamidate morpholino) as a structural unit
- a complete peptide nucleic acid modified oligonucleotide is an oligonucleotide having a group represented by the following general formula as a constituent unit.
- a compound comprising an oligonucleotide of the present invention may be a single-stranded oligonucleotide comprising a sequence complementary to a target sequence, i.e., an antisense oligonucleotide (ASO), or an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- ASO antisense oligonucleotide
- a double-stranded oligonucleotide consisting of a sense strand (also referred to as a "first nucleic acid strand") and a sense strand (also referred to as a "second nucleic acid strand”) complementary in whole or in part to the sense strand (also referred to as a "second nucleic acid strand”) may be Complementarity of the antisense strand sequence to the sense strand sequence is as defined above for the complementarity of the antisense strand sequence to the target sequence.
- the antisense strand of the double-stranded oligonucleotide (nucleic acid complex) preferably contains an antisense oligonucleotide region, more preferably an antisense oligonucleotide.
- an antisense oligonucleotide is a single-stranded oligonucleotide with an antisense effect.
- An antisense oligonucleotide may be an antisense strand that forms a nucleic acid complex.
- an antisense oligonucleotide region is a region of an oligonucleotide (antisense strand) having an antisense effect.
- the term "antisense effect" refers to the interaction between a target transcript (RNA sense strand) and a strand (e.g., DNA strand) that is complementary to a partial sequence of a transcript or the like and designed to cause an antisense effect.
- Modulation of expression of a target transcript can be achieved by suppressing or reducing the expression of a target gene or the level (expression amount) of a target transcript, or, in certain instances, inhibiting translation or altering splicing function effects, such as exon skipping. , or transcript degradation).
- ASO antisense oligonucleotide
- the ASO binds to the target gene transcript (mRNA), forming a partial duplex. be done.
- This partial duplex serves as a cover to prevent translation by the ribosome, thus inhibiting expression of the protein encoded by the target gene at the translational level.
- oligonucleotides containing DNA are introduced into cells as ASOs, partial DNA-RNA heteroduplexes are formed.
- This heteroduplex structure is recognized by RNase H, resulting in degradation of the mRNA of the target gene, thus inhibiting expression of the protein encoded by the target gene at the expression level. This is termed the "RNase H dependent pathway".
- antisense effects can be produced by targeting introns of pre-mRNAs.
- Antisense effects may also be produced by targeting miRNAs, in which case the function of the miRNA may be inhibited and the expression of genes whose expression is normally regulated by the miRNA may be increased.
- modulation of target transcript expression can be a reduction in target transcript abundance.
- the length of the antisense oligonucleotide region in the first nucleic acid strand is usually at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, It may be at least 10 nucleotides in length, at least 11 nucleotides in length, at least 12 nucleotides in length, or at least 13 nucleotides in length, but is not particularly limited.
- the length of the antisense oligonucleotide region may be the same as the entire length of the first nucleic acid strand.
- the antisense strand contains a base sequence capable of hybridizing to at least part of the target transcript (eg, any target region).
- Target regions may include 3'UTRs, 5'UTRs, exons, introns, coding regions, translation initiation regions, translation termination regions or other nucleic acid regions.
- the antisense effect is measured, for example, by administering a test nucleic acid compound to a subject (eg, a mouse), and, for example, several days later (eg, 2-7 days later), the expression is modulated by the antisense effect provided by the test nucleic acid compound. It can be carried out by measuring the expression level (amount) of the target gene or the level (amount) of the target transcript (for example, the amount of mRNA or RNA such as microRNA, the amount of cDNA, the amount of protein, etc.).
- the measured target gene expression level or target transcript level is at least 10%, at least 20%, at least 25%, at least 30%, or at least 40% compared to a negative control (e.g., vehicle administration) If so, it indicates that the test nucleic acid compound is capable of producing an antisense effect (eg, reduction in target transcript abundance).
- a negative control e.g., vehicle administration
- the compound containing the oligonucleotide of the present invention is a single-stranded oligonucleotide, for example, a single-stranded oligonucleotide consisting of an antisense oligonucleotide, it is desired to introduce at the 5' end, 3' end, or both ends of the antisense oligonucleotide.
- Functional molecules other than the peptides of the present invention that can be efficiently delivered to cells, tissues, organs, etc. can be bound.
- the functional molecule may be linked to an internal nucleotide of the antisense oligonucleotide. There are no particular limitations on the structure of "functional molecules" according to certain embodiments.
- Desired functions include labeling and purification functions.
- moieties that provide a labeling function include compounds such as fluorescent proteins, luciferase, and the like.
- moieties that provide a purification function include compounds such as biotin, avidin, His-tag peptides, GST-tag peptides, FLAG-tag peptides.
- the binding position and type of binding on the second nucleic acid strand of the functional molecule are as described above for binding to compounds, including oligonucleotides.
- the 5' end of the antisense strand or antisense oligonucleotide may be any group of the following chemical formulas (1) to (3).
- group (1) the groups represented by (1), (2) and (3) above are referred to as “group (1)”, “group (2)” and “group (3)”, respectively. Furthermore, it is preferably “group (2)”.
- a compound comprising an oligonucleotide of the invention can be a single-stranded antisense oligonucleotide (ASO).
- ASO single-stranded antisense oligonucleotide
- an ASO consisting of a nucleotide sequence represented by SEQ ID NO: 687, which is completely complementary to the 36th to 60th nucleotide sequences of human exon 53, [MoG][MoT][MoT][MoG][MoC][MoC][MoC][MoG][MoG][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoG][MoA ][MoA][MoG][MoG][MoT][MoG][MoT][M
- the base thymine (T) may be uracil (U).
- the base cytosine (C) may be 5-methylcytosine.
- the 5' end may be any group of the following chemical formulas (1) to (3).
- group (1) the groups represented by (1), (2) and (3) above are referred to as “group (1)”, “group (2)” and “group (3)”, respectively. Furthermore, it is preferably “group (2)”.
- Mo in the above sequence indicates PMO (preferably morpholino nucleic acid).
- ASO consisting of a nucleotide sequence represented by SEQ ID NO: 687 that is completely complementary to the 36th to 60th nucleotide sequences of human exon 53, [MoG][MoT][MoT][MoG][MoC][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoG][MoA ][MoA][MoG][MoG][MoT][MoG][MoT][MoT][MoT][MoC] (SEQ ID NO: 687-1).
- the ASO consisting of the nucleotide sequence represented by SEQ ID NO: 688 which is completely complementary to the 36th to 56th nucleotide sequences, [MoC][MoC][MoT][MoC][MoG][MoG][MoT][MoT][MoT][MoG][MoA][MoG][MoG][MoT ][MoT][MoC] (SEQ ID NO: 688-1).
- Mo in the above sequence indicates PMO (preferably morpholino nucleic acid).
- compounds containing the oligonucleotides of the present invention include compounds containing the following antisense oligonucleotides (antisense strands).
- antisense oligonucleotide consisting of a nucleotide sequence represented by SEQ ID NO: 687 that is completely complementary to the 36th to 60th nucleotide sequences of human exon 53, [MoG][MoT][MoT][MoG][MoC][MoT][MoC][MoC][MoG][MoG][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoG][MoA ][MoA][MoG][MoG][MoT][MoG][MoT][MoT][MoC][MoC]
- an antisense oligonucleotide consisting of a nucleotide sequence represented by SEQ ID NO: 706 that is completely complementary to the sequence in mouse exon 23, [MoG][MoG][MoC][MoA][MoA][MoA][MoC][MoC][MoT][MoC][MoG][MoG][MoC][MoT][MoT][MoA ][MoC][MoT][MoG][MoA][MoA][MoT] (SEQ ID NO: 706-1).
- Mo in the above sequence indicates PMO (preferably morpholino nucleic acid).
- an antisense oligonucleotide consisting of a nucleotide sequence represented by SEQ ID NO: 687 that is completely complementary to the 36th to 60th nucleotide sequences of human exon 53, [MoG][MoT][MoT][MoG][MoC][MoT][MoC][MoG][MoG][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoG][MoA ][MoA][MoG][MoG][MoT][MoG][MoT][MoT][MoT][MoC] (SEQ ID NO: 687-1).
- an antisense oligonucleotide consisting of a nucleotide sequence represented by SEQ ID NO: 688 that is completely complementary to the 36th to 56th nucleotide sequences, [MoC][MoC][MoT][MoC][MoG][MoG][MoT][MoT][MoT][MoG][MoA][MoA][MoG][MoG][MoT ][MoG][MoT][MoT][MoC] (SEQ ID NO: 688-1).
- the base thymine (T) may be uracil (U).
- the base cytosine (C) may be 5-methylcytosine.
- the 5' end may be any group of the following chemical formulas (1) to (3).
- group (1) the groups represented by (1), (2) and (3) above are referred to as “group (1)”, “group (2)” and “group (3)”, respectively. Furthermore, it is preferably “group (2)”.
- the compound containing the oligonucleotide of the present invention comprises the antisense oligonucleotide region in the antisense strand (first nucleic acid strand) and all or part of the antisense strand. and a complementary sense strand (second nucleic acid strand), wherein the first nucleic acid strand is annealed to the second nucleic acid strand.
- the conjugate of the invention is such that the peptide is linked directly or via a linker to the second nucleic acid strand.
- a compound containing the oligonucleotide of the present invention is a double-stranded oligonucleotide consisting of an antisense oligonucleotide region in an antisense strand (first nucleic acid strand) and a sense strand (second nucleic acid strand) complementary thereto.
- the second nucleic acid strand may comprise a nucleotide sequence complementary to the entire length of the sequence complementary to the target sequence in the first nucleic acid strand, or a portion of the sequence complementary to the target sequence. It may contain complementary nucleotide sequences.
- the second nucleic acid strand comprises or consists of a complementary region complementary to all or part of the first nucleic acid strand.
- the length of the nucleotide sequence in the second nucleic acid strand complementary to the first nucleic acid strand is usually at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least It may be, but is not limited to, 7 nucleotides long, at least 8 nucleotides long, at least 9 nucleotides long, at least 10 nucleotides long, at least 11 nucleotides long, at least 12 nucleotides long, or at least 13 nucleotides long.
- the complementary region in the second nucleic acid strand has a length of 35 nucleotides or less, 30 nucleotides or less, 25 nucleotides or less, 24 nucleotides or less, 23 nucleotides or less, 22 nucleotides or less, 21 nucleotides or less, or 20 nucleotides or less. , 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, or 16 nucleotides or less.
- the complementary region in the second nucleic acid strand is 9-35 nucleotides long, 10-35 nucleotides long, 11-35 nucleotides long, 12-35 nucleotides long, 12-30 nucleotides long, 12-25 nucleotides long. long or 12-22 nucleotides long. In one embodiment, the complementary region in the second nucleic acid strand is 13-35 nucleotides long, 16-30 nucleotides long, 18-30 nucleotides long, 20-30 nucleotides long or 20-25 nucleotides long.
- the complementary region in the second nucleic acid strand is 4-35 nucleotides long, 4-30 nucleotides long, 4-25 nucleotides long, 8-20 nucleotides long, 8-16 nucleotides long, 8-12 nucleotides long. long, 8-10 nucleotides long.
- the second nucleic acid strand is not particularly limited, but has a length of at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, or at least 12 nucleotides. or at least 13 nucleotides in length.
- the second nucleic acid strand has a length of 50 nucleotides or less, 45 nucleotides or less, 40 nucleotides or less, 35 nucleotides or less, 30 nucleotides or less, 28 nucleotides or less, 26 nucleotides or less, 24 nucleotides or less, or 22 nucleotides or less. , 20 nucleotides or less, 18 nucleotides or less, 16 nucleotides or less, 14 nucleotides or less, 12 nucleotides or less, 10 nucleotides or less, or 9 nucleotides or less.
- the second nucleic acid strand is, for example, 9 to 50 nucleotides long, 10 to 40 nucleotides long, 11 to 35 nucleotides long, 12 to 35 nucleotides long, or 12 to 30 nucleotides long, 14 to 30 nucleotides long, or 16 to 30 nucleotides long. , or 18-25 nucleotides long, or 4-25 nucleotides long, 8-20 nucleotides long, 7-20 nucleotides long, 8-16 nucleotides long, 8-12 nucleotides long, 8-10 nucleotides long.
- the second nucleic acid strand is 9-35 nucleotides long, 10-35 nucleotides long, 11-35 nucleotides long, 12-35 nucleotides long, 12-30 nucleotides long, 12-25 nucleotides long or 12-22 nucleotides long. Nucleotide length. In one embodiment, the second nucleic acid strand is 13-35 nucleotides long, 16-30 nucleotides long, 18-30 nucleotides long, 20-30 nucleotides long or 20-25 nucleotides long.
- the complementary region in the second nucleic acid strand can be complementary to at least part of the antisense oligonucleotide region in the first nucleic acid strand.
- the complementary region in the second nucleic acid strand may be complementary to the entire antisense oligonucleotide region in the first nucleic acid strand.
- the complementary region in the second nucleic acid strand may be complementary to portions other than the antisense oligonucleotide region in the first nucleic acid strand.
- International Publication No. 2013/089283 Nishina K, et. al., Nature Communication, 2015, 6:7969, and Asami Y, et al., Drug Discoveries & Therapeutics. 2016; 10(5 ):256-262.
- the second nucleic acid strand may contain at least four contiguous ribonucleosides complementary to the antisense oligonucleotide region in the first nucleic acid strand.
- the second nucleic acid strand may contain at least four contiguous ribonucleosides, deoxyribonucleosides and/or modified nucleosides complementary to the antisense oligonucleotide region in the first nucleic acid strand.
- Preferred are ribonucleosides and/or deoxyribonucleosides. Ribonucleosides are more preferred.
- At least four consecutive ribonucleosides and/or deoxyribonucleosides in the second nucleic acid strand are preferably linked by naturally occurring internucleoside linkages, ie phosphodiester linkages.
- All nucleosides of the second nucleic acid strand may be composed of ribonucleosides, deoxyribonucleosides and/or modified nucleosides. All nucleosides of the second nucleic acid strand may be composed of deoxyribonucleosides and/or modified nucleosides, or may be free of ribonucleosides. In one embodiment, all nucleosides of the second nucleic acid strand may be composed of deoxyribonucleosides and/or modified nucleosides.
- At least 1, at least 2, at least 3, or at least 4 nucleosides from the end (5' end, 3' end, or both ends) of the second nucleic acid strand may be modified nucleosides.
- Modified nucleosides include 2'-modified nucleosides (e.g. 2'-O-methyl nucleosides) and/or bridged nucleosides (e.g. 2',4'-BNA NC nucleosides (e.g. 2',4'-BNA NC [NH ] nucleosides, 2′,4′-BNA NC [N-Me] nucleosides)), preferably 2′-modified nucleosides (e.g.
- 2′-O-methyl nucleosides and/or 2′,4 '-BNA NC nucleosides (e.g., 2',4'-BNA NC [NH] nucleosides, 2',4'-BNA NC [N-Me] nucleosides, more preferably 2'-O-methyl nucleosides and /or 2',4'-BNA NC [N-Me] nucleosides
- Modified nucleosides may contain modified bases, preferably 5-methylcytosine.
- the second nucleic acid strand is a modified nucleoside (e.g., 2'-modified nucleoside (e.g., 2'-O-methyl nucleoside), a bridged nucleoside (e.g., , 2',4'-BNA NC nucleosides (e.g.
- 2'-modified nucleosides such as , 2'-O-methyl nucleosides
- bridged nucleosides e.g. 2',4'-BNA NC nucleoside
- a compound comprising an oligonucleotide of the invention consisting of a double-stranded oligonucleotide is a double-stranded oligonucleotide antisense oligo targeting exon 53 of the human dystrophin gene that has any of the following nucleotide sequences: It is included as a sequence complementary to the nucleotide region (sequence in the second nucleic acid strand).
- the base thymine (T) may be uracil (U).
- the base cytosine (C) may be 5-methylcytosine.
- a compound comprising an oligonucleotide of the invention consisting of a double-stranded oligonucleotide comprises the following nucleotide sequence: antisense oligonucleotide region of a double-stranded oligonucleotide targeting exon 23 of the mouse dystrophin gene as a complementary sequence (sequence in the second nucleic acid strand).
- the base thymine (T) may be uracil (U).
- the base cytosine (C) may be 5-methylcytosine.
- the antisense strand of the present invention containing any of the modified nucleoside residues described above is used as the antisense strand (first nucleic acid strand).
- a total mer is preferred, and a completely morpholino-modified oligonucleotide (preferably PMO, more preferably a completely phosphorodimethylamidate morpholino-modified oligonucleotide) is particularly preferred.
- the antisense strand (first nucleic acid strand) preferably has an antisense effect.
- the antisense strand (first nucleic acid strand) comprises an antisense oligonucleotide region. In another embodiment, the antisense strand (first nucleic acid strand) is an antisense oligonucleotide.
- a compound comprising an oligonucleotide of the invention is a double-stranded oligonucleotide, it is preferably HDO.
- the antisense strand of the present invention includes an antisense strand consisting of the following sequences.
- ASO consisting of a nucleotide sequence represented by SEQ ID NO: 687 that is completely complementary to the 36th to 60th nucleotide sequences of human exon 53
- Mo in the above sequence indicates PMO (preferably morpholino nucleic acid).
- ASO consisting of a nucleotide sequence represented by SEQ ID NO: 687, which is completely complementary to the 36th to 60th nucleotide sequences of human exon 53, [MoG][MoT][MoT][MoG][MoC][MoT][MoC][MoG][MoG][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoG][MoA ][MoA][MoG][MoG][MoT][MoG][MoT][MoT][MoC] (SEQ ID NO: 687-1), As an ASO consisting of a nucleotide sequence represented by SEQ ID NO: 688 that is completely complementary to the 36th to 56th nucleotide sequences,
- Mo in the above sequence indicates PMO (preferably morpholino nucleic acid).
- ASO consisting of a nucleotide sequence represented by SEQ ID NO: 687 that is completely complementary to the 36th to 60th nucleotide sequences of human exon 53, [MoG][MoT][MoT][MoG][MoC][MoT][MoC][MoG][MoG][MoT][MoT][MoT][MoT][MoT][MoT][MoT][MoG][MoA ][MoA][MoG][MoG][MoT][MoG][MoT][MoT][MoT][MoC] (SEQ ID NO: 687-1).
- the ASO consisting of the nucleotide sequence represented by SEQ ID NO: 688 which is completely complementary to the 36th to 56th nucleotide sequences, [MoC][MoC][MoT][MoC][MoG][MoG][MoT][MoT][MoT][MoG][MoA][MoG][MoG][MoT ][MoT][MoC] (SEQ ID NO: 688-1).
- Mo in the above sequence indicates PMO (preferably morpholino nucleic acid).
- the sense strand As the sense strand (second nucleic acid strand), it maintains the stability of the double-stranded oligonucleotide until delivery to the target tissue, is cleaved by RNase H in the target cell (RNase H-dependent pathway), or There is no particular limitation as long as it is an oligonucleotide that is released in an RNase H-independent manner (RNase H-independent pathway) and is suitable for releasing an antisense strand.
- a compound comprising an oligonucleotide of the invention consisting of a double-stranded oligonucleotide, the second nucleic acid strand comprises at least one first exposed region and at least one protected region.
- the "first exposed region” is a region consisting of one or two to three consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages, complementary to a part of the first nucleic acid strand. means.
- the "protection region” is one or two or more (a) deoxyribonucleosides linked by internucleoside linkages, (b) sugar-modified nucleosides and/or (c) 3'-modified internucleoside linkages. means a region consisting of nucleosides having
- the "first exposed region” is one, or two to three consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages, complementary to a portion of the first nucleic acid strand. and/or a region consisting of deoxyribonucleosides.
- the complementary region in the second nucleic acid strand can be complementary to at least part of the antisense oligonucleotide region in the first nucleic acid strand.
- the complementary region in the second nucleic acid strand may be complementary to the entire antisense oligonucleotide region in the first nucleic acid strand.
- the complementary region in the second nucleic acid strand may be complementary to portions other than the antisense oligonucleotide region in the first nucleic acid strand.
- the second nucleic acid strand has at least one first exposed region, such as 1-10, 1-5, 1-4, 1-3, 1-2, or 1, at least 2, such as 2-10, 2-5, 3-4, 2-3 or 2, or at least 3, such as 3-10, 3-5, 3-4 or 3 including
- the first exposed region may be completely complementary to a portion of the first nucleic acid strand, or may have one or more mismatched bases.
- the first exposed region may have 1-3, 1-2, or 1 mismatched bases (non-complementary bases) with respect to a portion of the first nucleic acid strand.
- the first exposed region consists of one or two to three consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages.
- sugar-unmodified ribonucleoside means a ribonucleoside in which the sugar portion of the native ribonucleoside does not contain sugar modifications, such as substitutions and/or any alterations at the 2' position.
- the first exposed region may comprise at least one modified base and/or modified internucleoside linkage.
- the first exposed region consists of one or 2-3 contiguous non-sugar modified ribonucleosides and/or deoxyribonucleosides linked by internucleoside linkages.
- the sugar-unmodified ribonucleosides in the first exposed region comprise natural ribonucleosides, e.g., all of the sugar-unmodified ribonucleosides are natural ribonucleosides, or a portion thereof, such as one or two Sugar-unmodified ribonucleosides are natural ribonucleosides.
- the first exposed region consists of 2 or 3 consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages. In one embodiment, the first exposed region consists of three consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages. This embodiment can have the effect of maintaining high RNase H cleavage activity compared to the first exposed region consisting of one or two consecutive sugar-unmodified ribonucleosides. This embodiment can have the effect that the activity in the RNase H-dependent and/or independent pathway is maintained/improved compared to the central region consisting of non-sugar-modified ribonucleosides.
- the first exposed region comprises nucleosides comprising modified or unmodified purine bases.
- this embodiment maintains the cleavage activity by RNase H while suppressing the cleavage activity by RNase A. can have the effect of being
- the activity in the RNase H-dependent and/or independent pathway is maintained/improved compared to the first exposed region that does not contain a nucleoside containing a purine base (e.g., consists of a nucleoside containing a pyrimidine base). can have the effect of being
- the second nucleic acid strand comprises at least 1 protective region, such as 1-10, 1-5, 1-4, 1-3, 1-2, or 1, at least 2 such as 2-10, 2-5, 3-4, 2-3 or 2, or at least 3, such as 3-10, 3-5, 3-4 or 3 .
- the term "protective region” refers to a region that is resistant to cleavage by a nucleolytic enzyme.
- the nucleolytic enzyme is not limited. Examples of nucleolytic enzymes include RNase A and RNaseH.
- the protective region may be, for example, a region having resistance to RNase A, a region having resistance to RNase H, or a region having resistance to both RNase A and RNase H.
- the resistance to cleavage by a nucleolytic enzyme does not need to be complete resistance, as long as the resistance is increased as compared to the region having the same nucleotide sequence and containing unmodified ribonucleosides.
- the protective region comprises one, or two or more (a) deoxyribonucleosides linked by internucleoside linkages, (b) sugar-modified nucleosides and/or (c) nucleosides having modified internucleoside linkages on the 3' side. Become.
- a protected region may comprise at least one modified base and/or modified internucleoside linkage.
- Deoxyribonucleosides and/or sugar-modified nucleosides in the protective region are preferably deoxyribonucleosides, 2'-sugar-modified nucleosides (e.g., nucleosides containing a 2'-O-methyl group), bridged nucleosides (e.g., LNA nucleosides) and/or or cationic nucleosides, more preferably deoxyribonucleosides, 2'-sugar-modified nucleosides (e.g., nucleosides containing a 2'-O-methyl group) and/or bridged nucleosides (e.g., LNA nucleosides), more preferably is a deoxyribonucleoside and/or a 2'-sugar-modified nucleoside (e.g., a nucleoside containing a 2'-O-methyl group), particularly preferably a deoxyribonucleoside and/
- Nucleosides of nucleosides with modified internucleoside linkages on the 3' side of the protective region are preferably deoxyribonucleosides, ribonucleosides, 2'-sugar modified nucleosides (e.g. nucleosides containing a 2'-O-methyl group), bridging nucleosides (e.g. LNA nucleosides) and/or cationic nucleosides, more preferably deoxyribonucleosides, ribonucleosides, 2'-sugar modified nucleosides (e.g.
- nucleosides containing a 2'-O-methyl group and/or bridged nucleosides (e.g., LNA nucleosides), more preferably deoxyribonucleosides, ribonucleosides and/or 2'-sugar-modified nucleosides (e.g., nucleosides containing a 2'-O-methyl group), still more preferably deoxyribonucleosides Nucleosides, ribonucleosides and/or nucleosides containing a 2'-O-methyl group, particularly preferably ribonucleosides.
- Nucleosides having a modified internucleoside linkage on the 3' side of the protective region are preferably phosphorothioate linkages, phosphorothioate linkages, guanidine moieties substituted with 1 to 4 C1-6 alkyl groups on the 3' side (preferably TMG moiety) containing an internucleoside bond (preferably the partial structure represented by the above formula (III)) and/or an internucleoside bond containing a cyclic guanidine moiety (preferably a partial structure represented by the above formula (II) ), more preferably a nucleoside having a phosphorothioate bond on the 3′ side.
- the 3' modified internucleoside linkage may be chirally controlled to the Rp or Sp configuration.
- a nucleoside having a modified internucleoside linkage on the 3' side means a nucleoside having a modified internucleoside linkage on at least the 3' side, and also has a modified internucleoside linkage on the 5' side. good too.
- the protective region may be completely complementary to a portion of the first nucleic acid strand, or may have one or more mismatched bases.
- the protective region may have 1-3, 1-2, or 1 mismatched bases (non-complementary bases) to a portion of the first nucleic acid strand.
- the protective region includes (a) deoxyribonucleosides containing pyrimidine bases, (b) sugar-modified nucleosides and/or (c) nucleosides with modified internucleoside linkages on the 3' side.
- the pyrimidine base can be either modified or unmodified.
- at least one of the protective regions, or all of the protective regions contains modified or unmodified pyrimidine bases (a) deoxyribonucleosides, (b) sugar-modified nucleosides and/or (c) 3′ internucleoside modifications. It may also include nucleosides with linkages.
- the cleavage activity of RNase A on the second nucleic acid strand is suppressed to a lower level than when a nucleoside containing a pyrimidine base is contained in a sugar-unmodified region (e.g., the first exposed region or the second exposed region).
- a nucleoside containing a pyrimidine base is contained in a sugar-unmodified region (e.g., the first exposed region or the second exposed region).
- the activity in the RNase H-dependent and / or -independent pathway is enhanced compared to the case where the nucleoside containing a pyrimidine base is contained in the sugar-unmodified region (e.g., the first exposed region or the second exposed region). It can have the effect of being maintained and improved.
- the sugar-modified nucleoside in the protection region is a sugar-modified ribonucleoside.
- the second nucleic acid strand consists of the first exposed region and the protected region. In a further embodiment, the second nucleic acid strand comprises alternating first exposed regions and protected regions. In a further embodiment, at least one of the protective regions, or all of the protective regions, comprises modified or unmodified pyrimidine bases (a) deoxyribonucleosides, (b) sugar-modified nucleosides and/or (c) 3' includes nucleosides with modified internucleoside linkages.
- the second nucleic acid strand has at least one second exposed region, such as 1-5, 1-4, 1-3, 1-2, complementary to a portion of the first nucleic acid strand. 1, or 1, or at least 2.
- the second exposed region consists of four or more consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages, and the bases of the sugar-unmodified ribonucleosides in the second exposed region include purine bases.
- the purine base may be either modified or unmodified.
- the number of sugar-unmodified ribonucleosides constituting the second exposed region is, for example, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, or 4 may be one.
- the second exposed region may comprise at least one modified base and/or modified internucleoside linkage.
- the second exposed region consists of four or more consecutive sugar-unmodified ribonucleosides and/or deoxyribonucleosides linked by internucleoside linkages, and the sugar-unmodified ribonucleosides and/or deoxyribonucleosides in the second exposed region
- the deoxyribonucleoside base includes a purine base.
- the second exposed region may be completely complementary to a portion of the first nucleic acid strand, or may have one or more mismatched bases.
- the second exposed region may have 1-3, 1-2, or 1 mismatched bases (non-complementary bases) with respect to a portion of the first nucleic acid strand.
- the sugar-unmodified ribonucleosides in the second exposed region comprise natural ribonucleosides, e.g., all of the sugar-unmodified ribonucleosides are natural ribonucleosides, or a portion thereof, such as one or two Sugar-unmodified ribonucleosides are natural ribonucleosides.
- the second nucleic acid strand has at least one second exposed region, such as 1-10, 1-5, 1-4, 1-3, 1-2, or 1, at least 2, such as 2-10, 2-5, 3-4, 2-3 or 2, or at least 3, such as 3-10, 3-5, 3-4 or 3 including
- the second nucleic acid strand has at least 1, for example 1 to 10, 1 to 6, 1 to 5, 1 to 4 1-3, 1-2, or 1, at least 2, such as 2-10, 2-5, 3-4, 2-3 or 2, or at least 3, such as 3-10, 3-5, 3-4 or 3 included.
- the second nucleic acid strand consists of a first exposed region, a second exposed region, and a protected region. In a further embodiment, the second nucleic acid strand comprises alternating first or second exposed regions and protective regions. In a further embodiment, at least one of the protective regions, or all of the protective regions, comprises modified or unmodified pyrimidine bases (a) deoxyribonucleosides, (b) sugar-modified nucleosides and/or (c) 3' includes nucleosides with modified internucleoside linkages.
- the second nucleic acid strand consists of a second exposed region and a protected region. In a further embodiment, the second nucleic acid strand comprises alternating second exposed regions and protected regions. In a further embodiment, at least one of the protective regions, or all of the protective regions, comprises modified or unmodified pyrimidine bases (a) deoxyribonucleosides, (b) sugar-modified nucleosides and/or (c) 3' includes nucleosides with modified internucleoside linkages.
- At least one protective region of the second nucleic acid strand is linked to the first exposed region and/or the second exposed region by internucleoside linkages at the 5' and 3' ends.
- the first exposed region and/or the second exposed region comprises at least one, such as one or two modified internucleoside linkages, such as phosphorothioate linkages, such as phosphorothioate chirally controlled to the Rp or Sp configuration.
- internucleoside linkages eg, substructures represented by formula (III)
- a guanidine moiety eg, TMG moiety
- cyclic guanidine Including internucleoside linkages containing moieties (eg, substructures represented by formula (II)).
- the second nucleic acid strand is (1) said first exposed region, and/or (2) said second exposed region, and (3) ( It comprises or consists of a) deoxyribonucleosides and/or (b) sugar-modified nucleosides, eg sugar-modified ribonucleosides.
- the second nucleic acid strand further comprises the following sugar-unmodified terminal regions at the 5' and/or 3' ends.
- the length of the 5′-terminal and/or 3′-terminal sugar-unmodified terminal region is independently usually 1 to 10 bases long, 1 to 7 bases long, 2 to 5 bases long, or 2 bases long. ⁇ 3 bases long.
- the second nucleic acid strand comprises said first exposed region and/or second exposed region and sugar-modified ribonucleosides (and optionally sugar-unmodified termini) linked by modified or unmodified internucleoside linkages. area), comprising or consisting of
- the second nucleic acid strand comprises at least 1, such as 1-6, 1-5, 1-4, 1-3, 1-2, or 1, or at least 2
- a sugar-unmodified terminal region comprising sugar-unmodified ribonucleosides is included at the 5' and/or 3' end. Since the toxicity of the nucleic acid complex tends to increase as the amount of sugar modification increases, by making the terminal region unmodified with sugar, the number of sugar-modified nucleic acids in the second nucleic acid strand is reduced, resulting in reduced toxicity. obtain.
- the sugar-unmodified terminal region may contain modified bases and/or modified internucleoside linkages.
- the sugar-unmodified terminal region is complementary to a portion of the first nucleic acid strand.
- the sugar-unmodified terminal region may be completely complementary to a portion of the first nucleic acid strand, or may have one or more mismatched bases.
- the second exposed region may have 1-3, 1-2, or 1 mismatched bases (non-complementary bases) with respect to a portion of the first nucleic acid strand.
- the sugar-unmodified ribonucleosides in the sugar-unmodified terminal region comprise natural ribonucleosides, eg, all of the sugar-unmodified ribonucleosides are natural ribonucleosides, or a portion thereof, such as 1-5, 1-4, 1-3, or 1 or 2 sugar-unmodified ribonucleosides are natural ribonucleosides.
- the sugar-unmodified terminal region comprises nucleosides comprising modified or unmodified purine bases and/or modified or unmodified pyrimidine bases.
- the sugar-unmodified terminal region comprises nucleosides containing modified or unmodified purine bases.
- the second nucleic acid strand comprises (1) at least one first exposed region and/or at least one second exposed region, (2) at least one and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 10 first exposed regions and/or 1 to 10 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consisting of 1 to 10 protective regions and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 5 first exposed regions and/or 1 to 5 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consisting of 1 to 5 protective regions and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 3 first exposed regions and/or 1 to 3 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consisting of 1 to 3 protective regions and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 2-10 first exposed regions and/or second exposed regions, (2) 2-10 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 2-6 first exposed regions and/or second exposed regions, (2) 2-6 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 2-5 first exposed regions and/or second exposed regions, (2) 2-5 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 2-4 first exposed regions and/or second exposed regions, (2) 2-4 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 2-3 first exposed regions and/or second exposed regions, (2) 2-3 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 3-10 first exposed regions and/or second exposed regions, (2) 3-10 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand is linked by modified or unmodified internucleoside linkages and comprises (1) 3-6 first exposed regions and/or second exposed regions, (2) 3-6 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 3-5 first exposed regions and/or second exposed regions, (2) 3-5 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 3-4 first exposed regions and/or second exposed regions, (2) 3-4 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In this embodiment, the second nucleic acid strand has (a) first exposed regions or second exposed regions and (b) protective regions alternately arranged.
- the second nucleic acid strand comprises at least one deoxyribonucleoside, a sugar-modified nucleoside and/or a nucleoside having a modified internucleoside linkage on the 3' side of the sugar-modified terminal region at the 5'-end and/or the 3'-end. Include at the end.
- the second nucleic acid strand comprises a sugar-modified terminal region at the 5' and/or 3' end comprising at least one deoxyribonucleoside and/or sugar-modified nucleoside.
- the sugar-modified terminal region is complementary to a portion of the first nucleic acid strand.
- the sugar-modified terminal region may be fully complementary to a portion of the first nucleic acid strand, or may have one or more mismatched bases.
- the second exposed region may have 1-3, 1-2, or 1 mismatched bases (non-complementary bases) with respect to a portion of the first nucleic acid strand.
- the sugar-modified terminal region comprises deoxyribonucleosides containing pyrimidine bases, sugar-modified nucleosides and/or nucleosides with modified internucleoside linkages on the 3' side.
- the pyrimidine base can be either modified or unmodified.
- the sugar-modified terminal region comprises deoxyribonucleosides containing purine bases, sugar-modified nucleosides and/or nucleosides with modified internucleoside linkages on the 3' side.
- the sugar-modified terminal region comprises deoxyribonucleosides and/or sugar-modified nucleosides containing purine bases.
- the purine base may be either modified or unmodified.
- the second nucleic acid strand comprises or consists of said first exposed region, second exposed region, protective region, and/or sugar-modified terminal region linked by modified or unmodified internucleoside linkages.
- the length of the 5'-terminal and/or 3'-terminal sugar-modified terminal region is independently usually 1-10 bases long, 1-7 bases long, 2-5 bases long, or 2-5 bases long. It is 3 bases long.
- the sugar-modified terminal region is a nucleoside in which all of the nucleosides are deoxyribonucleosides, sugar-modified nucleosides and/or nucleosides having a modified internucleoside linkage on the 3′ side (preferably all of the nucleosides are deoxyribonucleosides and/or sugar-modified nucleoside) or part thereof, such as 1, 1-2, 1-3, 1-4, 1-5, 1-6 or 1-7 deoxyribonucleosides, sugar-modified nucleosides and/or a nucleoside having a modified internucleoside linkage on the 3' side (preferably, all of the nucleosides are deoxyribonucleosides and/or sugar-modified nucleosides).
- nucleosides in the sugar-modified terminal region deoxyribonucleosides, sugar-modified nucleosides and/or nucleosides having a modified internucleoside linkage on the 3′ side (preferably, all of the nucleosides are deoxyribonucleosides and/or or sugar-modified nucleosides).
- 10% or more, 30% or more, 50% or more, 70% or more, 80% or more, 90% or more are deoxyribonucleosides, sugar-modified nucleosides and / or nucleosides having a modified internucleoside bond on the 3' side (preferably, All of the nucleosides are deoxyribonucleosides and/or sugar-modified nucleosides).
- Deoxyribonucleosides and/or sugar-modified nucleosides are preferably deoxyribonucleosides, 2'-sugar-modified nucleosides (e.g., 2'-O-methyl nucleosides), bridged nucleosides (e.g., LNA nucleosides) and/or cationic nucleosides.
- a nucleoside with a modified internucleoside linkage on the 3' side is preferably a nucleoside with a phosphorothioate linkage on the 3' side.
- deoxyribonucleosides and/or sugar-modified nucleosides are preferably deoxyribonucleosides, 2'-sugar-modified nucleosides (e.g., 2'-O-methylnucleosides), bridged nucleosides (e.g., 2',4 '-BNA NC nucleosides (e.g., 2',4'-BNA NC [NH] nucleosides, 2',4'-BNA NC [N-Me] nucleosides) and/or cationic nucleosides, more preferably Deoxyribonucleosides, 2'-sugar modified nucleosides (e.g.
- nucleosides 2'-O-methyl nucleosides and/or bridged nucleosides (e.g. 2',4'-BNA NC nucleosides (e.g. 2',4'-BNA NC [NH ] nucleosides, 2′,4′-BNA NC [N-Me] nucleosides)), more preferably deoxyribonucleosides, 2′-sugar modified nucleosides (e.g., 2′-O-methyl nucleosides) and/or 2 ',4'-BNA NC nucleoside (e.g., 2',4'-BNA NC [NH] nucleoside, 2',4'-BNA NC [N-Me] nucleoside), more preferably deoxyribonucleoside, 2' -O-methyl nucleosides and/or 2',4'-BNA NC [N-Me] nucleosides, more preferably deoxyribonucleosides
- the second nucleic acid strand comprises (1) at least one first exposed region and/or at least one second exposed region, (2) at least one and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 10 first exposed regions and/or 1 to 10 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consisting of 1 to 10 protective regions and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 5 first exposed regions and/or 1 to 5 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) 1 to 5 protective regions, and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 4 first exposed regions and/or 1 to 4 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) 1 to 4 protective regions, and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 1 to 3 first exposed regions and/or 1 to 3 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) 1 to 3 protective regions, and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 2 to 5 first exposed regions and/or 1 to 5 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consists of 2 to 5 protective regions and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 2 to 4 first exposed regions and/or 1 to 4 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consists of 2 to 4 protective regions and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 2-3 first exposed regions and/or 1-3 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consists of 2-3 protective regions and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 3 to 5 first exposed regions and/or 1 to 5 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consists of 3 to 5 protective regions and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is (1) 3 to 4 first exposed regions and/or 1 to 4 second exposed regions, linked by modified or unmodified internucleoside linkages, ( 2) consists of 3 to 4 protective regions and (3) sugar-modified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 2-10 first exposed regions and/or second exposed regions, (2) 2-10 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 2-6 first exposed regions and/or second exposed regions, (2) 2-6 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 2-5 first exposed regions and/or second exposed regions, (2) 2-5 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 2-4 first exposed regions and/or second exposed regions, (2) 2-4 and (3) sugar-unmodified terminal regions at the 5' and 3' ends. In one embodiment, the second nucleic acid strand comprises (1) 2-3 first exposed regions and/or second exposed regions, (2) 2-3 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 3-10 first exposed regions and/or second exposed regions, (2) 3-10 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand is linked by modified or unmodified internucleoside linkages and comprises (1) 3-6 first exposed regions and/or second exposed regions, (2) 3-6 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 3-5 first exposed regions and/or second exposed regions, (2) 3-5 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand comprises (1) 3-4 first exposed regions and/or second exposed regions, (2) 3-4 and (3) sugar-unmodified terminal regions at the 5' and 3' ends.
- the second nucleic acid strand has (a) first exposed regions or second exposed regions and (b) protective regions alternately arranged.
- the modified internucleoside linkages of the second nucleic acid strand are at a pH (e.g., physiological pH in humans (about 7.4), the pH of the delivery site (e.g., organelle, cell, tissue, organ, organism, etc.) etc.), the modified internucleoside linkage is in the anionic form (e.g., -OP(O)(O - )-O- (the anionic form of the natural phosphate linkage), -OP(O)(S - )-O- including non-negatively charged (neutral or cationic, respectively) internucleoside linkages that exist as neutral or cationic forms, as compared to (such as (the anionic form of phosphorothioate linkages))
- the second nucleic acid The modified internucleoside linkages of the strand comprise neutral internucleoside linkages.
- the modified internucleoside linkages of the second nucleic acid strand comprise cationic internucle
- Internucleoside linkages e.g., neutral internucleoside linkages
- the non-negatively charged internucleoside linkage is, for example, a methylphosphonate linkage as described in U.S. Patent Nos. 5,264,423 and 5,286,717, a methylphosphotriester linkage, an ethylphosphotriester linkage as described in U.S. Patent No.
- non-negatively charged internucleoside linkages The linkage comprises a triazole moiety or an alkyne moiety.
- the non-negatively charged internucleoside linkage is a cyclic guanidine moiety and/or a guanidine moiety substituted with 1-4 C 1-6 alkyl groups (preferably includes a TMG moiety)
- the modified internucleoside linkage comprising a cyclic guanidine moiety has a substructure represented by formula (II) In one embodiment, 1-4 C 1-
- the guanidine moiety substituted with 6 alkyl groups has a substructure represented by formula (III)
- the neutral internucleoside linkages comprising the guanidine moieties are chirally controlled.
- the present disclosure provides at least one neutral internucleoside linkage and at least also relates to compositions comprising
- neutral internucleotide linkages have properties compared to equivalent nucleic acids that do not contain neutral internucleotide linkages. and/or improve activity, e.g., improve delivery, improve resistance to exonucleases and endonucleases, improve cellular uptake, improve endosomal escape, and/or improve nuclear uptake, etc. do.
- the second nucleic acid strand has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 modified internucleoside linkages. 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, It may contain 29, 30, 35, 40, 45, 50 or more.
- the first nucleic acid strand and/or the second nucleic acid strand each have at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least It may contain 60%, at least 70%, at least 80%, at least 90%, or more.
- the first exposed region, the second exposed region, the protected region, the sugar-unmodified end region and/or the sugar-modified end region of the second nucleic acid strand each have 1, 1-2 modified internucleoside linkages.
- 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-21, 1-22 may contain one.
- the first exposed region, the second exposed region, the protected region, the sugar-unmodified end region and/or the sugar-modified end region of the second nucleic acid strand have at least 5% modified internucleoside linkages, at least 10% modified internucleoside linkages, respectively. , at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more.
- the second nucleic acid strand has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 chirally controlled internucleoside linkages. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, It may contain 28, 29, 30, 35, 40, 45, 50 or more. In one embodiment, the second nucleic acid strand has at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least It may contain 70%, at least 80%, at least 90%, or more.
- the first exposed region, the second exposed region, the protected region, the sugar-unmodified end region and/or the sugar-modified end region of the second nucleic acid strand each have one chiral controlled internucleoside linkage, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-21, 1 to 22 may be included.
- the first exposed region, the second exposed region, the protected region, the sugar-unmodified end region and/or the sugar-modified end region of the second nucleic acid strand each have at least 5% chiral controlled internucleoside linkages. , at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more.
- the second nucleic acid strand has 1, 2, 3, 4, 5, 6, 7, non-negatively charged internucleoside linkages (preferably neutral internucleoside linkages). 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more.
- the first nucleic acid strand and/or the second nucleic acid strand each have at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50% non-negatively charged internucleoside linkages. , at least 60%, at least 70%, at least 80%, at least 90%, or more.
- the first exposed region, the second exposed region, the protective region, the non-sugar-modified end region and/or the sugar-modified end region of the second nucleic acid strand each comprise non-negatively charged internucleoside linkages (preferably medium internucleoside linkages) 1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, It may contain 1-20, 1-21, 1-22.
- internucleoside linkages preferably medium internucleoside linkages
- the first exposed region, the second exposed region, the protected region, the sugar-unmodified end region and/or the sugar-modified end region of the second nucleic acid strand each have at least 5% non-negatively charged internucleoside linkages, It may comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or more.
- any of the above regions (first exposed region, protective region, second exposed region, sugar-unmodified terminal region, and/or sugar-modified terminal region) in the second nucleic acid strand is within or adjacent to the region at least one, such as one or two modified internucleoside linkages, such as phosphorothioate linkages, phosphorothioate linkages chirally controlled to the Rp or Sp configuration, 1-4 C 1-6 an internucleoside linkage (e.g., the partial structure represented by formula (III) above) containing a guanidine moiety (e.g., TMG moiety) substituted with an alkyl group of 1 to 4 chirally controlled to the Rp or Sp configuration Internucleoside linkages (e.g., partial structures represented by the above formula (III)) containing guanidine moieties (e.g., TMG moieties) substituted with one C 1-6 alkyl group, internucleoside linkages containing cyclic guanidine moi
- At least one, at least two, or at least three internucleoside linkages from the 5' end of the second nucleic acid strand may be modified internucleoside linkages. At least one, at least two, or at least three internucleoside linkages from the 3′ end of the second nucleic acid strand are substituted with modified internucleoside linkages, such as phosphorothioate linkages, 1-4 C 1-6 alkyl groups.
- An internucleoside linkage containing a guanidine moiety (e.g., TMG moiety) (e.g., partial structure represented by formula (III) above) and/or an internucleoside linkage containing a cyclic guanidine moiety (e.g., represented by formula (II) above) It may be a partial structure that is Modified internucleoside linkages may be chirally controlled to the Rp or Sp configuration.
- the second nucleic acid strand may contain no sugar-unmodified region other than the first exposed region and/or the second exposed region (and the sugar-unmodified terminal region, if present). That is, the sugars of the nucleic acid in regions other than the first exposed region and/or the second exposed region (and sugar-unmodified terminal regions, if present) are modified sugars, eg, 2'-modified sugars.
- the bases in regions other than the first exposed region and/or the second exposed region (and sugar-unmodified terminal region, if present) comprise modified and/or unmodified pyrimidine bases.
- all of the bases are modified and/or unmodified pyrimidine bases, or some thereof, such as 1-20, 1-15, 1-10, 1-5, 1-2, or One is a modified and/or unmodified pyrimidine base.
- Modified and/or unmodified pyrimidine bases are preferably cytosine, uracil, thymine, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, N4-methylcytosine and/or 2 -thio-thymine, more preferably cytosine, uracil, thymine and/or 5-methylcytosine, particularly preferably cytosine.
- any proportion of modified and/or unmodified pyrimidines Contains bases. For example, 10% or more, 30% or more, 50% or more, 70% or more, 80% or more, 90% or more are modified and/or unmodified pyrimidine bases.
- Modified and/or unmodified pyrimidine bases are preferably cytosine, uracil, thymine, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, N4-methylcytosine and/or 2-thio-thymine, more preferably cytosine, uracil, thymine and/or 5-methylcytosine, particularly preferably cytosine.
- the bases in the first exposed region comprise purine bases, e.g., all of the bases are modified and/or unmodified purine bases, or some of them, e.g., 1 or 2 bases are modified. and/or unmodified purine bases.
- purine bases e.g., all of the bases are modified and/or unmodified purine bases, or some of them, e.g., 1 or 2 bases are modified. and/or unmodified purine bases.
- RNase A cleaves the phosphodiester bond on the 3' side of modified and/or unmodified pyrimidine bases, so if the bases in the first exposed region are modified and/or unmodified pyrimidine bases , since this part can be cleaved by RNase A.
- the bases in the first exposed region may contain modified and/or unmodified purine bases to reduce unwanted degradation by RNase A.
- the bases in the first exposed region include any of C, UC and UU, eg modified and/or unmodified pyrimidine
- the bases in the first exposed region include modified and/or unmodified purine bases.
- all of the bases are modified and/or unmodified purine bases, or some of them, eg 1-3, 1-2 or 1, are modified and/or unmodified purine bases.
- the bases in the second exposed region comprise modified and/or unmodified purine bases.
- all of the bases are modified and/or unmodified purine bases, or some of them, such as 1-7, 1-6, 1-5, 1-4, 1-3, 1 ⁇ 2 or 1 are modified and/or unmodified purine bases.
- the bases in the first exposed region and/or the second exposed region contain modified and/or unmodified purine bases in any proportion.
- Modified and/or unmodified purine bases are preferably adenine, guanine, N6-methyladenine, 8-bromoadenine, N2-methylguanine and/or 8-bromoguanine, more preferably adenine and/or guanine. be.
- the second nucleic acid strand comprises sugar-modified nucleosides and/or deoxyribonucleosides containing modified and/or unmodified pyrimidine bases.
- all of the bases are modified and/or unmodified pyrimidine bases, or some thereof, such as 1-20, 1-15, 1-10, 1-5, 1-2, or One is a modified and/or unmodified pyrimidine base.
- the second nucleic acid strand comprises any proportion of sugar-modified nucleosides and/or deoxyribonucleosides, including modified and/or unmodified pyrimidine bases.
- pyrimidine bases For example, 10% or more, 30% or more, 50% or more, 70% or more, 80% or more, 90% or more of the second nucleic acid strand are pyrimidine bases.
- Preferred sugar-modified pyrimidine bases are cytosine, uracil, thymine, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, N4-methylcytosine and/or 2-thio- Thymine, more preferably cytosine, uracil, thymine and/or 5-methylcytosine, particularly preferably cytosine.
- the protected region of the second nucleic acid strand comprises modified and/or unmodified pyrimidine bases.
- all of the bases are modified and/or unmodified pyrimidine bases, or some thereof, such as 1-20, 1-15, 1-10, 1-5, 1-2, or One is a modified and/or unmodified pyrimidine base.
- the protected region of the second nucleic acid strand comprises modified and/or unmodified pyrimidine bases. For example, 10% or more, 30% or more, 50% or more, 70% or more, 80% or more, 90% or more of the second nucleic acid strand are pyrimidine bases.
- Preferred sugar-modified pyrimidine bases are cytosine, uracil, thymine, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, N4-methylcytosine, and/or 2-thio- Thymine, more preferably cytosine, uracil, thymine and/or 5-methylcytosine, particularly preferably cytosine.
- the positions of the first exposed region and/or the second exposed region in the second nucleic acid strand are not limited. In one embodiment, at least one, eg, all of the first exposed regions and/or the second exposed regions are located 3′ to the center of the second nucleic acid strand.
- “the first exposed region and/or the second exposed region are located on the 3' side of the center of the second nucleic acid strand” means the first exposed region and/or the center of the second exposed region, 5 The 'end or 3' end is located 3' from the center of the second nucleic acid strand.
- the first exposed region and/or the second exposed region can be cleaved by RNase H.
- Whether or not the nucleic acid strand is cleaved by RNase H can be determined, for example, by reacting the nucleic acid strand with RNase H, performing electrophoresis, and measuring the density of the undigested band. Details are given in Examples. As described.
- the first exposed region consisting of one, or two or three consecutive sugar-unmodified ribonucleosides linked by internucleoside linkages can be cleaved by RNase H means that the cleavage activity by RNase H is at least four Considering the conventional common knowledge that requires consecutive natural ribonucleosides (for example, see FIG. 3 of FEBS J 2008; 276(6): 1494-505), it was surprising .
- the first exposed region and/or the second exposed region (and sugar-unmodified terminal region, if present) may have activity in RNase H dependent and/or independent pathways.
- the second nucleic acid strand may comprise, in whole or in part, cationic nucleosides.
- the cationic nucleosides are 2'-Amino-LNA nucleosides (e.g. 3-(Bis(3-aminopropyl)amino)propanoyl substituted nucleosides), aminoalkyl modified nucleosides (e.g. 2'-O-methyl and 4' - CH2CH2CH2NH2 substituted nucleosides), GuNA nucleosides, and the like .
- a compound comprising an oligonucleotide of the present invention may comprise an oligonucleotide shown in Table 1 as the second nucleic acid strand of a double-stranded oligonucleotide targeting human exon 53.
- a compound comprising an oligonucleotide of the present invention may comprise an oligonucleotide shown in Table 2 as the second nucleic acid strand of a double-stranded oligonucleotide targeting exon 23 of mouse.
- A, U, G, and C represent ribonucleosides adenine, uracil, guanine, and cytosine
- da, dt, dg, dc, and d5 represent deoxyribonucleosides adenine, thymine, Guanine, cytosine, 5-methylcytosine are shown.
- base uracil (U) and base thymine (T) can be substituted with each other.
- MoA, MoT, MoG, MoC indicate morpholino nucleic acids.
- mA, mU, mG, and mC represent 2'-O-methylnucleosides.
- bA, bT, bG, and b5 represent 2',4'-BNA NC [N-Me] nucleosides.
- the bond between each base is a phosphorodiamidate bond having a dimethylamino group in the case of morpholino nucleic acid, and a phosphodiester bond in the case of other oligonucleic acid chains.
- s when s is attached after the base, it indicates a phosphorothioate bond.
- the 3' end is not conjugated, it is an unmodified form with no phosphate group.
- a compound comprising an oligonucleotide of the invention is used as the first and second nucleic acid strands of a double-stranded oligonucleotide targeting human exon 53, Examples 1-54, 65-75. , 86, 88 and 89 (see Tables 9 and 11, etc.).
- a compound comprising an oligonucleotide of the invention is used as the first and second nucleic acid strands of a double-stranded oligonucleotide targeting exon 23 of a mouse according to Examples 55, 56, 77-82. , 84 and 87 in combination of the first and second nucleic acid strands (see Tables 10 and 12, etc.).
- the compound containing the oligonucleotide of the present invention is a nucleic acid complex, it is efficiently delivered to the 5′ end, 3′ end or both ends of the antisense strand and/or the sense strand to cells, tissues, organs, etc. to be introduced.
- Functional molecules other than the peptides of the present invention that are capable of binding can be attached.
- the functional molecule may be linked to an internal nucleotide of the antisense oligonucleotide.
- Functional molecules include those described above.
- the conjugates of the present invention include the compounds of Examples 1-54, 57-59, 65-75, 86, 88 and 89 as conjugates targeting human exon 53. can.
- the conjugates of the invention include the compounds of Examples 55, 56, 60, 61, 77-82, 84, 85 and 87 as conjugates targeting mouse exon 23. be able to. That is, in a preferred embodiment, the peptide, linker and nucleic acid (single-stranded oligonucleotide, first nucleic acid strand, second nucleic acid strand) constituting the conjugate of the present invention are those constituting the above-described example compounds. Combinations can be mentioned.
- the conjugates of the present invention may be at least drug (at least partially functional) with muscle tissue tropism.
- compounds, including oligonucleotides for producing a specific dystrophin protein can be delivered to muscle tissue.
- the conjugates of the invention may be useful in the prevention or treatment of neuromuscular diseases, particularly dystrophinopathies (e.g., asymptomatic hyperCKemia, muscle spasms with myoglobinuria, quadriceps myopathy). , Becker muscular dystrophy, Duchenne muscular dystrophy and DMD gene-related dilated cardiomyopathy (DCM), female dystrophinopathy), preferably Duchenne muscular dystrophy.
- DCM dilated cardiomyopathy
- the conjugate of the present invention has excellent pharmacokinetics (e.g., blood drug half-life, intracerebral penetration, metabolic stability) and low toxicity (e.g., acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity). , is superior as a drug in terms of drug interaction, carcinogenicity, etc.), as a drug as it is, or as a pharmaceutical composition mixed with a pharmaceutically acceptable carrier, etc., mammals (e.g., humans, monkeys, cows, horses, pigs, mice, rats, hamsters, rabbits, cats, dogs, sheep, goats, etc.) can be safely administered orally or parenterally.
- mammals e.g., humans, monkeys, cows, horses, pigs, mice, rats, hamsters, rabbits, cats, dogs, sheep, goats, etc.
- Parenter includes intravenous, intramuscular, intrathecal, subcutaneous, intraorgan, intranasal, intradermal, eye drop, intracerebral, intrarectal, intravaginal, intraperitoneal, intratumoral, proximal to tumor, etc. administration and direct focal administration.
- the dose of the conjugate of the present invention varies depending on the route of administration, symptoms, etc.
- parenteral administration eg, intravenous administration
- Duchenne muscular dystrophy adults, body weight 40-80 kg, eg, 60 kg.
- the amount of the nucleic acid complex of the present invention contained in one dose of the composition is, for example, 0.001 mg/kg or more, 0.005 mg/kg or more, 0.01 mg/kg or more, 00.25 mg/kg or more, 0.5 mg/kg or more, 1 mg/kg or more, 2.5 mg/kg or more, 5 mg/kg or more, 10 mg/kg or more, 20 mg/kg or more, 30 mg/kg or more, 40 mg/kg or more kg or more, 50 mg/kg or more, 75 mg/kg or more, 100 mg/kg or more, 150 mg/kg or more, 200 mg/kg or more, 300 mg/kg or more, 400 mg/kg or more, or 500 mg/kg or more.
- any amount within the range of 0.001 mg/kg to 500 mg/kg can be selected as appropriate.
- the compositions may be single or multiple doses. In the case of multiple administrations, administration may be daily or at appropriate time intervals (eg, at intervals of 1 day, 2 days, 3 days, 1 week, 2 weeks, 1 month, 2 months).
- a medicament containing the conjugate of the present invention can be prepared by using the conjugate of the present invention alone or in combination with the conjugate of the present invention according to a method known per se as a method for producing pharmaceutical preparations (e.g., the method described in the Japanese Pharmacopoeia). It can be used as a pharmaceutical composition mixed with a pharmaceutically acceptable carrier.
- Pharmaceuticals containing the conjugate of the present invention include, for example, tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets, buccal tablets, etc.), pills, powders, granules, capsules (soft capsules, microcapsules), lozenges, syrups, liquids, emulsions, suspensions, controlled-release preparations (e.g., immediate-release preparations, sustained-release preparations, sustained-release microcapsules), aerosols, films (e.g., orally disintegrating film, oral mucosal adhesive film), injections (e.g., subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections), drips, transdermal preparations, ointments , oral or parenteral (eg, intravenous intramuscularly, subcutaneously, intraorganically, intranasally, intradermally, eye drops, intracerebral, intrarectal, intravaginal, intraperitoneal, focal,
- the conjugate of the present invention has excellent solubility in water, Japanese Pharmacopoeia Dissolution Test Fluid 2, or Japanese Pharmacopoeia Disintegration Test Fluid 2, brain penetration, metabolic stability, CYP inhibition) and low toxicity (for example, acute toxicity, chronic toxicity, genotoxicity, reproductive toxicity, cardiotoxicity, drug interaction, carcinogenicity, phototoxicity, etc.) It is superior as a medicine) and has excellent properties as a medicine such as few side effects.
- the conjugate of the present invention may contain other active ingredients as long as they do not cause unfavorable interactions when blended with the conjugate of the present invention.
- the conjugates of the invention may contain other conjugates of the invention so long as they do not interact unfavorably upon combination with the conjugates of the invention.
- Other conjugates of the invention may target the same or different exons as the conjugates of the invention, preferably the conjugates of the invention and other conjugates of the invention target the same exons. are the same.
- a conjugate of the invention and another conjugate of the invention differ in exons with the same target exon.
- dystrophinopathy e.g., asymptomatic hyperCKemia, muscle spasm accompanied by myoglobinuria, quadriceps myopathy, Becker muscular dystrophy
- DCM DMD gene-related dilated cardiomyopathy
- other active ingredients such as Eteplirsen, SRP-5051, Viltolarsen, Golodirsen, Renadirsen, NS-089, and other drugs for Duchenne muscular dystrophy; Steroids, corticosteroids, glucocorticoids, anabolic steroids, mineralocorticoids, dexamethasone Steroids such as hexestrol and cortisone acetate; NF- ⁇ B inhibitors such as edasalonexent; nonsteroidal anti-inflammatory drugs such as meloxicam, tenoxicam, indomethacin, ibuprofen, celecoxib, rofecoxib, and aspirin; disease-modifying antirheumatic drugs drugs; may contain anti-cytokine drugs such as TNF inhibitors and MAP kinase inhibitors; These concomitant agents can be formulated with the conjugates of the invention and administered as a single formulation, or can be formulated separately from the conjugates of the invention and can be
- these concomitant drugs can also be administered simultaneously or staggered by different routes.
- the dose of these concomitant drugs may be the amount usually used when the drug is administered alone, or the dose can be reduced from the amount usually used.
- These concomitant drugs may be linked directly or via a linker to the conjugate of the present invention.
- linker known linkers such as WO2021/054370, WO2020/209285, WO2020/028832, WO2017/221883, WO2012/150960, J.Am.Chem.Soc., 2021, 143, 3416-3429, Antibodies 2020 , 9, 2 and the like.
- the “pharmaceutically acceptable carrier” various organic or inorganic carriers commonly used as starting materials are used. For example, in solid preparations, excipients, lubricants, binders, disintegrants, etc. are used, and in liquid preparations, solvents, solubilizers, suspending agents, tonicity agents, buffers, and An analgesic or the like is used. Moreover, formulation additives such as preservatives, antioxidants, coloring agents, and sweetening agents can be used as necessary. Furthermore, in order to improve the stability of the oligonucleotide-containing compound or to change the in vivo behavior of the drug, a cationic molecule having binding properties can be added to the oligonucleotide-containing compound.
- Excipients include, for example, lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose, light anhydrous silicic acid and the like.
- lubricants include magnesium stearate, calcium stearate, talc, colloidal silica and the like.
- binders include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose and the like.
- disintegrants include starch, carboxymethylcellulose, carboxymethylcellulose calcium, carboxymethylstarch sodium, L-hydroxypropylcellulose and the like.
- solvents examples include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like.
- solubilizing agents include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like.
- Suspending agents include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glyceryl monostearate; , carboxymethylcellulose sodium, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, and other hydrophilic polymers.
- Examples of tonicity agents include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like.
- buffers include phosphate, acetate, carbonate, citrate buffers, and the like.
- soothing agents include benzyl alcohol and the like.
- preservatives include paraoxybenzoic acid esters, chlorobutanol, benzyl alcohol, phenylethyl alcohol, dehydroacetic acid, sorbic acid and the like.
- Antioxidants include, for example, sulfites, ascorbic acid, ⁇ -tocopherol, and the like.
- Cationic molecules include peptides and oligosaccharides.
- Cationic peptides include, for example, 2,4-diaminobutyric acid octamer (Dab8).
- the conjugates of the present invention can be modified in various ways in view of the properties of polypeptides that are easily metabolized and excreted.
- polyethylene glycol (PEG) or sugar chains can be added to polypeptides to prolong blood residence time and reduce antigenicity.
- biodegradable polymer compounds such as polylactic acid glycol (PLGA), porous hydroxyapatite, liposomes, surface-modified liposomes, emulsions prepared with unsaturated fatty acids, nanoparticles, nanospheres, etc. are used as sustained-release bases. , which may be used to encapsulate the polypeptide.
- a weak electric current can be applied to the skin surface to permeate the stratum corneum (iontophoresis method).
- the pharmaceutical composition varies depending on the dosage form, administration method, carrier, etc., but the conjugate of the present invention is usually 0.01 to 100% (w / w), preferably 0.1 to 95% ( w/w), it can be produced according to a conventional method.
- conjugate for manufacturing a medicament for the prevention or treatment of neuromuscular disease.
- the conjugate in this case may be any of those described above.
- Root temperature in the following examples usually indicates about 10°C to about 35°C.
- the ratios shown for mixed solvents are volume ratios unless otherwise specified. % indicates % by weight unless otherwise specified.
- Mass spectra were measured with a mass spectrometer. Although molecular ion peaks are observed, they may be observed as fragment ions. The data are actual measured values (found) or calculated values obtained by deconvolution processing such as MaxEnt1 using Waters MassLynx. In the case of salts, a molecular ion peak or fragment ion peak of the free form is usually observed.
- the sequence structures of the oligonucleotides used in the following examples are summarized in Tables 1 to 4.
- the PMO of the first nucleic acid strand used in the Examples was synthesized by Wuxi STA or Gene Tools.
- a complementary strand oligonucleotide of the second nucleic acid strand was synthesized by a known phosphoramidite method.
- Some oligonucleotides were further synthesized by condensing the BCN linker with BCN-NHS.
- Some oligonucleotides were synthesized by Genedesign Co., Ltd. (Osaka, Japan), Hokkaido System Science Co., Ltd., or Wuxi.
- A, U, G, C represent the ribonucleosides adenine, uracil, guanine, cytosine, and da, dt, dg, dc, d5 represent the deoxyribonucleosides adenine, thymine, guanine, cytosine, 5- Indicates methylcytosine.
- MoA, MoT, MoG, MoC indicate morpholino nucleic acids.
- mA, mU, mG, and mC represent 2'-O-methylnucleosides.
- bA, bT, bG, and b5 represent 2',4'-BNA NC [N-Me] nucleosides.
- each base is a phosphorodiamidate bond having a dimethylamino group in the case of morpholino nucleic acid, and a phosphodiester bond in the case of other oligonucleic acid chains.
- s when s is attached after the base, it indicates a phosphorothioate bond.
- the 3' end is not conjugated, it is an unmodified form with no phosphate group. The following also have the same meaning.
- Fmoc-Gly-wang resin (Watanabe Kagaku Co., Ltd., 0.78 mmol/g, 1.31 g)
- the desired peptide was synthesized starting from removal of the Fmoc group by the general method described above.
- CEM's Liberty Blue was used as a solid-phase synthesizer, and the synthesis was carried out according to the manufacturer's manual.
- Fmoc-AA/HATU/DIEA 4.2 eq/4 eq/8 eq
- the reaction was carried out once for 30 minutes at 25°C.
- the reaction was repeated twice for 20 minutes at 25°C.
- one reaction was carried out at 60° C. for 15 minutes.
- one reaction was carried out at 60° C. for 15 minutes.
- one reaction was carried out at 60° C. for 15 minutes.
- the reaction was carried out twice at 60°C for 45 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd and 13th residues was repeated twice at 25°C for 5 minutes.
- Introduction of a chloroacetyl group is performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding chloroacetic acid (5 equivalents). , 5 eq. of DIPCDI, 5 eq. Shaking was performed. Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diisopropyl ether cooled to 0° C. resulted in a cloudy precipitate. The mixture was centrifuged (9500 rpm, 1 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration was 4 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking at room temperature for about 12 hours.
- the resulting reaction solution was concentrated under reduced pressure using GenevaC EZ-2.
- the purity of the target product was 92.2% calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis conditions.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis conditions and was 97.1%.
- H-PEG4cKN3-Sieber amide resin was synthesized starting from removal of the Fmoc group by the general method described above. At that time, CEM's Liberty Blue was used as a solid-phase synthesizer, and the synthesis was carried out according to the manufacturer's manual. 1 eq of the solid-phase resin obtained above is swollen in DMF, and 3 eq of compound P0 (485 mg), 3 eq of HATU (86 mg), and 6 eq of DIEA (78 ⁇ L) separately synthesized are used and shaken at 25° C. for 2 hours and 30 minutes.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diisopropyl ether cooled to 0° C. resulted in a cloudy precipitate.
- the mixture was centrifuged (9500 rpm, 1 min) and the solution was decanted and dried under reduced pressure.
- the purity of the target product was 97.7% calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis conditions.
- H-PEG12cKN3-Sieber amide resin was synthesized starting from removal of the Fmoc group by the general method described above. At that time, CEM's Liberty Blue was used as a solid-phase synthesizer, and the synthesis was carried out according to the manufacturer's manual. 1 eq of the solid-phase resin obtained above was swollen in DMF, and 3 eq of compound P0 (334 mg), 2.6 eq of HATU (57 mg), and 6 eq of DIEA (52 ⁇ L) separately synthesized were shaken at 25° C. for 2 hours and 30 minutes.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diisopropyl ether cooled to 0° C. resulted in a cloudy precipitate.
- the mixture was centrifuged (9500 rpm, 1 min) and the solution was decanted and dried under vacuum.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis conditions and was 98.3%.
- the 7th and 13th residues were reacted twice at 75°C for 10 minutes.
- the 12th residue was reacted twice at 50°C for 15 minutes.
- the 15th residue was reacted once at 50°C for 15 minutes.
- Fmoc was removed by reacting with a 20% piperidine DMF solution at 75° C. for 3 minutes.
- the removal of Fmoc from the 2nd, 4th and 13th residues was carried out by reacting at 25°C for 5 minutes and then for 10 minutes.
- the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step was removed by the method described above, followed by addition of 0.1 M chloroacetic acid in DMF. (about 5 eq), 0.1 M HATU in DMF (about 5 eq), and 0.2 M DIEA in DMF (about 10 eq) were added and shaken at 25° C. for 30 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (7 mL, a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5) was added to the reaction vessel containing the solid-phase resin, and the temperature was maintained at room temperature. and shaken for 90 minutes.
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- this filtrate was added to a mixed solvent of excess diethyl ether/hexane (1/1) cooled to 0° C., a cloudy precipitate was formed.
- the mixture was centrifuged (9000 rpm, 2 min) and the solution decanted.
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure.
- the resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO/water (9/1) so that the final concentration of the peptide was 5 mM based on the number of moles of the solid-phase resin, adding 10 eq of triethylamine, and stirring at room temperature for 30 minutes. . After quenching the reaction solution with 15 eq of acetic acid, it was concentrated under reduced pressure using Genevac EZ-2 Elite.
- the purity of the target product was 94.2% calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis conditions.
- the 11th and 12th residues were reacted twice at 50°C for 15 minutes.
- the 13th residue was reacted twice at 90°C for 3 minutes.
- the 15th residue was reacted once at 50°C for 15 minutes.
- the 16th, 17th, 18th, 19th and 20th residues were reacted once at 90°C for 10 minutes.
- Fmoc was removed by reacting with a 10% pyrrolidine DMF solution at 90° C. for 1 minute.
- the removal of Fmoc from the 2nd and 13th residues was performed by reacting at 25° C. for 1 minute and then reacting for 1 minute.
- chloroacetyl group was carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of chloroacetic acid (about 10 eq) and DIPCDI. (about 10 eq) and HOSu (about 10 eq) were shaken in DCM for 60 minutes, and then ClAcOSu (0.25 M) prepared by adding DCM and the same amount of DMF was added and shaken at 25°C for 60 minutes. rice field.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (15 mL, a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5) was added to the reaction vessel containing the solid-phase resin, and the temperature was maintained at room temperature. and shaken for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A 15 mL, a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5
- the cyclization reaction of the peptide was carried out by dissolving the peptide in acetonitrile/water (1/1) so that the final concentration of the peptide was 5 mM based on the number of moles of the solid-phase resin, adding 10 eq of triethylamine, and shaking at room temperature for 30 minutes. .
- the reaction solution was concentrated under reduced pressure using Genevac EZ-2 Elite.
- the purity of the target product was 93.3% calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis conditions.
- reaction solution was filtered through a 0.45 ⁇ m membrane filter and subjected to preparative HPLC using Triart Bio C18 5 ⁇ m (150 x 20 mm ID). Purified by linear gradient elution (15 min) from mL/min, A/B: 65/35-62/38 at 40°C. Fractions containing the desired product were collected and lyophilized. Dissolve the obtained powder in distilled water (4 mL), add physiological saline (4 mL), stir well, and allow to stand for 5 minutes to remove ions. exchanged. Then, it was filtered through a 0.45 ⁇ m membrane filter and desalted by gel filtration (Sephadex G-25, fine, distilled water). Fractions containing the target compound were collected, concentrated, and filtered through a 0.20 ⁇ m membrane filter to obtain 4377 nmol of the title compound. MS (calculated value): 10748.1
- the structure of Y6 is shown below.
- the BCN portion indicates the relative configuration.
- the structure of Y7 in the table is shown below.
- the BCN portion indicates the relative configuration.
- the structure of Y8 in the table is shown below.
- the BCN portion indicates the relative configuration.
- the structure of Y9 in the table is shown below.
- the BCN portion indicates the relative configuration.
- the double coupling method was used in which the condensation reaction was performed at 50° C. for 15 minutes, the solution was removed by filtration, and the same condensation reaction was performed again.
- the resin was washed with MeOH and dried under reduced pressure to obtain the target protected peptide resin H-AEEA-Arg(Pbf)-Arg(Pbf)-Arg(Pbf)- ⁇ Ala-Alko resin.
- 1.5 mL of TFA:water:triisopropylsilane (95:2.5:2.5) was added to the total amount of the obtained resin, and the mixture was stirred for 2.0 hours. Diethyl ether was added to the reaction solution to obtain a precipitate.
- reaction solution was diluted with 20% acetonitrile water, filtered through a 0.45 ⁇ m membrane filter, and subjected to preparative HPLC using Phenomenex Kinetex 5 ⁇ XB-C18 (250 ⁇ 21.2 mmI.D). Purification was performed by linear gradient elution (60 minutes) to water, liquid B: acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min, A/B: 76/24-66/34. The above work was repeated once more using Fmoc- ⁇ Ala-Alko resin (0.62 meq/g, 80.65 mg, 0.05 mmol).
- reaction solution 50 mM DMSO solution, 60 ⁇ L
- compound P1 50 mM DMSO solution, 60 ⁇ L
- the reaction solution was diluted with 0.1% TFA-water, filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ XB-C18 (150 ⁇ 21.2 mmI.D). Purification was performed three times by linear concentration gradient elution (30 minutes) with water, liquid B: acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min, and A/B: 75/25-65/35. Fractions containing the desired product were concentrated and lyophilized.
- the structure of Y10 is shown below.
- the BCN portion indicates the relative configuration.
- reaction mixture was diluted with acetonitrile/water (20/80), filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ m XB-C18 (150 ⁇ 21.2 mm ID).
- %TFA-water, liquid B purified by linear gradient elution (30 minutes) with acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min, A/B: 79/21-69/31.
- Fractions containing the target compound were collected, concentrated, and filtered through a 0.20 ⁇ m membrane filter to obtain 1611 nmol of the title compound.
- reaction mixture was diluted with acetonitrile/water (20/80), filtered through a 0.45 ⁇ m membrane filter, and subjected to preparative HPLC using DAISOPAK SP-100-5-ODS-P (250 ⁇ 20 mm ID).
- Liquid A 0.1% TFA-water
- liquid B acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min
- A/B purification was performed by linear gradient elution (60 minutes) from 74/26 to 64/36. Fractions containing the desired product were collected and lyophilized to give 35.4 mg of white powder.
- reaction mixture was diluted with acetonitrile/water (20/80), filtered through a 0.45 ⁇ m membrane filter, and subjected to preparative HPLC using DAISOPAK SP-100-5-ODS-P (250 ⁇ 20 mm ID).
- Liquid A 0.1% TFA-water
- liquid B acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min
- A/B purification was performed by linear gradient elution (60 minutes) from 74/26 to 64/36. Fractions containing the desired product were collected and freeze-dried to give 22.0 mg of white powder.
- reaction solution was diluted with acetonitrile/water (5/95), filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ m XB-C18 (150 ⁇ 21.2 mm ID).
- %TFA-water, liquid B purified by linear gradient elution (36 minutes) with acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min, A/B: 79/21-69/31.
- Fractions containing the desired product were collected and lyophilized to give 18.0 mg of white powder.
- reaction solution was diluted with an acetonitrile/water (5/95) solution, filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using a YMC-Actus Triart C8 S-5 ⁇ m 12 nm (250 ⁇ 20.0 mm ID).
- Liquid 0.1% TFA-water
- liquid B flow rate 8 mL/min with acetonitrile containing 0.1% TFA
- A/B purified by linear gradient elution (60 minutes) from 67/33 to 57/43. Fractions containing the desired product were concentrated and lyophilized.
- the structure of Y11 is shown below.
- the BCN portion indicates the relative configuration.
- HPLC Anaeris PEPTIDE, XB-C18 column, 3.6 ⁇ m, 150 x 4.6 mm, A solution: 0.1% TFA in DW, B solution: 0.1% TFA in acetonitrile).
- Fractions containing the desired product were collected and lyophilized, and the resulting powder was dissolved in distilled water (1 mL), added with 5 mM HCl aqueous solution (0.5 mL), stirred well, and left for 5 minutes. Ion exchange was performed.
- the structure of Y12 is shown.
- the BCN portion indicates the relative configuration.
- Example 60 Y13-PMO conjugates ([Y1][MoG][MoG][MoC][MoC][MoA][MoA][MoA][MoC][MoC][MoT][MoC][MoG][MoG][MoC ][MoT][Y13] (SEQ ID NO: 878))
- Fmoc-Gly-Alko resin (0.78 meq/g, 64.10 mg, 0.05 mmol) was added to the reaction tube to synthesize peptide. 20% piperidine/NMP was used for deprotection of the Fmoc group [50°C, 5 min reaction], and 5 equivalents of Fmoc-amino acid/DIPCDI/OxymaPure [50°C, 15 min] was used for condensation of Fmoc-amino acid. The amino acids were extended sequentially by a protocol using the reaction].
- the double coupling method was used in which the condensation reaction was performed at 50° C. for 15 minutes, the solution was removed by filtration, and the same condensation reaction was repeated.
- the resin was washed with MeOH, dried under reduced pressure, and the desired protected peptide resin 4-pentynoyl-AEEA-Arg(Pbf)-Arg(Pbf)-Arg(Pbf)-Gly (SEQ ID NO: 880)-Alko Acquired resin.
- 1.5 mL of TFA:water:triisopropylsilane (95:2.5:2.5) was added to the total amount of the obtained resin, and the mixture was stirred for 2.0 hours.
- reaction solution was diluted with 0.1% TFA-water, filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ XB-C18 (150 ⁇ 21.2 mmI.D).
- Solution A 0.1% TFA-water
- B acetonitrile containing 0.1% TFA
- flow rate 8 mL/min
- A/B 75/25-65/35
- linear gradient elution (30 min) was performed in three steps. rice field. Fractions containing the desired product were freeze-dried to obtain 29.8 mg of white powder.
- reaction solution was diluted with 0.1% TFA-water, filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ XB-C18 (150 ⁇ 21.2 mmI.D). Purification was performed three times by linear concentration gradient elution (30 minutes) with water, liquid B: acetonitrile containing 0.1% TFA at a flow rate of 8 mL/min, and A/B: 66/34-49/51. Fractions containing the target compound were concentrated and freeze-dried to obtain 3436 nmol of the title compound.
- reaction solution was diluted with 0.1% TFA-water, filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ XB-C18 (150 ⁇ 21.2 mmI.D). Purification was performed by linear gradient elution (30 minutes) to water, liquid B: acetonitrile containing 0.1% TFA, flow rate 8 mL/min, A/B: 64/36-51/49. Fractions containing the desired product were concentrated and lyophilized.
- a DMSO solution (236 ⁇ L) of the obtained powder, hydrazine (80 mM aqueous solution, 177 ⁇ L) and DMSO (400 ⁇ L) were mixed in a microtube, stirred, sedimented, and reacted at room temperature for 2 hours. After that, hydrazine hydrate (68.8 ⁇ L) was added, stirred and precipitated, and then reacted at room temperature for 20 hours.
- the reaction solution was diluted with a 50% aqueous acetonitrile solution, filtered through a 0.45 ⁇ m membrane filter, and analyzed by preparative HPLC using Phenomenex Kinetex 5 ⁇ XB-C18 (150 ⁇ 21.2 mmI.D).
- a 350 mM EDTA solution was reacted at a flow rate of 10 ⁇ L/min for 60 seconds, a 0.5 mM NiCl 2 solution (Kishida Chemical) was reacted at a flow rate of 10 ⁇ L/min for 60 seconds, and then a 3 mM EDTA solution (Nacalai Tesque, Inc.) was added at a flow rate of 10 ⁇ L/min.
- the NTA sensor chip was washed for 60 seconds at min. 50 ⁇ L each of 60 mM EDC solution (Global Life Science Technologies Japan Co., Ltd.) and 650 mM NHS solution (Global Life Science Technologies Japan Co., Ltd.) were mixed and reacted at a flow rate of 10 ⁇ L/min for 420 seconds.
- a 0.5 ⁇ M hTfR solution (150 ⁇ L) was prepared by dilution with a running buffer, and reacted at a flow rate of 10 ⁇ L/min for 300 seconds to immobilize hTfR on the NTA sensor chip. After immobilization, 1.0 M ethanolamine aqueous solution (Global Life Science Technologies Japan Co., Ltd.) was allowed to react for 420 seconds at a flow rate of 10 ⁇ L/min for capping.
- a peptide-nucleic acid conjugate solution adjusted to 10 mM in DMSO solution was diluted with running buffer to a final concentration of 10 ⁇ M peptide-nucleic acid conjugate solution, followed by 100 nM, 50 nM, 25 nM, 10 nM, and 5 nM.
- a peptide-nucleic acid conjugate solution was made.
- the kinetics of peptides against hTfR was obtained by SPR measurements. Single Cycle Kinetics was used as the kinetics evaluation model, and curve fitting was performed using Biacore T200 Evaluation Software Version 3.0 (Global Life Science Technologies Japan Co., Ltd.). The resulting sensorgram was subjected to curve fitting by the least squares method, and the KD value was obtained to evaluate the binding of the peptide-nucleic acid conjugate to hTfR.
- Tables 13-1 and 13-2 below show the measurement results of the KD values of the Example compounds for hTfR by SPR.
- the KD value was less than 100 nM, it was represented by A, when it was 100 nM or more and less than 1000 nM, it was represented by B, and when it was 1000 nM or more, it was represented by C.
- Synthesis example 1 Chemical Synthesis All raw materials, building blocks, reagents, acids, bases, solid-phase resins, and solvents used in the chemical syntheses in the following examples were either commercially available products or organic chemical techniques were used by those skilled in the art. can be synthesized using As amino acids containing protective groups, commercially available products were used as they were unless otherwise specified.
- the elongation of the peptide chain on the solid-phase resin was carried out using the resins described in each example as starting materials, and using the commonly used peptide coupling reaction conditions and Fmoc removal reaction conditions.
- the reaction was carried out using an automatic peptide synthesizer, CEM's Liberty Blue, according to the manufacturer's manual. Common amino acids used are listed below, with side chain protecting groups shown in brackets.
- Fmoc-Trp(Boc)-OH Fmoc-Thr(tBu)-OH; Fmoc-N-Me-Gly-OH; Fmoc-Asp(OtBu)-OH; Fmoc-N-Me-Phe-OH; -OH; Fmoc-N-Me-Ala-OH; Fmoc-His(Trt)-OH; Fmoc-Tyr(tBu)-OH; Fmoc-Val-OH; Fmoc-HydPro(tBu)-OH; Trt)-OH; Fmoc-Lys(Mtt)-OH; Fmoc-Ser(tBu)-OH; Fmoc-N-Me-Ser(tBu)-OH.
- the chloroacetyl group is introduced by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of chloroacetic acid (3 equivalents ), 3 equivalents of N,N'-diisopropylcarbodiimide in DMF (0.5 M), and 3 equivalents of HOAt in DMF (0.5 M) were added and shaken at room temperature for 40 minutes.
- the resin obtained after the chloroacetyl group-introducing step was washed with DMF and methylene chloride five times each and dried under reduced pressure.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 6 equivalents of triethylamine, and stirring at room temperature for about 16 hours. .
- the resulting reaction solution was acidified with acetic acid and concentrated under reduced pressure using Biotage (registered trademark) V-10 (Biotage Japan).
- the purity of the peptide chemically synthesized in the present invention was determined by any of the following analytical methods.
- Analysis condition A Column; CORTECS (registered trademark) UPLC (registered trademark) C18 column (Nippon Waters Co., Ltd.), 90 ⁇ , 1.6 ⁇ m, 2.1 x 100 mm
- Mobile phase 0.025% TFA in MeCN/0.025% TFA in H2O Temperature: 40°C Gradient: 5-95% MeCN/0.025% TFA in H2O in 5.56 min; linear gradient Flow rate 0.4mL/min Detection method: UV 220nm
- Introduction of a chloroacetyl group is performed by removing the Fmoc group from the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 equivalents of chloroacetic acid.
- DMF solution (0.2 M) of HATU, 5 equivalents of HATU in DMF solution (0.5 M), and 10 equivalents of DIPEA in DMF solution (1 M) were added and shaken at room temperature for 30 minutes.
- the resin obtained after the chloroacetyl group introduction step was washed with DMF five times and methylene chloride three times, and dried under reduced pressure.
- a reactant cocktail (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid-phase resin, and the temperature was maintained at room temperature. and shaken for 90 minutes.
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diethyl ether/hexane (1/1) chilled to 0° C. resulted in a cloudy precipitate.
- the mixture was centrifuged (10000 rpm, 1 min) and the solution decanted.
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C., dried and used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 6 equivalents of triethylamine, and stirring at room temperature for about 16 hours.
- the resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVac.
- the target product obtained was analyzed under the aforementioned analysis condition A or analysis condition B, and the structure was confirmed by ESI-MS (+) in mass spectrometry.
- Table 14 shows the obtained ESI-MS (+) observed value and the value of X when expressed as the protonation number (M+XH)X+ in that case.
- Synthesis example 2 The following peptides or linker-added peptides were synthesized.
- the target peptide was synthesized.
- Biotage's SyroI was used as an automatic synthesizer, and the synthesis was carried out according to the manufacturer's manual.
- the basic condition of the condensation reaction was to repeat the reaction at 75° C. for 20 minutes twice. However, when introducing the 15th and 16th residues, the reaction was carried out at room temperature for 60 minutes and 15 minutes, respectively.
- the reaction was carried out once, and when introducing the 11th amino acid, the condensation reaction was carried out three times.
- the basic conditions for removing Fmoc were to react piperazine (5%) and Oxima pure (0.2 M) in a DMF solution at 50° C. for 5 minutes, and then react again for 15 minutes. However, the removal of the Fmoc group at the 15th and 16th residues was carried out at 25° C. for 5 minutes and then reacting again for 15 minutes.
- Introduction of a chloroacetyl group is carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, and then adding 5 equivalents of ClAcOSu in DMF. It was carried out by adding the solution and shaking at room temperature for 60 minutes.
- the resin obtained after the chloroacetyl group-introducing step was washed with DMF five times and methylene chloride three times, and dried under reduced pressure.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- the resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC. Subsequently, using the obtained solid-phase resin, deprotection of the side chain, cleavage from the solid-phase resin, and cyclization were carried out according to the general method described above.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 91.5%.
- Analysis condition B: Retention time 12.8 min: Gradient (%B conc); 20-60% over 20 min, then 60-95% over 1 min, then 95% over 5 min.
- Fmoc was removed by reacting with a 20% piperidine solution in DMF at room temperature for 5 minutes and then reacting again for 15 minutes.
- Introduction of the chloroacetyl group was carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, and then adding 3 equivalents of chloroacetic acid in DMF. solution (0.45 M), 3 equivalents of HCTU in DMF (0.43 M), and 3 equivalents of DIPEA in DMF (1.57 M) were added to the solid-phase resin and shaken at room temperature for 30 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- the reactant cocktail—HFIP/DCM (1/4) was then added to the reaction vessel containing the solid phase resin and shaken at room temperature for 90 minutes.
- the reaction solution was recovered by filtration through a frit.
- the solid phase resin remaining in the reaction vessel was shaken with a cocktail for excision, the solution component was recovered from the frit, and the above operation of mixing with the filtrate was repeated three times.
- the filtrate was concentrated under reduced pressure using GenevaC EZ-2 Elite and then added to excess diisopropyl ether cooled to 0° C. to give a cloudy precipitate.
- the mixture was centrifuged (9000 rpm, 5 min) and the supernatant decanted.
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure.
- the resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMF so that the final concentration of the peptide was 2.5 mM based on the number of moles of the solid-phase resin.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 97.4%.
- the condensation reaction was carried out twice at 25° C. for 30 minutes.
- the 13th and 14th residues were treated twice at 75°C for 10 minutes.
- the 15th residue was treated once at 25°C for 30 minutes.
- Fmoc-AA-OH/HATU/DIEA 3eq/3eq/6eq was used at 25° C. for 120 minutes once.
- the basic condition for Fmoc removal was reaction in 20% piperidine in DMF at 75°C for 3 minutes.
- the removal of the Fmoc groups at the 13th and 15th residues was carried out at 25° C. for 5 minutes and then reacted for 10 minutes.
- a chloroacetyl group is carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of 10 eq of chloroacetic acid, 10 eq of DIPCI and 10 eq of HOSu were stirred in DCM, the same amount of NMP as DCM was added to prepare a DCM/NMP solution of ClAcOSu (0.2 M), added to the solid phase resin and shaken at room temperature for 60 minutes. rice field.
- the resin obtained after the chloroacetyl group introduction step was washed with DMF five times and methylene chloride three times, and dried under reduced pressure.
- a reactant cocktail (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid-phase resin, and the temperature was maintained at room temperature. and shaken for 60 minutes.
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 77.0%.
- ESI-MS(+) observed m/z 1378.48(M+2H) 2+
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 97.1%.
- the reaction was carried out twice at 75°C for 30 minutes.
- the 9th residue was reacted twice at 90°C for 10 minutes.
- the 11th and 12th residues were reacted twice at 50°C for 15 minutes.
- the 13th residue was reacted twice at 90°C for 3 minutes.
- the 15th residue was reacted once at 50°C for 15 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- Introduction of a chloroacetyl group was performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 eq of chloroacetic acid in DMF, 5 eq of HATU in DMF and 10 eq of DIEA in DMF were added to the solid-phase resin and shaken at room temperature for 30 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 60 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. When this filtrate was added to a mixed solvent of excess diethyl ether/hexane (1/1) cooled to 0° C., a cloudy precipitate was formed. The mixture was centrifuged (9000 rpm, 1.5 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking at room temperature for about 24 hours.
- the resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 93.1%.
- the 2nd and 4th residues were reacted twice at 75°C for 30 minutes.
- the 9th, 10th and 11th residues were reacted twice at 75°C for 20 minutes.
- the 12th residue was reacted twice at 25°C for 30 minutes.
- the 13th residue was reacted twice at 75°C for 10 minutes.
- the 15th residue was reacted once at 25°C for 30 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- Introduction of a chloroacetyl group was performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 eq of ClAcOH in DMF and 5 eq. of HATU in DMF and 10 eq of DIEA in DMF were added to the solid-phase resin and shaken at 25° C. for 30 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 60 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. When this filtrate was added to a mixed solvent of excess diisopropyl ether/hexane (1/1) cooled to 0° C., a cloudy precipitate was formed. The mixture was centrifuged (9000 rpm, 2 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking at room temperature for about 16 hours.
- the resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 97.5%.
- the 10th and 11th residues were reacted twice at 90°C for 10 minutes.
- the 12th residue was reacted twice at 50°C for 15 minutes.
- the 13th residue was reacted twice at 90°C for 3 minutes.
- the 15th residue was reacted once at 50°C for 15 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 5 eq of triethylamine, and shaking at room temperature for about 14 hours.
- the resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 87.5%.
- Fmoc-D-Glu(OtBu)-wang resin (Watanabe Kagaku Co., Ltd., 0.68 mmol/g, 184 mg)
- the peptide of interest was synthesized according to the general method, starting with removal of Fmoc.
- CEM's Liberty Blue HT was used as a solid-phase synthesizer, and the synthesis was carried out according to the manufacturer's manual.
- the basic conditions for the condensation reaction were to use HATU as a condensing agent and conduct the reaction twice at 75° C. for 10 minutes. However, the second residue was reacted twice at 75°C for 30 minutes. The fourth residue was reacted twice at 75°C for 30 minutes.
- the 6th residue was reacted once for 10 minutes at 75°C.
- the 7th residue was reacted once for 10 minutes at 75°C.
- the eighth residue was reacted once for 10 minutes at 75°C.
- the 10th residue was reacted once for 10 minutes at 75°C.
- the 11th residue was reacted twice at 30°C for 30 minutes.
- the 12th residue was reacted once for 30 minutes at 30°C.
- the 15th residue was reacted once for 30 minutes at 30°C.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, for the 2nd, 4th, and 13th residues, Fmoc removal was performed by reacting twice at room temperature for 5 minutes.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diethyl ether/hexane (3/1) chilled to 0° C. resulted in a cloudy precipitate.
- the mixture was centrifuged (9500 rpm, 1 min), the supernatant was decanted, washed with diethyl ether cooled to 0° C., and the obtained solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration was 4 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking at room temperature for about 16 hours.
- the resulting reaction solution was concentrated under reduced pressure using GenevaC EZ-2 Elite.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 88.60%.
- Analysis condition B: Retention time 13.03 min: Gradient (%B conc); 20-60% over 20 min, then 60-95% over 1 min, then 95% over 5 min.
- ESI-MS(+) observed m/z 1137.23(M+2H) 2+
- the reaction was repeated twice at 50°C for 15 minutes.
- the reaction was carried out twice at 90°C for 3 minutes.
- the basic condition for removing Fmoc was to react once with a 20% piperidine solution in DMF at 75° C. for 3 minutes.
- the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- the resin was suspended in DCM and Pd(PPh 3 ) 4 /PhSiH 3 (0.2 eq/10 eq) was added and shaken at room temperature for 1 hour.
- the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step was washed with DMF three times and DCM three times, and then the Fmoc group of the ⁇ -amino group was removed by the method described above. After that, 5 eq of chloroacetic acid in DMF, 5 eq of HATU in DMF, and 10 eq of DIEA in DMF were added and shaken at room temperature for 30 minutes. Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. When this filtrate was added to a mixed solvent of excess diethyl ether/hexane (1/1) cooled to 0° C., a cloudy precipitate was formed. The mixture was centrifuged (10000 rpm, 1 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking overnight at room temperature.
- the reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the resulting mixture was dissolved in DMSO (4 mL), HOSu (10 eq) and EDC HCl (10 eq) were added, and the mixture was stirred at room temperature for 2 hours.
- the obtained cyclic peptide-NHS ester 25 mg, 11.3 ⁇ mol
- DMF 225 ⁇ L
- Fmoc-MeK-OH hydrochloride 5 mg, 11.9 ⁇ mol
- DIEA 5.9 ⁇ L, 33.9 ⁇ mol
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 97.9%.
- the reaction was carried out twice at 75°C for 45 minutes.
- the reaction was repeated twice for 15 minutes at 50°C.
- the reaction was carried out twice at 90°C for 3 minutes.
- the basic condition for removing Fmoc was to react once with a 20% piperidine solution in DMF at 75° C. for 3 minutes.
- the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- the resin was suspended in DCM and Pd(PPh 3 ) 4 /PhSiH 3 (0.2 eq/10 eq) was added and shaken at room temperature for 1 hour.
- the solid phase resin was washed 3 times with DMF and 3 times with DCM and then dried under vacuum.
- Resin (60 ⁇ mol) was suspended in DMF and added HD-Glu(OtBu)-OtBu hydrochloride (71 mg, 0.24 mmol), 0.5 M Oxyma pure in DMF (0.48 mL, 0.24 mmol), DIPCI (37 ⁇ L, 0.24 mmol) and DIEA (42 ⁇ L, 0.24 mmol) were added and reacted twice for 30 minutes at 75° C.
- the chloroacetyl group was introduced by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 eq of chloroacetic acid in DMF and 5 eq. of HATU in DMF and 10 eq of DIEA in DMF were added and shaken at room temperature for 30 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. When this filtrate was added to a mixed solvent of excess diethyl ether/hexane (1/1) cooled to 0° C., a cloudy precipitate was formed. The mixture was centrifuged (10000 rpm, 1 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 10 eq of triethylamine, and shaking overnight at room temperature.
- the reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 94.9%.
- the 11th and 12th residues were reacted twice at 90°C for 10 minutes.
- the 13th residue was reacted twice at 75°C for 10 minutes.
- the 15th residue was reacted once at 25°C for 20 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd, 4th and 13th residues was carried out at 25°C for 5 minutes and then at 25°C for 10 minutes.
- chloroacetyl group is carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of chloroacetic acid (10 equivalents), 10 equivalents of DIPCI, 10 equivalents of HOSu were stirred in DCM and the same amount of DMF as DCM was added to prepare a solution of ClAcOSu in DCM/DMF (0.2 M), added to the solid phase resin and shaken at room temperature for 60 minutes.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in a 50% MeCN aqueous solution so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 5 equivalents of triethylamine, and shaking at room temperature for about 14 hours.
- the resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 98.2%.
- the third residue was reacted twice at 75°C for 30 minutes.
- the 7th and 8th residues were reacted once at 90°C for 3 minutes.
- the reaction was carried out twice at 50°C for 15 minutes.
- the 15th and 16th residues were reacted once at 50°C for 15 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- chloroacetyl group is carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of chloroacetic acid (5 equivalents), 5 equivalents of DIPCI, 5 equivalents of HOSu are stirred in DCM and the same amount of DMF as DCM is added to prepare a solution of ClAcOSu in DCM/DMF (0.2 M), added to the solid phase resin and shaken at room temperature for 60 minutes.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 95.4%.
- the reaction was repeated twice at 25°C for 20 minutes.
- the 13th residue was reacted twice at 75°C for 10 minutes.
- the 15th and 22nd residues were reacted once at 25°C for 30 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes.
- the Fmoc removal of the 2nd, 4th and 13th residues was carried out at 25° C. for 5 minutes and then at room temperature for 10 minutes.
- a chloroacetyl group is performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of 10 eq of chloroacetic acid and 10 eq of DIPCI, 10 eq of HOSu were stirred in DCM and the same amount of DMF as DCM was added to prepare a DCM/DMF solution (0.2M) of ClAcOSu, which was added to the solid phase resin and shaken at room temperature for 60 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5) was added to the reaction vessel containing the solid-phase resin, and the mixture was stirred at room temperature for 90 minutes. shaken for a minute. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5
- the resulting mixture was dissolved in DMSO and 3 eq of silver acetate was added and shaken for 3 hours. After adding a 2M DTT aqueous solution (11 eq), the mixture was centrifuged, the supernatant was collected, and then concentrated under reduced pressure to obtain a crude product.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 94.8%.
- the target peptide was synthesized according to the general method, starting with removal of Fmoc. At that time, CEM's Liberty Blue HT was used as a solid-phase synthesizer, and it was carried out according to the manufacturer's manual.
- the basic condition of the condensation reaction was to use DIPCI and Oxyma pure as condensing agents and conduct the reaction once at 90° C. for 3 minutes. However, for the 11th and 12th residues, the reaction was repeated twice at 50°C for 15 minutes. For the 13th residue, the reaction was repeated twice at 90°C for 3 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, for the 13th residue, Fmoc was removed by reacting twice for 5 minutes at 25°C. The resulting resin was washed five times with DMF and three times with methylene chloride and dried under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- this filtrate was added to a mixed solvent of excess diisopropyl ether and hexane cooled to 0° C., a cloudy precipitate was formed.
- the mixture was centrifuged (9000 rpm, 2 min) and the supernatant decanted. The obtained solid was washed with ice-cooled diethyl ether and then dried. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMF so that the final concentration of the peptide was 5 mM based on the number of moles of the solid-phase resin, adding 1.5 equivalents of HATU and 3 equivalents of triethylamine, and conducting the reaction at room temperature for about 1 hour. shaken. The resulting reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVaC.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 96.8%.
- the 2nd and 3rd residues were reacted twice at 75°C for 20 minutes.
- the fourth residue was reacted twice at 75°C for 30 minutes.
- the 11th and 14th residues were reacted once at 75°C for 20 minutes.
- the 12th and 15th residues were reacted once at 30°C for 30 minutes.
- the basic condition for removing Fmoc was to react once with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd, 4th and 13th residues was repeated twice at 25°C for 5 minutes.
- Introduction of a chloroacetyl group is performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 equivalents of chloroacetic acid, 5 equivalents of chloroacetic acid, 5 equivalents of Prepare a solution of ClAcOSu in DCM/DMF (0.2 M) by stirring equivalents of DIPCI, 5 equivalents of HOSu in DCM and adding an equal amount of DMF to DCM, add to the solid phase resin and shake for 75 minutes at room temperature. gone.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the resulting reaction solution was concentrated under reduced pressure using GenevaC EZ-2 Elite.
- the resulting mixture was dissolved in DMF so that the final concentration of the peptide was 25 mM based on the number of moles of the solid phase resin, added with 1 equivalent of HATU and 3 equivalents of DIEA, and shaken at room temperature for about 30 minutes.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 94.8%.
- the solid phase resin was washed successively with DMF and DCM, dried under reduced pressure, swelled with DCM, added with 10 equivalents of PhSiH 3 and 0.2 equivalents of Pd(PPh 3 ) 4 and shaken at room temperature for 1 hour.
- the solid phase resin was washed 5 times with DCM, 5 times with DMF, 3 times with diethyl ether and dried.
- the solid phase resin was swollen with NMP, 5 equivalents of HATU, 5 equivalents of DIEA were added and shaken at room temperature for 30 minutes. After washing the resin, 5 equivalents of HATU and 5 equivalents of DIEA were added again and shaken at room temperature for 30 minutes.
- the solid phase resin was washed 5 times with DCM, 5 times with DMF and 3 times with diethyl ether.
- Introduction of a chloroacetyl group is performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 equivalents of chloroacetic acid, 5 equivalents of chloroacetic acid, 5 equivalents of Equivalents of DIPCI, 5 equivalents of HOSu were stirred in DCM and the same amount of DMF as DCM was added to prepare a solution of ClAcOSu in DCM/DMF (0.2 M), added to the solid phase resin and shaken at room temperature for 60 minutes. gone.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 94.8%.
- Fmoc-Gly-wang resin (Watanabe Kagaku Co., Ltd., 0.78 mmol/g, 1.31 g)
- the desired peptide was synthesized starting from removal of the Fmoc group by the general method described above.
- CEM's Liberty Blue was used as a solid-phase synthesizer, and the synthesis was carried out according to the manufacturer's manual.
- Fmoc-AA/HATU/DIEA 4.2 equivalents/4 equivalents/8 equivalents
- the reaction was carried out once for 30 minutes at 25°C.
- the reaction was repeated twice for 20 minutes at 25°C.
- one reaction was carried out at 60° C. for 15 minutes.
- one reaction was carried out at 60° C. for 15 minutes.
- one reaction was carried out at 60° C. for 15 minutes.
- the reaction was carried out twice at 60°C for 45 minutes.
- the basic condition for removing Fmoc was to react with a 20% piperidine solution in DMF at 75° C. for 3 minutes. However, the Fmoc removal of the 2nd and 13th residues was repeated twice at 25°C for 5 minutes.
- Introduction of a chloroacetyl group is carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of chloroacetic acid (5 equivalents), Prepare DCM/DMF solution (0.2 M) of ClAcOSu by stirring 5 eq. of DIPCI, 5 eq. It was done by Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diisopropyl ether cooled to 0° C. resulted in a cloudy precipitate. The mixture was centrifuged (9500 rpm, 1 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration was 4 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking at room temperature for about 12 hours.
- the resulting reaction solution was concentrated under reduced pressure using GenevaC EZ-2.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 92.2%.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 97.3%.
- Introduction of a chloroacetyl group is carried out by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 5 equivalents of chloroacetic acid in DMF, 5 equivalents of HATU in DMF and 10 equivalents of DIEA in DMF were added and shaken at 25°C for 30 minutes.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure.
- reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 60 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. When this filtrate was added to a mixed solvent of excess diisopropyl ether/hexane (1/1) cooled to 0° C., a cloudy precipitate was formed. The mixture was centrifuged (9000 rpm, 2 min) and the solution decanted.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C. and then dried under reduced pressure. The resulting solid was used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and shaking overnight at room temperature.
- the reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVac.
- the obtained solid was dissolved in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid-phase resin, and then MePEG4c (1.2 equivalents), HATU (1.1 equivalents) and DIEA (3 equivalents) were added. was added and shaken at room temperature for 1 hour.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 92.3%.
- the reaction was repeated twice for 20 minutes at 25°C.
- the 13th residue was reacted twice at 75°C for 10 minutes.
- the 15th and 22nd residues were reacted once at 25°C for 30 minutes.
- the basic condition for removing Fmoc was to react a 20% piperidine in DMF solution at 75° C. for 3 minutes.
- the removal of Fmoc from the 4th and 13th residues was carried out at 25° C. for 5 minutes and then at room temperature for 10 minutes.
- Introduction of a chloroacetyl group is performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 10 equivalents of chloroacetic acid, 10 equivalents of chloroacetic acid, 10 equivalents of Equivalents of DIPCI, 10 equivalents of HOSu were stirred in DCM and the same amount of DMF as DCM was added to prepare a solution of ClAcOSu in DCM/DMF (0.2 M), added to the solid phase resin and shaken at room temperature for 60 minutes. gone.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5) was added to the reaction vessel containing the solid-phase resin, and the mixture was stirred at room temperature for 90 minutes. shaken for a minute. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 90:2.5:2.5:5
- the resulting mixture was dissolved in DMSO (20 mL) and 3 equivalents of silver acetate was added and shaken for 3 hours. After adding a 2M DTT aqueous solution (11 equivalents), the mixture was centrifuged, the supernatant was collected, and the mixture was concentrated under reduced pressure to obtain a crude product.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 94.8%.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under the following analysis conditions and was 94.20%.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under the following analysis conditions and was 97.52%.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under the following analysis conditions and was 98.02%.
- the reaction was repeated twice at 75°C for 10 minutes.
- the 12th residue was reacted twice at 25°C for 20 minutes.
- the 15th residue was reacted once at 25°C for 20 minutes.
- the basic condition for removing Fmoc was to react a 20% piperidine in DMF solution at 75° C. for 3 minutes.
- the Fmoc removal of the 2nd, 4th and 13th residues was carried out at 25°C for 5 minutes and then at 25°C for 10 minutes.
- Introduction of a chloroacetyl group is performed by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by adding 10 equivalents of chloroacetic acid, 10 equivalents of chloroacetic acid, 10 equivalents of Equivalents of DIPCI, 10 equivalents of HOSu were stirred in DCM and the same amount of DMF as DCM was added to prepare a solution of ClAcOSu in DCM/DMF (0.2 M), added to the solid phase resin and shaken at room temperature for 60 minutes. gone.
- Deprotection of the side chain and cleavage from the solid-phase resin were performed by first washing the resin obtained after the step of introducing the chloroacetyl group five times with DMF and three times with methylene chloride, followed by drying under reduced pressure. Subsequently, reactant cocktail-A (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid phase resin. , shaken at room temperature for 90 minutes. The reaction solution was recovered by filtration through a frit. The solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate.
- reactant cocktail-A a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 92.8%.
- Fmoc-Abu(4)-Alko resin (Watanabe Kagaku, 1.00 mmol/g, 0.1 g)
- Fmoc-PEG4c-Abu-Alko resin prepared according to a general solid-phase synthesis following the general method Therefore, starting with Fmoc removal, the C-terminal carboxylic acid peptide was synthesized. At that time, CEM's Liberty Blue was used as a solid-phase synthesizer, and the synthesis was carried out according to the manufacturer's manual.
- the chloroacetyl group is introduced by removing the Fmoc group of the ⁇ -amino group of the solid-phase resin holding the Fmoc-protected peptide obtained in the previous step by the method described above, followed by addition of 0.2 M chloroacetic acid.
- DMF 5 equivalents
- 0.5M HATU in DMF 5 equivalents
- 1M DIEA in DMF 10 equivalents
- the resin obtained after the chloroacetyl group introduction step was washed with DMF five times and methylene chloride three times, and dried under reduced pressure.
- a reactant cocktail (a mixture of TFA/H 2 O/TIS/DODT at a volume ratio of 92.5:2.5:2.5:2.5) was added to the reaction vessel containing the solid-phase resin, and the temperature was maintained at room temperature. and shaken for 90 minutes.
- the reaction solution was recovered by filtration through a frit.
- the solid-phase resin remaining in the reaction vessel was shaken again with the cutting cocktail, and the solution component was recovered from the frit and mixed with the above filtrate. Addition of this filtrate to excess diethyl ether/hexane (1/1) chilled to 0° C. resulted in a cloudy precipitate.
- the mixture was centrifuged (10000 rpm, 1 min) and the solution decanted.
- the obtained solid was washed again with a small amount of diethyl ether cooled to 0° C., dried and used for the next cyclization reaction.
- the cyclization reaction of the peptide was carried out by dissolving the peptide in DMSO so that the final concentration of the peptide was 5 mM based on the number of moles of the solid phase resin, adding 10 equivalents of triethylamine, and stirring at room temperature for about 17 hours.
- the reaction solution was concentrated under reduced pressure using a Savant Explorer SpeedVac.
- the purity of the target product was calculated from the area ratio of the LC/MS (UV wavelength 225 nm) chromatogram under analysis condition B and found to be 87.4%.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Marine Sciences & Fisheries (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Neurology (AREA)
- Physical Education & Sports Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP22861282.6A EP4389893A4 (en) | 2021-08-21 | 2022-08-19 | PEPTIDE-DRUG CONJUGATE BINDING HUMAN TRANSFERRIN RECEPTOR |
| JP2023543884A JPWO2023026994A1 (https=) | 2021-08-21 | 2022-08-19 | |
| US18/685,457 US20240390508A1 (en) | 2021-08-21 | 2022-08-19 | Human transferrin receptor binding peptide-drug conjugate |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2021-135254 | 2021-08-21 | ||
| JP2021135254 | 2021-08-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023026994A1 true WO2023026994A1 (ja) | 2023-03-02 |
Family
ID=85322137
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2022/031434 Ceased WO2023026994A1 (ja) | 2021-08-21 | 2022-08-19 | ヒトトランスフェリンレセプター結合ペプチド-薬物コンジュゲート |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20240390508A1 (https=) |
| EP (1) | EP4389893A4 (https=) |
| JP (1) | JPWO2023026994A1 (https=) |
| WO (1) | WO2023026994A1 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024195711A1 (ja) * | 2023-03-17 | 2024-09-26 | 富士フイルム株式会社 | 環状ペプチド又はその塩及びそれらの利用 |
| US12173078B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12173079B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12239716B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12263225B2 (en) | 2018-08-02 | 2025-04-01 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy |
| WO2025072246A1 (en) * | 2023-09-26 | 2025-04-03 | Entrada Therapeutics, Inc. | Compounds and methods for skipping exon 50 in duchenne muscular dystrophy |
| US12280122B2 (en) | 2018-08-02 | 2025-04-22 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12329825B1 (en) | 2018-08-02 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject |
| US12370264B1 (en) | 2018-08-02 | 2025-07-29 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject |
| US12403203B2 (en) | 2021-07-09 | 2025-09-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12440574B2 (en) | 2022-04-15 | 2025-10-14 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating myotonic dystrophy |
Citations (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| WO1991009033A1 (en) | 1989-12-20 | 1991-06-27 | Anti-Gene Development Group | Uncharged morpholino-based polymers having phosphorous-containing chiral intersubunit linkages |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5286717A (en) | 1987-03-25 | 1994-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5525491A (en) | 1991-02-27 | 1996-06-11 | Creative Biomolecules, Inc. | Serine-rich peptide linkers |
| US5955599A (en) | 1995-06-01 | 1999-09-21 | Hybridon, Inc. | Process for making oligonucleotides containing o- and s- methylphosphotriester internucleoside linkages |
| JP2000297097A (ja) | 1999-02-12 | 2000-10-24 | Sankyo Co Ltd | 新規ヌクレオシド及びオリゴヌクレオチド類縁体 |
| JP2002241393A (ja) | 2000-08-10 | 2002-08-28 | Sankyo Co Ltd | ヌクレオシド及びオリゴヌクレオチド類縁体を含有する核酸試薬及び医薬 |
| WO2004080406A2 (en) | 2003-03-07 | 2004-09-23 | Alnylam Pharmaceuticals | Therapeutic compositions |
| WO2007066627A1 (ja) | 2005-12-06 | 2007-06-14 | The University Of Tokyo | 多目的アシル化触媒とその用途 |
| US7271149B2 (en) | 2000-12-07 | 2007-09-18 | Eli Lilly And Company | GLP-1 fusion proteins |
| WO2007143315A2 (en) | 2006-05-05 | 2007-12-13 | Isis Pharmaceutical, Inc. | Compounds and methods for modulating expression of pcsk9 |
| WO2008043753A2 (en) | 2006-10-09 | 2008-04-17 | Santaris Pharma A/S | Rna antagonist compounds for the modulation of pcsk9 |
| WO2008049085A1 (en) | 2006-10-18 | 2008-04-24 | Isis Pharmaceuticals, Inc. | Antisense compounds |
| WO2009064471A1 (en) | 2007-11-15 | 2009-05-22 | Avi Biopharma, Inc. | Method of synthesis of morpholino oligomers |
| WO2009147368A1 (en) | 2008-06-04 | 2009-12-10 | Medical Research Council | Peptides |
| US7902160B2 (en) | 2002-11-25 | 2011-03-08 | Masafumi Matsuo | ENA nucleic acid drugs modifying splicing in mRNA precursor |
| WO2011052436A1 (ja) | 2009-10-29 | 2011-05-05 | 国立大学法人大阪大学 | 架橋型人工ヌクレオシドおよびヌクレオチド |
| US8084601B2 (en) | 2008-09-11 | 2011-12-27 | Royal Holloway And Bedford New College Royal Holloway, University Of London | Oligomers |
| WO2012029986A1 (ja) | 2010-09-01 | 2012-03-08 | 日本新薬株式会社 | アンチセンス核酸 |
| WO2012150960A1 (en) | 2011-05-05 | 2012-11-08 | Avi Biopharma, Inc. | Peptide oligonucleotide conjugates |
| WO2013030569A2 (en) | 2011-08-30 | 2013-03-07 | Michael John Gait | Peptides |
| WO2013089283A1 (en) | 2011-12-16 | 2013-06-20 | National University Corporation Tokyo Medical And Dental University | Chimeric double-stranded nucleic acid |
| WO2013100190A1 (ja) | 2011-12-28 | 2013-07-04 | 日本新薬株式会社 | アンチセンス核酸 |
| US8524880B2 (en) | 2004-06-28 | 2013-09-03 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
| WO2014046212A1 (ja) | 2012-09-21 | 2014-03-27 | 国立大学法人大阪大学 | グアニジン架橋を有する人工ヌクレオシドおよびオリゴヌクレオチド |
| WO2015022504A2 (en) | 2013-08-12 | 2015-02-19 | Medical Research Council | Peptide conjugates |
| WO2015125783A1 (ja) | 2014-02-18 | 2015-08-27 | 国立大学法人大阪大学 | 架橋型ヌクレオシドおよびヌクレオチド |
| WO2015168172A1 (en) | 2014-04-28 | 2015-11-05 | Isis Pharmaceuticals, Inc. | Linkage modified oligomeric compounds |
| US20150329609A1 (en) * | 2014-03-03 | 2015-11-19 | Sujata Acharjee | Chimeric dystrophin proteins to treat dystrophinopathies |
| WO2015194520A1 (ja) | 2014-06-17 | 2015-12-23 | 日本新薬株式会社 | アンチセンス核酸 |
| WO2016081600A1 (en) | 2014-11-18 | 2016-05-26 | Zata Pharmaceuticals, Inc. | Phosphoramidite synthones for the synthesis of self-neutralizing oligonucleotide compounds |
| WO2016208695A1 (ja) * | 2015-06-24 | 2016-12-29 | Jcrファーマ株式会社 | 血液脳関門を通過する抗ヒトトランスフェリン受容体抗体 |
| WO2017221883A1 (ja) | 2016-06-20 | 2017-12-28 | 武田薬品工業株式会社 | 抗体-薬物コンジュゲート |
| WO2020028832A1 (en) | 2018-08-02 | 2020-02-06 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| JP6708770B2 (ja) | 2012-09-19 | 2020-06-10 | ジェムバックス アンド カエル カンパニー,リミティド | 細胞透過性ペプチド、それを含んだコンジュゲート、及びそれを含んだ組成物 |
| WO2020209285A1 (ja) | 2019-04-08 | 2020-10-15 | 国立大学法人東京医科歯科大学 | 筋疾患治療用医薬組成物 |
| JP2020537497A (ja) * | 2017-09-22 | 2020-12-24 | アビディティー バイオサイエンシーズ,インク. | エクソンスキッピングを誘発する核酸ポリペプチド組成物と方法 |
| WO2021054370A1 (ja) | 2019-09-18 | 2021-03-25 | 国立大学法人東京医科歯科大学 | 核酸複合体 |
| WO2021167107A1 (ja) * | 2020-02-22 | 2021-08-26 | Jcrファーマ株式会社 | ヒトトランスフェリンレセプター結合ペプチド |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11168141B2 (en) * | 2018-08-02 | 2021-11-09 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| WO2020219820A1 (en) * | 2019-04-25 | 2020-10-29 | Avidity Biosciences, Inc. | Nucleic acid compositions and methods of multi-exon skipping |
| JP7780691B2 (ja) * | 2020-01-10 | 2025-12-05 | ダイン セラピューティクス,インコーポレーテッド | ジストロフィン異常症を処置するための筋標的化複合体およびそれらの使用 |
| CA3163608A1 (en) * | 2020-01-10 | 2021-07-15 | Romesh R. Subramanian | Muscle-targeting complexes and uses thereof |
-
2022
- 2022-08-19 US US18/685,457 patent/US20240390508A1/en active Pending
- 2022-08-19 EP EP22861282.6A patent/EP4389893A4/en active Pending
- 2022-08-19 JP JP2023543884A patent/JPWO2023026994A1/ja active Pending
- 2022-08-19 WO PCT/JP2022/031434 patent/WO2023026994A1/ja not_active Ceased
Patent Citations (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5286717A (en) | 1987-03-25 | 1994-02-15 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| WO1991009033A1 (en) | 1989-12-20 | 1991-06-27 | Anti-Gene Development Group | Uncharged morpholino-based polymers having phosphorous-containing chiral intersubunit linkages |
| US5525491A (en) | 1991-02-27 | 1996-06-11 | Creative Biomolecules, Inc. | Serine-rich peptide linkers |
| US5955599A (en) | 1995-06-01 | 1999-09-21 | Hybridon, Inc. | Process for making oligonucleotides containing o- and s- methylphosphotriester internucleoside linkages |
| JP2000297097A (ja) | 1999-02-12 | 2000-10-24 | Sankyo Co Ltd | 新規ヌクレオシド及びオリゴヌクレオチド類縁体 |
| JP2002241393A (ja) | 2000-08-10 | 2002-08-28 | Sankyo Co Ltd | ヌクレオシド及びオリゴヌクレオチド類縁体を含有する核酸試薬及び医薬 |
| US7271149B2 (en) | 2000-12-07 | 2007-09-18 | Eli Lilly And Company | GLP-1 fusion proteins |
| US7902160B2 (en) | 2002-11-25 | 2011-03-08 | Masafumi Matsuo | ENA nucleic acid drugs modifying splicing in mRNA precursor |
| WO2004080406A2 (en) | 2003-03-07 | 2004-09-23 | Alnylam Pharmaceuticals | Therapeutic compositions |
| US8524880B2 (en) | 2004-06-28 | 2013-09-03 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
| US9018368B2 (en) | 2004-06-28 | 2015-04-28 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
| WO2007066627A1 (ja) | 2005-12-06 | 2007-06-14 | The University Of Tokyo | 多目的アシル化触媒とその用途 |
| WO2007143315A2 (en) | 2006-05-05 | 2007-12-13 | Isis Pharmaceutical, Inc. | Compounds and methods for modulating expression of pcsk9 |
| WO2008043753A2 (en) | 2006-10-09 | 2008-04-17 | Santaris Pharma A/S | Rna antagonist compounds for the modulation of pcsk9 |
| WO2008049085A1 (en) | 2006-10-18 | 2008-04-24 | Isis Pharmaceuticals, Inc. | Antisense compounds |
| WO2009064471A1 (en) | 2007-11-15 | 2009-05-22 | Avi Biopharma, Inc. | Method of synthesis of morpholino oligomers |
| WO2009147368A1 (en) | 2008-06-04 | 2009-12-10 | Medical Research Council | Peptides |
| US8084601B2 (en) | 2008-09-11 | 2011-12-27 | Royal Holloway And Bedford New College Royal Holloway, University Of London | Oligomers |
| US8324371B2 (en) | 2008-09-11 | 2012-12-04 | Royal Holloway and Bedford New College, University of London | Oligomers |
| US8552172B2 (en) | 2008-09-11 | 2013-10-08 | Linda POPPLEWELL | Oligomers |
| WO2011052436A1 (ja) | 2009-10-29 | 2011-05-05 | 国立大学法人大阪大学 | 架橋型人工ヌクレオシドおよびヌクレオチド |
| WO2012029986A1 (ja) | 2010-09-01 | 2012-03-08 | 日本新薬株式会社 | アンチセンス核酸 |
| WO2012150960A1 (en) | 2011-05-05 | 2012-11-08 | Avi Biopharma, Inc. | Peptide oligonucleotide conjugates |
| JP6478632B2 (ja) | 2011-05-05 | 2019-03-06 | サレプタ セラピューティクス, インコーポレイテッド | ペプチドオリゴヌクレオチドコンジュゲート |
| WO2013030569A2 (en) | 2011-08-30 | 2013-03-07 | Michael John Gait | Peptides |
| WO2013089283A1 (en) | 2011-12-16 | 2013-06-20 | National University Corporation Tokyo Medical And Dental University | Chimeric double-stranded nucleic acid |
| WO2013100190A1 (ja) | 2011-12-28 | 2013-07-04 | 日本新薬株式会社 | アンチセンス核酸 |
| JP6708770B2 (ja) | 2012-09-19 | 2020-06-10 | ジェムバックス アンド カエル カンパニー,リミティド | 細胞透過性ペプチド、それを含んだコンジュゲート、及びそれを含んだ組成物 |
| WO2014046212A1 (ja) | 2012-09-21 | 2014-03-27 | 国立大学法人大阪大学 | グアニジン架橋を有する人工ヌクレオシドおよびオリゴヌクレオチド |
| WO2015022504A2 (en) | 2013-08-12 | 2015-02-19 | Medical Research Council | Peptide conjugates |
| WO2015125783A1 (ja) | 2014-02-18 | 2015-08-27 | 国立大学法人大阪大学 | 架橋型ヌクレオシドおよびヌクレオチド |
| US20150329609A1 (en) * | 2014-03-03 | 2015-11-19 | Sujata Acharjee | Chimeric dystrophin proteins to treat dystrophinopathies |
| WO2015168172A1 (en) | 2014-04-28 | 2015-11-05 | Isis Pharmaceuticals, Inc. | Linkage modified oligomeric compounds |
| WO2015194520A1 (ja) | 2014-06-17 | 2015-12-23 | 日本新薬株式会社 | アンチセンス核酸 |
| WO2016081600A1 (en) | 2014-11-18 | 2016-05-26 | Zata Pharmaceuticals, Inc. | Phosphoramidite synthones for the synthesis of self-neutralizing oligonucleotide compounds |
| WO2016208695A1 (ja) * | 2015-06-24 | 2016-12-29 | Jcrファーマ株式会社 | 血液脳関門を通過する抗ヒトトランスフェリン受容体抗体 |
| WO2017221883A1 (ja) | 2016-06-20 | 2017-12-28 | 武田薬品工業株式会社 | 抗体-薬物コンジュゲート |
| JP2020537497A (ja) * | 2017-09-22 | 2020-12-24 | アビディティー バイオサイエンシーズ,インク. | エクソンスキッピングを誘発する核酸ポリペプチド組成物と方法 |
| WO2020028832A1 (en) | 2018-08-02 | 2020-02-06 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| WO2020209285A1 (ja) | 2019-04-08 | 2020-10-15 | 国立大学法人東京医科歯科大学 | 筋疾患治療用医薬組成物 |
| WO2021054370A1 (ja) | 2019-09-18 | 2021-03-25 | 国立大学法人東京医科歯科大学 | 核酸複合体 |
| WO2021167107A1 (ja) * | 2020-02-22 | 2021-08-26 | Jcrファーマ株式会社 | ヒトトランスフェリンレセプター結合ペプチド |
Non-Patent Citations (45)
| Title |
|---|
| "Concise Encyclopedia Of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859 |
| "Current Protocols in Molecular Biology", 1999, JOHN WILEY & SONS, pages: 1 - 6 |
| "GenBank", Database accession no. NM_00401 1.3 |
| "Solid Phase Peptide Synthesis Utilizing 9-Fluorenylmethoxycarbonyl Amino Acids", INT. J. PEPTIDE PROTEIN RES., vol. 35, 1990, pages 161 - 214 |
| ALEXANDER A. LOMZOV ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 513, no. 4, 2019, pages 807 - 811 |
| ANASTASIA KHVOROVA ET AL., NAT. BIOTECHNOL., vol. 35, no. 3, 2017, pages 238 - 248 |
| ANTIBODIES, vol. 9, 2020, pages 2 |
| ASAMI Y ET AL., DRUG DISCOVERIES &THERAPEUTICS, vol. 10, no. 5, 2016, pages 256 - 262 |
| CHEM. SOC. REV., vol. 48, 2019, pages 4361 |
| ENGLISCH ET AL., ANGEWANDTE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613 |
| FEES J, vol. 276, no. 6, 2008, pages 1494 - 505 |
| FLANIGAN KM: "Mutational spectrum of DMD mutations in dystrophinopathy patients", APPLICATION OF MODERN DIAGNOSTIC TECHNIQUES TO A LARGE COHORT, AND HUM MUTAT, vol. 30, no. 12, December 2009 (2009-12-01), pages 1657 - 66, XP055218851, DOI: 10.1002/humu.21114 |
| H. MURAKAMIA. OHTAH. ASHIGAIH. SUGA: "The flexizyme system: a highly flexible tRNA aminoacylation tool for the synthesis of nonnatural peptides", NATURE METHODS, vol. 3, 2006, pages 357 - 359 |
| H. MURAKAMID. KOUROUKLISH. SUGA, CHEMISTRY & BIOLOGY, vol. 10, 2003, pages 1077 - 1084 |
| H. XIA, B. ANDERSON, Q. MAO, B. L. DAVIDSON: "Recombinant Human Adenovirus: Targeting to the Human Transferrin Receptor Improves Gene Transfer to Brain Microcapillary Endothelium", JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 74, no. 23, 1 December 2000 (2000-12-01), US , pages 11359 - 11366, XP055328224, ISSN: 0022-538X, DOI: 10.1128/JVI.74.23.11359-11366.2000 * |
| J. AM. CHEM. SOC., vol. 119, no. 47, 1997, pages 11548 - 11549 |
| J. AM. CHEM. SOC., vol. 124, no. 21, 2002, pages 5993 - 6002 |
| J. AM. CHEM. SOC., vol. 143, 2021, pages 3416 - 3429 |
| JAE H. LEE, JEFFREY A. ENGLER, JAMES F. COLLAWN, BRYAN A. MOORE: "Receptor mediated uptake of peptides that bind the human transferrin receptor", EUROPEAN JOURNAL OF BIOCHEMISTRY, PUBLISHED BY SPRINGER-VERLAG ON BEHALF OF THE FEDERATION OF EUROPEAN BIOCHEMICAL SOCIETIES, vol. 268, no. 7, 1 April 2001 (2001-04-01), pages 2004 - 2012, XP055059531, ISSN: 00142956, DOI: 10.1046/j.1432-1327.2001.02073.x * |
| K. J. JENSENP. T. SHELTONS. L. PEDERSEN: "Peptide Synthesis and Applications", 2013, SPRINGER |
| K.L. DUEHOLMM. EGHOLMC. BEHRENSL. CHRISTENSENH.F. HANSENT. VULPIUSK.H. PETERSENR.H. BERGP.E. NIELSENO. BUCHARDT, J. ORG. CHEM., vol. 59, 1994, pages 5767 |
| L. CHRISTENSENR. FITZPATRICKB. GILDEAK.H. PETERSENH.F. HANSENT. KOCHM. EGHOLMO. BUCHARDTP.E. NIELSENJ. COULL, J. PEPT. SCI., vol. 1, 1995, pages 175 |
| L. LEHNINGER: "Biochemistry", 1975, WORTH PUBLISHER, pages: 73 - 75 |
| LEHNINGER, BIOCHEMISTRY, no. 1415408-69-3, 1975, pages 73 - 75 |
| LIMBACH ET AL.: "Summary:the modified nucleosides of RNA", NUCLEIC ACIDS RES, vol. 22, 1994, pages 2183 - 2196, XP001152667 |
| M. EGHOLMO. BUCHARDTP.E. NIELSENR.H. BERG, JACS, vol. 114, 1992, pages 1895 |
| MED. CHEM. COMMUN., vol. 5, 2014, pages 1454 - 1471 |
| MUSCLE & NERVE, 2006, pages 135 - 144 |
| N. NIWAY. YAMAGISHIH. MURAKAMIH. SUGA: "A flexizyme that selectively charges amino acids activated by a water-friendly leaving group", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 19, 2009, pages 3892 - 3894 |
| NAOKI IWAMOTO ET AL., ANGEW. CHEM. INT. ED. ENGL., vol. 48, no. 3, 2009, pages 496 - 9 |
| NATSUHISA OKA ET AL., J. AM. CHEM. SOC., vol. 125, 2003, pages 8307 - 8317 |
| NATSUHISA OKA ET AL., J. AM. CHEM. SOC., vol. 130, 2008, pages 16031 - 16037 |
| NISHINA K, NATURE COMMUNICATION, vol. 6, 2015, pages 7969 |
| NUCLEIC ACIDS RES, vol. 30, no. 13, 1 July 2002 (2002-07-01), pages 2751 - 7 |
| P.E. NIELSENM. EGHOLMR.H. BERGO. BUCHARDT, SCIENCE, vol. 254, 1991, pages 1497 |
| SANTI MELISSA, MACCARI GIUSEPPE, MEREGHETTI PAOLO, VOLIANI VALERIO, ROCCHICCIOLI SILVIA, UCCIFERRI NADIA, LUIN STEFANO, SIGNORE GI: "Rational Design of a Transferrin-Binding Peptide Sequence Tailored to Targeted Nanoparticle Internalization", BIOCONJUGATE CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 28, no. 2, 15 February 2017 (2017-02-15), US , pages 471 - 480, XP055856057, ISSN: 1043-1802, DOI: 10.1021/acs.bioconjchem.6b00611 * |
| See also references of EP4389893A4 |
| STEFFENS, R.LEUMANN, C., HELV. CHIM. ACTA, vol. 80, 1997, pages 2426 - 2439 |
| T. KOCHH.F. HANSENP. ANDERSENT. LARSENH.G. BATZK. OTTESONH. ORUM, J. PEPT. RES., vol. 49, 1997, pages 80 |
| TEIXEIRAW. E. BENCKHUIJSENP. E. DE KONINGA. R. P. M. VALENTIJNJ. W. DRIJFHOUT, PROTEIN PEPT. LETT., vol. 9, 2002, pages 379 - 385 |
| WILTON S.D. ET AL., MOL. THER., vol. 15, no. 7, 2007, pages 1288 - 1296 |
| Y. GOTO ET AL., ACSS CHEM. BIOL., vol. 3, 2008, pages 120 - 129 |
| YOHEI NUKAGA ET AL., J. ORG. CHEM., vol. 77, 2012, pages 7913 - 7922 |
| YOHEI NUKAGA ET AL., J. ORG. CHEM., vol. 81, 2016, pages 2753 - 2762 |
| ZHANG YUE, ZHAI MEIFANG, CHEN ZHIJIANG, HAN XIAOYANG, YU FANGLIN, LI ZHIPING, XIE XIANGYANG, HAN CUIYAN, YU LIAN, YANG YANG, MEI X: "Dual-modified liposome codelivery of doxorubicin and vincristine improve targeting and therapeutic efficacy of glioma", DRUG DELIVERY, ACADEMIC PRESS, ORLANDO, FL., US, vol. 24, no. 1, 1 January 2017 (2017-01-01), US , pages 1045 - 1055, XP055856056, ISSN: 1071-7544, DOI: 10.1080/10717544.2017.1344334 * |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12460011B2 (en) | 2018-08-02 | 2025-11-04 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering an oligonucleotide to a subject |
| US12173078B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12173079B2 (en) | 2018-08-02 | 2024-12-24 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide |
| US12496352B2 (en) | 2018-08-02 | 2025-12-16 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12478687B2 (en) | 2018-08-02 | 2025-11-25 | Dyne Therapeutics, Inc. | United states |
| US12263225B2 (en) | 2018-08-02 | 2025-04-01 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy |
| US12370264B1 (en) | 2018-08-02 | 2025-07-29 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject |
| US12280122B2 (en) | 2018-08-02 | 2025-04-22 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating myotonic dystrophy |
| US12319743B2 (en) | 2018-08-02 | 2025-06-03 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of delivering oligonucleotide to a subject |
| US12325753B2 (en) | 2018-08-02 | 2025-06-10 | Dyne Therapeutics, Inc. | Method of using an anti-transferrin receptor antibody to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy |
| US12428487B2 (en) | 2018-08-02 | 2025-09-30 | Dyne Therapeutics, Inc. | Complexes comprising an anti-transferrin receptor antibody linked to an oligonicleotide and method of delivering oligonucleotide to a subject |
| US12329825B1 (en) | 2018-08-02 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject |
| US12357703B2 (en) | 2018-08-02 | 2025-07-15 | Dyne Therapeutics, Inc. | Muscle-targeting complexes comprising an anti-transferin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping |
| US12329824B1 (en) | 2021-07-09 | 2025-06-17 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12397062B2 (en) | 2021-07-09 | 2025-08-26 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12403203B2 (en) | 2021-07-09 | 2025-09-02 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12440575B2 (en) | 2021-07-09 | 2025-10-14 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12239717B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12239716B2 (en) | 2021-07-09 | 2025-03-04 | Dyne Therapeutics, Inc. | Muscle targeting complexes and uses thereof for treating dystrophinopathies |
| US12440574B2 (en) | 2022-04-15 | 2025-10-14 | Dyne Therapeutics, Inc. | Muscle targeting complexes and formulations for treating myotonic dystrophy |
| WO2024195711A1 (ja) * | 2023-03-17 | 2024-09-26 | 富士フイルム株式会社 | 環状ペプチド又はその塩及びそれらの利用 |
| WO2025072246A1 (en) * | 2023-09-26 | 2025-04-03 | Entrada Therapeutics, Inc. | Compounds and methods for skipping exon 50 in duchenne muscular dystrophy |
Also Published As
| Publication number | Publication date |
|---|---|
| US20240390508A1 (en) | 2024-11-28 |
| JPWO2023026994A1 (https=) | 2023-03-02 |
| EP4389893A4 (en) | 2025-09-10 |
| EP4389893A1 (en) | 2024-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2023026994A1 (ja) | ヒトトランスフェリンレセプター結合ペプチド-薬物コンジュゲート | |
| US20230020092A1 (en) | Compositions for delivery of antisense compounds | |
| US11944688B2 (en) | Biologically active compounds | |
| CN109996807B (zh) | Scn9a反义寡核苷酸 | |
| TW202346591A (zh) | 連結有載體胜肽的核酸 | |
| WO2023034818A1 (en) | Compositions and methods for skipping exon 45 in duchenne muscular dystrophy | |
| JP6825914B2 (ja) | ペプチド担体上の多重オリゴヌクレオチド部分 | |
| US20220062431A1 (en) | Compounds comprising stapled or stitched peptides for improved drug delivery | |
| CN113272429A (zh) | 肌抑素信号抑制剂 | |
| US20250011777A1 (en) | Delivery of anitsense oligomers by mirror image peptides | |
| JP2024532464A (ja) | デュシェンヌ型筋ジストロフィーにおいてエクソン44をスキッピングするための化合物及び方法 | |
| WO2024069229A2 (en) | Biologically active compounds | |
| US20250171776A1 (en) | Non-canonical cell-penetrating peptides for antisense oligomer delivery | |
| KR20260056195A (ko) | 올리고뉴클레오타이드의 세포내 표적화 | |
| WO2025076243A1 (en) | Cell-targeting complexes and uses thereof | |
| CN118284434A (zh) | 用于跳跃杜兴氏肌营养不良中的外显子45的组合物和方法 | |
| CN118215504A (zh) | 用于跳跃杜兴氏肌营养不良中的外显子44的化合物和方法 | |
| CN121772940A (zh) | 寡核苷酸的细胞内靶向 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22861282 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023543884 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022861282 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022861282 Country of ref document: EP Effective date: 20240321 |