WO2022211420A1 - 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물 - Google Patents

항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2022211420A1
WO2022211420A1 PCT/KR2022/004341 KR2022004341W WO2022211420A1 WO 2022211420 A1 WO2022211420 A1 WO 2022211420A1 KR 2022004341 W KR2022004341 W KR 2022004341W WO 2022211420 A1 WO2022211420 A1 WO 2022211420A1
Authority
WO
WIPO (PCT)
Prior art keywords
straight
formula
oxazol
chain
arylamide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/004341
Other languages
English (en)
French (fr)
Korean (ko)
Inventor
정동주
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Klotho Sciences Co Ltd
Original Assignee
Klotho Sciences Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Klotho Sciences Co Ltd filed Critical Klotho Sciences Co Ltd
Priority to EP22781539.6A priority Critical patent/EP4316487A4/en
Priority to AU2022251900A priority patent/AU2022251900B2/en
Priority to US18/553,414 priority patent/US20240358683A1/en
Priority to JP2023561185A priority patent/JP7728031B2/ja
Priority to CA3213904A priority patent/CA3213904A1/en
Priority to BR112023019984A priority patent/BR112023019984A2/pt
Priority to CN202280026649.3A priority patent/CN117136055A/zh
Publication of WO2022211420A1 publication Critical patent/WO2022211420A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42Oxazoles
    • A61K31/423Oxazoles condensed with carbocyclic rings
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia

Definitions

  • the present invention relates to a composition for preventing or treating neurodegenerative diseases, comprising a compound inducing the expression of the anti-aging gene klotho.
  • Imbalance of control of the neuroimmune system is known to be the etiology of various neurodegenerative diseases, and many studies have shown that neuroinflammatory responses to Parkinson's disease, Alzheimer's disease, traumatic injury, stroke, and brain damage caused by seizures in the central nervous system are the cause. is being reported
  • mice that could not express this gene premature aging occurred and lifespan was shortened. More interestingly, mice that later increased the expression of this gene increased their lifespan by 20.0 to 30.8% in males and by 18.8 to 19.0% in females. This was an opportunity to inform the world for the first time that the lifespan of mice can be increased or decreased depending on the expression of a single gene. And, the nucleotide sequence of the Klotho gene is very similar between animals, and it has been reported that about 98% coincidence between mice and humans. This indicates that lifespan can be regulated by the expression of klotho gene even in humans.
  • klotho ⁇ -klotho
  • klotho which is known to be related to aging
  • klotho is located on the 13th chromosome and produces a membrane protein with a base sequence similar to that of ⁇ -glucosidase.
  • Klotho protein is mainly expressed in renal tubular epithelial cells and in the choroid plexus of the brain and has been reported to be expressed in some parathyroid glands.
  • the Klotho gene is a gene related to various aging phenotypes.
  • mice lacking the klotho gene aging processes such as reduced lifespan, decreased activity, growth retardation, atherosclerosis, calcification of arteries, osteoporosis, reproductive immaturity, infertility, skin atrophy, emphysema, etc.
  • a syndrome similar to In Klotho mutant mice atherosclerosis similar to Monckeberg type atherosclerosis caused by aging in humans was observed in all arteries from the aorta to arterioles, and angiogenesis and vasculogenesis were impaired.
  • Klotho mRNA expression is significantly higher in kidney tissue than in other tissues, but the expression of klotho mRNA is reduced in the kidneys of mouse models of diseases such as hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure.
  • NO nitric oxide
  • OLETF Otsuka Long-Evans Tokushima fatty rat
  • klotho gene affects glucose and insulin metabolism in mice, and statin, a representative hypercholesterolemia treatment, increases klotho mRNA expression in renal proximal tubule cells.
  • statin a representative hypercholesterolemia treatment
  • osteopenia with low bone turnover due to impaired differentiation of both osteoblasts and osteoclasts occurs, which is similar to the characteristics of age-related bone loss and senile osteoporosis in humans.
  • Klotho mutant rats abnormal trabecular height and micro-computed tomography in the epiphyseal region of the trabecular bone were observed. The clinical phenotype changes due to Klotho gene mutations observed in humans are diverse.
  • KL-VS (functional variant of klotho) variant with mutations in three regions of Klotho gene exon2 is related to lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease and cerebrovascular disease, microsatellite polymorphism and single base of Klotho gene Gene polymorphisms were associated with bone mineral density, and it was also reported that single nucleotide polymorphisms of the Klotho gene were associated with cardiovascular disease risk factors and bone mineral density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's has been reported in several papers. It has been reported that overexpression of klotho in a mouse model of Alzheimer's dementia increases the lifespan of mice by 30% and suppresses cognitive decline.
  • amyloid beta protein in the brain was reduced by 50% by klotho expression.
  • the expression level of klotho is inversely proportional to the progression of Alzheimer's disease, and it has been reported that klotho protein reduces the amount of inflammatory cytokines in the blood of Alzheimer's disease patients.
  • Efforts have been made to develop a substance capable of inducing the expression of the klotho gene, which has such a pronounced anti-aging effect.
  • known substances those reported to be capable of inducing klotho expression include rapamycin, vitamin D, and statin.
  • a research team at Boston University reported three compounds by screening for compounds capable of inducing klotho gene expression using a library of 150,000 compounds.
  • the present inventor selected a compound called compound H, which has a structure that is highly likely to be developed as a pharmaceutical, from among the compounds, confirmed that this compound can express the klotho gene in cells through actual experiments, and reported the study results on the mechanism of action. announced as After that, an experiment was conducted to analyze the structure of compound H (Comparative Example 1) to determine the structural characteristics of a compound capable of inducing klotho expression, and based on this, a new compound with increased activity 10 times or more was created. In addition, the present inventors confirmed that the novel compound inducing the expression of the anti-aging gene klotho is effective in degenerative neurological diseases, and completed the present invention.
  • An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases comprising a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • Another object of the present invention is to provide a health functional food composition for the prevention or improvement of neurodegenerative diseases, or a food composition, comprising a compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the present invention provides a pharmaceutical composition for preventing or treating neurodegenerative diseases comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, C 1-10 straight or branched chain alkyl, or C 6-8 arylamide, wherein the aryl of the arylamide includes halogen, —NO 2 and C 1-10 One or more of the straight-chain or branched alkyl halide may be substituted;
  • R 1 and R 2 together with the carbon atom to which they are connected may form a C 6-8 aryl
  • R 3 , R 4 , R 5 , R 6 and R 7 are each -H, halogen, -NO 2 or C 1-10 straight-chain or branched alkyl).
  • the present invention also provides a health functional food composition for the prevention or improvement of neurodegenerative diseases comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a food composition for preventing or improving neurodegenerative diseases, comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention also provides a method for preventing or treating neurodegenerative diseases, comprising administering or taking a composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient to an individual.
  • the present invention provides a use for preventing or treating neurodegenerative diseases, comprising the step of a composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the compound represented by Formula 1 according to the present invention is excellent in the effect of improving the expression level of the Klotho gene, which is a gene associated with aging, and can be usefully used as a pharmaceutical composition or food composition for preventing, improving or treating degenerative neurological diseases. .
  • 1A shows the results of a luciferase expression experiment using a reporter gene including a promoter up to 1.7 kbp from the start of the human klotho gene of Comparative Examples 1 to 4;
  • 1B shows the results of a luciferase expression experiment using a reporter gene including a promoter up to 240 bp from the start of the human klotho gene of Comparative Examples 1 to 4;
  • FIG. 2 shows the results of a luciferase expression experiment using a reporter gene including a promoter included up to -2.1 kb upstream of the human klotho gene of Examples 1 to 6.
  • FIG. 3 shows the results of a luciferase expression experiment using a reporter gene including a promoter included up to -2.1 kb upstream of the human klotho gene of Examples 1 to 3.
  • the present invention relates to a composition for preventing or treating/improving neurodegenerative diseases comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the compound represented by the following formula (1) according to the present invention is excellent in the effect of improving the expression level of the Klotho gene, which is a gene related to aging, and can be usefully used as a pharmaceutical composition or food composition for the prevention, improvement or treatment of neurodegenerative diseases. have.
  • composition for the prevention or treatment of neurodegenerative diseases
  • the present invention provides a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
  • L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, C 1-10 straight or branched chain alkyl, or C 6-8 arylamide, wherein the aryl of the arylamide includes halogen, —NO 2 and C 1-10 One or more of the straight-chain or branched alkyl halide may be substituted;
  • R 1 and R 2 together with the carbon atom to which they are connected may form a C 6-8 aryl
  • R 3 , R 4 , R 5 , R 6 and R 7 may each be —H, halogen, —NO 2 or C 1-10 straight-chain or branched alkyl.
  • the L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, C 1-5 straight or branched chain alkyl, or C 6-7 arylamide, wherein the aryl of the arylamide includes halogen, —NO 2 and C 1-5 One or more of the straight-chain or branched alkyl halide may be substituted;
  • R 1 and R 2 together with the carbon atom to which they are connected may form a C 6-7 aryl
  • R 3 , R 4 , R 5 , R 6 and R 7 may each be —H, halogen, —NO 2 or C 1-5 straight-chain or branched alkyl.
  • the L 1 is a single bond or ego
  • R 1 and R 2 are each —H, —OH, —CH 3 , or phenylamide, wherein the phenyl of the phenylamide may be substituted with one or more of —Cl, —NO 2 and —CH 2 Cl;
  • R 1 and R 2 together with the carbon atom to which they are connected may form phenyl
  • R 3 , R 4 , R 5 , R 6 and R 7 may each be -H, -F, -Cl, -NO 2 or -CH 2 CH 3 .
  • the L 1 is a single bond or ego
  • R 1 is -H, -OH, -CH 3 , , , or ego;
  • R 2 is —H
  • R 1 and R 2 together with the carbon atom to which they are connected may form phenyl
  • R 3 is —H or —Cl
  • R 4 is —H, —F or —Cl
  • R 5 is —F, —Cl, —NO 2 , or —CH 2 CH 3 ;
  • R 6 is —H
  • R 7 may be -H.
  • Preferred examples of the compound represented by Formula 1 according to the present invention include the following compound groups.
  • the compound represented by Formula 1 of the present invention may be used in the form of a pharmaceutically acceptable salt, and as the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful.
  • the expression pharmaceutically acceptable salt is a concentration having an effective action that is relatively non-toxic and harmless to a patient, and any organic or means inorganic addition salts.
  • inorganic acids and organic acids can be used as free acids, and hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc. can be used as inorganic acids, and citric acid, acetic acid, lactic acid, maleic acid, fumarin, etc. can be used as organic acids.
  • these salts include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salt (calcium salt, magnesium salt, etc.) and the like.
  • acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate/carbonate, bisulfate/sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, Gluceptate, gluconate, glucuronate, hexafluorophosphate, hebenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, isethionate, lactate, malate, maleate , malonate, mesylate, methylsulfate, naphthylate, 2-naphsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate/hydrogen phosphate/dihydrogen phosphate, saccharate , stearate, succinate, tartrate, tosylate, trifluoroacetate,
  • the compound represented by Formula 1 of the present invention includes all salts, isomers, hydrates and solvates that can be prepared by conventional methods as well as pharmaceutically acceptable salts.
  • the addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving the compound of Formula 1 in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, and adding an excess of organic acid or inorganic acid It can be prepared by precipitation or crystallization after addition of an aqueous acid solution of Subsequently, after evaporating the solvent or excess acid from this mixture, it can be dried to obtain an addition salt, or it can be prepared by suction filtration of the precipitated salt.
  • a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile
  • step 1 After dissolving compound 2 in an organic solvent, adding compound 3 and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 4 (step 1); and
  • step 2 To an organic solvent in which potassium superoxide is dissolved, the organic solvent in which the compound 4 obtained in step 1 is dissolved is added dropwise, and then reacted at 15 to 30° C. for 10 to 16 hours to obtain compound 1A (step 2) ;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above,
  • Compound 1A is included in Formula 1 above.
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • examples of the compound that can be prepared by the preparation method include 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-( 3,4-dichlorophenyl)] aminobenzoxazole, N- (3,4-dichlorophenyl) naphtho [2,3-d] oxazol-2-amine, N- (3,4-difluorophenyl) )-5-methylbenzo[d]oxazol-2-amine or N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.
  • step 1 After dissolving compound 5 in an organic solvent, adding compound 3 and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 6 (step 1);
  • step 2 To the organic solvent in which potassium peroxide (Potassium superoxide) is dissolved, the organic solvent in which the compound 6 obtained in step 1 is dissolved is added dropwise, and then reacted for 12 to 24 hours to obtain compound 7 (step 2); and
  • R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above,
  • the compound 1B is included in the formula (1).
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • examples of the compound that can be prepared by the preparation method may be 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.
  • step One After dissolving compound 8, carbon disulfide, iodomethane, and sodium hydride in an organic solvent, reacting at 10 to 50° C. for 2 to 8 hours to obtain compound 9 (step One); and
  • step 2 After dissolving compound 9 and compound 2 in an organic solvent, reacting for 2 to 8 hours to obtain compound 1C (step 2);
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above,
  • the compound 1C is included in the formula (1).
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • an example of the compound that can be prepared by the preparation method may be N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide.
  • step 1 After dissolving compound 10 and compound 3 in an organic solvent, reacting at 10 to 50° C. for 20 to 28 hours to obtain compound 11 (step 1);
  • step 2 To the organic solvent in which potassium superoxide is dissolved, the organic solvent in which the compound 11 obtained in step 1 is dissolved is added dropwise, and then reacted at 10 to 50° C. for 12 to 24 hours to obtain compound 12 (step 2) ;
  • step 3 after adding compound 12 to an organic solvent together with a catalyst, injecting hydrogen gas and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 13 (step 3);
  • step 4 After dissolving compound 13 and compound 14 in an organic solvent, reacting at 10 to 50° C. for 12 to 24 hours to obtain compound 1D (step 4);
  • R 3 , R 4 , R 5 , R 6 and R 7 are as defined in Formula 1 above;
  • R 8 is at least one of halogen, —NO 2 and C 1-10 linear or branched alkyl halide
  • the compound 1D is included in the formula (1).
  • examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2- Dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO) or dioxane may be used alone or in combination.
  • examples of the compound that can be prepared by the preparation method include N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5 -nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide or N-(2-(4-ethylphenylamino)benzo [d]oxazol-5-yl)-3-(chloromethyl)benzamide.
  • the composition can improve the expression level of the Klotho gene.
  • the degenerative neurological disease is stroke, stroke, memory loss, memory impairment, dementia, forgetfulness, cognitive dysfunction, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeld-Jakob disease, It may include one or more diseases selected from the group consisting of Huntington's disease and Lou Gehrig's disease, but is not limited thereto.
  • the compound of the present invention may be administered in various oral and parenteral dosage forms during clinical administration, and when formulated, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. manufactured.
  • commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. manufactured.
  • Solid preparations for oral administration include tablets, patients, powders, granules, capsules, troches, and the like, and such solid preparations include one or more compounds of the present invention and at least one excipient, for example, starch, calcium carbonate, water It is prepared by mixing sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate talc are also used.
  • Liquid formulations for oral administration include suspensions, solutions, emulsions, or syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. can
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, lyophilized formulations, suppositories, and the like.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, etc. may be used.
  • the effective dose of the compound of the present invention to the human body may vary depending on the patient's age, weight, sex, dosage form, health status and disease level, and is generally about 0.001-100 mg/kg/day, preferably Usually 0.01-35 mg/kg/day. Based on an adult patient weighing 70 kg, it is generally 0.07-7000 mg/day, preferably 0.7-2500 mg/day, and once a day at regular time intervals according to the judgment of a doctor or pharmacist It may be administered in several divided doses.
  • the present invention provides a food composition or health functional food composition for preventing or improving neurodegenerative diseases, comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.
  • the composition can improve the expression level of the Klotho gene.
  • the degenerative neurological disease is stroke, stroke, memory loss, memory impairment, dementia, forgetfulness, cognitive dysfunction, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeld-Jakob disease, It may include one or more diseases selected from the group consisting of Huntington's disease and Lou Gehrig's disease, but is not limited thereto.
  • Examples of foods to which the active substance of the present invention can be added include drinks, meat, sausage, bread, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, There are various soups, beverages, alcoholic beverages and vitamin complexes, dairy products and processed dairy products, and includes all health food and health functional food in the ordinary sense.
  • the health food and health functional food composition containing the active substance according to the present invention may be added to food as it is or used together with other food or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active substance may be appropriately determined depending on the purpose of its use (for prevention or improvement).
  • the amount of the composition in health food and health functional food may be added in an amount of 0.1 to 90 parts by weight based on the total weight of the food.
  • the above amount may be less than the above range, and since there is no problem in terms of safety, the active substance may be used in an amount above the above range.
  • the food composition and health functional food composition of the present invention are not particularly limited in other ingredients except for containing the active substance of the present invention as an essential ingredient in the indicated ratio, and various flavoring agents or natural carbohydrates are added as additional ingredients like conventional beverages. may contain.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents tacmatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • the proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 g of the dietary supplement of the present invention.
  • food compositions and health functional food compositions containing the active substances of the present invention are various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.) ), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • the food composition and health functional food composition of the present invention may contain natural fruit juice, fruit juice beverage, and fruit for the production of vegetable beverage.
  • These components may be used independently or in combination.
  • the proportion of these additives is not so important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and health functional food composition containing the active substance of the present invention.
  • Step 1 Preparation of dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate (Dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate, 17064-2-1)
  • reaction mixture was purified by silica-gel column chromatography (10% Ethyl acetate / n-hexane) to dimethyl (2-chloro-4-nitrobenzoyl) carbonimidodithioate (Dimethyl (2- chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) was obtained as a pale yellow solid (160 mg, 21%).
  • Step 2 N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide ( N Preparation of -(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide, FCCS-17064)
  • Step 1 1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-methylphenyl) thiourea (1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-methylphenyl) thiourea, 17065-2-1) preparation
  • Step 2 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, FCCS-17065) Produce
  • Step 1 1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-methoxyphenyl) thiourea (1- (3,4-Dichlorophenyl) -3- (2-hydroxy-5-) Preparation of methoxyphenyl)thiourea, 17066-3-1)
  • Step 2 N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine ,17066-3-2) preparation
  • reaction mixture was purified by chromatography (Silica-gel column chromatography) (20% Ethyl acetate / n-hexane) to N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine ,17066-3-2) was obtained as a brown solid (230 mg, 35%).
  • Step 3 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol ,FCCS -17066) preparation
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain the target compound 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol ,FCCS-17066) was obtained as a brown solid (97 mg, 50%).
  • Step 1 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea, Interm Preparation of -3-1)
  • Step 2 N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine (N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine, Interm-3- 2) Manufacturing
  • Step 3 N- (4-ethylphenyl) benzo [d] oxazole-2,5-diamine (N- (4-ethylphenyl) benzo [d] oxazole-2,5-diamine, Interm-3-3) Produce
  • Step 4 N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)benzo[d] Preparation of ]oxazol-5-yl)-2-chloro-5-nitrobenzamide ,FCCS-17067)
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain the target compound N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl) -2-chloro-5-nitrobenzamide (N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide ,FCCS-17067) as a pale yellow solid ( 120 mg, 27%).
  • Interm-3-3 (253 mg, 1 mmol) and 3,4-dichlorobenzoyl chloride (209 mg, 1 mmol) obtained in step 3 of Example 4 were mixed with dimethylformamide ( N ,N -dimethylformamide, DMF) (4 mL) was added, and then diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, extracted with ethyl acetate, and the organic layer was washed sequentially with saturated aqueous NaHCO 3 and brine. The organic layer was dried over Na 2 SO 4 and the solvent was removed under reduced pressure.
  • DIPEA diisopropylethylamine
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain the target compound FCCS-17068 as a pale white solid (270 mg, 64 %).
  • the organic layer was dried over Na 2 SO 4 and the solvent was removed under reduced pressure.
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (30% Ethyl acetate / n-hexane) to obtain the target compound FCCS-17069 as a pale white solid (170 mg, 40%).
  • Step 1 1- (3,4-dichlorophenyl) -3- (2-hydroxyphenyl) thiourea (1- (3,4-dichlorophenyl) -3- (2-hydroxyphenyl) thiourea , FCCS-17065-A Preparation of -2-1)
  • Step 2 Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, FCCS-17065-A)
  • FCCS-17065-A-2-1 400 mg, 1.277 mmol
  • potassium peroxide (KO 2 ) 454 mg, 6.386 mmol
  • acetonitrile acetonitrile, MeCN
  • Step 1 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (1-(3,4-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl) ) Preparation of thiourea, FCCS-17065-B-2-1)
  • 3-amino-2-naphthol (3-Amino-2-naphthol) (350 mg, 2.119 mmol) was mixed with methanol (anhydrous MeOH) (7 mL) and chloroform (CHCl 3 ) (2 mL) After adding and stirring at room temperature for 5 minutes, 3,4-dichlorophenyl isothiocyanate (0.38 mL, 2.638 mmol) was slowly added dropwise and stirred at room temperature for 13 hours.
  • Step 2 N- (3,4-dichlorophenyl) naphtho [2,3-d] oxazol-2-amine (N- (3,4-dichlorophenyl) naphtho [2,3-d] oxazol-2- Preparation of amine, FCCS-17065-B)
  • FCCS-17065-B-2-1 400 mg, 1.101 mmol
  • potassium peroxide (KO 2 ) 391 mg, 5.505 mmol
  • acetonitrile acetonitrile, MeCN
  • Step 1 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4-difluorophenyl)-3-(2-hydroxy-5-) Preparation of methylphenyl)thiourea, FCCS-17065-C-2-1)
  • Step 2 N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2- Preparation of amine, FCCS-17065-C)
  • FCCS-17065-C-2-1 400 mg, 1.359 mmol
  • potassium peroxide (KO 2 ) 483 mg, 6.795 mmol
  • acetonitrile acetonitrile, MeCN
  • MeCN MeCN
  • Step 1 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea, FCCS-19025 Preparation of -2-1)
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (20% Acetone / n-hexane) to 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1 -(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea, FCCS-19025-2-1) was obtained as a pale yellow solid (354 mg, 92%).
  • Step 2 N- (3,4-difluorophenyl) benzo [d] oxazol-2-amine (N- (3,4-difluorophenyl) benzo [d] oxazol-2-amine , FCCS-19025) Produce
  • FCCS-19025-2-1 (224 mg, 0.80 mmol) and potassium peroxide (KO 2 ) (284 mg, 4.00 mmol) obtained in step 1 under Ar gas atmosphere were mixed with acetonitrile (MeCN) (25 mL), and stirred at room temperature for 14 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), acetonitrile (MeCN) was removed under reduced pressure.
  • MeCN acetonitrile
  • the reaction mixture was purified by chromatography (Silica-gel column chromatography) (10 to 20% Ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazole-2-
  • An amine N- (3,4-difluorophenyl) benzo [d] oxazol-2-amine , FCCS-19025) was obtained as a white solid (160 mg, 82%).
  • N-(2-chlorophenyl)-1H-indole-3-carboxamide N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1.
  • N-methyl-1H-indole-3-carboxamide N-methyl-1H-indole-3-carboxamide, FCCS-16030 was purchased and used as Comparative Example 3.
  • Step 1 Preparation of methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3-1)
  • Step 2 Preparation of 2-(1H-indole-3-carboxamido)acetic acid (2-(1H-indole-3-carboxamido)acetic acid, FCCS-16031-3-2)
  • 2-(1H-indole-3-carboxamido)acetate (methyl 2-(1H-indole-3-carboxamido)acetate, CCS-16031-3-1) (220 mg, 0.947 mmol) obtained in step 1 was Dissolve in tetrahydrofuran (6 mL), put a solution of lithium hydroxide monohydrate (LiOH monohydrate) (131 mg, 3.126 mmol) in water (2 mL), and stir at room temperature for 1 hour. A 1.0N HCl aqueous solution was added to adjust the pH to 2, followed by extraction with ethyl acetate. After passing through anhydrous Na 2 SO 4 Pad to remove the remaining moisture, the solvent is removed under reduced pressure.
  • LiOH monohydrate lithium hydroxide monohydrate
  • Step 3 N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (N-(2-((2-chlorophenyl)amino)-2- Preparation of oxoethyl)-1H-indole-3-carboxamide, FCCS-16031)
  • 2-(1H-indole-3-carboxamido)acetic acid (2-(1H-indole-3-carboxamido)acetic acid, FCCS-16031-3-2) (200 mg, 0.917 mmol) and TSTU (N,N,N',N'-Tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate) (290 mg, 0.962 mmol) were mixed with dimethylformamide (N,N-dimethylformamide) (4 mL, anhydorus) and N,N-diisopropylethylamine (DIEA) (0.4 mL, 2.293 mmol) was added thereto, followed by stirring at room temperature for 3 hours.
  • DIEA N,N-diisopropylethylamine
  • RPTEC human renal proximal tubule epithelial cell, ATCC CRL-4031
  • ATCC CRL-4031 human renal proximal tubule epithelial cell
  • Renal Epithelial Growth Medium (REGMTM) Bulletkit manufactured by Lonza was also used, and cultured at 37° C., 5% CO 2 conditions.
  • a plasmid for luciferase expression was used in which the promoter region of the human KL (klotho) gene was arranged to regulate the firefly luciferase gene expression.
  • the plasmid was introduced into cells using Roche's X-treme GENE transfection reagent.
  • the luciferase activity expressed in the cells was measured using a Dual-Luciferase reporter assay system manufactured by Promega.
  • the luciferase activity was measured after each compound was treated with the indicated concentrations in the cultured cells for 24 hours.
  • the high activity of luciferase indirectly indicates that the expression of klotho gene can be increased.
  • Comparative Examples 1 to 4 were treated in RPTEC cells at a concentration of 5 ⁇ M, and a reporter gene including a promoter from the start site of the human klotho gene to the front of 1.7 kbp or from the start site of the human klotho gene to the front of 240 bp. Expression of the reporter gene was confirmed using a reporter gene including a promoter.
  • Examples 1 to 6 were treated with RPTEC, which is an epithelial cell of the proximal tubule of the human kidney, at concentrations of 0.5, 1, and 5 ⁇ M, respectively, and Comparative Example 1 was treated with a concentration of 5 ⁇ M to treat human klotho
  • RPTEC which is an epithelial cell of the proximal tubule of the human kidney
  • Comparative Example 1 was treated with a concentration of 5 ⁇ M to treat human klotho
  • FIGS. 2 and 3 The results of confirming the expression of the reporter gene using a reporter gene (pHKP-luc) including a promoter included up to -2.1 kb upstream of the gene are shown in FIGS. 2 and 3 .
  • RPTEC cells were treated with Comparative Examples 1 and 1 to 3 at a concentration of 5 ⁇ M, and a reporter gene (pHKP-luc) including a promoter included up to -2.1 kb upstream of the human klotho gene (pHKP-luc) was added.
  • pHKP-luc a reporter gene including a promoter included up to -2.1 kb upstream of the human klotho gene
  • RNA extraction from RPTEC cells which are epithelial cells of the proximal tubule of a human kidney, treated with the compounds of Comparative Example 1 and Examples 1 and 2 for 6 hours.
  • the extracted RNA was cDNA prepared using Thermo's Superscript II kit, and the KL (klotho) gene-specific kit was performed using Appliedbiosystem's Taqman Gene Expression assays, as shown in FIG. 4 .
  • Example 2 As shown in FIG. 4 , it was confirmed that the compound of Example 2 was at a level similar to that of Comparative Example 1.
  • Examples 7 to 10 were treated in RPTEC cells, which are epithelial cells of the proximal tubule of human kidney, by 2.5 ⁇ M for 6 hours, then RNA was extracted from the cells, and the extracted RNA was obtained using Thermo's Superscript II kit. cDNA was prepared and then subjected to general PCR.
  • the primer information used in the experiment is as follows.
  • GAPDH-F TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3)
  • GAPDH-R AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4)
  • the DNA amplified by PCR was confirmed by ethidium bromide staining after electrophoresis on an agarose gel, and the amount of DNA in the band was quantitatively compared using the SpeedyQuant program and is shown in FIG. 5 .
  • Example 10 was improved by about 10 times compared to Comparative Example 1.
  • the compound of Example 10 exhibited the least toxicity when treated at a concentration of 12.5 ⁇ M or 25 ⁇ M, and it was confirmed that the toxicity was improved by 20% or more even when compared with Comparative Example 1.
  • HT22 cells which are neurons derived from mouse hippocampus, were cultured in DMEM culture medium supplemented with 10% FBS.
  • Cell culture was cultured in a 37 ° C incubator under 5% CO 2 conditions, and when the cells grew to saturate the surface of the culture dish to about 80%, they were treated with 0.05% trypsin and transferred to a new culture dish and subcultured. Compounds were added to the medium at each subculture to maintain a final concentration of 2.5 ⁇ M.
  • Cells containing only DMSO, a solvent were used for negative control, and cells passaged 3 times (#5) were used as a non-senescent control. Cells inducing senescence were all passaged 20 times (#25).
  • cells cultured 20 times showed an increased degree of senescence compared to cells passaged 5 times.
  • the degree of staining decreased in the cell group cultured by adding the KS1 compound (Example 10) to the medium, and about 40% of the cells were stained. That is, the cells cultured in the presence of the KS1 compound (Example 10) showed that the degree of senescence was reduced by about 20% compared to the cells grown in the medium to which DMSO was added during the 20 passage culture period (FIG. 7).
  • HT22 cells which are neurons derived from mouse hippocampus, were cultured in DMEM culture medium supplemented with 10% FBS.
  • Cell culture was cultured in a 37° C. incubator under 5% CO 2 conditions, and when the cells grew to saturate the surface of the culture dish to about 80%, they were treated with 0.05% trypsin, transferred to a new culture dish, and subcultured. Compounds were added to the medium at each subculture to maintain a final concentration of 2.5 ⁇ M.
  • Cells containing only DMSO, a solvent were used for negative control, and cells passaged 3 times (#5) were used as a control that did not undergo aging. Cells inducing senescence were all passaged 20 times (#25).
  • 5xFAD mice were Alzheimer's mice genetically mutated to overproduce beta amyloid (A ⁇ , ⁇ amyloid). They were provided by the KIST Research Animal Resource Center, which maintains and sells them.
  • WT normal mice that were not genetically mutated to produce beta amyloid (A ⁇ , ⁇ amyloid) were provided from the KIST Research Animal Resource Center and used.
  • the experimental animals were acclimatized for 1 week before the experiment. Mice were bred on a free diet in a breeding room maintained at a temperature of 22 ⁇ 2 °C and a humidity of 40-60% during the experiment, and the light and dark cycle was controlled at intervals of 12 hours. All animal experiments were performed in compliance with the animal experimentation operation regulations of the Institutional Animal Care and Use Committee of the Korea Institute of Science and Technology.
  • mice and normal control mice were administered orally (p.o.) with vehicle (5% DMSO + 65% PEG400 + 30% Saline) or KS1 (Example 10) for 4 or 12 weeks at a concentration of 10 mg/kg daily. was administered with Three rats were used in each experimental group. During the administration period, body weight was measured, and after administration, an experiment on cognitive function was conducted, and after sacrifice, organs were removed and the change status was confirmed through biochemical methods.
  • the novel object recognition test is a modification of the existing method and consists of an adaptor, a searcher, and a new material recognizer.
  • the mice were placed in an open field for 30 minutes the day before the experiment and acclimatized, and two identical objects were installed at regular intervals.
  • the animals were allowed to explore freely for 10 minutes, and the dwell time at each object was measured by Ethovision, and then returned to the cage for one day. And the next day, one of the installed objects was replaced with a new material and the movement of the experimental animal was measured for 10 minutes.
  • the object's recognition index (%) was converted into a percentage of the time spent in each object among the total search time.
  • the passive evasion test apparatus is divided into two zones, a light-in and dark zone, respectively, and the floor is made of wire mesh.
  • the experimental animal is placed in a light area, the door is closed as soon as the animal moves to the dark area, and a 0.45 mA current is applied for 2 seconds to a foot shock.
  • the test is conducted one day after training, and the time until the experimental animal is placed in a bright area and moves back to the dark area is measured (maximum time is set to 600 seconds). Through this passive avoidance experiment, spatial learning and memory were evaluated.
  • mice In the hippocampus (HPC) region, only the 3-month-administered mice showed a decrease, and in the neocortex (primary somatosensory cortex, CTX) region, the expression decreased in both 1-month and 3-month administration mice (FIG. 9).
  • HPC hippocampus
  • CTX primary somatosensory cortex
  • neocortex primary somatosensory cortex, CTX
  • DG dentate gyrus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Neurosurgery (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Neurology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
PCT/KR2022/004341 2021-04-01 2022-03-28 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물 Ceased WO2022211420A1 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP22781539.6A EP4316487A4 (en) 2021-04-01 2022-03-28 Composition for the prevention or treatment of neurodegenerative diseases containing a compound for inducing the expression of the anti-aging gene Klotho
AU2022251900A AU2022251900B2 (en) 2021-04-01 2022-03-28 Composition for preventing or treating neurodegenerative disease comprising compound inducing expression of anti-aging gene klotho
US18/553,414 US20240358683A1 (en) 2021-04-01 2022-03-28 Composition for preventing or treating neurodegenerative disease comprising compound inducing expression of anti-aging gene klotho
JP2023561185A JP7728031B2 (ja) 2021-04-01 2022-03-28 抗老化遺伝子klothoの発現を誘導する化合物を含む退行性神経疾患の予防または治療用組成物
CA3213904A CA3213904A1 (en) 2021-04-01 2022-03-28 Composition for preventing or treating neurodegenerative disease comprising compounds that induces the expression of anti-aging gene klotho
BR112023019984A BR112023019984A2 (pt) 2021-04-01 2022-03-28 Composição para prevenir ou tratar doenças neurodegenerativas compreendendo compostos que induzem a expressão do gene antienvelhecimento klotho
CN202280026649.3A CN117136055A (zh) 2021-04-01 2022-03-28 包含诱导抗老化基因klotho的表达的化合物的用于预防或治疗退行性神经疾病的组合物

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210042958 2021-04-01
KR10-2021-0042958 2021-04-01
KR10-2021-0130307 2021-09-30
KR1020210130307A KR102375097B1 (ko) 2021-04-01 2021-09-30 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물

Publications (1)

Publication Number Publication Date
WO2022211420A1 true WO2022211420A1 (ko) 2022-10-06

Family

ID=80936324

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004341 Ceased WO2022211420A1 (ko) 2021-04-01 2022-03-28 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물

Country Status (9)

Country Link
US (1) US20240358683A1 (cg-RX-API-DMAC7.html)
EP (1) EP4316487A4 (cg-RX-API-DMAC7.html)
JP (1) JP7728031B2 (cg-RX-API-DMAC7.html)
KR (1) KR102375097B1 (cg-RX-API-DMAC7.html)
CN (1) CN117136055A (cg-RX-API-DMAC7.html)
AU (1) AU2022251900B2 (cg-RX-API-DMAC7.html)
BR (1) BR112023019984A2 (cg-RX-API-DMAC7.html)
CA (1) CA3213904A1 (cg-RX-API-DMAC7.html)
WO (1) WO2022211420A1 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4434534A1 (en) 2023-03-22 2024-09-25 ADvantage Therapeutics, Inc. Klotho mrna

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR112023020026A2 (pt) * 2021-04-01 2024-01-23 Klotho Sciences Composição para prevenir ou tratar doença renal crônica compreendendo compostos que induzem a expressão do gene antienvelhecimento klotho
KR102375097B1 (ko) * 2021-04-01 2022-03-17 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110137868A (ko) * 2010-06-18 2011-12-26 이화여자대학교 산학협력단 Interleukin―6 억제 작용을 갖는 신규한 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR101446301B1 (ko) * 2013-04-11 2014-10-06 서울대학교산학협력단 Cxcr3/cxcl10 길항제 화합물, 이의 제조방법 및 이를 포함하는 골 전이의 예방 및 치료용 약학 조성물
KR20160069736A (ko) * 2014-12-09 2016-06-17 (주)아모레퍼시픽 메틸화된 카테킨을 유효성분으로 함유하는 Klotho 유전자 활성화용 조성물
KR20170024522A (ko) * 2015-08-24 2017-03-07 이화여자대학교 산학협력단 2-(페닐아미노)벤조[d]옥사졸-5-올 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR20190041897A (ko) * 2017-10-13 2019-04-23 이화여자대학교 산학협력단 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR20210042958A (ko) 2018-09-26 2021-04-20 미쓰비시 덴키 빌딩 테크노 서비스 가부시키 가이샤 엘리베이터 시스템 및 휴대 단말
KR20210130307A (ko) 2020-04-21 2021-11-01 엘지마그나 이파워트레인 주식회사 전기모터 및 이를 구비한 전기차량
KR102375097B1 (ko) * 2021-04-01 2022-03-17 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4088770A (en) * 1971-05-04 1978-05-09 Eli Lilly And Company Substituted 2-anilinobenzoxazoles used as immunosuppressive agents
US6713474B2 (en) * 1998-09-18 2004-03-30 Abbott Gmbh & Co. Kg Pyrrolopyrimidines as therapeutic agents
EP1388341A1 (en) * 2002-08-07 2004-02-11 Aventis Pharma Deutschland GmbH Acylamino-substituted heteroaromatic compounds and their use as pharmaceuticals
US20070066577A1 (en) * 2003-04-03 2007-03-22 Hea Young Park Choo Benzoxazole derivative or analogue thereof for inhibiting 5-lipoxygenase and pharmaceutical composition containing same
CA2573699A1 (en) 2004-07-16 2006-02-23 The Trustees Of Columbia University In The City Of New York Compounds and their preparation for the treatment of alzheimer's disease by inhibiting beta-amyloid peptide production
DK1910384T3 (da) * 2005-08-04 2012-12-17 Sirtris Pharmaceuticals Inc Imidazo [2,1-b] thiazol-derivater som sirtuinmodulerende forbindelser
WO2010039186A2 (en) * 2008-09-23 2010-04-08 Renovis, Inc. Compounds useful as faah modulators and uses thereof
WO2010129954A1 (en) * 2009-05-08 2010-11-11 Apogee Biotechnology Corporation Treatment of ischemia-reperfusion injury
WO2016176473A1 (en) * 2015-04-28 2016-11-03 Sanford-Burnham Medical Researc Institute Apelin receptor agonists and methods of use thereof
WO2021066608A1 (ko) * 2019-10-02 2021-04-08 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물 및 이의 용도

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110137868A (ko) * 2010-06-18 2011-12-26 이화여자대학교 산학협력단 Interleukin―6 억제 작용을 갖는 신규한 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR101446301B1 (ko) * 2013-04-11 2014-10-06 서울대학교산학협력단 Cxcr3/cxcl10 길항제 화합물, 이의 제조방법 및 이를 포함하는 골 전이의 예방 및 치료용 약학 조성물
KR20160069736A (ko) * 2014-12-09 2016-06-17 (주)아모레퍼시픽 메틸화된 카테킨을 유효성분으로 함유하는 Klotho 유전자 활성화용 조성물
KR20170024522A (ko) * 2015-08-24 2017-03-07 이화여자대학교 산학협력단 2-(페닐아미노)벤조[d]옥사졸-5-올 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR20190041897A (ko) * 2017-10-13 2019-04-23 이화여자대학교 산학협력단 벤즈옥사졸 유도체, 이의 제조 방법 및 이를 포함하는 약학적 조성물
KR20210042958A (ko) 2018-09-26 2021-04-20 미쓰비시 덴키 빌딩 테크노 서비스 가부시키 가이샤 엘리베이터 시스템 및 휴대 단말
KR20210130307A (ko) 2020-04-21 2021-11-01 엘지마그나 이파워트레인 주식회사 전기모터 및 이를 구비한 전기차량
KR102375097B1 (ko) * 2021-04-01 2022-03-17 주식회사 클로소사이언스 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4316487A4

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4434534A1 (en) 2023-03-22 2024-09-25 ADvantage Therapeutics, Inc. Klotho mrna
WO2024197254A1 (en) 2023-03-22 2024-09-26 Advantage Therapeutics, Inc. Klotho mrna

Also Published As

Publication number Publication date
EP4316487A4 (en) 2025-04-09
AU2022251900A1 (en) 2023-10-26
CA3213904A1 (en) 2022-10-06
EP4316487A1 (en) 2024-02-07
JP2024512818A (ja) 2024-03-19
AU2022251900A9 (en) 2023-11-09
AU2022251900B2 (en) 2025-09-18
KR102375097B1 (ko) 2022-03-17
BR112023019984A2 (pt) 2024-04-02
CN117136055A (zh) 2023-11-28
JP7728031B2 (ja) 2025-08-22
US20240358683A1 (en) 2024-10-31

Similar Documents

Publication Publication Date Title
WO2021066608A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물 및 이의 용도
WO2022211420A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
WO2019168237A1 (ko) 신규 화합물 및 이를 유효성분으로 함유하는 섬유증 또는 비알코올성 지방간염의 예방, 개선 또는 치료용 조성물
WO2012115479A2 (en) Diaminopyrimidine derivatives and processes for the preparation thereof
WO2014171801A1 (ko) 아미도피리딘올 유도체 또는 이의 약제학적 허용가능한 염 및 이를 유효성분으로 함유하는 약학조성물
WO2022108377A1 (ko) O-GlcNAcase 저해 활성을 갖는 화합물 및 이의 용도
WO2021118318A2 (ko) 신규한 인돌 유도체 및 이의 용도
WO2023224371A1 (ko) 신규 옥사다이아졸 유도체 화합물 및 이를 포함하는 신경염증성 질환 예방 또는 치료용 약학적 조성물
WO2021149900A1 (ko) 이치환 아다만틸 유도체, 이의 약학적으로 허용가능한 염 및 이를 유효성분으로 포함하는 암 성장 억제용 약학적 조성물
WO2019190177A1 (ko) (2e,4e)-5-페닐-펜타-2,4-다이엔-1-온 유도체
WO2012148140A2 (ko) 혈관 신생 억제 및 항산화 효과를 가지는 이미다졸계 알칼로이드 유도체 및 이의 제조방법
WO2021256899A1 (ko) 신규한 융합헤테로고리-카르보노하이드라조노일 디시아나이드 화합물 및 이의 용도
WO2021215624A1 (ko) 신규의 2-아릴티아졸 유도체 또는 이의 염, 이의 제조방법, 및 이를 함유하는 약학 조성물
WO2021066573A1 (ko) 신규 화합물 및 이의 자가면역질환 치료 용도
WO2023013996A1 (ko) 인돌 유도체, 이의 제조방법 및 약학적 용도
WO2025034034A1 (ko) 신규한 화합물, 및 이를 포함하는 암 또는 종양의 예방 또는 치료용 약학적 조성물
WO2020017878A1 (en) Novel catechol derivatives or salt thereof, processes for preparing the same, and pharmaceutical compositions comprising the same
WO2022211574A1 (ko) 항노화 유전자 klotho의 발현을 유도하는 화합물을 포함하는 만성신장질환의 예방 또는 치료용 조성물
WO2020013531A1 (ko) N-(3-(이미다조[1,2-b]피리다진-3-일에티닐)-4-메틸페닐)-5-페닐-4,5-다이하이드로-1H-피라졸-1-카복사마이드 유도체 및 이를 유효성분으로 포함하는 키나아제 관련 질환 치료용 약학적 조성물
WO2023013994A1 (ko) 신규한 인돌 유도체, 이를 포함하는 약학적 조성물, 및 이의 용도
WO2010140835A2 (ko) 신규한 피리돈 화합물 또는 이의 약학적으로 허용가능한 염, 이의 제조방법 및 이를 포함하는 암 치료용 약학 조성물
WO2022019663A1 (ko) 벤조퓨란계 n-아실하이드라존 유도체를 포함하는 항염증 조성물
WO2021096314A1 (ko) 신규한 벤즈이미다졸 유도체 및 이의 용도
WO2020045982A1 (ko) 치환된 인돌 유도체, 이의 제조방법 및 이를 유효성분으로 포함하는 PPARα, PPARγ 및 PPARδ 관련 질환의 예방 또는 치료용 약학적 조성물
WO2022235097A1 (ko) 신규한 피라졸로[3,4-b]피리딘 유도체를 포함하는 비만 및 당뇨병을 비롯한 대사성 질환 또는 비알콜성 지방간염의 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22781539

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3213904

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023561185

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU2022251900

Country of ref document: AU

Ref document number: 2022251900

Country of ref document: AU

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023019984

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022251900

Country of ref document: AU

Date of ref document: 20220328

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202327074401

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2022781539

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022781539

Country of ref document: EP

Effective date: 20231102

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112023019984

Country of ref document: BR

Free format text: APRESENTAR NOVO CONTEUDO ELETRONICO DE LISTAGEM DE SEQUENCIAS BIOLOGICAS, UMA VEZ QUE O APRESENTADO NAO ESTA NO MESMO FORMATO ACEITO NA PUBLICACAO INTERNACIONAL WO/2022/211420, DE 06/10/2022.

ENP Entry into the national phase

Ref document number: 112023019984

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230927