WO2022092769A1 - Bp26 및 항원 폴리펩타이드를 포함하는 융합 단백질 - Google Patents

Bp26 및 항원 폴리펩타이드를 포함하는 융합 단백질 Download PDF

Info

Publication number
WO2022092769A1
WO2022092769A1 PCT/KR2021/015113 KR2021015113W WO2022092769A1 WO 2022092769 A1 WO2022092769 A1 WO 2022092769A1 KR 2021015113 W KR2021015113 W KR 2021015113W WO 2022092769 A1 WO2022092769 A1 WO 2022092769A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusion protein
present
vaccine composition
vaccine
cancer
Prior art date
Application number
PCT/KR2021/015113
Other languages
English (en)
French (fr)
Inventor
전상용
강석모
김유진
송지준
Original Assignee
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술원 filed Critical 한국과학기술원
Priority to EP21886763.8A priority Critical patent/EP4234573A1/en
Publication of WO2022092769A1 publication Critical patent/WO2022092769A1/ko
Priority to US18/139,003 priority patent/US20230257426A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/23—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Brucella (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/098—Brucella
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08—RNA viruses
    • C07K14/11—Orthomyxoviridae, e.g. influenza virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K2039/10—Brucella; Bordetella, e.g. Bordetella pertussis; Not used, see subgroups
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541—Mucosal route
    • A61K2039/543—Mucosal route intranasal
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6068—Other bacterial proteins, e.g. OMP
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/62—Medicinal preparations containing antigens or antibodies characterised by the link between antigen and carrier
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • A61K2039/876—Skin, melanoma
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention was made under the support of the Ministry of Science and ICT of the Republic of Korea under the project number 1711074336 and the project number 2018R1A3B1052661.
  • Research Center for Microenvironment Target and Sensitive Precision Bio-Nanomedicine the host organization is "Korea Advanced Institute of Science and Technology", and the research period is 2018.06.01-2027.02.28.
  • the present invention was made by the project specific number 1711070719, the project number 2018M3A9B5023527 under the support of the Ministry of Science and ICT of the Republic of Korea, the research management specialized institution of the above project is the National Research Foundation of Korea, the research project name is "Original Technology Development Project”, a research project The title is "Development of tumor microenvironment target and sensitive drug delivery platform technology", the lead institution is the Korea Advanced Institute of Science and Technology, and the research period is 2018.04.01-2020.12.31.
  • the present invention relates to a fusion protein comprising BP26 and an antigenic polypeptide.
  • Nanomaterials can be used as antigen delivery carriers to induce humoral or cellular immunity for the development of anticancer and antiviral vaccines.
  • naturally occurring self-assembled protein nanostructures such as ferritin and heat shock proteins can harbor or display antigens and can be used as antigen delivery carriers.
  • Nanostructures having such antigen display, self-assembly, symmetrical structure, and nano size can mimic a virus-like architecture, but antigen-specific immunity without additional use of an adjuvant that activates immunity not effective in eliciting a response.
  • existing adjuvants may cause various side effects, such as inflammation and edema at the injection site, and systemic immunotoxicity.
  • the present inventors made intensive research efforts to develop a self-assembled protein nanostructure that serves as an adjuvant and a carrier.
  • BP26 the outer membrane protein of Brucella
  • a fusion protein comprising BP26 and an antigenic polypeptide.
  • Another object of the present invention is to provide a nanostructure comprising the fusion protein.
  • Another object of the present invention is to provide a vaccine composition comprising the fusion protein, the nanostructure, or a combination thereof.
  • the present invention provides a fusion protein comprising BP26 and an antigenic polypeptide.
  • BP26 refers to an outer membrane protein of Brucella, also referred to as BP26/OMP28. Since BP26 has the property of self-assembly and is a major immunodominant antigen, it exhibits antigen carrier and adjuvant effects.
  • the BP26 includes the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • amino acid refers to the most basic structural unit of a protein molecule. If you look at the structure of an amino acid, an amino group (-NH 2 ) and a carboxyl group (-COOH) are attached to one carbon atom, and hydrogen and R groups are connected here.
  • the BP26 is to include a variant of the amino acid sequence of SEQ ID NO: 1.
  • amino acid sequence of the polypeptide may be changed in order to improve the biological properties of the BP26.
  • changes include, for example, deletions, insertions and/or substitutions of amino acid sequence residues of the polypeptide.
  • variant has "substantial similarity" to the original polypeptide, wherein the two polypeptide sequences have at least about 90% sequence identity when optimally aligned, such as by the program GAP or BESTFIT using default gap weights, more preferably sharing at least about 95%, 98% or 99% sequence identity.
  • the positions of amino acid residues that are not identical differ by conservative amino acid substitutions.
  • a “conservative amino acid substitution” is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (eg charge or hydrophobicity).
  • conservative amino acid substitutions do not substantially change the functionality of the protein.
  • amino acid variations are made based on the relative similarity of amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and the like.
  • amino acid side chain substituents such as hydrophobicity, hydrophilicity, charge, size, and the like.
  • arginine, lysine and histidine are all positively charged residues; alanine, glycine and serine have similar sizes; It can be seen that phenylalanine, tryptophan and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine and histidine; alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine can be said to be biologically functional equivalents.
  • the hydropathic idex of amino acids may be considered.
  • Each amino acid is assigned a hydrophobicity index according to its hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • the hydrophobic amino acid index is very important in conferring an interactive biological function of a protein. It is a known fact that amino acids having a similar hydrophobicity index must be substituted to retain similar biological activity. When introducing a mutation with reference to the hydrophobicity index, the substitution is made between amino acids that show a difference in the hydrophobicity index, preferably within ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5.
  • the substitution is made between amino acids exhibiting a difference in the hydrophilicity value within preferably ⁇ 2, more preferably within ⁇ 1, and even more preferably within ⁇ 0.5.
  • Amino acid exchanges in proteins that do not entirely alter the activity of the molecule are known in the art (H. Neurath, R.L. Hill, The Proteins, Academic Press, New York, 1979).
  • the most common exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ It is an exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly.
  • the BP26 polypeptide of the present invention has at least 90% sequence homology with the amino acid sequence of SEQ ID NO: 1 (eg, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97, 98%, or 99%). All integers greater than or equal to 90% and less than or equal to 100%, and prime numbers therebetween, are included within the scope of the present invention with respect to % homology.
  • the antigen included in the fusion protein is a pathogen-derived antigen or a tumor-derived antigen.
  • the fusion protein comprises one or more antigen-derived antigen polypeptides from the pathogen or tumor-derived antigen.
  • the fusion protein of the present invention included 4 or 8 M2e polypeptides derived from influenza virus, or 6 M30 polypeptides, which are tumor-derived antigens.
  • the fusion protein comprises 1 to 20, 1 to 18, 1 to 16, 1 to 14, 1 to 12, 1 to 10, the pathogen-derived antigen polypeptide or tumor-derived antigen polypeptide.
  • pathogen refers to a microorganism that parasitizes a host and causes disease, and examples thereof include viruses, ricketts, bacteria, fungi, protozoa, and the like.
  • polypeptide or “protein” as used herein are used interchangeably herein to refer to a polymer of amino acid residues.
  • Polypeptides and proteins also apply to amino acid polymers in which one or more amino acid residues are analogs or mimetics of the naturally occurring amino acid polymer as well as the corresponding naturally occurring amino acid.
  • Polypeptides and proteins may also comprise polymers of amino acids that have been modified or phosphorylated to form glycoproteins, for example, by addition of carbohydrate moieties.
  • the polypeptide or protein of the present invention can be synthesized by a synthetic method known in the art, for example, by transforming an expression vector containing a nucleic acid molecule expressing the protein into a host cell to synthesize the recombinant protein, or by solid-phase synthesis technology (solid-phase synthesis). synthesis techniques) (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co. : Rockford, 111 (1984)).
  • the antigenic polypeptide derived from a pathogen of the present invention can serve as an antigen for antibody production, and as long as it is an antigenic polypeptide derived from a pathogen, various selections are possible regardless of its type.
  • the pathogen is selected from the group consisting of viruses, bacteria, rickettsia, fungi, and protozoa, but is not limited thereto.
  • the virus is HPV (Human papillomavirus), HBV (hepatitis B virus), HCV (hepatitis C virus), HIV (human immunodeficiency virus), MERS-CoV, SARS-CoV-2, Zika Virus, HPV, norovirus, rotavirus, influenza virus, parvo virus, adenovirus, herpes simplex virus (HSV), porcine reproductive and respiratory syndrome virus (PRRSV), swine fever virus, swine circovirus (Porcine circovirus, PCV), porcine epidemic diarrhea virus (PEDV), foot-and-mouth disease virus, Newcastle virus, vernavirus or viral hemorrhagic septicemia virus (VHSV), but is not limited thereto.
  • HPV Human papillomavirus
  • HBV hepatitis B virus
  • HCV hepatitis C virus
  • HIV human immunodeficiency virus
  • MERS-CoV human immunodeficiency virus
  • SARS-CoV-2 human
  • the bacteria are Escherichia coli, Clostridium perfringens, Campylobacter fetus jejuni, Mycobacterium paratuberculosis (Mycobacterium paratuberculosis), Mycobacterium bovis, Clostridium tetani, Salmonella gallinarum, Staphylococcus aureus, Mycoplasma gallisepticum, Haemophilus gallisepticum parasuis), Lawsonia intracellularis, Bordetella bronchiseptica, Pasteurella multocida or Rhodococcus equi, but are not limited thereto.
  • the ricketts tea is Rickettsia rickettsia, Orientia tsutsugamushi, Coxiella burnetii, typhus rickettsia typhi or Rickettsia prowazekii or Rickettsia rickettsia. , but is not limited thereto.
  • the fungus is Candida (Candida spp.), hair fungus (Mucor spp.), Rhizopus (Rhizopus spp.), or Aspergillus (Aspergillus spp.), but is limited thereto not.
  • the protozoa is Cryptosporidium, Eimeria, trypanosoma, Plasmodium or Toxoplasma, but is not limited thereto.
  • the antigen polypeptide derived from the pathogen-specific pathogen is, in the case of birds, VP2, VP3, VP4 protein of Infectious bursal disease virus (IBDV), or a combination thereof; glycoprotein B, glycoprotein I, glycoprotein D, glycoprotein E, glycoprotein C, or a combination thereof of Infectious laryngotracheitis virus (ILTV); fusion protein of Newcastle disease virus (NDV-F); avian influenza virus HA (hemagglutinin), NA (neuraminidase), M2e protein, or a combination thereof; S1, S2 protein of Infectious bronchitis virus (IBV), or a combination thereof; OMP (outer membrane protein) of poultry typhus (Salmonella gallinarum); Clostridium perfringens Net-B, PFO protein, or a combination thereof, and the like.
  • IBDV Infectious bursal disease virus
  • ILTV Infectious laryngotracheitis virus
  • NDV-F Newcastle disease
  • the antigen polypeptide derived from the pathogen-specific pathogen is, in the case of pigs, rotavirus VP2, VP4, VP6 protein, or a combination thereof; VP1, VP2, VP3, VP4 protein of P1 protein of foot and mouth disease virus (FMDV), or a combination thereof, VP2 protein of parvovirus; Porcine reproductive and respiratory syndrome virus (PRRSV) protein E, ORF3, protein M, or a combination thereof; E1, E2, or a combination thereof of classical swine fever virus (CSFV); capsid protein of circovirus type 2 (PCV2); Escherichia coli k88, k99, 987p protein, or a combination thereof; Pasteurella multocida OMP H (outer membrane protein H) and the like, but is not limited thereto.
  • PRRSV Porcine reproductive and respiratory syndrome virus
  • PCV2 capsid protein of circovirus type 2
  • PCV2 capsid protein of circovirus type 2
  • the antigen polypeptide derived from the pathogen-specific pathogen is glycoprotein G, nucleoprotein N, phosphoprotein P, matrix protein M, RNA polymerization of rabies virus. enzyme L, or a combination thereof; HA protein of canine distemper virus, F protein, or a combination thereof, and the like.
  • the pathogen-derived antigen polypeptide is a receptor binding domain (RBD) of the spike protein shown in SARS-CoV 2.
  • the antigenic polypeptide derived from the pathogen is M2e.
  • M2e is a protein found in most influenza viruses and refers to the matrix protein 2 ectodomain. Since M2e is an evolutionarily conserved protein in influenza viruses, it is a promising candidate for constructing a universal vaccine against most influenza viruses.
  • the M2e is to include the amino acid sequence of SEQ ID NO: 3, 4, 5, or 6.
  • the tumor-derived antigen comprises a tumor-associated antigen (tumor-associated antigen, TAA) and a tumor-specific antigen (tumor-specific antigen, TSA).
  • TAA tumor-associated antigen
  • TSA tumor-specific antigen
  • TAA tumor-associated antigen
  • the tumor-specific antigen includes a mutation (nonsynonymous mutation) that changes the amino acid of a protein and a neoantigen caused by genetic aleration and an oncoviral antigen of a virus.
  • the new antigen again includes a shared neoantigen and a private neoantigen that is different for each individual.
  • the tumor-derived antigen is M30, MAGE-1, MAGE-2, MAGE-3, MAGE-12, BAGE, GAGE, NY-ESO-1, tyrosinase, TRP-1, TRP-2, gp100, MART- 1, MCIR, Ig idotype, CDK4, Caspase-B, beta-catenin, CLA, BCR/ABL, mutated p21/ras, mutated p53, proteinase 3, WT1, MUC-1, Her2/neu, PAP, PSA, PSMA, It is selected from the group consisting of G250, HPV E6/E7, EBV LMP2a, CEA, alpha-Fetoprotein, 5T4, onco-trophoblast glycoprotein, and the like, but is not limited thereto. It will be easy to understand that it can be applied.
  • the M30 is to include the amino acid sequence of SEQ ID NO: 8.
  • the M30 is also encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:9.
  • the tumor is breast cancer, head and neck cancer, bladder cancer, stomach cancer, rectal/colon cancer, pancreatic cancer, lung cancer, melanoma, prostate cancer, kidney cancer, liver cancer, biliary tract cancer, cervical cancer, thyroid cancer, and the like, but are not limited thereto.
  • the BP26 and the antigenic polypeptide are directly linked or indirectly linked through a linker (eg, an amino acid linker).
  • a linker eg, an amino acid linker
  • linker refers to a peptide inserted between a protein and a protein so that, when a fusion protein is made by linking two proteins, the structural flexibility of these proteins or the activity of each protein can be enhanced.
  • the linker is not limited as long as it does not inhibit the activity of each protein to be fused and does not cause an unnecessary immune response, but specifically, it may be a peptide linker consisting of 1 to 20 amino acids, and more specifically 1 to 6 amino acids. .
  • linker between the functional moieties to be fused, usually when constructing a fusion protein, and other types of linkers with different properties, for example, flexible amino acid linkers, inflexibility It will be appreciated that there are linkers and cleavable amino acid linkers. Linkers have been used to increase the expression level of the fusion protein, improve biological activity, enable targeting, or change pharmacokinetics, or to increase stability and improve folding of the fusion protein.
  • the fusion protein may include at least one linker, such as at least one linker selected from a flexible amino acid linker, a non-flexible linker and a cleavable amino acid linker.
  • the linker may consist of an amino acid sequence represented by the general formula (GnSm)p or (SmGn)p:
  • n, m and p are independently,
  • n is an integer from 1 to 7;
  • n is an integer from 0 to 7;
  • n and m are integer less than or equal to 8.
  • p is an integer from 1 to 7.
  • the linker is GGGGS.
  • the linker is GGGG, GGGSG.
  • the linker may be VDGS or ASGS, but is not limited thereto.
  • the polypeptide is continuously or discontinuously linked in the fusion protein.
  • the present invention can regulate the immune response by controlling the number of antigenic polypeptides in the fusion protein, and according to an embodiment of the present invention, a fusion protein in which 8 M2e polypeptides or 6 M30 polypeptides are linked shows an excellent immune-inducing effect .
  • tandem repeat structure refers to a configuration in which two or more antigenic polypeptides included in the fusion protein of the present invention are continuously or non-contiguously connected in series by a linker.
  • BP26 of the present invention forms a fusion protein in a configuration in which 4 or 8 M2e are linked by a linker, and the fusion protein can self-assemble to form a nanostructure.
  • nucleic acid molecule comprising a nucleotide sequence encoding the fusion protein.
  • nucleic acids has a meaning comprehensively including DNA (gDNA and cDNA) and RNA molecules. Modified analogs are also included (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
  • nucleotide sequence encoding the fusion protein of the present invention is a nucleotide sequence encoding an amino acid sequence constituting the fusion protein, and it is not limited to any specific nucleotide sequence.
  • nucleotide sequence is a functionally equivalent codon or codon encoding the same amino acid (eg, due to codon degeneracy, there are six codons for arginine or serine), or a codon encoding a biologically equivalent amino acid It contains a nucleotide sequence comprising a.
  • nucleic acid molecule of the present invention encoding the amino acid sequence constituting the fusion protein also includes a sequence exhibiting substantial identity thereto.
  • the substantial identity is obtained by aligning the sequence of the present invention and any other sequences to the maximum correspondence, and analyzing the aligned sequence using an algorithm commonly used in the art,
  • At least 60% or more homology eg, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, or 69%), more preferably at least 70% or more homology Same sex (eg, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%), even more preferably at least 80% or more (eg 80%) , 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% homology, most preferably at least 90% (eg, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). All integers greater than or equal to 70% and less than or equal to 100% and prime numbers therebetween are included within the scope of the present invention with respect to % homology.
  • BLAST The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10(1990)) is accessible from the National Center for Biological Information (NBCI), etc. It can be used in conjunction with sequencing programs such as blastx, tblastn and tblastx. BLAST can be accessed through the BLAST page of the ncbi website. A method for comparing sequence homology using this program can be found on the BLAST help page of the ncbi website.
  • NBCI National Center for Biological Information
  • the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the fusion protein.
  • vector refers to a means for expressing a target gene in a host cell, including a plasmid vector; cozmid vector; and viral vectors such as bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors, and the like.
  • the nucleic acid molecule encoding the fusion protein in the vector of the present invention is operatively linked to the promoter of the vector.
  • operably linked refers to a functional association between a nucleic acid expression control sequence (eg, a promoter, signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence, whereby the Regulatory sequences will control the transcription and/or translation of said other nucleic acid sequences.
  • a nucleic acid expression control sequence eg, a promoter, signal sequence, or an array of transcriptional regulator binding sites
  • the recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001), This document is incorporated herein by reference.
  • the vector of the present invention can typically be constructed as a vector for gene cloning or a vector for expression of a protein.
  • the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host.
  • a promoter derived from the genome of a mammalian cell eg, metallotionine promoter, ⁇ -actin promoter, human hegglobin promoter and human muscle creatine promoter
  • promoters derived from mammalian viruses eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter
  • the LTR promoter of HIV, the promoter of Moloney virus, the promoter of Epstein Barr virus (EBV), and the promoter of Loose sarcoma virus (RSV) can be used, and they generally have a polyadenylation sequence as a transcription termination sequence.
  • the vector of the present invention may be fused with other sequences to facilitate purification of the polypeptide or protein expressed therefrom.
  • the sequence to be fused includes, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).
  • the expression vector of the present invention includes an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neo There is a gene for resistance to mycin and tetracycline.
  • the present invention provides a host cell comprising the vector.
  • a host cell capable of stably and continuously cloning and expressing the vector of the present invention is known in the art, and any host cell may be used.
  • suitable eukaryotic host cells of the vector include monkey kidney cells (COS7), NSO cells, SP2/0, Chinese hamster ovary (CHO) cells, W138, young hamster kidney (BHK: baby hamster kidney) cells, MDCK, myeloma cell line, HuT 78 cells and HEK-293 cells.
  • transformed As used herein, the terms “transformed”, “transduced” or “transfected” refer to the process by which an exogenous nucleic acid is transferred or introduced into a host cell. "transformed”, “transduced” or “ A “transfected” cell is a cell that has been transformed, transduced, or transfected with an exogenous nucleic acid, said cell including said cell and progeny cells resulting from subculture thereof.
  • the present invention provides a nanostructure comprising the fusion protein.
  • the nanostructure includes two or more of the fusion protein.
  • the nanostructure is to include 2 to 20 of the fusion protein. More specifically, the nanostructure includes 8 or 16 of the fusion protein.
  • the nanostructure includes a hexamer formed by combining two octamers formed by the eight fusion proteins.
  • the nanostructure is to include a hollow structure.
  • the hollow structure means a hollow structure of the structure, and according to an embodiment of the present invention, the nanostructure of the present invention represents a hollow barrel-type structure.
  • the size of the pores appears smaller as the fusion protein included in the nanostructure contains more antigenic polypeptides.
  • the nanostructure is to display the antigen on the surface.
  • the epitope of the M2e or M30 antigen is displayed on the surface of the nanostructure of the present invention.
  • the fusion protein constituting the nanostructure is the same as the fusion protein including BP26 and the antigenic polypeptide, overlapping parts are omitted to avoid excessive complexity of the specification.
  • the present invention provides a vaccine composition comprising the fusion protein, the nanostructure, or a combination thereof.
  • the vaccine composition is HPV (Human papillomavirus), HBV (hepatitis B virus), HCV (hepatitis C virus), HIV (human immunodeficiency virus), MERS-CoV, SARS-CoV-2, Zika virus, HPV, norovirus, rotavirus, influenza virus, herpes simplex virus (HSV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine cholera virus, porcine circovirus (PCV), swine diarrhea virus (PEDV), foot-and-mouth disease
  • HBV herpes simplex virus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PCV porcine circovirus
  • PEDV swine diarrhea virus
  • foot-and-mouth disease It is a vaccine composition for preventing viruses selected from the group consisting of viruses, Newcastle virus and viral hemorrhagic septicemia virus (VHSV), but is not limited thereto.
  • the vaccine composition is a vaccine composition for preventing infectious pathogen infection.
  • the vaccine composition is Escherichia coli, Clostridium perfringens, Campylobacter fetus jejuni, Mycobacterium paratuberculosis (Mycobacterium paratuberculosis), Mycobacterium bovis, Clostridium tetani, Salmonella gallinarum, Staphylococcus aureus, Mycoplasma gallisepticum, Haemophilus gallisepticum parasuis), Lawsonia intracellularis, for preventing bacteria selected from the group consisting of Bordetella bronchiseptica, Pasteurella multocida and Rhodococcus equi It is a vaccine composition, but is not limited thereto.
  • the vaccine composition comprises Rickettsia rickettsia, Orientia tsutsugamushi, Coxiella burnetii, typhus rickettsia (Rickettsia prowazekii) or Rickettsia typhi. It is a vaccine composition for preventing Rickettsia selected from the group consisting of, but is not limited thereto.
  • the vaccine composition is selected from the group consisting of Candida (Candida spp.), hair fungus (Mucor spp.), Rhizopus (Rhizopus spp.) and Aspergillus (Aspergillus spp.) It is a vaccine composition for preventing fungi, but is not limited thereto.
  • the vaccine composition is selected from the group consisting of Cryptosporidium, Eimeria, Trypanosoma, Plasmodium and Toxoplasma. It is a vaccine composition for preventing protozoa, but is not limited thereto.
  • the vaccine composition is a vaccine composition for preventing influenza virus.
  • the vaccine composition is a vaccine composition for a cancer vaccine.
  • the cancer vaccine of the present invention can be used to elicit an immune response in a mammal against cancer or a tumor in a mammal or subject in need thereof.
  • the induced immune response can prevent or treat cancer or tumor growth.
  • the evoked immune response can prevent and/or reduce metastasis of cancer or tumor cells.
  • the cancer is breast cancer, head and neck cancer, bladder cancer, stomach cancer, rectal/colon cancer, pancreatic cancer, lung cancer, melanoma, prostate cancer, kidney cancer, skin cancer, liver cancer, biliary tract cancer, cervical cancer, thyroid cancer, blood cancer (eg, leukemia, lymphoma, myeloma), and the like.
  • the administered vaccine (1) blocks the production of monocyte chemoattractant protein-1 (MCP-1), thereby delaying bone marrow-derived suppressor cells (MDSC) and inhibiting tumor growth B cell response induction of humoral immunity through (2) increase cytotoxic T lymphocytes such as CD8+ (CTL) that attack and kill tumor cells; (3) increasing helper T cell responses; and (4) through IFN- ⁇ and TFN- ⁇ , preferably through all of the above, by increasing the inflammatory response, thereby mediating the removal of tumor cells or inhibiting their growth.
  • MCP-1 monocyte chemoattractant protein-1
  • MDSC bone marrow-derived suppressor cells
  • CTL cytotoxic T lymphocytes
  • helper T cell responses and (4) through IFN- ⁇ and TFN- ⁇ , preferably through all of the above, by increasing the inflammatory response, thereby mediating the removal of tumor cells or inhibiting their growth.
  • the immune response is a humoral immune response and/or antigen-specific cytotoxic T that does not cause damage to or inflammation of various tissues or systems (eg, brain or nervous system, etc.) in a subject to which the vaccine is administered. It can cause lymphocyte (CTL) responses.
  • CTL lymphocyte
  • the composition will additionally include an adjuvant.
  • the term “adjuvant” refers to an additive to increase an immune response, and is generally used together with an antigen for antibody production and enhancement of immunity.
  • the adjuvant is alum, Freund's complete adjuvant, Freund's incomplete adjuvant, LPS, poly IC, poly AU, lysolecithin, plurone polyol, polyanion, oil or hydrocarbon emulsion, keyhollimpet he It is selected from the group consisting of mocyanine and dinitrophenol, but is not limited thereto.
  • the adjuvant is an immunostimulatory single- or double-stranded oligonucleotide, an immunostimulatory small molecule compound, or a combination thereof.
  • the immunostimulatory single-stranded or double-stranded oligonucleotide is known as a useful adjuvant (immunoadjuvant). They often contain a CpG motif (a dinucleotide sequence comprising an unmethylated cytosine linked to a guanosine). Oligonucleotides comprising a TpG motif, a palindrome arrangement, a plurality of contiguous thymidine nucleotides (eg TTTT), a plurality of contiguous cytosine nucleotides (eg CCCC) or a poly(dG) arrangement are also It is a known adjuvant like double-stranded RNA. Any of a variety of immunostimulatory oligonucleotides can be used without limitation with the present invention.
  • the oligonucleotide typically has 10-100 nucleotides, for example 15-50 nucleotides, 20-30 nucleotides, or 25-28 nucleotides. It is typically a single chain.
  • the oligonucleotide may comprise only natural nucleotides, only non-natural nucleotides, or a mixture of both.
  • the oligonucleotide may contain one or more phosphorothioate linkages, and/or one or more 2'-O-methyl modifications.
  • the single-stranded or double-stranded oligonucleotide is a CpG oligonucleotide, a STING active oligonucleotide, or a combination thereof.
  • STING Stimulator of Interferon Genes
  • STING a stimulator of interferon genes
  • ER endoplasmic reticulum
  • TM transmembrane
  • Loss of STING reduces the ability of polyIC to activate type I IFN, and mouse embryonic fibroblasts lacking STING produced by targeted homologous recombination and susceptible to vesicular stomatitis virus (VSV) infection. (-/- MEF) is provided. In the absence of STING, the DNA-mediated type I IFN response is inhibited, indicating that STING may play an important role in recognizing DNA from viruses, bacteria and other pathogens that can infect cells. Yeast double hybridization and co-immunoprecipitation studies have shown that STING interacts with RIG-I and Ssr2/TRAP ⁇ (members of the transloconassociated protein (TRAP) complex required for post-translational transport of proteins across the ER membrane).
  • RIG-I and Ssr2/TRAP ⁇ members of the transloconassociated protein (TRAP) complex required for post-translational transport of proteins across the ER membrane.
  • RNAi removal of TRAP ⁇ inhibited STING function and prevented the generation of type I IFN in response to polyIC.
  • STING itself binds to nucleic acids, including single and double-stranded DNA, for example from pathogens or apoptotic DNA, and modulates proinflammatory gene expression in DNA-mediated arthritis and inflammatory conditions such as cancer. has been shown to play a central role in Various novel methods for upregulating STING expression or function and various novel compositions for upregulating STING expression or function are described herein, along with further characterization of other cellular molecules that interact with STING. These findings allow the design of new adjuvants, vaccines and therapies to modulate the immune system and other systems.
  • the STING activity oligonucleotide may be a nucleic acid molecule that binds a STING function to STING.
  • the STING-binding nucleic acid molecule may be a single stranded DNA of 40 to 150 base pairs in length or a double stranded DNA of 40 to 150, 60 to 120, 80 to 100, or 85 to 95 base pairs or more in length.
  • the STING binding nucleic acid molecule may be nuclease resistant, for example, made of nuclease resistant nucleotides.
  • a STING-binding nucleic acid molecule may also bind to a molecule that promotes transmembrane transport. In such methods, the disease or disorder may be a DNA-dependent inflammatory disease.
  • the oligonucleotide is an antisense oligonucleotide, a CpG oligonucleotide, or a combination thereof.
  • CpG oligonucleotide is a short term comprising unmethylated cytosine triphosphate deoxynucleotide (“C”) and guanine triphosphate deoxynucleotide (“G”).
  • C cytosine triphosphate deoxynucleotide
  • G guanine triphosphate deoxynucleotide
  • immunostimulant As a single-stranded synthetic DNA molecule, it is known as an immunostimulant.
  • the CpG serves as an adjuvant that enhances the immune response of dendritic cells when included as a component of the nano-vaccine of the present invention.
  • the immunostimulatory low-molecular compound is also called a small molecule adjuvant, and includes a synthetic low-molecular adjuvant and a natural low-molecular adjuvant.
  • the immunostimulatory low molecular weight compound or low molecular weight adjuvant include monophosphoryl lipid A, Muramyl dipeptide, Bryostatin-1, Mannide monooleate (Montanide ISA 720), Squalene, QS21, Bis-(3′,5′)-cyclic dimeric guanosine monophosphate, PAM2CSK4, PAM3CSK4, Imiquimod, Resiquimod, Gardiquimod, cl075, cl097, Levamisole, 48/80, Bupivacaine, Isatoribine, Bestatin, Sm360320, and Loxoribine.
  • For small molecule adjuvants Flower DR et al . (Expert Opin Drug Discov. 2012 Sep;7(9):807-17.
  • the vaccine composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent.
  • the term “pharmaceutically acceptable” refers to characteristics acceptable to a patient from a pharmacological/toxicological point of view and acceptable to a dispensing pharmacist from a physical/chemical point of view with respect to composition, formulation, safety, patient acceptability and bioavailability. and/or substances.
  • “Pharmaceutically acceptable carrier” refers to a medium that does not interfere with the effect of the biological activity of the active ingredient(s) and is nontoxic to the host upon administration.
  • Suitable carriers for the vaccine are known to those skilled in the art and include, but are not limited to, proteins, sugars, and the like. Such carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions.
  • Non-aqueous carriers include propylene glycol, polyethylene glycol, edible oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcohol/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • a suitable dosage of the vaccine composition of the present invention depends on the species of the individual, the breed of the individual, the formulation method, the mode of administration, the age, weight, sex, vaccination history, food, administration time, route of administration, excretion rate and reaction sensitivity of the individual. It can be prescribed in various ways depending on the same factors.
  • the dosage of the vaccine composition of the present invention may be 0.1 ml to 10 ml.
  • the dosage of the vaccine composition of the present invention may be 0.1 ml to 0.5 ml, more specifically 0.3 ml to 0.5 ml in avian species.
  • the dosage of the vaccine composition of the present invention may be 0.2 ml to 3.0 ml, more specifically 0.3 ml to 2.0 ml, most specifically 0.5 ml to 1.0 ml in cat, dog and horse species.
  • the dosage of the vaccine composition of the present invention may be 0.2 ml to 5.0 ml, more specifically 0.3 ml to 3.0 ml, more specifically 0.5 ml to 2.0 ml for bovine and porcine species.
  • the amount of antigen in the vaccine composition dosage may be 1-100 ⁇ g, 5-50 ⁇ g, 5-30 ⁇ g, 5-25 ⁇ g, 10-50 ⁇ g, 10-40 ⁇ g, 10-30 ⁇ g, 10-25 ⁇ g days can According to an embodiment of the present invention, the amount of antigen in the vaccine composition dose is 10 to 30 ⁇ g.
  • the subject to which the present invention can be applied may be any animal, specifically, with mammals such as humans, mice, rats, hamsters, guinea pigs, rabbits, cats, dogs, monkeys, cattle, horses, pigs; Livestock including birds, such as chickens, ducks, turkeys, and the like. Most preferred subjects are livestock or humans.
  • the vaccine composition may be freeze-dried or formulated as a liquid formulation according to any means suitable in the art.
  • formulations in liquid form include solutions, suspensions, syrups, slurries, and emulsions.
  • suitable liquid carriers include all suitable organic or inorganic solvents, for example, water, alcohol, saline, buffered saline, physiological saline, dextrose solution, water propylene glycol solution, and the like, preferably in sterile form.
  • Vaccine compositions may be formulated in neutral or salt form.
  • Pharmaceutically acceptable salts include acid addition salts (formed with the free amino group of the active polypeptide), which include inorganic acids such as hydrochloric or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like. are formed together
  • salts formed from free carboxyl groups include inorganic bases such as sodium, potassium, ammonium, calcium or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine. , procaine, and the like.
  • the vaccine composition is preferably formulated for inoculation or injection into a subject.
  • the vaccine composition of the present invention may be formulated in an aqueous solution, e.g., water or alcohol, or in a physiologically suitable buffer, e.g., Hanks' solution, Ringer's solution or physiological saline buffer.
  • can Solutions may contain formulatory agents such as suspending, preservative, stabilizing and/or dispersing agents.
  • injectable formulations may also be prepared as solid form preparations which are converted shortly before use into liquid form preparations suitable for injection, for example, by reconstitution with a suitable vehicle such as sterile water, saline or alcohol prior to use.
  • Vaccine compositions may also be formulated as delayed release vehicles or depot preparations. Such long acting formulations may be administered by inoculation or implantation (eg subcutaneously or intramuscularly) or by injection.
  • a vaccine composition may be formulated with a suitable polymeric or hydrophobic material (eg, as an emulsion in an acceptable oil) or ion exchange resin, or as a sparingly soluble derivative, eg, a sparingly soluble salt.
  • a suitable polymeric or hydrophobic material eg, as an emulsion in an acceptable oil
  • ion exchange resin eg, as a sparingly soluble derivative, eg, a sparingly soluble salt.
  • liposomes and emulsions are well-known examples of delivery vehicles suitable for use as carriers.
  • the vaccine composition may be administered by infusion or injection (eg, intravenous, intramuscular, intradermal, subcutaneous, intrathecal, intraduodenal, intraperitoneal, etc.).
  • the vaccine composition may be administered intranasally, vaginally, rectally, orally, or transdermally.
  • the vaccine composition may be administered by a “needle-free” delivery system.
  • the composition is administered by intradermal injection. Administration may be as directed by a physician or medical assistant.
  • the injection may be divided into several injections, and these divided inoculations are preferably administered substantially simultaneously.
  • the doses of the immunogen are preferably, but not necessarily, allocated equally in each separate injection.
  • the dose of adjuvant is preferably, but not necessarily, allocated equally at each separate injection.
  • the separate injections for split inoculation are, in some aspects, administered substantially adjacent to one another in the body of the patient. In some aspects, the injections are administered at least about 1 cm apart from each other in the body. In some aspects, the injections are administered at least about 2.5 cm apart from each other in the body. In some aspects, the injections are administered at least about 5 cm apart from each other in the body.
  • the injections are administered at least about 10 cm apart from each other in the body. In some aspects, the injections are administered more than 10 cm apart in the body, eg, at least about 12.5, 15, 17.5, 20 cm or more apart.
  • the primary vaccination injection and booster injection may be administered in split doses as described and exemplified herein.
  • Non-limiting examples of such systems include liposomes and emulsions. Certain organic solvents such as dimethylsulfoxide may also be used.
  • vaccine compositions may be delivered using a delayed release system, for example, a semipermeable matrix of a solid polymer comprising a therapeutic agent.
  • delayed release materials available are well known to those skilled in the art. Delayed release capsules can release the vaccine composition over a range of days to weeks to months, depending on their chemistry.
  • a therapeutically effective amount of a vaccine composition is administered to a subject.
  • a therapeutically effective amount is a clinically significant increase in the number of tumor-derived antigen-specific cytotoxic T-lymphocytes (CD8 + ) in a patient and a cytotoxic T for antigen, as measured by any means suitable in the art. - will provide a clinically significant increase in lymphocyte response.
  • a therapeutically effective amount of the vaccine composition will destroy the remaining microscopic disease, significantly reducing or eliminating the risk of cancer recurrence in the patient.
  • An effective amount of the vaccine composition may significantly increase the likelihood of a recurrence of the cancer in the patient, including, but not limited to, race, breed, dimension, height, weight, age, general health of the patient, type of formulation, mode or method of administration, or cancer.
  • Prevalence can depend on many variables, including the presence or absence of risk factors. These risk factors include, but are not limited to, type of surgery, condition and number of benign lymph nodes, size of tumor, histological grade of tumor, presence/absence of hormone receptors (estrogen and progesterone receptors), HER2/neu expression, lymphatic vascular infiltration and genetic predisposition (such as BRCA 1 and 2).
  • the effective amount is dependent on whether the patient is lymph node positive or lymph node negative, and, if the patient is lymph node positive, the number and extent of positive lymph nodes.
  • a suitable effective amount can be determined by one of ordinary skill in the art, usually using routine optimization techniques and the skillful and conscientious judgment of the skilled artisan, and other factors apparent to those skilled in the art.
  • a therapeutically effective amount of a vaccine composition described herein will provide a therapeutic benefit without causing substantial toxicity to a subject.
  • Toxicity and therapeutic efficacy of vaccine compositions can be measured in cell culture or experimental animals, for example, to determine LD 50 (dose lethal to 50% of a population) and ED 50 (dose that is therapeutically effective to 50% of a population). It can be measured by standard pharmaceutical procedures. The dose ratio between toxicity and therapeutic effect is the therapeutic index, which can be expressed as the ratio LD 50 /ED 50 . Vaccine compositions that exhibit large therapeutic indices are preferred. Data obtained from cell culture assays and animal studies can be used to formulate a range of doses for use in patients. Doses of such vaccine compositions preferably fall within a range of circulating concentrations that include the ED 50 with very little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration employed.
  • Toxicity information can be used to more accurately determine useful doses in a particular subject, eg, a human.
  • the treating physician may terminate, discontinue, or adjust administration due to toxicity or organ dysfunction, and may adjust treatment as needed if clinical response is not adequate to improve response.
  • the size of the dose administered in the prevention of recurrent cancer will vary depending on the severity of the patient's condition, the relative risk for recurrence, or the route of administration, among other factors. The severity of a patient's condition can be assessed, for example, in part by standard prognostic assessment methods.
  • the vaccine composition may be administered to the patient on any schedule suitable for inducing and/or supporting a cytotoxic T lymphocyte response, to induce and/or support protective immunity against recurrence of cancer.
  • a booster may be administered to support and/or maintain protective immunity.
  • the vaccine composition may be administered to the patient once, twice or more times per month.
  • Vaccine dosing schedules can be continued, for example over the course of several years, to prolong the patient's lifespan as long as the patient needs it.
  • the vaccine schedule includes more frequent dosing at the start of vaccine therapy and less frequent dosing (eg, boosters) during times to maintain protective immunity.
  • the vaccine composition may be administered at a lower dose at the start of vaccine therapy and at a higher dose over time.
  • the vaccine may be administered in higher doses at the start of vaccine therapy and in lower doses over time.
  • the number of primary vaccine and booster administrations and the dose of antigen administered may be tailored and/or adjusted to meet the specific needs of the individual patient, as determined by the attending physician according to any means suitable in the art. there is.
  • the vaccine composition according to an aspect of the present invention is a composition comprising the above-described fusion protein or nanostructure in common, and description thereof is omitted within the overlapping range in order to avoid complexity of the specification.
  • the vaccine composition may be administered by infusion or injection (eg, intravenous, intramuscular, intradermal, subcutaneous, intrathecal, intraduodenal, intraperitoneal, etc.).
  • the vaccine composition may be administered intranasally, vaginally, rectally, orally, or transdermally.
  • the vaccine composition may be administered by a “needle-free” delivery system.
  • the composition is administered by intradermal injection. Administration may be as directed by a physician or medical assistant.
  • the injection may be divided into several injections, and these divided inoculations are preferably administered substantially simultaneously.
  • the doses of the immunogen are preferably, but not necessarily, allocated equally in each separate injection.
  • the dose of adjuvant is preferably, but not necessarily, allocated equally at each separate injection.
  • the separate injections for split inoculation are, in some aspects, administered substantially adjacent to one another in the body of the patient. In some aspects, the injections are administered at least about 1 cm apart from each other in the body. In some aspects, the injections are administered at least about 2.5 cm apart from each other in the body. In some aspects, the injections are administered at least about 5 cm apart from each other in the body.
  • the injections are administered at least about 10 cm apart from each other in the body. In some aspects, the injections are administered more than 10 cm apart in the body, eg, at least about 12.5, 15, 17.5, 20 cm or more apart.
  • the primary vaccination injection and booster injection may be administered in split doses as described and exemplified herein.
  • Non-limiting examples of such systems include liposomes and emulsions. Certain organic solvents such as dimethylsulfoxide may also be used.
  • vaccine compositions may be delivered using a delayed release system, for example, a semipermeable matrix of a solid polymer comprising a therapeutic agent.
  • delayed release materials available are well known to those skilled in the art. Delayed release capsules can release the vaccine composition over a range of days to weeks to months, depending on their chemistry.
  • a therapeutically effective amount of the vaccine composition is administered to the subject.
  • a therapeutically effective amount is a clinically significant increase in the number of tumor-associated antigen-specific cytotoxic T-lymphocytes (CD8 + ) in a patient and a cytotoxic T for the antigen, as measured by any means suitable in the art. - will provide a clinically significant increase in lymphocyte response.
  • a therapeutically effective amount of the vaccine composition will destroy the remaining microscopic disease, significantly reducing or eliminating the risk of cancer recurrence in the patient.
  • An effective amount of the vaccine composition may significantly increase the likelihood of a recurrence of the cancer in the patient, including, but not limited to, race, breed, dimension, height, weight, age, general health of the patient, type of formulation, mode or method of administration, or cancer.
  • Prevalence can depend on many variables, including the presence or absence of risk factors. These risk factors include, but are not limited to, type of surgery, condition and number of benign lymph nodes, size of tumor, histological grade of tumor, presence/absence of hormone receptors (estrogen and progesterone receptors), HER2/neu expression, lymphatic vascular infiltration and genetic predisposition (such as BRCA 1 and 2).
  • the effective amount is dependent on whether the patient is lymph node positive or lymph node negative, and, if the patient is lymph node positive, the number and extent of positive lymph nodes.
  • a suitable effective amount can be determined by one of ordinary skill in the art, usually using routine optimization techniques and the skillful and conscientious judgment of the skilled artisan, and other factors apparent to those skilled in the art.
  • a therapeutically effective amount of a vaccine composition described herein will provide a therapeutic benefit without causing substantial toxicity to a subject.
  • Toxicity and therapeutic efficacy of vaccine compositions can be measured in cell culture or experimental animals, for example, to determine LD 50 (dose lethal to 50% of a population) and ED 50 (dose that is therapeutically effective to 50% of a population). It can be measured by standard pharmaceutical procedures. The dose ratio between toxicity and therapeutic effect is the therapeutic index, which can be expressed as the ratio LD 50 /ED 50 . Vaccine compositions that exhibit large therapeutic indices are preferred. Data obtained from cell culture assays and animal studies can be used to formulate a range of doses for use in patients. Doses of such vaccine compositions preferably fall within a range of circulating concentrations that include the ED 50 with very little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration employed.
  • Toxicity information can be used to more accurately determine useful doses in a particular subject, eg, a human.
  • the treating physician may terminate, discontinue, or adjust administration due to toxicity or organ dysfunction, and may adjust treatment as needed if clinical response is not adequate to improve response.
  • the size of the dose administered in the prevention of recurrent cancer will vary depending on the severity of the patient's condition, the relative risk for recurrence, or the route of administration, among other factors. The severity of a patient's condition can be assessed, for example, in part by standard prognostic assessment methods.
  • the vaccine composition may be administered to the patient on any schedule suitable for inducing and/or supporting a cytotoxic T lymphocyte response, to induce and/or support protective immunity against recurrence of cancer.
  • a booster may be administered to support and/or maintain protective immunity.
  • the vaccine composition may be administered to the patient once, twice or more times per month.
  • Vaccine dosing schedules can be continued, for example over the course of several years, to prolong the patient's lifespan as long as the patient needs it.
  • the vaccine schedule includes more frequent dosing at the start of vaccine therapy and less frequent dosing (eg, boosters) during times to maintain protective immunity.
  • the vaccine composition may be administered at a lower dose at the start of vaccine therapy and at a higher dose over time.
  • the vaccine may be administered in higher doses at the start of vaccine therapy and in lower doses over time.
  • the number of primary vaccine and booster administrations and the dose of antigen administered may be tailored and/or adjusted to meet the specific needs of the individual patient, as determined by the attending physician according to any means suitable in the art. there is.
  • the vaccine composition according to an aspect of the present invention is a composition comprising the above-described fusion protein or nanostructure in common, and description thereof is omitted within the overlapping range in order to avoid complexity of the specification.
  • the vaccine composition is for preventing or treating cancer.
  • the antigen of the fusion protein or nanostructure as an active ingredient is a tumor-derived antigen.
  • prevention refers to a method of preventing cancer recurrence/relapse in patients in clinical remission as measured by any objective or subjective variable, including the results of radiological or physical examination. Mention any success or signs of success.
  • fusion protein and nanostructure included in the vaccine composition are the same as the above-described fusion protein and nanostructure, overlapping parts are omitted to avoid excessive complexity of the specification.
  • the present invention provides a method for preventing or treating an infectious disease or cancer, comprising administering the vaccine composition to a subject.
  • the subject to which the present invention can be applied may be any animal, specifically, with mammals such as humans, mice, rats, hamsters, guinea pigs, rabbits, cats, dogs, monkeys, cattle, horses, pigs; Livestock including birds, such as chickens, ducks, turkeys, and the like. Most preferred subjects are livestock or humans.
  • the method for preventing or treating an infectious disease or cancer according to an aspect of the present invention includes administering the above-described vaccine composition to a subject, description thereof is omitted within the overlapping scope in order to avoid complexity of the specification.
  • the present invention provides a fusion protein comprising BP26 and an antigenic polypeptide.
  • the present invention provides a nanostructure comprising the fusion protein.
  • FIG. 1 shows a BP26-based nanostructure displaying an influenza M2e epitope.
  • Figure 2a shows a fusion protein comprising BP26 and M2e.
  • Figure 2b shows the results of confirming the expression of BP26-M2e (x4) and BP26-M2e (x8) by size exclusion chromatography.
  • Figure 2c shows the results of confirming the expression of BP26-WT, BP26-M2e (x4) and BP26-M2e (x8) by SDS-PAGE.
  • TEM transmission electron microscopy
  • Figure 2e shows the hydrodynamic diameter of the nanostructure measured by dynamic light scattering (dynamic light scattering, DLS). .
  • Figure 2f shows the results of ELISA analysis to confirm the accessibility and reactivity of the anti-M2e antibody to the multi-tandem (tandem) repeat structure of the M2e epitope displayed on the surface of the BP26 nanostructure.
  • Figure 3a shows an experimental method for confirming the antibody production of the mouse by the nanostructure.
  • Figure 3b shows the result of measuring the anti-M2e antibody titer in the serum after immunization with the nanostructure measured through ELISA.
  • Figure 3c shows the titers of anti-M2e IgG in the serum of immunized mice (days 14, 35, 56) measured by ELISA.
  • Figure 3d shows the titers of M2e-specific IgG1 and IgG2a in the serum of immunized mice (day 56) measured by ELISA.
  • Figure 3e shows the titers of anti-BP26 IgG in the serum of immunized mice (day 56) measured by ELISA.
  • 4A shows anti-M2e antibody binding to M2e of influenza virus-infected cells.
  • Figure 4c shows the results of evaluating the binding ability of the anti-M2e antibody to influenza virus-infected MDCK cells measured by whole-cell ELISA.
  • Figure 4d shows the results of evaluating the binding ability of the anti-M2e antibody to influenza virus-infected MDCK cells measured by Western blot.
  • Figure 5a shows the immunization schedule of Balb/c mice to evaluate the protective effect of the BP26-M2e nano vaccine against influenza virus.
  • 5B shows the clinical scores of mice infected with influenza virus.
  • Figure 5c shows the results of measuring the survival rate to evaluate the protective effect of the BP26-M2e nano vaccine against influenza virus.
  • Figure 5d shows the weight loss measurement results to evaluate the protective effect of the BP26-M2e nano vaccine against influenza virus.
  • Figure 5e shows the results of clinical scoring to evaluate the protective effect of the BP26-M2e nano vaccine against influenza virus.
  • Figure 5f shows the results of rectal temperature measurement to evaluate the protective effect of the BP26-M2e nano vaccine against influenza virus.
  • Figure 5g shows residual lung virus titers of immunized mice measured 3 days after virus inoculation.
  • FIG. 6 is a diagram showing a protein complex prepared to confirm the use of BP26 as a cancer vaccine of the present invention.
  • FIG. 7 is a diagram showing an immunization schedule for evaluating the efficacy of the BP26-containing cancer vaccine of the present invention.
  • FIG. 9 is a diagram illustrating a gating strategy of flow cytometry of the present invention.
  • FIG. 10 is a diagram showing the % of CD4+ T cells secreting IFN- ⁇ after immunization with the cancer vaccine containing BP26 of the present invention.
  • % used to indicate the concentration of a specific substance is (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (volume/volume) %.
  • mice Female Balb/c mice were purchased from Orient Bio (Korea) and bred under pathogen-free conditions. Animal care and experimental procedures were approved by the Animal Experimental Ethics Committee of the Korea Advanced Institute of Science and Technology (KAIST) (Certification No.: KA2020-56). MDCK cells were cultured in MEM medium (Welgene, Gyeongsan, Korea) supplemented with 1% penicillin/streptomycin and heat-inactivated 10% fetal bovine serum (FBS; Welgene) at 5% CO 2 , 37 °C conditions. Influenza A virus A/PR/8, A/CA/04/09 and A/Aquatic bird/Korea were used.
  • MEM medium Welgene, Gyeongsan, Korea
  • FBS fetal bovine serum
  • Influenza A virus A/PR/8, A/CA/04/09 and A/Aquatic bird/Korea were used.
  • Example 1 Cloning, expression and purification of BP26-M2e recombinant protein
  • the BP26 sequence is as follows (Table 1).
  • Tandem repeats of the M2e(x4) sequence were synthesized using a gene synthesizer (Bioneer, Korea) and introduced into the pUC vector.
  • M2e repeats SLLTEVETPIRNEWGSRSNDSSD, SEQ ID NO: 3 were connected with an amino acid linker consisting of GGGSG.
  • the nucleotide sequence of M2e (x4) is as follows, and codon optimization was performed to maximize expression in the E. coli system, and BamHI and Xho I restriction sites were introduced at the N-terminus and C-terminus, respectively.
  • the BP26-M2e(x4) expression vector was constructed by subcloning into a modified pET28a vector containing an N-terminal His-tag and a His-tag followed by a tobacco etch virus (TEV) protease cleavage site, BP26-M2e
  • the expression vector for (x8) was constructed by injection cloning kit (Takara) according to the manufacturer's protocol.
  • the recombinant protein was expressed in BL21 (DE3) RIPL E. coli using 1 mM isopropyl ⁇ -D-1-thiogalactopyranoside (IPTG) at 18 °C for 16 hours and purified by Ni-NTA affinity chromatography (Qiagen).
  • the protein was further purified by Ni-NTA resin, HiTrap Q-SP cation exchange column and Superdex 200 26/60 size exclusion chromatography (GE Healthcare).
  • the expressed and purified recombinant protein was confirmed by SDS-PAGE.
  • M2e The major epitope of M2e is fused to the monomeric BP26 and self-assembles into an octamer, further assembled into a hexadecameric hollow barrel structure called a nanostructure, displaying the M2e antigen at the edge (Fig. One).
  • the 4 and 8 tandem repeat structures of M2e were genetically fused to the C-terminus of monomeric BP26 using a designated short flexible linker (GGGSG), and the fused proteins were BP26-M2e (x4) and BP26-M2e (x8), respectively. ) (Fig. 2a). Both fusion proteins were expressed in high yield in E. coli and confirmed by size exclusion chromatography (Fig. 2b). SDS-PAGE analysis revealed a clear difference in the molecular size of each protein (Fig. 2c).
  • BP26-M2e BP26-M2e
  • BP26-M2e BP26-M2e
  • TEM analysis of the self-assembled structure of the fusion protein showed that BP26-M2e (x4) and BP26-M2e (x8) formed distinct nanoparticles with an average diameter of 16.4 nm and 19.2 nm and contained a hollow hole in the center. was shown (Fig. 2d); The latter exhibited a smaller pore size than the former due to the larger M2e tandem repeat structure protruding around the pore.
  • M2e antigen does not interfere with the self-assembly of BP26, even though the M2e (x8) repeat structure ( ⁇ 23 kDa) is similar in size to the BP26 monomer ( ⁇ 28 kDa), and this property is a complex vaccine module design and expression It can alleviate the need for screening.
  • the hydrodynamic size of the nanostructure was determined by dynamic light scattering (DLS) at ambient temperature using a Zetasizer Nano range system (Malvern, Worcestershire, UK).
  • Hydrodynamic size is defined as "the size of an imaginary solid sphere that diffuses in the same way as the particle being measured” as measured by DLS.
  • the hydrodynamic size of the nanostructures measured by dynamic light scattering was measured to be 10.97 nm or less in the case of wild-type (WT) BP26, and 14.07 nm or less in the case of BP26-M2e(x4), and that of BP26-M2e(x8). In the case of 22.42 nm or less (Fig. 2e).
  • ELISA was performed to confirm the accessibility of the anti-M2e antibody to the M2e epitope on the surface of the BP26 nanostructure.
  • Various concentrations of BP26-WT, BP26-M2e(x4) and BP26-M2e(x8) (M2e concentration: 0.01-1000 pmol) were coated in 96-well plates overnight at 4°C. Plates were blocked with PBST buffer containing 2% bovine serum albumin (BSA) for 1 h at room temperature, followed by 2 h at room temperature with mouse anti-M2e IgG antibody (14C2 clone, 1:1000 dilution; Santa Cruz Biotechnology).
  • BSA bovine serum albumin
  • HRP horseradish peroxidase
  • anti-M2e antibody showed significantly higher reactivity to BP26-M2e (x8) than BP26-M2e (x4) (Fig. 2f), indicating that as the M2e tandem repeats increased, the indicated antigens were transferred to BCR in B cells. was recognized more efficiently, suggesting an increase in B cell response.
  • mice Six-week-old female Balb/c mice were immunized using a homologous prime-boost regimen. Mice were divided into 5 groups as follows; PBS buffered vehicle, (BP26-WT+M2e)/alum (BP26-WT: 20 ⁇ g; M2e: 7.3 ⁇ g), BP26-M2e(x4) (25 ⁇ g), BP26-M2e(x8) (18 ⁇ g), BP26 -M2e (x8)/alum (BP26-M2e: 18 ⁇ g). These were subcutaneously injected into the soles of both feet 3 times at 3-week intervals.
  • the dose is adjusted so that M2e is administered in an equimolar amount.
  • the antigen solution and 30% AlOH solution were mixed in equal amounts.
  • a 30% AlOH solution was prepared by diluting an Al 2 O 3 solution (Rehydragel HPA, Reheis, Berkeley Heights, NJ) with dH 2 O to adjust the pH to 7.
  • mice were divided into 5 treatment groups as described above and immunized 3 times at 3-week intervals.
  • blood from the back of the orbit was collected on days -1 (pre-immunization), 14, 35, and 56 (2 weeks after each immunization) and placed in a serum separator tube (BD). was isolated.
  • An ELISA assay was performed to determine the M2e specific antibody titers described above.
  • 96-well plates were coated with M2e antigen and incubated overnight at 4°C. Plates were washed and blocked with PBST containing 2% BSA for 1 h at room temperature, and then incubated with diluted serum samples for 2 h at room temperature. Plates were then washed and incubated with HRP-conjugated goat anti-mouse IgG, IgG1 or IgG2a (1:5000 dilution; Santa Cruz Biotechnology) as secondary antibodies for 1 h at room temperature.
  • the immunogenicity of the BP26-M2e nanostructures was evaluated after three immunizations at 3-week intervals via the subcutaneous route in Balb/c mice.
  • the titers of anti-M2e antibody were measured in sera collected on days 14, 35 and 56 ( FIG. 3A ).
  • BP26-M2e induced significantly greater IgG1 and IgG2a responses than BP26-M2e (x4) ( FIG. 3D ).
  • BP26 carrier 96-well plates were coated with BP26 protein and incubated overnight at 4°C. Plates were washed, blocked, and incubated with serum samples as described above. Plates were then washed and incubated with HRP-conjugated goat anti-mouse IgG (1:5000 dilution) as secondary antibody for 1 h at room temperature.
  • BP26 is the major immunodominant antigen of Brucella
  • antibodies specific for the BP26 carrier were generated in the immune group (Fig. 3e); However, this anti-BP26 antibody did not interfere with the M2e-specific antibody response and did not induce complications such as autoimmune responses in immunized animals.
  • Immunocytochemistry ICC
  • ELISA ELISA
  • Western blot were performed to determine whether the anti-M2e antibody of the immunized mouse serum could recognize influenza-infected cells expressing M2e on the plasma membrane (Fig. 4a). .
  • MDCK cells were seeded on coverslips of 24-well plates, grown to a density of 2 x 10 5 cells per well in 0.5 mL medium and allowed to attach overnight. MDCK cells in influenza A virus strain (A/PR/8, A/CA/04/09 or A/Aquatic bird/Korea) in influenza infection medium (DMEM medium supplemented with MEM-vitamin, gentamicin and 4% BSA) was infected and incubated for 20 hours. Cells were washed with PBS and fixed with 10% formalin solution for 10 min.
  • influenza A virus strain A/PR/8, A/CA/04/09 or A/Aquatic bird/Korea
  • influenza infection medium DMEM medium supplemented with MEM-vitamin, gentamicin and 4% BSA
  • M2e is a small, abundant protein and is embedded in the viral membrane, so the antiviral effect of anti-M2e antibodies directly prevents viral infection. Rather than neutralizing, it is known to be mediated by the induction of antibody dependent cellular cytotoxicity (ADCC) upon binding to the infected cell membrane. That is, the ability of anti-M2e antibody to bind to the plasma membrane of virus-infected cells is predicted to be directly related to protection from viral infection.
  • ADCC antibody dependent cellular cytotoxicity
  • the virus strain and M2e amino acid sequence used in the experiment are as follows (Table 2).
  • virus strain subtype M2e amino acid sequence SEQ ID NO: A/PR/8 H1N1 SLLTEVETPIRNEWGCRCNDGSD 4 A/CA/04/09 H1N1 SLLTEVETPTRNGWECKCSDSSD 5 A/Aquatic bird/Korea H5N2 SLLTEVETPTRSEWECRCSDSSD 6
  • HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution
  • the ELISA result showed that the serum anti-M2e antibody bound to MDCK cells infected with influenza virus regardless of the virus subtype, and showed little binding to uninfected MDCK cells (Fig. 4c). .
  • Virus-infected cells were harvested and lysed using a protein extraction solution (PRO-PREPTM, iNtRON Biotechnology) according to the manufacturer's instructions, followed by determination of protein concentration by Bradford assay. Proteins were separated by SDS-PAGE on a 20% gel and then transferred to a polyvinylidene difluoride (PVDF) membrane.
  • PVDF polyvinylidene difluoride
  • the membrane was blocked with 5% skim milk in TBS-T for 2 h at room temperature and incubated with sera containing immunized mice anti-M2e IgG antibody (1:200 dilution) at room temperature for 2 h. The membranes were then incubated with HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution) for 1 h at room temperature to reveal bands, using a ChemiDoc XRS imaging system (BIO-RAD, Hercules, CA). imaged.
  • mice were immunized in the same manner as in Example 3-1 as follows:
  • mice were divided into 5 groups as follows; PBS buffered vehicle, (BP26-WT + M2e)/alum (BP26-WT: 20 ⁇ g; M2e: 7.3 ⁇ g), BP26-M2e(x4) (25 ⁇ g), BP26-M2e(x8) (18 ⁇ g), BP26 -M2e(x8)/alum (BP26-M2e: 18 ⁇ g), injected subcutaneously into both paws 3 times at 3-week intervals.
  • mice Two weeks after the last immunization, mice were inoculated intranasally with 30 ⁇ L of PBS containing 4xLD 50 of A/PR/8 influenza virus ( FIG. 5A ).
  • the survival rate, body weight change, clinical score and rectal temperature of the mice were monitored daily for 16 days after virus inoculation. Mice that lost more than 25% of their initial body weight were humanely euthanized and included as the endpoint of the experiment.
  • Clinical scores were determined according to the criteria described in FIG. 5B . Since mice infected with influenza virus exhibit hypothermia unlike humans, rectal temperature was measured to measure body temperature.
  • mice infected with influenza virus showed a weight loss of 30% or more, a sharp increase in clinical score, and a decrease in rectal temperature within 10 days after virus inoculation.
  • the group treated with a physical mixture of BP26-WT and M2e together with alum adjuvant showed similar results to the PBS treatment group.
  • BP26-M2e(x8) showed only mild symptoms (slightly wrinkled hairs) with a significantly higher survival rate up to 80% and a much lower clinical score than BP26-M2e(x4) with shorter antigen repeats.
  • the group treated by adding alum adjuvant to the BP26-M2e(x8) nanostructure could protect mice from influenza virus infection (100% survival), and showed slight weight loss and rapid recovery (Figs. 5c to 5f). ).
  • lung virus titers were measured.
  • mice were divided into 5 groups as follows; PBS buffered vehicle, (BP26-WT + M2e)/alum (BP26-WT: 20 ⁇ g; M2e: 7.3 ⁇ g), BP26-M2e(x4) (25 ⁇ g), BP26-M2e(x8) (18 ⁇ g), BP26 -M2e(x8)/alum (BP26-M2e: 18 ⁇ g), injected subcutaneously into both paws 3 times at 3-week intervals.
  • mice Two weeks after the last immunization, mice were inoculated intranasally with 30 ⁇ L of PBS containing 4xLD 50 of A/PR/8 influenza virus. Three days after influenza virus inoculation, mice were euthanized and a lung homogenate was obtained. Lung virus titers were determined by 50% tissue culture dose (TCID 50 ) assay using MDCK cells.
  • BP26-M2e nano vaccine can generate strong protective immunity against influenza virus infection without the use of a conventional adjuvant, and that the protective efficacy can be adjusted by adjusting the length of the antigen.
  • the present applicant developed a universal vaccine platform for influenza virus infection based on a protein nanostructure formed by self-assembly of Brucella outer membrane protein BP26.
  • Genetic manipulation of BP26 allowed the generation of M2e-labeled barrel-shaped nanovaccines (BP26-M2e).
  • Immunity by BP26-M2e nanovaccine can induce high level of anti-M2e antibody production in mice, and these antibodies can specifically bind to influenza virus-infected cells, leading to influenza infection without the use of an adjuvant. to effectively protect the mouse from
  • the immune response of the BP26-M2e nanovaccine can be modulated by controlling the length of the tandem repeat structure of the M2e epitope.
  • BP26-based nanostructured vaccines can be designed to display relatively large antigens and multiple epitopes to optimize or maximize humoral responses to various viruses.
  • the BP26-based vaccine can be produced in high yield through simple expression in E. coli, so it has a high potential for commercialization for humans or animals.
  • the strong immune response induced by the present invention is due to the nanostructure formed by BP26. Since there is no limitation on the polypeptide fused to BP26 by the linker, the nanostructure of the present invention can induce immunity to various pathogens.
  • the unique function of the BP26-based nanostructure system which is a multi-purpose vaccine platform, is expected to enable rapid development of vaccines against various viruses and bacteria, including SARS-CoV2 and influenza virus.
  • the present inventors tried to prepare a cancer vaccine composition using a nanostructure containing BP26. Specifically, the present inventors prepared a protein complex having a structure as shown in FIG. 6 .
  • a fusion protein was designed that displays M30 (27 amino acids), an MHC class II neoantigen peptide of mouse melanoma cell line B16-F10, in 6 tandem repeats on the C-term side of the BP26 protein.
  • M30 peptide acts as an MHC class II epitope and can induce M30 antigen-specific CD4+ T cell response.
  • Example 8 Efficacy evaluation of BP26-comprising cancer vaccine
  • FIG. 7 is a diagram showing an immunization schedule for evaluating the efficacy of the BP26-containing cancer vaccine of the present invention.
  • the present inventors inoculated the cells through subcutaneous injection of B16-F10 cancer cells (day 0). Then, the cancer vaccine composition (BP26 and M30 tandem repeat fusion protein, BP26-M30) prepared in Example 8 of the present invention at intervals of 4 days from the 4th day after tumor cell inoculation was administered 46.8 ⁇ g/two times a total of 2 times ( Day 4, day 8) and immunization was performed by injection. Five days after the last immunization, the mice were sacrificed, the spleen was removed, and splenocytes were isolated.
  • the cancer vaccine composition BP26 and M30 tandem repeat fusion protein, BP26-M30
  • BP26-WT+M30 an aqueous mixture of BP26-WT (25.3 ⁇ g/head) and M30 peptide (20 ⁇ g/head) was mixed (BP26-WT+M30), and a mixture of the cancer vaccine of the present invention and a vaccine adjuvant, CpG ODN ( 46.8 ⁇ g/head of BP26-M30 + 10 ⁇ g/head of CpG) were administered, respectively.
  • the CpG ODN is an oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 15 (5'-TCC ATG ACG TTC CTG ACG TT-3') and having a phosphorothioate backbone, Genotech (Daejeon, Korea) was purchased from As a control group, PBS was administered (Control). In addition, the tumor volume was measured every 2 days after tumor cell inoculation until sacrifice.
  • FIG. 8 shows the volume of B16F10 tumor cells and shows the growth degree of the tumor cells.
  • BP26-M30 cancer vaccine composition
  • FIG. 8 shows the volume of B16F10 tumor cells and shows the growth degree of the tumor cells.
  • the present inventors tried to confirm whether the M30 antigen-specific T cell immune response was induced by checking the percent of CD4+ T cells secreting IFN- ⁇ . That is, it was attempted to confirm the immunogenicity of the cancer vaccine.
  • the isolated spleen cells were restimulated with M30 peptide (10 ⁇ g/ml) ex vivo for 1 hour, followed by CD4 + T cells.
  • INF- ⁇ produced by INF- ⁇ was quantified by intracellular cytokine staining (ICS).
  • GolgiStop TM or GolgiPlug TM was added to each tube to inhibit intracellular transport of cytokines.
  • Cells were incubated for 5 h, and apoptotic cells were distinguished by staining with the fixable viability dye eFluor450 (eBioscience, San Diego, CA, USA) for 20 min at 4 °C, followed by anti-CD3-PE/ Stained with Cy7 and anti-CD4-FITC antibody.
  • eFluor450 eBioscience, San Diego, CA, USA
  • FIG. 9 is a diagram illustrating a gating strategy for determining the ratio of CD4+ T cells secreting IFN- ⁇ through flow cytometry analysis of splenocytes.
  • FSC x SSC gating was used to obtain single cells based on size and granularity, and dead cells were excluded to analyze only live cells.
  • CD3, CD4 and CD8 were used as T cell markers. Finally, INF- ⁇ secretion from CD3+CD4+ T cells was confirmed.
  • FIG. 10 is a diagram showing the % of CD4+ T cells secreting IFN- ⁇ after immunization with the cancer vaccine containing BP26 of the present invention.
  • the BP26 platform of the present invention can effectively induce antigen-specific cellular immune responses when displaying cancer neoantigen peptide as well as M2e peptide of influenza virus. showed potential.
  • the present invention relates to a fusion protein comprising BP26 and an antigenic polypeptide.

Abstract

본 발명은 본 발명은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질 및 이를 포함하는 나노 구조체에 관한 것이다. 본 발명의 융합 단백질, 나노 구조체 또는 이들의 조합을 포함하는 백신 조성물을 이용하는 경우, 병원체 또는 암을 효과적으로 예방하거나 치료할 수 있어 다목적 백신 플랫폼으로 사용가능하다.

Description

BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질
본 발명은 대한민국 과학기술정보통신부의 지원 하에서 과제고유번호 1711074336, 과제번호 2018R1A3B1052661에 의해 이루어진 것으로서, 상기 과제의 연구관리 전문기관은 한국연구재단, 연구사업명은 "기초연구사업", 연구과제명은 "종양 미세환경 표적 및 감응형 정밀 바이오-나노메디신 연구단", 주관기관은 "한국과학기술원", 연구기간은 2018.06.01-2027.02.28 이다.
또한, 본 발명은 대한민국 과학기술정보통신부의 지원 하에서 과제고유번호 1711070719, 과제번호 2018M3A9B5023527에 의해 이루어진 것으로서, 상기 과제의 연구관리 전문기관은 한국연구재단, 연구사업명은 "원천기술개발사업", 연구과제명은 "종양 미세환경 표적 및 감응형 약물전달 플랫폼 기술 개발", 주관기관은 한국과학기술원, 연구기간은 2018.04.01-2020.12.31 이다.
본 특허출원은 2020년 10월 26일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2020-0139699 호에 대하여 우선권을 주장하며, 상기 특허출원의 개시사항은 본 명세서에 참조로서 삽입된다.
본 발명은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질에 관한 것이다.
다양한 나노물질은 항암 및 항바이러스 백신 개발을 위한 체액성 또는 세포성 면역을 유도하는 항원 전달 캐리어로 사용될 수 있다. 특히, 페리틴 및 열 쇼크 단백질 같은 자연적으로 발생하는 자가 조립 단백질 나노 구조체는 항원을 보유하거나 표시할 수 있고, 항원 전달 캐리어로 사용가능하다. 이러한 항원 표시, 자가 조립, 대칭적 구조, 및 나노 사이즈를 갖는 나노 구조체는 바이러스 유사 구조체(virus-like architecture)를 모방할 수 있지만, 면역을 활성화시키는 어주번트를 추가적으로 사용하지 않고는 항원 특이적 면역 반응을 유도하는데 효과적이지 않다. 그러나, 기존의 어주번트는 주사 부위의 염증과 부종, 전신 면역 독성 등 여러가지 부작용을 일으킬 수 있다.
본 발명자들은 어주번트 역할 및 캐리어 역할을 하는 자가 조립 단백질 나노 구조체를 개발하고자 예의 연구 노력하였다. 그 결과 브루셀라의 외막 단백질인 BP26이 자가 조립을 통해 나노 구조체를 형성하고 이들 나노 구조체가 항원을 효과적으로 전달할 수 있음을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질을 제공하는 것이다.
본 발명의 다른 목적은 상기 융합 단백질을 포함하는 나노 구조체를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 융합 단백질, 상기 나노 구조체, 또는 이들의 조합을 포함하는 백신 조성물을 제공하는 것이다.
본 발명의 일 양태에 따르면, 본 발명은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질를 제공한다.
본 명세서에서 용어 "BP26"은 브루셀라의 외막 단백질(outer membrane protein)을 의미하며, BP26/OMP28로도 지칭된다. BP26은 자가조립되는 특성이 있고, 주요한 면역우성 항원이므로, 항원 캐리어 및 어주번트 효과를 나타낸다.
본 발명의 일 구현예에 있어서, 상기 BP26은 서열번호 1의 아미노산 서열을 포함하는 것이나 이에 한정되는 것은 아니다.
본 명세서에서 용어 "아미노산(amino acid)"은 단백질 분자의 가장 기본적인 구성 단위를 의미한다. 아미노산의 구조를 보면 탄소 원자 1개에 아미노기(- NH2)와 카르복실기(-COOH)가 붙어 있으며 여기에 수소와 R기가 연결되어 있다.
본 발명의 일 구현예에 있어서, 상기 BP26은 서열번호 1의 아미노산 서열의 변이체를 포함하는 것이다.
예를 들면, 상기 BP26의 생물학적 특성을 개선시키기 위하여 폴리펩타이드의 아미노산 서열에 변화를 줄 수 있다. 이러한 변화는 예를 들어 폴리펩타이드의 아미노산 서열 잔기의 결실, 삽입 및/또는 치환을 포함한다.
상기 변이체는 원래의 폴리펩타이드와 "실질적 유사성"을 가지는 것으로, 2개의 폴리펩타이드 서열이 디폴트 갭 가중치를 사용하는 프로그램 GAP 또는 BESTFIT에 의해서와 같이 최적으로 정렬되는 경우에 적어도 약 90%의 서열 동일성, 더욱 바람직하게는 적어도 약 95%, 98% 또는 99%의 서열 동일성을 공유함을 의미한다.
바람직하게는, 동일하지 않은 아미노산 잔기의 위치는 보존적 아미노산 치환에 의해 상이하다. 상기 "보존적 아미노산 치환"은 아미노산 잔기가 유사한 화학적 특성(예: 전하 또는 소수성)을 갖는 측쇄(R 기)를 갖는 또 다른 아미노산 잔기에 의해 치환된 것이다. 일반적으로, 보존적 아미노산 치환은 단백질의 기능성을 실질적으로 변화시키지 않는다.
이러한 아미노산 변이는 아미노산 곁사슬 치환체의 상대적 유사성, 예컨대, 소수성, 친수성, 전하, 크기 등에 기초하여 이루어진다. 아미노산 곁사슬 치환체의 크기, 모양 및 종류에 대한 분석에 의하여, 아르기닌, 라이신과 히스티딘은 모두 양전하를 띤 잔기이고; 알라닌, 글라이신과 세린은 유사한 크기를 갖으며; 페닐알라닌, 트립토판과 타이로신은 유사한 모양을 갖는다는 것을 알 수 있다. 따라서, 이러한 고려 사항에 기초하여, 아르기닌, 라이신과 히스티딘; 알라닌, 글라이신과 세린; 그리고 페닐알라닌, 트립토판과 타이로신은 생물학적으로 기능 균등물이라 할 수 있다.
변이를 도입하는 데 있어서, 아미노산의 소수성 인덱스(hydropathic idex)가 고려될 수 있다. 각각의 아미노산은 소수성과 전하에 따라 소수성 인덱스가 부여되어 있다: 아이소루이신(+4.5); 발린(+4.2); 루이신(+3.8); 페닐알라닌(+2.8); 시스테인/시스타인(+2.5); 메티오닌(+1.9); 알라닌(+1.8); 글라이신(-0.4); 쓰레오닌(-0.7); 세린(-0.8); 트립토판(-0.9); 타이로신(-1.3); 프롤린(-1.6); 히스티딘(-3.2); 글루타메이트(-3.5); 글루타민(-3.5); 아스파르테이트(-3.5); 아스파라긴(-3.5); 라이신(-3.9); 및 아르기닌(-4.5).
단백질의 상호적인 생물학적 기능(interactive biological function)을 부여하는 데 있어서 소수성 아미노산 인덱스는 매우 중요하다. 유사한 소수성 인덱스를 가지는 아미노산으로 치환하여야 유사한 생물학적 활성을 보유할 수 있다는 것은 공지된 사실이다. 소수성 인덱스를 참조하여 변이를 도입시키는 경우, 바람직하게는 ± 2 이내, 보다 바람직하게는 ± 1 이내, 보다 더 바람직하게는 ± 0.5 이내의 소수성 인덱스 차이를 나타내는 아미노산 사이에서 치환을 한다.
한편, 유사한 친수성 값(hydrophilicity value)을 가지는 아미노산 사이의 치환이 균등한 생물학적 활성을 갖는 단백질을 초래한다는 것도 잘 알려져 있다. 미국 특허 제4,554,101호에 개시된 바와 같이, 다음의 친수성 값이 각각의 아미노산 잔기에 부여되어 있다: 아르기닌(+3.0); 라이신(+3.0); 아스팔테이트(+3.0± 1); 글루타메이트(+3.0± 1); 세린(+0.3); 아스파라긴(+0.2); 글루타민(+0.2); 글라이신(0); 쓰레오닌(-0.4); 프롤린(-0.5 ± 1); 알라닌(-0.5); 히스티딘(-0.5); 시스테인(-1.0); 메티오닌(-1.3); 발린(-1.5); 루이신(-1.8); 아이소루이신(-1.8); 타이로신(-2.3); 페닐알라닌(-2.5); 트립토판(-3.4).
친수성 값을 참조하여 변이를 도입시키는 경우, 바람직하게는 ± 2 이내, 보다 바람직하게는 ± 1 이내, 보다 더 바람직하게는 ± 0.5 이내의 친수성 값 차이를 나타내는 아미노산 사이에서 치환을 한다.
분자의 활성을 전체적으로 변경시키지 않는 단백질에서의 아미노산 교환은 당해 분야에 공지되어 있다(H. Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979). 가장 통상적으로 일어나는 교환은 아미노산 잔기 Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly 간의 교환이다.
본 발명의 일 구현예에 있어서, 본 발명의 BP26 폴리펩타이드는 서열번호 1의 아미노산 서열과 적어도 90%의 서열 상동성(예컨대 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97, 98%, 또는 99%)을 가지는 서열을 포함한다. 상기 90% 이상 100% 이하의 모든 정수 및 이 사이의 존재하는 소수는 % 상동성과 관련하여 본 발명의 범위 내에 포함된다.
본 발명의 일 구현예에 있어서, 상기 융합 단백질이 포함하는 상기 항원은 병원체 유래 항원, 또는 종양 유래 항원이다.
본 발명의 일 구현예에 있어서, 상기 융합 단백질은 상기 병원체 유래 항원 폴리펩타이드, 또는 종양 유래 항원 폴리펩타이드를 1개 이상 포함한다. 예컨대, 본원 실시예에서 본 발명의 융합 단백질은 인플루엔자 바이러스에서 유래한 M2e 폴리펩타이드를 4개, 또는 8개 포함하였고, 또는 종양 유래 항원인 M30 폴리 펩타이드를 6개 포함하였다.
보다 구체적으로 상기 융합 단백질은 상기 병원체 유래 항원 폴리펩타이드 또는 종양 유래 항원 폴리펩타이드를 1 내지 20개, 1 내지 18개, 1 내지 16개, 1 내지 14개, 1 내지 12개, 1 내지 10개, 1 내지 8개, 1 내지 6개, 1 내지 4개, 1 내지 2개, 2 내지 20개, 2 내지 18개, 2 내지 16개, 2 내지 14개, 2 내지 12개, 2 내지 10개, 2 내지 8개, 2 내지 6개, 2 내지 4개, 4 내지 20개, 4 내지 18개, 4 내지 16개, 4 내지 14개, 4 내지 12개, 4 내지 10개, 4 내지 8개, 또는 4 내지 6개 포함할 수 있으나, 이에 한정되는 것은 아니고, 면역반응을 일으키는데 충분한 개수를 선택할 수 있음은 당업자에게 자명할 것이다.
본 명세서 상의 용어 "병원체"는 숙주에 기생하여 병을 일으키는 미생물을 의미하며, 그 예시로 바이러스, 리케차, 세균, 진균, 원충 등이 존재한다.
본 명세서 상의 용어 "폴리펩타이드" 또는 "단백질"은 아미노산 잔기의 중합체를 지칭하기 위하여 본 명세서에 상호호환적으로 사용된다. 또한, 폴리펩타이드 및 단백질은 하나 이상의 아미노산 잔기가 상응하는 자연 발생 아미노산뿐 아니라 자연 발생 아미노산 중합체의 유사체 또는 모방체인 아미노산 중합체에 적용된다. 또한, 폴리펩타이드 및 단백질은 예를 들어, 탄수화물 잔기의 첨가에 의하여 당단백질을 형성하도록 변형되거나 인산화된 아미노산 중합체를 포함할 수 있다.
본 발명의 폴리펩타이드 또는 단백질은 당 업계에 공지된 합성 방법, 예를 들어 단백질을 발현하는 핵산분자를 포함하는 발현벡터를 숙주세포에 형질전환하여 재조합 단백질을 합성하거나, 고체상 합성 기술(solid-phase synthesis techniques)에 따라 제조될 수 있다(Merrifield, J. Amer. Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)).
본 발명의 병원체 유래 항원 폴리펩타이드는 항체 생산을 위한 항원으로서의 역할을 수행할 수 있으며, 병원체에서 유래되는 항원 폴리펩타이드라면 그 종류에 관계없이 다양하게 선택가능하다.
본 발명의 일 구현예에 있어서, 상기 병원체는 바이러스, 세균, 리케차, 진균, 원충으로 이루어지는 군으로부터 선택되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 바이러스는 HPV(Human papillomavirus), HBV(hepatitis B virus), HCV(hepatitis C virus), HIV(human immunodeficiency virus), MERS-CoV, SARS-CoV-2, 지카바이러스, HPV, 노로바이러스, 로타바이러스, 인플루엔자 바이러스, 파보 바이러스, 아데노바이러스, HSV(herpes simplex virus), 돼지 생식기 및 호흡기 증후군 바이러스(Porcine reproductive and respiratory syndrome virus, PRRSV), 돼지 열병 바이러스, 돼지써코바이러스(Porcine circovirus, PCV), 돼지유행성설사바이러스(Porcine epidemic diarrhea virus, PEDV), 구제역 바이러스, 뉴캐슬바이러스, 버나바이러스 또는 바이러스성 출혈성 패혈증 바이러스(viral hemorrhagic septicemia virus, VHSV)이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 세균은 에세리키아 콜라이 (Escherichia coli), 클로스트리디움 퍼프린젠스(Clostridium perfringens), 캠필로박터 피터스 제주니(Campylobacter fetus jejuni), 마이코박테리움 파라튜버쿨로시스(Mycobacterium paratuberculosis), 소결핵균(Mycobacterium bovis), 파상풍균(Clostridium tetani), 살모넬라 갈라나룸(Salmonella gallinarum), 황색포도상구균(Staphylococcus aureus), 마이코플라스마 갈리셉티쿰(Mycoplasma gallisepticum), 헤모필루스 파라스위스(Haemophilus parasuis), 로소니아 인트라셀룰라리스(Lawsonia intracellularis), 보데텔라 브론키셉티카(Bordetella bronchiseptica), 파스튜렐라 멀토시다(Pasteurella multocida) 또는 로도코커스 에퀴(Rhodococcus equi)이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 리케차는 리케차 리케치(Rickettsia rickettsia), 오리엔타 쯔쯔가무시(Orientia tsutsugamushi), 콕시엘라 부르네티(Coxiella burnetii), 발진티푸스 리케차(Rickettsia prowazekii) 또는 발진열 리케차(Rickettsia typhi)이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 진균은 칸디다(Candida spp.), 털곰팡이(Mucor spp.), 리조푸스(Rhizopus spp.), 또는 아스퍼길루스(Aspergillus spp.)이나, 이에 한정되는 것은 아니다.
상기 원충은 크립토스포르디움(cryptosporidium), 아이메리아(Eimeria), 트리파소마(trypanosoma), 플라스모디움(Plasmodium) 또는 톡소플라즈마(Toxoplasma)이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 병원체별 병원체에서 유래되는 항원 폴리펩타이드는 조류의 경우, 전염성 기관지염 바이러스(Infectious bursal disease virus, IBDV)의 VP2, VP3, VP4 단백질, 또는 이들의 조합; 전염성 후두기관지염 바이러스(Infectious laryngotracheitis virus, ILTV)의 당단백질 B, 당단백질 I, 당단백질 D, 당단백질 E, 당단백질 C, 또는 이들의 조합; 뉴캐슬병 바이러스의 융합단백질(NDV-F); 조류인플루엔자 바이러스의 HA (hemagglutinin), NA (neuraminidase), M2e 단백질, 또는 이들의 조합; 전염성 기관지염 바이러스(Infectious bronchitis virus, IBV)의 S1, S2 단백질, 또는 이들의 조합; 가금 티푸스(Salmonella gallinarum)의 OMP(outer membrane protein); 클로스트리디움 퍼프린젠스의 Net-B, PFO 단백질, 또는 이들의 조합 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 병원체별 병원체에서 유래되는 항원 폴리펩타이드는 돼지의 경우, 로타바이러스(rotavirus)의 VP2, VP4, VP6 단백질, 또는 이들의 조합; 구제역 바이러스(foot and mouth disease virus, FMDV)의 P1 단백질의 VP1, VP2, VP3, VP4 단백질, 또는 이들의 조합, 파보바이러스의 VP2 단백질; 돼지생식기호흡기증후군 바이러스(Porcine reproductive and respiratory syndrome virus, PRRSV)의 단백질 E, ORF3, 단백질 M, 또는 이들의 조합; 돼지 열병 바이러스(classical swine fever virus, CSFV)의 E1, E2, 또는 이들의 조합; 써코바이러스 타입 2(PCV2)의 캡시드 단백질; 대장균(Escherichia coli)의 k88, k99, 987p 단백질, 또는 이들의 조합; 파스튜렐라 멀토시다의 OMP H(outer membrane protein H) 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 개의 경우, 상기 병원체별 병원체에서 유래되는 항원 폴리펩타이드는 광견병 바이러스(rabies virus)의 당단백질 G, 뉴클레오단백질 N, 포스포단백질 P, 매트릭스 단백질 M, RNA 중합효소 L, 또는 이들의 조합; 개 디스템퍼 바이러스의 HA 단백질, F 단백질, 또는 이들의 조합 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 병원체 유래 항원 폴리펩타이드는 SARS-CoV 2에서 나타나는 spike protein의 RBD(receptor binding domain)인 것이다.
본 발명의 일 구현예에 있어서, 상기 병원체 유래 항원 폴리펩타이드는 M2e인 것이다.
M2e는 대부분의 인플루엔자 바이러스에서 발견되는 단백질로 matrix protein 2 ectodomain를 의미한다. M2e는 인플루엔자 바이러스에서 진화적으로 보존된 단백질이기 때문에 대부분의 인플루엔자 바이러스에 대한 보편적인 백신을 구축할 수 있는 유망한 후보이다.
본 발명의 일 구현예에 있어서, 상기 M2e는 서열번호 3, 4, 5, 또는 6의 아미노산 서열을 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 종양 유래항원은 종양-연관 항원(tumor-associated antigen, TAA) 및 종양-특이 항원(tumor-specific antigen, TSA)를 포함한다.
상기 종양-연관 항원(TAA)은 종양에서 비정상적으로 높게 과다발현되는 자가 항원이다. 자가 항원은 중앙 관용 및 주변 관용(central tolerance and peripheral tolerance) 기작을 통하여 이를 인지하는 T 세포들이 제거될 수 있다.
상기 종양-특이 항원(TSA)은 단백질의 아미노산을 변화시키는 돌연변이(nonsynonymous mutation)와 유전적 변형(genetic aleration)으로 인한 신항원(neoantigen) 및 바이러스의 암 발생 유전자 항원(oncoviral antigen)을 포함한다. 상기 신항원은 다시 공유된 신항원(shared neoantigen) 및 개인마다 상이한 신항원(private neoantigen)을 포함한다.
보다 구체적으로 상기 종양 유래 항원은 M30, MAGE-1, MAGE-2, MAGE-3, MAGE-12, BAGE, GAGE, NY-ESO-1, tyrosinase, TRP-1, TRP-2, gp100, MART-1, MCIR, Ig idotype, CDK4, Caspase-B, beta-catenin, CLA, BCR/ABL, mutated p21/ras, mutated p53, proteinase 3, WT1, MUC-1, Her2/neu, PAP, PSA, PSMA, G250, HPV E6/E7, EBV LMP2a, CEA, alpha-Fetoprotein, 5T4, onco-trophoblast glycoprotein 등으로 이루어진 군으로부터 선택되나, 이에 한정되는 것은 아니며, 당업자는 동 분야의 암백신에서 적용될 수 있는 다양한 항원이 적용될 수 있음을 쉽게 이해할 수 있을 것이다.
본 발명의 일 구현예에 있어서, 상기 M30은 서열번호 8의 아미노산 서열을 포함하는 것이다. 상기 M30은 또한 서열번호 9의 뉴클레오타이드 서열을 포함하는 핵산 분자에 의하여 인코딩된다.
본 발명의 일 구현예에 있어서, 상기 종양(또는 암)은 유방암, 두경부암, 방광암, 위암, 직/결장암, 췌장암, 폐암, 흑색종, 전립선암, 신장암, 간암, 담도암, 자궁경부암, 갑상선암 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 BP26 및 항원 폴리펩타이드는 직접적으로 연결되거나, 또는 링커(예컨대 아미노산 링커)를 통해 간접적으로 연결된다.
본 명세서 상의 용어 "링커"란, 2개의 단백질을 연결하여 융합 단백질을 만드는 경우 이들 단백질의 구조적 유연성을 증가시키거나 각 단백질의 활성이 증진될 수 있도록, 단백질과 단백질 사이에 삽입하는 펩타이드를 의미한다. 링커는 융합되는 각 단백질의 활성을 저해하지 않으면서 불필요한 면역반응을 일으키지 않는 것이라면 제한이 없으나, 구체적으로는 아미노산 1개 내지 20개, 보다 구체적으로 아미노산 1개 내지 6개로 구성되는 펩타이드 링커일 수 있다.
통상의 기술자라면, 융합 단백질의 제작 시 보통 융합하고자하는 기능적 일부분(moiety) 사이에 링커를 사용하는 것을 포함할 수 있으며, 서로 다른 특성을 가진 다른 종류의 링커, 예를 들어 유연성 아미노산 링커, 비유연성 링커 및 절단 가능한 아미노산 링커가 있다는 것을 알고 있을 것이다. 링커는 융합단백질의 발현량 증가, 생물학적 활성 향상, 타겟팅을 가능하게 하거나, 약동학을 변경시키기 위한 목적으로, 또는 융합단백질의 안정성을 증가시키고 폴딩을 향상시키기 위해 사용되어 왔다.
따라서 본 발명의 구체적인 구현예에 따르면, 상기 융합 단백질은 적어도 하나의 링커, 예컨대 유연성 아미노산 링커, 비유연성 링커 및 절단 가능한 아미노산 링커로부터 선택되는 적어도 하나의 링커를 포함할 수 있다.
상기 링커는 일반식 (GnSm)p 또는 (SmGn)p로 표시되는 아미노산 서열로 이루어질 수 있다:
여기에서 상기 n, m 및 p는 독립적으로,
n은 1 내지 7의 정수이고;
m은 0 내지 7의 정수이며;
n과 m의 합은 8이하의 정수이고; 및
p는 1 내지 7의 정수이다.
본 발명의 다른 구현예에 있어서, 상기 링커는 n = 1 내지 5이고, m = 0 내지 5이다. 또 다른 구현예의 경우, 상기 링커는 GGGGS이다. 또 다른 구체적인 구현예의 경우, 상기 링커는 GGGG, GGGSG이다.
본 발명의 또 다른 구현예에 있어서, 상기 링커는 VDGS 또는 ASGS 등이 될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 폴리펩타이드는 융합 단백질 내에 연속적 또는 비연속적으로 연결된 것이다.
본 발명은 융합 단백질의 항원 폴리펩타이드의 수를 조절하여 면역반응을 조절할 수 있으며, 본 발명의 실시예에 따르면, M2e 폴리펩타이드 8개 또는 M30 폴리펩타이드 6개가 연결된 융합 단백질은 우수한 면역유도 효과를 나타낸다.
본 명세서 상의 용어 "탠덤 반복 구조"란, 본 발명의 융합 단백질에 포함되는 항원 폴리펩타이드가 2 개 이상 연속적 또는 링커에 의해 비연속적으로 직렬로 연결된 구성을 의미한다.
본 발명의 실시예에 따르면, 본 발명의 BP26은 4개 또는 8개의 M2e가 링커에 의해 연결된 구성으로 융합 단백질을 형성하고 있으며, 상기 융합 단백질은 자가 조립되어 나노 구조체를 형성할 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 상기 융합 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는 핵산 분자를 제공한다.
본 명세서에서 용어 "핵산(nucleic acids)"은 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 가지며, 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드 뿐만 아니라, 당 또는 염기 부위가 변형된 유사체(analogue)도 포함한다(Scheit, Nucleotide Analogs, John Wiley, New York(1980); Uhlman 및 Peyman, Chemical Reviews, 90:543-584(1990)). 본 발명의 일 구현예에 있어서, 본 발명의 상기 융합 단백질을 인코딩하는 뉴클레오타이드 서열은, 상기 융합 단백질을 구성하는 아미노산 서열을 인코딩하는 뉴클레오타이드 서열인 것으로 족하며, 어느 특정 뉴클레오타이드 서열에 한정되지 않는다는 것은 당업자에게 자명하다. 이는 뉴클레오타이드 서열의 변이가 발생하더라도 변이된 뉴클레오타이드 서열을 단백질로 발현하면 단백질 서열에서 변화를 가져오지 않는 경우도 있기 때문이다. 이를 코돈의 축퇴성이라고 한다. 따라서 상기 뉴클레오타이드 서열은 기능적으로 균등한 코돈 또는 동일한 아미노산을 인코딩하는 코돈 (예를 들어, 코돈의 축퇴성에 의해, 아르기닌 또는 세린에 대한 코돈은 여섯 개이다), 또는 생물학적으로 균등한 아미노산을 인코딩하는 코돈을 포함하는 뉴클레오타이드 서열을 포함한다.
상술한 생물학적 균등 활성을 갖는 변이를 고려한다면, 상기 융합 단백질을 구성하는 아미노산 서열을 코딩하는 본 발명의 핵산 분자는 이와 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인(align)하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에,
적어도 60% 이상의 상동성(예컨대, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 또는 69%), 보다 바람직하게는 적어도 70% 이상의 상동성(예컨대, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 또는 79%), 보다 더 바람직하게는 적어도 80% 이상(예컨대, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 또는 89%)의 상동성, 가장 바람직하게는 90% 이상(예컨대, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 100%)의 상동성을 나타내는 서열을 의미한다. 상기 70% 이상 100% 이하의 모든 정수 및 이 사이의 소수는 % 상동성과 관련하여 본 발명의 범위 내에 포함된다.
서열비교를 위한 얼라인먼트(alignment) 방법은 당업계에 공지되어있다. 얼라인먼트에 대한 다양한 방법 및 알고리즘은 Smith and Waterman, Adv. Appl. Math. 2:482(1981); Needleman and Wunsch, J. Mol. Bio.48:443(1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31(1988); Higgins and Sharp, Gene 73:237-44(1988); Higgins and Sharp, CABIOS 5:151-3(1989); Corpet et al., Nuc. Acids Res. 16:10881-90(1988); Huang et al.,Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al., Meth. Mol. Biol.24:307-31(1994)에 개시되어 있지만, 이에 한정되는 것은 아니다.
NCBI Basic Local Alignment Search Tool(BLAST)(Altschul et al., J. Mol. Biol. 215:403-10(1990))은 NBCI(National Center for Biological Information) 등에서 접근 가능하며, 인터넷 상에서 blastp, blastn, blastx, tblastn 및 tblastx와 같은 서열 분석 프로그램과 연동되어 이용할 수 있다. BLAST는 ncbi 웹사이트의 BLAST 페이지를 통하여 접속 가능하다. 이 프로그램을 이용한 서열 상동성 비교 방법은 ncbi 웹사이트의 BLAST help 페이지에서 확인할 수 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 융합 단백질을 인코딩하는 핵산 분자를 포함하는 재조합 벡터를 제공한다.
본 명세서 상의 용어 "벡터"는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단으로 플라스미드 벡터; 코즈미드 벡터; 그리고 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터같은 바이러스 벡터 등을 포함한다.
본 발명의 일 구현예에 있어서, 본 발명의 벡터에서 상기 융합 단백질을 인코딩하는 핵산 분자는 상기 벡터의 프로모터와 작동적으로 결합(operatively linked)되어 있다.
본 명세서에서, 용어 "작동적으로 결합된"은 핵산 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다.
본 발명의 재조합 벡터 시스템은 당업계에 공지된 다양한 방법을 통해 구축될 수 있으며, 이에 대한 구체적인 방법은 Sambrook et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press(2001)에 개시되어 있으며, 이 문헌은 본 명세서에 참조로서 삽입된다.
본 발명의 벡터는 전형적으로 유전자 클로닝을 위한 벡터 또는 단백질의 발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다.
예를 들어, 본 발명의 벡터가 발현 벡터이고, 진핵 세포를 숙주로 하는 경우에는, 포유동물 세포의 지놈으로부터 유래된 프로모터(예: 메탈로티오닌 프로모터, β-액틴 프로모터, 사람 헤로글로빈 프로모터 및 사람 근육 크레아틴 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예: 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터, HSV의 tk 프로모터, 마우스 유방 종양 바이러스(MMTV) 프로모터, HIV의 LTR 프로모터, 몰로니 바이러스의 프로모터 엡스타인 바 바이러스(EBV)의 프로모터 및 로우스 사코마 바이러스(RSV)의 프로모터)가 이용될 수 있으며, 이들은 일반적으로 전사 종결 서열로서 폴리아데닐화 서열을 갖는다.
본 발명의 벡터는 그로부터 발현되는 폴리펩타이드 또는 단백질의 정제를 용이하게 하기 위하여, 다른 서열과 융합될 수도 있다. 융합되는 서열은 예컨대, 글루타티온 S-트랜스퍼라제(Pharmacia, USA), 말토스 결합 단백질(NEB, USA), FLAG(IBI, USA) 및 6x His(hexahistidine; Quiagen, USA) 등이 있다.
한편, 본 발명의 발현 벡터는 선택표지로서, 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함하며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 제네티신, 네오마이신 및 테트라사이클린에 대한 내성 유전자가 있다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 벡터를 포함하는 숙주세포를 제공한다.
본 발명의 벡터를 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주 세포는 당업계에 공지되어 있으며, 어떠한 숙주 세포도 이용할 수 있다.
예컨대, 상기 벡터의 적합한 진핵세포 숙주 세포는 원숭이 신장 세포7(COS7: monkey kidney cells), NSO 세포, SP2/0, 차이니즈 햄스터 난소(CHO: Chinese hamster ovary) 세포, W138, 어린 햄스터 신장(BHK: baby hamster kidney) 세포, MDCK, 골수종 세포주, HuT 78 세포 및 HEK-293 세포를 포함하나 이에 한정되지 않는다.
본 명세서에서 용어 "형질전환 된", "형질도입 된" 또는 "형질감염 된”은 외인성 핵산이 숙주세포 내로 전달되거나 도입되는 과정을 지칭한다. "형질전환 된”, "형질도입 된" 또는 "형질감염 된" 세포는 외인성 핵산으로 형질전환, 형질 도입 또는 형질감염된 세포이며, 상기 세포는 당해 세포 및 그의 계대 배양으로 인한 자손 세포를 포함한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 융합 단백질을 포함하는 나노 구조체를 제공한다.
본 발명의 일 구현예에 있어서, 상기 나노 구조체는 상기 융합 단백질을 2 이상 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 나노 구조체는 상기 융합 단백질 2개 내지 20개를 포함하는 것이다. 보다 구체적으로, 상기 나노 구조체는 상기 융합 단백질을 8개 또는 16개를 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 나노 구조체는 상기 융합 단백질 8개가 형성하는 팔량체 2개가 결합하여 형성되는 십육량체를 포함하는 것이다.
본 발명의 일 구현예에 있어서, 상기 나노 구조체는 중공형 구조를 포함하는 것이다. 중공형 구조란 구조체의 속이 빈 구조를 의미하며, 본 발명의 실시예에 따르면 본 발명의 나노 구조체는 속이 빈 배럴형 구조를 나타낸다.
본 발명의 실시예에 따르면, 상기 나노 구조체의 중공형 구조는 나노 구조체에 포함되는 융합 단백질이 항원 폴리펩타이드를 많이 포함할수록 구멍의 크기가 작게 나타난다.
본 발명의 일 구현예에 있어서, 상기 나노 구조체는 표면에 항원을 표시하는 것이다. 본 발명의 실시예에 따르면, 본 발명의 나노 구조체는 표면에 M2e 또는 M30 항원의 에피토프를 표시한다.
나노 구조체를 이루는 융합 단백질은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질과 동일하기 때문에, 명세서의 과도한 복잡성을 피하기 위해 중복되는 부분은 그 기재를 생략한다.
본 발명의 또 다른 양태에 따르면, 본 발명은 상기 융합 단백질, 상기 나노 구조체, 또는 이들의 조합을 포함하는 백신 조성물을 제공한다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 HPV(Human papillomavirus), HBV(hepatitis B virus), HCV(hepatitis C virus), HIV(human immunodeficiency virus), MERS-CoV, SARS-CoV-2, 지카바이러스, HPV, 노로바이러스, 로타바이러스, 인플루엔자 바이러스, HSV(herpes simplex virus), 돼지 생식기 및 호흡기 증후군 바이러스(PRRSV), 돼지 콜레라 바이러스, 돼지써코바이러스(PCV), 돼지설사바이러스(PEDV), 구제역 바이러스, 뉴캐슬바이러스 및 바이러스성 출혈성 패혈증 바이러스(VHSV)으로 이루어지는 군으로부터 선택되는 바이러스 예방용 백신 조성물인 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 전염성 병원체 감염증 예방용 백신 조성물이다.
본 발명의 구체적인 구현예에 있어서, 백신 조성물은 에세리키아 콜라이 (Escherichia coli), 클로스트리디움 퍼프린젠스(Clostridium perfringens), 캠필로박터 피터스 제주니(Campylobacter fetus jejuni), 마이코박테리움 파라튜버쿨로시스(Mycobacterium paratuberculosis), 소결핵균(Mycobacterium bovis), 파상풍균(Clostridium tetani), 살모넬라 갈라나룸(Salmonella gallinarum), 황색포도상구균(Staphylococcus aureus), 마이코플라스마 갈리셉티쿰(Mycoplasma gallisepticum), 헤모필루스 파라스위스(Haemophilus parasuis), 로소니아 인트라셀룰라리스(Lawsonia intracellularis), 보데텔라 브론키셉티카(Bordetella bronchiseptica), 파스튜렐라 멀토시다(Pasteurella multocida) 및 로도코커스 에퀴(Rhodococcus equi)으로 이루어지는 군으로부터 선택되는 세균 예방용 백신 조성물인 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 리케차 리케치(Rickettsia rickettsia), 오리엔타 쯔쯔가무시(Orientia tsutsugamushi), 콕시엘라 부르네티(Coxiella burnetii), 발진티푸스 리케차(Rickettsia prowazekii) 또는 발진열 리케차(Rickettsia typhi)으로 이루어지는 군으로부터 선택되는 리케차 예방용 백신 조성물인 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 칸디다(Candida spp.), 털곰팡이(Mucor spp.), 리조푸스(Rhizopus spp.) 및 아스퍼길루스(Aspergillus spp.)으로 이루어지는 군으로부터 선택되는 진균 예방용 백신 조성물인 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 크립토스포르디움(cryptosporidium), 아이메리아(Eimeria), 트리파소마(trypanosoma), 플라스모디움(Plasmodium) 및 톡소플라즈마(Toxoplasma)로 이루어지는 군으로부터 선택되는 원충 예방용 백신 조성물인 것이나, 이에 한정되는 것은 아니다.
본 발명의 실시예에 따르면, 상기 백신 조성물은 인플루엔자 바이러스 예방용 백신 조성물인 것이다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 암 백신용 백신 조성물이다.
본 발명의 암 백신은 이를 필요로 하는 포유류 또는 대상체의 암 또는 종양에 관하여 포유류에서 면역반응을 유발하기 위하여 사용될 수 있다. 유발된 면역 반응은 암 또는 종양 성장을 예방 또는 치료할 수 있다.
유발된 면역 반응은 암 또는 종양 세포의 전이를 예방 및/또는 감소시킬 수 있다.
백신에서 사용되는 항원에 따라서, 상기 암은 유방암, 두경부암, 방광암, 위암, 직/결장암, 췌장암, 폐암, 흑색종, 전립선암, 신장암, 피부암, 간암, 담도암, 자궁경부암, 갑상선암, 혈액암(예컨대, 백혈병, 림프종, 골수종) 등을 포함하나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 투여된 백신은 (1) 단핵구 화학유인성 단백질-1 (MCP-1) 생성을 차단하여 골수 유래 억제자 세포 (MDSC)를 지연시키고 종양 성장을 억제하는 B 세포 반응을 통한 체액성 면역을 유도; (2) 종양 세포를 공격하고 사멸시키는 CD8+ (CTL)와 같은 세포독성 T 림프구를 증가; (3) 보조 T 세포 반응을 증가시키는 것; 및 (4) IFN-γ 및 TFN-α을 통하여, 바람직하게는 상기 언급된 모든 것을 통하여 염증성 반응을 증가시키는 것에 의하여 종양 세포의 제거를 매개하거나 이의 성장을 억제할 수 있다.
일부 구현예에서, 면역 반응은 백신이 투여된 대상체에서 다양한 조직 또는 계통 (예컨대, 뇌 또는 신경계, 등)에 대한 손상 또는 이의 염증을 야기하지 않는 체액성 면역 반응 및/또는 항원-특이적 세포독성 T 림프구 (CTL) 반응을 야기할 수 있다.
본 발명의 일 구현예에 있어서, 상기 조성물은 어주번트를 추가적으로 포함하는 것이다.
본 명세서의 용어 "어주번트"란 면역반응을 높이기 위한 첨가물질을 의미하며, 일반적으로 항체 생산과 면역의 강화를 위해 항원과 함께 사용되는 것이다. 구체적으로 상기 어주번트는 알룸(alum), 프로인트 완전 어주번트, 프로인트 불완전 어주번트, LPS, poly IC, poly AU, 리소레시틴, 플루론 폴리올, 다중음이온, 오일 또는 탄화수소 에멀전, 키홀림펫 헤모시아닌, 디니트로페놀으로 이루어지는 군으로부터 선택되는 것이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 어주번트는 면역 자극성 단일사슬 또는 이중사슬 올리고뉴클레오타이드, 면역자극성 저분자 화합물, 또는 이들의 조합이다.
본 발명의 일 구현예에 있어서, 상기 면역 자극성 단일사슬 또는 이중사슬 올리고뉴클레오타이드는 유용한 어주번트(면역보조제)로서 알려져 있다. 이들은 종종 CpG 모티프(구아노신에 연결된 메틸화되어 있지 않은 시토신을 포함한 디뉴클레오타이드 서열)를 포함한다. TpG 모티프, 회문(palindrome) 배열, 복수의 연속한 티미딘 뉴클레오타이드(예를 들면 TTTT), 복수의 연속한 시토신 뉴클레오타이드(예를 들면 CCCC) 또는 폴리(dG) 배열을 포함한 올리고뉴클레오타이 드도 또한 이중가닥 RNA와 같이 공지의 어주번트이다. 다양한 면역 자극성 올리고뉴클레오타이드 중 하나를 본 발명과 함께 제한 없이 사용할 수 있다.
상기 올리고뉴클레오타이드는 대표적으로는 10~100 뉴클레오타이드, 예를 들면 15~50 뉴클레오타이드, 20~30 뉴클레오타이드 또는 25~28뉴클레오타이드를 가진다. 그것은 대표적으로는 단일사슬이다.
상기 올리고뉴클레오타이드는 오로지 천연의 뉴클레오타이드, 오로지 비천연의 뉴클레오타이드, 또는 그 양쪽 모두의 혼합물을 포함할 수 있다. 예를 들면 상기 올리고뉴클레오타이드는 하나 이상의 포스포로티오에이트 결합을 포함하고, 및/또는 하나 이상의 2'-O-메틸 변경이 될 수 있다.
본 발명의 구체적인 구현예에 있어서, 상기 단일사슬 또는 이중사슬 올리고뉴클레오타이드는 CpG 올리고뉴클레오타이드, STING 활성 올리고뉴클레오타이드, 또는 이들의 조합이다.
본 명세서에서 용어 "Stimulator of Interferon Genes (STING)"은 선천성 면역 반응에서 주요한 역할을 수행하는 분자인 인터페론 유전자의 자극인자(STING)를 의미한다. STING은 주로 소포체(endoplasmic reticulum, ER) 내에 존재하는 5개의 추정적인 막관통(TM) 영역을 포함하며, I 형 IFG을 유도하고, 발현 후 강력한 항 바이러스 상태를 발휘하는 NF-kB 및 IRF3 전사 경로를 활성화할 수 있다 (미국 특허 출원 일련번호 제13/057,662호 및 PCT/US2009/052767 참조). STING의 소실은 폴리IC가 I형 IFN을 활성화시키는 능력을 감소시키고, 표적화된 상동 재조합에 의해 생성된 STING이 결여되고, 수포성 구내염 바이러스(vesicular stomatitis virus, VSV) 감염에 걸리기 쉬운 마우스 배아 섬유아세포(-/- MEF)를 제공한다. STING의 부재시, DNA-매개 I형 IFN 반응은 저해되며, 이는 STING이 바이러스, 박테리아 및 세포를 감염시킬 수 있는 다른 병원균들로부터 DNA를 인식하는데 중요한 역할을 수행할 수 있다는 것을 나타낸다. 효모 이중 혼성화 및 공동면역침전 연구는 STING이 RIG-I 및 Ssr2/TRAPβ(번역 후 ER 막을 가로지르는 단백질 이동에 요구되는 트랜스로콘-결합 단백질(transloconassociated protein, TRAP) 복합체의 구성원)와 상호작용한다는 것을 나타내었다. TRAPβ의 RNAi 제거는 STING 기능을 저해하고, 폴리IC에 반응한 I형 IFN의 생성을 방해하였다. 추가의 실험은 STING 자체가, 예를 들면 병원균 또는 세포사멸성 DNA로부터의 단일 및 이중 가닥 DNA를 포함하는 핵산에 결합하고, DNA 매개 관절염 및 암과 같은 염증성 병태에서의 전염증성 유전자 발현을 조절하는 데 중심적 역할을 수행한다는 것을 보여주었다. STING 발현 또는 기능을 상향조절하는 다양한 새로운 방법 및 STING 발현 또는 기능을 상향조절하기 위한 다양한 새로운 조성물들이 STING과 상호작용하는 다른 세포성 분자들의 추가적인 특성분석과 함께 본원에 기술된다. 이러한 발견은 면역계 및 다른 시스템들을 조절하기 위한 새로운 어주번트, 백신 및 치료요법을 설계할 수 있게 한다.
상기 STING 활성 올리고뉴클레오타이드는 STING 기능을 STING에 결합하는 핵산 분자일 수 있다. STING-결합 핵산 분자는 길이가 40 내지 150 염기쌍인 단일 가닥 DNA 또는 길이가 40 내지 150, 60 내지 120, 80 내지 100 또는 85 내지 95 염기쌍 이상의 이중 가닥 DNA일 수 있다. STING결합 핵산 분자는, 예컨대, 뉴클레아제 저항성 뉴클레오티드로 제조된 뉴클레아제 저항성일 수 있다. STING-결 합 핵산 분자는, 또한, 막관통 수송을 촉진하는 분자와 결합할 수 있다. 이러한 방법에서, 질환 또는 장애는 DNA-의존성 염증성 질환일 수 있다. 또한, 염증성 면역 세포가 침투된 암성 종양을 가지는 대상체에서 암을 치료하는 방법이 본원에 기술된다. 이러한 방법은 STING의 기능 또는 발현을 하향조절하는 제제 및 약학적으로 허용가능한 담체를 포함하는 약학적 조성물의 임의의 양을 대상체에 투여하는 단계를 포함할 수 있다.
보다 구체적으로 상기 올리고뉴클레오타이드는 안티센스 올리고뉴클레오타이드, CpG 올리고뉴클레오타이드, 또는 이들의 조합이다.
본 명세서에서 용어, CpG 올리고뉴클레오타이드(CpG oligodeoxynucleotide, 또는 CpG oligodeoxynucleotide, CpG ODN)는 메틸화되지 않은 시토신 트리포스페이트 디옥시뉴클레오타이드("C")와 구아닌 트리포스페이트 디옥시뉴클레오타이드("G")를 포함하는 짧은 단일-가닥 합성 DNA 분자로서, 면역자극제(immunostimulant)로 알려져 있다. 상기 CpG는 본 발명의 나노 백신의 구성성분으로 포함되는 경우 수지상 세포의 면역반응을 강화하는 어주번트로서의 역할을 수행한다.
상기 면역자극성 저분자 화합물은 저분자 어주번트(small molecule adjuvant)라고도 불리우고, 합성 저분자 어주번트와 천연 저분자 어주번트가 있다. 상기 면역자극성 저분자 화합물 또는 저분자 어주번트의 예로는 monophosphoryl lipid A, Muramyl dipeptide, Bryostatin-1, Mannide monooleate (Montanide ISA 720), Squalene, QS21, Bis-(3′,5′)-cyclic dimeric guanosine monophosphate, PAM2CSK4, PAM3CSK4, Imiquimod, Resiquimod, Gardiquimod, cl075, cl097, Levamisole, 48/80, Bupivacaine, Isatoribine, Bestatin, Sm360320, 및 Loxoribine 등이 있으나, 이에 제한되는 것은 아니다. 저분자 어주번트에 대해서는 Flower DR et al. (Expert Opin Drug Discov. 2012 Sep;7(9):807-17.)에 기술되어 있다.
본 발명의 백신 조성물은 추가로 약제학적으로 허용가능한 담체, 부형제, 또는 희석제를 포함할 수 있다.
본 명세서에서 용어 "약제학적으로 허용되는"은 조성, 제형, 안전성, 환자 허용성 및 생물 이용성에 대해 약리학적/독성학적 관점으로부터 환자에게 허용되고 물리적/화학적 관점으로부터 조제 약제사에 대해 허용되는 특성들 및/또는 물질을 언급한다. "약제학적으로 허용되는 담체"는 활성 성분(들)의 생물학적 활성의 효과를 방해하지 않는 매질을 언급하며, 투여시 숙주에 무독성이다. 상기 백신에 적합한 담체는 기술분야의 당업자에게 공지되어 있으며, 단백질, 설탕 등을 포함하지만, 이로 한정되는 것은 아니다. 상기의 담체는 수용액 또는 비-수용액, 현탁액, 및 에멀전일 수 있다. 비-수용액 담체는 프로필렌 글리콜, 폴리 에틸렌 글리콜, 식용유 예컨대 올리브 오일, 및 주사 가능한 유기 에스테르 예컨대 에틸 올레이트를 포함한다. 수용액 담체는 식염수 및 완충배지를 포함하는, 물, 알콜/수용액, 에멀전 또는 현탁액을 포함한다.
본 발명의 백신 조성물의 적합한 투여량은 개체의 종, 개체의 품종, 제제화 방법, 투여 방식, 개체의 연령, 체중, 성, 백신 접종력, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
예를 들어, 본 발명의 백신 조성물의 투여량은 0.1 ml 내지 10 ml 일 수 있다. 본 발명의 백신 조성물의 투여량은 조류 종에서 0.1 ml 내지 0.5 ml, 보다 구체적으로는 0.3 ml 내지 0.5 ml 일 수 있다. 본 발명의 백신 조성물의 투여량은 고양이, 개 및 말 종에서, 0.2 ml 내지 3.0 ml, 보다 구체적으로는 0.3 ml 내지 2.0 ml, 가장 구체적으로는 0.5 ml 내지 1.0 ml 일 수 있다. 본 발명의 백신 조성물의 투여량은 소 및 돼지 종에 대해서는, 0.2 ml 내지 5.0 ml, 보다 구체적으로는 0.3 ml 내지 3.0 ml, 보다 구체적으로는 0.5 ml 내지 2.0 ml 일 수 있다.
또한, 백신 조성물 투여량 내의 항원의 양은 1 내지 100 μg, 5 내지 50 μg, 5 내지 30 μg, 5 내지 25 μg, 10 내지 50 μg, 10 내지 40 μg, 10 내지 30 μg, 10 내지 25 μg 일 수 있다. 본 발명의 실시예에 따르면, 백신 조성물 투여량 내의 항원의 양은 10 내지 30 μg 이다.
본 발명의 적용 대상체는 모든 동물일 수 있으며, 구체적으로 포유동물, 예를 들어 사람, 마우스, 래트, 햄스터, 기니아 피그, 토끼, 고양이, 개, 원숭이, 소, 말, 돼지와; 조류, 예를 들어 닭, 오리, 칠면조 등을 포함하는 가축이다. 가장 바람직한 대상체는 가축 또는 사람이다.
백신 조성물은 당해 기술 분야에서 적합한 임의의 수단에 따라 동결-건조되거나 액체 제제로서 제형화 될 수 있다. 액체 형태의 제제의 비제한적 예는 용액, 현탁물, 시럽, 슬러리 및 에멀젼을 포함한다. 적합한 액체 담체는 모든 적합한 유기 또는 무기 용매, 예를 들어 물, 알콜, 식염수, 완충된 식염수, 생리 식염수, 덱스트로즈 용액, 물 프로필렌 글리콜 용액 등을 포함하며, 바람직하게는 멸균 형태로 존재한다.
백신 조성물은 중성 또는 염 형태로 제형화 될 수 있다. 약제학적으로 허용되는 염은 산부가염 (활성 폴리펩타이드의 유리 아미노 그룹과 함께 형성됨)을 포함하며, 이는 무기산, 예를 들어 염산 또는 인산, 또는 유기산, 예를 들어 아세트산, 옥살산, 타르타르산, 만델산 등과 함께 형성된다. 또한, 유리 카복실 그룹으로부터 형성되는 염은 무기 염기, 예를 들어 나트륨, 칼륨, 암모늄, 칼슘 또는 제2철 수산화물, 및 유기 염기, 예를 들어 이소프로필아민, 트리메틸아민, 2-에틸아미노 에탄올, 히스티딘, 프로카인 등으로부터 유도될 수 있다.
백신 조성물은 바람직하게는 대상체에게 접종 또는 주사하기 위해 제형화된다. 주사를 위해, 본 발명의 백신 조성물은 수성 용액, 예를 들어 물 또는 알콜 중에 또는 생리학적으로 적합한 완충액, 예를 들어 행크스 (Hanks) 용액, 링거 (Ringer) 용액 또는 생리학적 식염 완충액 중에 제형화 될 수 있다. 용액은 제형화제, 예를 들어 현탁제, 보존제, 안정화제 및/또는 분산제를 포함할 수 있다. 또한, 주사 제형은, 예를 들어 사용하기 전에 적합한 비히클, 예를 들어 멸균수, 식염수 또는 알콜로 재구성함으로써, 사용 직전에 주사에 적합한 액체 형 태 제제로 전환되는 고체 형태 제제로 제조될 수 있다.
또한, 백신 조성물은 지연 방출 비히클 또는 데포 (depot) 제제로 제형화될 수 있다. 이러한 장기간 작용 제형은 접종 또는 이식 (예를 들어 피하 또는 근육내)에 의하거나 주사에 의해 투여될 수 있다. 따라서, 예를 들어, 백신 조성물은 적합한 중합체성 또는 소수성 물질 (예를 들어, 허용되는 오일 중의 에멀젼으로서) 또는 이온 교환 수지와 함께, 또는 난용성 유도체, 예를 들어 난용성 염으로서 제형화될 수 있다. 리포좀 및 에멀젼은 담체로서 사용하기에 적합한 전달 비히클로서 널리 알려진 예이다.
백신 조성물은 주입 또는 주사 (예: 정맥내, 근육내, 피내, 피하, 경막내, 십이지장내, 복강내 등)에 의해 투여될 수 있다. 또한, 백신 조성물은 비내, 질, 직장, 경구, 또는 경피로 투여될 수 있다. 추가로, 백신 조성물 은 "바늘-없는" 전달 시스템에 의해 투여될 수 있다. 바람직하게는, 조성물은 피내 주사에 의해 투여된다. 투여는 의사 또는 의료 보조원의 지시에 따를 수 있다.
주사는 수회 주사로 나뉠 수 있으며, 이러한 분할 접종은 바람직하게는 실질적으로 동시에 투여된다. 분할 접종으로 투여되는 경우, 면역원의 용량은 바람직하게는, 반드시 필수적이지는 않지만, 각각의 분리된 주사시 동등하게 할당된다. 애주번트가 백신 조성물에 존재하는 경우, 애주번트의 용량은 바람직하게는, 반드시 필수적이지는 않지만, 각각의 분리된 주사시 동등하게 할당된다. 분할 접종을 위한 분리된 주사는 일부 양상으로 환자의 신체에서 실질적으로 서로 인접하게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 1 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 2.5 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 5 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 10 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 10 cm 초과로, 예를 들어 적어도 약 12.5, 15, 17.5, 20 cm 또는 그 이상으로 떨어지게 투여된다. 일차 예방접종 주사 및 부스터 주사는 본원에서 기술되고 예시되는 바와 같이 분할 접종으로 투여될 수 있다.
다양한 대안적 약제학적 전달 시스템이 이용될 수 있다. 이러한 시스템의 비제한적 예는 리포좀 및 에멀젼을 포함한다. 특정 유기 용매, 예를 들어 디메틸설폭사이드가 또한 사용될 수 있다. 추가로, 백신 조성물은 지연 방출 시스템, 예를 들어 치료제를 포함하는 고형 중합체의 반투과성 매트릭스를 사용하여 전달될 수 있다. 이 용가능한 다양한 지연 방출 물질이 당업자에게 널리 알려져 있다. 지연 방출 캡슐은, 이들의 화학적 특성에 따 라, 수일 내지 수주 내지 수개월의 범위에 걸쳐 백신 조성물을 방출할 수 있다.
암 완화 상태에 있는 환자에서 암의 재발을 예방하기 위해서, 치료학적 유효량의 백신 조성물이 대상체에게 투여된다. 치료학적 유효량은, 당해 기술 분야에서 적합한 임의의 수단에 의해 측정시, 환자에서 종양 유래 항원-특이적 세포독성 T-림프구 (CD8+) 수의 임상적으로 유의한 증가 및 항원에 대한 세포독성 T-림프구 반응의 임상적으로 유의한 증가를 제공할 것이다. 대체로 환자에서, 치료학적 유효량의 백신 조성물은 남아있는 미세한 질환을 파괴하여 환자에서 암의 재발 위험을 유의하게 감소 또는 제거시킬 것이다.
백신 조성물의 유효량은, 이로 제한됨이 없이, 인종, 품종, 치수, 신장, 체중, 연령, 환자의 전체적 건 강 상태, 제형의 유형, 투여 방식 또는 방법, 또는 암이 환자에서 재발할 가능성을 상당히 증가시키는 위험 인자의 존재 또는 부재를 포함하여 많은 변수에 의존적일 수 있다. 이러한 위험 인자는, 이로 제한됨이 없이, 수술 유형, 림프절의 상태 및 양성의 수, 종양의 크기, 종양의 조직학적 등급, 호르몬 수용체 (에스트로겐 및 프로게스테론 수용체)의 존재/부재, HER2/neu 발현, 림프혈관 침윤 및 유전적 소인 (BRCA 1 및 2 등)를 포함한다. 일부 바람직한 양태에서, 유효량은 환자가 림프절 양성 또는 림프절 음성인지의 여부에 의존적이며, 환자가 림프절 양성인 경우 양성 림프절의 수 및 정도에 의존적이다. 모든 경우에서, 적합한 유효량은 일반적으로 통상적인 최적화 기술 및 전문가의 능숙하고 정통한 판단 및 당업자에게 분명한 기타 인자들을 이용하여 당업자에 의해 결정될 수 있다. 바람직하게는, 본원에 기술되는 치료학적 유효량의 백신 조성물은 대상체에게 실질적인 독성을 일으키지 않으면서 치료학적 이점을 제공할 것이다.
백신 조성물의 독성 및 치료 효율은, 예를 들어 LD50 (집단의 50%에 치명적인 용량) 및 ED50 (집단의 50%에 치료학적으로 효과적인 용량)을 측정하기 위한, 세포 배양물 또는 실험 동물에서 표준 약제학적 절차에 의해 측정 될 수 있다. 독성과 치료 효과 사이의 용량 비율이 치료 지수이며, 이는 LD50/ED50의 비율로 표현될 수 있다. 큰 치료 지수를 나타내는 백신 조성물이 바람직하다. 세포 배양 검정 및 동물 연구로부터 얻어지는 자료는 환자에서 사용하기 위한 일정 범위의 용량을 제형화 하는데 이용될 수 있다. 이러한 백신 조성물의 용량은 바람직 하게는 독성이 매우 적거나 없는 ED50을 포함하는 일정 범위의 순환 농도 내에 속한다. 용량은 사용되는 용량 형태 및 이용되는 투여 경로에 따라 이러한 범위 내에서 다양할 수 있다.
독성 정보는 특정 대상체, 예를 들어 사람에서 유용한 용량을 보다 정확히 결정하는데 이용될 수 있다. 치료의 는 독성 또는 기관 기능이상 때문에 투여를 끝내거나 중단하거나 조절할 수 있으며, 임상 반응이 반응을 개선시키는데 적합하지 않은 경우 필요에 따라 처리를 조절할 수 있다. 재발 암의 예방에 있어 투여 용량의 크기는 다른 요인들 중에서 환자 상태의 중증도, 재발에 대한 상대적 위험 또는 투여 경로에 따라 다양할 것이다. 환자 상태의 중증도는, 예를 들어 부분적으로 표준 예후적 평가 방법에 의해 평가될 수 있다.
백신 조성물은 암의 재발에 대해 보호 면역을 유도 및/또는 지지하기 위하여, 세포독성 T 림프구 반응을 유도 및/또는 지지하기 위하여 적합한 임의의 스케줄로 환자에게 투여될 수 있다. 예를 들어, 일차 예방접종으로서 본원에서 기술되고 예시되는 바와 같은 백신 조성물을 환자에게 투여한 후, 보호 면역을 지지 및/또는 유지하기 위해 부스터를 투여할 수 있다. 일부 양상에서, 백신 조성물은 1개월 당 1회, 2회 또는 그 이상의 횟수로 환자에게 투여될 수 있다.
일차 예방접종 및 부스터 접종을 포함한 백신 투여 스케줄은, 환자에게 필요한 한, 환자의 수명을 연장하기 위해, 예를 들어 수년의 과정에 걸쳐 계속될 수 있다. 일부 양상으로, 백신 스케줄은 백신 요법의 시작시에 보다 빈번한 투여를 포함하며, 보호 면역을 유지하기 위한 시간 동안은 보다 덜 빈번한 투여 (예: 부스터)를 포함한다.
백신 조성물은 백신 요법의 시작시에는 보다 저용량이 투여되고, 시간이 지남에 따라 보다 고용량이 투여될 수 있다. 또한, 백신은 백신 요법의 시작시에는 보다 고용량이 투여되고, 시간이 지남에 따라 보다 저용량이 투여될 수 있다.
일차 백신 및 부스터 투여의 횟수 및 투여되는 항원의 용량은, 당해 기술 분야에서 적합한 임의의 수단에 따라 담당 의사에 의해 결정되는 바와 같이, 개개 환자의 특정 요구를 만족시키도록 맞춰지고/지거나 조절될 수 있다.
본 발명의 일 양태에 따른 백신 조성물은 상술한 융합 단백질, 또는 나노 구조체를 공통적으로 포함하는 조성물로서, 명세서의 복잡성을 피하기 위하여 중복되는 범위 내에서는 그 기재를 생략한다. 백신 조성물은 주입 또는 주사 (예: 정맥내, 근육내, 피내, 피하, 경막내, 십이지장내, 복강내 등)에 의해 투여될 수 있다. 또한, 백신 조성물은 비내, 질, 직장, 경구, 또는 경피로 투여될 수 있다. 추가로, 백신 조성물 은 "바늘-없는" 전달 시스템에 의해 투여될 수 있다. 바람직하게는, 조성물은 피내 주사에 의해 투여된다. 투여는 의사 또는 의료 보조원의 지시에 따를 수 있다.
주사는 수회 주사로 나뉠 수 있으며, 이러한 분할 접종은 바람직하게는 실질적으로 동시에 투여된다. 분할 접종으로 투여되는 경우, 면역원의 용량은 바람직하게는, 반드시 필수적이지는 않지만, 각각의 분리된 주사시 동등하게 할당된다. 애주번트가 백신 조성물에 존재하는 경우, 애주번트의 용량은 바람직하게는, 반드시 필수적이지는 않지만, 각각의 분리된 주사시 동등하게 할당된다. 분할 접종을 위한 분리된 주사는 일부 양상으로 환자의 신체에서 실질적으로 서로 인접하게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 1 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 2.5 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 5 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 적어도 약 10 cm 떨어지게 투여된다. 일부 양상으로, 주사는 신체에서 서로 10 cm 초과로, 예를 들어 적어도 약 12.5, 15, 17.5, 20 cm 또는 그 이상으로 떨어지게 투여된다. 일차 예방접종 주사 및 부스터 주사는 본원에서 기술되고 예시되는 바와 같이 분할 접종으로 투여될 수 있다.
다양한 대안적 약제학적 전달 시스템이 이용될 수 있다. 이러한 시스템의 비제한적 예는 리포좀 및 에멀젼을 포함한다. 특정 유기 용매, 예를 들어 디메틸설폭사이드가 또한 사용될 수 있다. 추가로, 백신 조성물은 지연 방출 시스템, 예를 들어 치료제를 포함하는 고형 중합체의 반투과성 매트릭스를 사용하여 전달될 수 있다. 이 용가능한 다양한 지연 방출 물질이 당업자에게 널리 알려져 있다. 지연 방출 캡슐은, 이들의 화학적 특성에 따 라, 수일 내지 수주 내지 수개월의 범위에 걸쳐 백신 조성물을 방출할 수 있다.
암 완화 상태에 있는 환자에서 암의 재발을 예방하기 위해서, 치료학적 유효량의 백신 조성물이 대상체에 게 투여된다. 치료학적 유효량은, 당해 기술 분야에서 적합한 임의의 수단에 의해 측정시, 환자에서 종양 연관 항원-특이 적 세포독성 T-림프구 (CD8+) 수의 임상적으로 유의한 증가 및 항원에 대한 세포독성 T-림프구 반응의 임상적으 로 유의한 증가를 제공할 것이다. 대체로 환자에서, 치료학적 유효량의 백신 조성물은 남아있는 미세한 질환을 파괴하여 환자에서 암의 재발 위험을 유의하게 감소 또는 제거시킬 것이다.
백신 조성물의 유효량은, 이로 제한됨이 없이, 인종, 품종, 치수, 신장, 체중, 연령, 환자의 전체적 건 강 상태, 제형의 유형, 투여 방식 또는 방법, 또는 암이 환자에서 재발할 가능성을 상당히 증가시키는 위험 인자의 존재 또는 부재를 포함하여 많은 변수에 의존적일 수 있다. 이러한 위험 인자는, 이로 제한됨이 없이, 수술 유형, 림프절의 상태 및 양성의 수, 종양의 크기, 종양의 조직학적 등급, 호르몬 수용체 (에스트로겐 및 프로게스테론 수용체)의 존재/부재, HER2/neu 발현, 림프혈관 침윤 및 유전적 소인 (BRCA 1 및 2 등)를 포함한다. 일부 바람직한 양태에서, 유효량은 환자가 림프절 양성 또는 림프절 음성인지의 여부에 의존적이며, 환자가 림프절 양성인 경우 양성 림프절의 수 및 정도에 의존적이다. 모든 경우에서, 적합한 유효량은 일반적으로 통상적인 최적화 기술 및 전문가의 능숙하고 정통한 판단 및 당업자에게 분명한 기타 인자들을 이용하여 당업자에 의해 결정될 수 있다. 바람직하게는, 본원에 기술되는 치료학적 유효량의 백신 조성물은 대상체에게 실질적인 독성을 일으키지 않으면서 치료학적 이점을 제공할 것이다.
백신 조성물의 독성 및 치료 효율은, 예를 들어 LD50 (집단의 50%에 치명적인 용량) 및 ED50 (집단의 50%에 치료학적으로 효과적인 용량)을 측정하기 위한, 세포 배양물 또는 실험 동물에서 표준 약제학적 절차에 의해 측정 될 수 있다. 독성과 치료 효과 사이의 용량 비율이 치료 지수이며, 이는 LD50/ED50의 비율로 표현될 수 있다. 큰 치료 지수를 나타내는 백신 조성물이 바람직하다. 세포 배양 검정 및 동물 연구로부터 얻어지는 자료는 환자에서 사용하기 위한 일정 범위의 용량을 제형화 하는데 이용될 수 있다. 이러한 백신 조성물의 용량은 바람직 하게는 독성이 매우 적거나 없는 ED50을 포함하는 일정 범위의 순환 농도 내에 속한다. 용량은 사용되는 용량 형태 및 이용되는 투여 경로에 따라 이러한 범위 내에서 다양할 수 있다.
독성 정보는 특정 대상체, 예를 들어 사람에서 유용한 용량을 보다 정확히 결정하는데 이용될 수 있다. 치료의 는 독성 또는 기관 기능이상 때문에 투여를 끝내거나 중단하거나 조절할 수 있으며, 임상 반응이 반응을 개선시키는데 적합하지 않은 경우 필요에 따라 처리를 조절할 수 있다. 재발 암의 예방에 있어 투여 용량의 크기 는 다른 요인들 중에서 환자 상태의 중증도, 재발에 대한 상대적 위험 또는 투여 경로에 따라 다양할 것이다. 환자 상태의 중증도는, 예를 들어 부분적으로 표준 예후적 평가 방법에 의해 평가될 수 있다.
백신 조성물은 암의 재발에 대해 보호 면역을 유도 및/또는 지지하기 위하여, 세포독성 T 림프구 반응을 유도 및/또는 지지하기 위하여 적합한 임의의 스케줄로 환자에게 투여될 수 있다. 예를 들어, 일차 예방접종으로서 본원에서 기술되고 예시되는 바와 같은 백신 조성물을 환자에게 투여한 후, 보호 면역을 지지 및/또는 유지하기 위해 부스터를 투여할 수 있다. 일부 양상에서, 백신 조성물은 1개월 당 1회, 2회 또는 그 이상의 횟수로 환자에게 투여될 수 있다.
일차 예방접종 및 부스터 접종을 포함한 백신 투여 스케줄은, 환자에게 필요한 한, 환자의 수명을 연장하기 위해, 예를 들어 수년의 과정에 걸쳐 계속될 수 있다. 일부 양상으로, 백신 스케줄은 백신 요법의 시작시에 보다 빈번한 투여를 포함하며, 보호 면역을 유지하기 위한 시간 동안은 보다 덜 빈번한 투여 (예: 부스터)를 포함한다.
백신 조성물은 백신 요법의 시작시에는 보다 저용량이 투여되고, 시간이 지남에 따라 보다 고용량이 투여될 수 있다. 또한, 백신은 백신 요법의 시작시에는 보다 고용량이 투여되고, 시간이 지남에 따라 보다 저용량이 투여될 수 있다.
일차 백신 및 부스터 투여의 횟수 및 투여되는 항원의 용량은, 당해 기술 분야에서 적합한 임의의 수단에 따라 담당 의사에 의해 결정되는 바와 같이, 개개 환자의 특정 요구를 만족시키도록 맞춰지고/지거나 조절될 수 있다.
본 발명의 일 양태에 따른 백신 조성물은 상술한 융합 단백질 또는 나노구조체를 공통적으로 포함하는 조성물로서, 명세서의 복잡성을 피하기 위하여 중복되는 범위 내에서는 그 기재를 생략한다.
본 발명의 일 구현예에 있어서, 상기 백신 조성물은 암의 예방 또는 치료용이다. 상기 백신 조성물이 암 예방 또는 치료용인 경우에는 유효성분인 융합 단백질 또는 나노 구조체의 항원은 종양 유래 항원이다.
본 명세서에서 용어, "예방"은 방사선학적 또는 신체 조사의 결과를 포함하여 임의의 객관적 또는 주관적 변수로 측정시, 임상적 완화 상태의 환자에서 암의 재발 (recurrence/relapse)을 미리 막는데 있어서의 모든 성공 또는 성공의 징후를 언급한다.
백신 조성물에 포함되는 융합 단백질, 나노 구조체는 상술한 융합 단백질, 나노 구조체와 동일하기 때문에, 명세서의 과도한 복잡성을 피하기 위해 중복되는 부분은 그 기재를 생략한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 백신 조성물을 대상체에 투여하는 단계를 포함하는, 전염성 질병 또는 암의 예방 또는 치료방법을 제공한다.
본 발명의 적용 대상체는 모든 동물일 수 있으며, 구체적으로 포유동물, 예를 들어 사람, 마우스, 래트, 햄스터, 기니아 피그, 토끼, 고양이, 개, 원숭이, 소, 말, 돼지와; 조류, 예를 들어 닭, 오리, 칠면조 등을 포함하는 가축이다. 가장 바람직한 대상체는 가축 또는 사람이다.
본 발명의 일 양태에 따른 전염성 질병 또는 암의 예방 또는 치료방법은 상술한 백신 조성물을 대상체에 투여하는 단계를 포함하므로, 명세서의 복잡성을 피하기 위하여 중복되는 범위 내에서는 그 기재를 생략한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질을 제공한다.
(b) 본 발명은 상기 융합 단백질을 포함하는 나노 구조체를 제공한다.
(c) 본 발명의 상기 융합 단백질, 상기 나노 구조체, 또는 이들이 조합을 포함하는 백신 조성물를 이용하는 경우, 병원체 또는 암을 효과적으로 예방 또는 치료할 수 있어 다목적 백신 플랫폼으로 사용가능하다.
도 1은 인플루엔자 M2e 에피토프를 표시하는 BP26 기반 나노 구조체를 나타낸다.
도 2a는 BP26 및 M2e를 포함하는 융합 단백질을 나타낸다.
도 2b는 BP26-M2e(x4) 및 BP26-M2e(x8)의 발현을 크기 배제 크로마토그래피로 확인한 결과를 나타낸다.
도 2c는 BP26-WT, BP26-M2e(x4) 및 BP26-M2e(x8)의 발현을 SDS-PAGE로 확인한 결과를 나타낸다.
도 2d는 BP26-M2e(x4) 및 BP26-M2e(x8)의 투과 전자 현미경(transmission electron microscopy, TEM) 이미지로 확인한 결과를 나타낸다(스케일 바 = 100 nm).
도 2e는 동적 광 산란(dynamic light scattering, DLS)에 의해 측정된 나노 구조체의 하이드로다이나믹 직경을 나타낸다. .
도 2f는 BP26 나노 구조체의 표면에 표시된 M2e 에피토프의 다중 탠덤(tandem) 반복 구조에 대한 항-M2e 항체의 접근성 및 반응성을 확인하기위한 ELISA 분석 결과를 나타낸다.
도 3a는 나노 구조체에 의한 마우스의 항체 생성 확인을 위한 실험 방법을 나타낸다.
도 3b는 ELISA를 통해 측정된 나노 구조체로 면역화 후 혈청에서의 항-M2e 항체 역가를 측정한 결과를 나타낸다.
도 3c는 ELISA를 통해 측정된 면역화된 마우스(14 일, 35 일, 56 일)의 혈청 내 항-M2e IgG의 역가를 나타낸다.
도 3d는 ELISA를 통해 측정된 면역화 된 마우스(56 일)의 혈청 내 M2e 특이적 IgG1 및 IgG2a의 역가를 나타낸다.
도 3e는 ELISA를 통해 측정된 면역화된 마우스(56 일)의 혈청 내 항-BP26 IgG의 역가를 나타낸다.
도 4a는 인플루엔자 바이러스 감염 세포의 M2e에 대한 항-M2e 항체 결합을 나타낸다.
도 4b는 항-M2e 항체의 인플루엔자 바이러스 감염 MDCK 세포에 대한 결합 능력을 공 초점 레이저 스캐닝 현미경으로 관찰한 결과를 나타낸다(스케일 바 = 100 μm.).
도 4c는 Whole-cell ELISA로 측정한 항-M2e 항체의 인플루엔자 바이러스 감염 MDCK 세포에 대한 결합 능력을 평가한 결과를 나타낸다.
도 4d는 웨스턴 블롯으로 측정한 항-M2e 항체의 인플루엔자 바이러스 감염 MDCK 세포에 대한 결합 능력을 평가한 결과를 나타낸다.
도 5a는 BP26-M2e 나노 백신의 인플루엔자 바이러스에 대한 보호 효과를 평가하기위한 Balb/c 마우스의 면역화 일정을 나타낸다.
도 5b는 인플루엔자 바이러스에 감염된 마우스의 임상 점수를 나타낸다.
도 5c는 BP26-M2e 나노 백신의 인플루엔자 바이러스에 대한 보호 효과를 평가하기위한 생존율 측정 결과를 나타낸다.
도 5d는 BP26-M2e 나노 백신의 인플루엔자 바이러스에 대한 보호 효과를 평가하기위한 체중 감소 측정 결과를 나타낸다.
도 5e는 BP26-M2e 나노 백신의 인플루엔자 바이러스에 대한 보호 효과를 평가하기위한 임상 점수 측정 결과를 나타낸다.
도 5f는 BP26-M2e 나노 백신의 인플루엔자 바이러스에 대한 보호 효과를 평가하기위한 직장 온도 측정 결과를 나타낸다.
도 5g는 바이러스 접종 후 3일 후에 측정한 면역화된 마우스의 잔류 폐 바이러스 역가를 나타낸다.
도 6은 본 발명의 BP26의 암 백신 용도를 확인하기 위하여 제작한 단백질 복합체를 나타낸 도이다.
도 7은 본 발명의 BP26 포함 암 백신의 효능을 평가하기 위한 면역 스케쥴을 나타낸 도이다.
도 8은 B16F10 종양 세포의 부피를 나타낸 것으로 종양세포의 성장 정도를 나타낸다.
도 9는 본 발명의 flow cytometry의 gating strategy를 나타내는 도이다.
도 10은 본 발명의 BP26 포함 암백신으로 면역화한 후 IFN-γ를 분비하는 CD4+ T cell %를 나타낸 도이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.
동물, 세포, 바이러스
암컷 Balb/c 마우스는 오리엔트 바이오(한국)에서 구입하여 pathogen-free 조건에서 사육하였다. 동물 관리 및 실험 절차는 한국과학기술원 (KAIST) 동물실험윤리위원회의 승인을 받았다(인증 번호: KA2020-56). MDCK 세포는 1% 페니실린/스트렙토마이신, 열로 불활성화된 10% 소태아혈청(FBS; Welgene)으로 보충된 MEM 배지(Welgene, 경산, 대한민국)에서 5 % CO2, 37 ℃ 조건으로 배양하였다. 인플루엔자 A 바이러스는 A/PR/8, A/CA/04/09 및 A/Aquatic bird/Korea을 사용하였다.
실시예 1: BP26-M2e 재조합 단백질의 클로닝, 발현 및 정제
BP26 서열은 다음과 같다 (표1).
구분 서열 SEQ ID NO.
BP26 QENQMTTQPARIAVTGEGMMTASPDMAILNLSVLRQAKTAREAMTANNEAMTKVLDAMKKAGIEDRDLQTGGIDIQPIYVYPDDKNNLKEPTITGYSVSTSLTVRVRELANVGKILDESVTLGVNQGGDLNLVNDNPSAVINEARKRAVANAIAKAKTLADAAGVGLGRVVEISELSRPPMPMPIARGQFRTMLAAAPDNSVPIAAGENSYNVSVNVVFEIK SEQ ID NO: 1
His tag 및 TEV cleavage site가 추가된 BP26(클로닝에 사용된 서열) MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSENLYFQGSQENQMTTQPARIAVTGEGMMTASPDMAILNLSVLRQAKTAREAMTANNEAMTKVLDAMKKAGIEDRDLQTGGIDIQPIYVYPDDKNNLKEPTITGYSVSTSLTVRVRELANVGKILDESVTLGVNQGGDLNLVNDNPSAVINEARKRAVANAIAKAKTLADAAGVGLGRVVEISELSRPPMPMPIARGQFRTMLAAAPDNSVPIAAGENSYNVSVNVVFEIK SEQ ID NO: 2
M2e(x4) 서열의 탠덤(tandem) 반복은 유전자 합성기(Bioneer, Korea)로 합성하였고, pUC 벡터에 도입하였다. 4개의 M2e 반복(SLLTEVETPIRNEWGSRSNDSSD, 서열번호 3)을 GGGSG로 이루어진 아미노산 링커로 연결하였다. M2e(x4)의 염기 서열은 다음과 같으며 E.coli 시스템에서 발현을 극대화하기 위해 코돈 최적화하였고, BamH I과 Xho I제한 부위는 각각 N-말단과 C-말단에 도입하였다.
M2e의 염기서열(서열번호 7):
AGCCTGCTGACCGAAGTCGAGACTCCGATCCGTAATGAATGGGGCTCTCGTTCTAACGACTCGTCGGAT
BP26-M2e(x4) 발현 벡터는 N-말단 His-태그 및 His 태그뒤의 담배 식각 바이러스 (tobacco etch virus, TEV) 프로테아제 절단 부위를 포함하는 변형된 pET28a 벡터에 서브 클로닝하여 구축하였고, BP26-M2e(x8)에 대한 발현 벡터는 제조업체의 프로토콜에 따라 주입 클로닝 키트(Takara)에 의해 구축하였다. 재조합단백질은 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG)를 사용하여 18 ℃에서 16 시간 동안 BL21 (DE3) RIPL E. coli에서 발현되었고 Ni-NTA 친화성 크로마토 그래피(Qiagen)로 정제하였다. TEV 프로테아제로 N-말단 His-태그를 절단 한 후, 단백질을 Ni-NTA 수지, HiTrap Q-SP 양이온 교환 컬럼 및 Superdex 200 26/60 크기 배제 크로마토그래피(GE Healthcare)로 추가로 정제하였다.
발현 및 정제된 재조합 단백질은 SDS-PAGE로 확인하였다.
M2e의 주요 에피토프는 단량체(monomeric) BP26에 융합되어 팔량체(octamer)로 자가 조립되고, 추가로 나노 구조체라고하는 16량체(hexadecameric) 중공 배럴형 구조로 조립되며 가장자리에 M2e 항원을 표시한다 (도 1).
M2e의 4 개 및 8 개의 탠덤 반복 구조는 지정된 짧은 flexible 링커(GGGSG)를 사용하여 단량체 BP26의 C-말단에 유전적으로 융합되었으며, 융합된 단백질을 각각 BP26-M2e(x4) 및 BP26-M2e(x8)로 지칭하였다 (도 2a). 두 융합 단백질 모두 E. coli에서 높은 수율로 발현되었고 크기 배제 크로마토그래피로 확인하였다 (도 2b). SDS-PAGE 분석은 각 단백질의 분자 크기에서 명확한 차이를 나타내었다 (도 2c).
실시예 2: BP26-M2e 나노 구조체의 특성 확인
2-1. 투과전자현미경으로 평가한 BP26-M2e(x4) 및 BP26-M2e(x8)의 형태
BP26-M2e(x4) 및 BP26-M2e(x8)의 형태는 네거티브 염색 투과전자현미경(TEM)으로 평가하였다.
융합 단백질의 자가 조립 구조에 대한 TEM 분석 결과는 BP26-M2e(x4) 및 BP26-M2e(x8)가 평균 직경이 16.4 nm 및 19.2 nm 인 별개의 나노 입자를 형성하고 중앙에 중공 구멍을 포함하는 점을 나타내었다 (도 2d); 후자는 구멍 주위로 돌출된 더 큰 M2e 탠덤 반복 구조로 인해 전자보다 작은 구멍 크기를 나타내었다. 이는 M2e(x8) 반복구조(~23 kDa)가 BP26 단량체(~28 kDa)와 크기가 유사하더라도 M2e 항원이 BP26의 자가 조립 과정을 방해하지 않는 것을 시사하며, 이러한 특성은 복잡한 백신 모듈 설계 및 발현 스크리닝의 필요성을 완화 할 수 있다.
2-2. 나노 구조체의 하이드로다이나믹(hydrodynamic) 크기
나노 구조체의 하이드로다이나믹 크기는 주위 온도에서 Zetasizer Nano range system (Malvern, Worcestershire, UK)을 사용하여 동적광산란(dynamic light scattering, DLS)으로 결정하였다.
하이드로다이나믹 크기(hydrodynamic size)는 DLS에 의해 측정된 "측정중인 입자와 동일한 방식으로 확산되는 가상의 단단한 구체의 크기"로 정의한다.
동적광산란으로 측정한 나노 구조체의 하이드로다이나믹 크기는 와일드-타입(WT) BP26의 경우 10.97 nm 이하로 측정되었고, BP26-M2e(x4)의 경우 14.07 nm 이하로 측정되었고, BP26-M2e(x8)의 경우 22.42 nm 이하로 측정되었다(도 2e).
2-3. BP26 나노 구조체 표면의 M2e 에피토프에 대한 항 M2e 항체의 접근성
BP26 나노 구조체 표면의 M2e 에피토프에 대한 항 M2e 항체의 접근성을 확인하기 위해 ELISA를 수행하였다. 다양한 농도의 BP26-WT, BP26-M2e(x4) 및 BP26-M2e(x8) (M2e 농도: 0.01-1000 pmol)를 4 ℃에서 오버나잇으로 96-웰 플레이트에 코팅하였다. 플레이트를 2 % 소 혈청 알부민(BSA)을 포함하는 PBST 버퍼로 실온에서 1 시간 동안 블록한 다음, 마우스 항-M2e IgG 항체(14C2 클론, 1:1000 희석; Santa Cruz Biotechnology)와 함께 실온에서 2 시간 동안 배양하였다. 이어서 플레이트를 세척하고 horseradish peroxidase(HRP)-접합 염소 항-마우스 IgG 항체(1:5000 희석; Santa Cruz Biotechnology)와 함께 실온에서 1 시간 동안 배양 한 다음, TMB 기질 용액을 각 웰에 첨가하여 결과를 확인하였다. 흡광도는 마이크로 플레이트 리더(VERASmaxTM, Molecular Devices)에서 450 nm로 측정하였다.
ELISA 결과, 항-M2e 항체가 BP26-M2e(x8)에 대해 BP26-M2e(x4)보다 훨씬 더 높은 반응성을 보였으며(도 2f), 이는 M2e 탠덤 반복이 증가함에 따라 표시된 항원이 B 세포에서 BCR에 의해 더 효율적으로 인식되어 B 세포 반응이 증가하는 것을 시사한다.
실시예 3: 나노 구조체에 의한 마우스의 항체 생성 확인
3-1. 나노 구조체를 이용한 마우스의 면역화
6 주령 암컷 Balb/c 마우스를 homologous prime-boost 요법을 사용하여 면역화하였다. 마우스를 다음과 같이 5개의 군으로 분류하였다; PBS 완충 비히클, (BP26-WT+M2e)/알룸(BP26-WT: 20 μg; M2e: 7.3 μg), BP26-M2e(x4) (25 μg), BP26-M2e(x8)(18 μg), BP26-M2e(x8)/알룸(BP26-M2e: 18 μg). 이들을 3주 간격으로 3회 양쪽 발바닥에 피하 주사하였다.
상기 용량은 M2e가 등몰량으로 투여되도록 용량을 조절한 것이다. 알룸이 포함된 군은 항원 용액과 30% AlOH 용액을 동량으로 혼합하였다. 30 % AlOH 용액은 Al2O3 용액(Rehydragel HPA, Reheis, Berkeley Heights, NJ)을 dH2O로 희석하여 pH 7로 조정하여 제조하였다.
3-2. ELISA 분석을 통한 M2e 항체 생성의 확인
마우스를 전술한 바와 같이 5 개의 처리군으로 나누고 3 주 간격으로 3 회 면역화하였다. 체액성 면역 반응을 결정하기 위해 안와 뒤에서 얻은 혈액을 -1 일 (면역 전), 14 일, 35 일 및 56 일(각 면역화 후 2주)에 수집하여 혈청 분리기 튜브(BD)에 투입한 후 혈청을 분리하였다. ELISA 분석을 수행하여 상술한 M2e 특이적 항체 역가를 결정하였다.
96-웰 플레이트를 M2e 항원으로 코팅하고 4 ℃에서 오버나잇 배양하였다. 플레이트를 세척하고 2 % BSA를 포함하는 PBST로 실온에서 1 시간 동안 블록한 다음, 실온에서 2 시간 동안 희석된 혈청 샘플과 함께 배양하였다. 이어서 플레이트를 세척하고 실온에서 1 시간 동안 2 차 항체로서 HRP-접합 염소 항-마우스 IgG, IgG1 또는 IgG2a (1:5000 희석; Santa Cruz Biotechnology)와 함께 플레이트를 배양하였다.
BP26-M2e 나노 구조체의 면역원성은 Balb/c 마우스에서 피하 경로를 통해 3 주 간격으로 3 회 면역 후 평가하였다. 항-M2e 항체의 역가는 14, 35 및 56 일에 수집된 혈청에서 측정하였다(도 3a).
M2e와 BP26-WT의 물리적 혼합물은 면역수에 관계없이, 심지어 알룸(alum) 어주번트의 사용에도 불구하고 검출 가능한 항체 생산을 유도하지 않았다.
대조적으로, BP26-M2e 나노 구조체를 사용한 면역화는 항-M2e IgG 항체의 생산을 유도했으며 항체 역가는 다중 부스팅 면역화 후 100 배 이상 증가하였다. 또한, BP26-M2e(x8)-면역 군은 BP26-M2e(x4)-면역 군보다 항-M2e IgG 역가가 더 높았다. 더 나아가, 나노 구조체 기반 면역은 그 자체로 높은 수준의 항체를 생산할 수 있지만, 알룸(alum) 어주번트를 추가로 사용하면 효율성이 더 향상될 수 있었다 (도 3b 및 도 3c).
또한, M2e 특이적 항체 반응을 IgG1 및 IgG2a isotype 수준으로 분석한 결과, BP26-M2e(x8)는 BP26-M2e(x4)보다 유의미하게 큰 IgG1 및 IgG2a 반응을 유도하였다(도 3d).
3-3. ELISA 분석을 통한 BP26 항체 생성의 확인
BP26 담체의 면역원성을 평가하기 위해 96-웰 플레이트를 BP26 단백질로 코팅하고 4 ℃에서 오버나잇 배양하였다. 상기 기재된 바와 같이 플레이트를 세척하고, 블록하고, 혈청 샘플과 함께 배양하였다. 이어서 플레이트를 세척하고 실온에서 1 시간 동안 2 차 항체로서 HRP-접합 염소 항-마우스 IgG(1:5000 희석)와 함께 플레이트를 배양하였다.
BP26이 브루셀라의 주요 면역우세 항원이기 때문에, BP26 캐리어에 특이적인 항체가 면역군에서 생성되었다 (도 3e); 그러나 이 항-BP26 항체는 M2e 특이적 항체 반응을 방해하지 않으며 면역화된 동물에서 자가면역 반응과 같은 합병증을 유발하지 않았다.
상기 결과는 M2e 항원과 BP26의 유전적 융합 및 이의 자체 조립된 나노 구조체가 인플루엔자 바이러스의 M2e에 대한 강력한 항체 생산(체액 반응)을 유도하는 데 중요한 역할을 하는 것을 나타낸다.
실시예 4: 인플루엔자 바이러스 감염 세포에 대한 항-M2e 항체의 결합 능력 확인
면역화된 마우스 혈청의 항-M2e 항체가 원형질막에 M2e를 나타내는 인플루엔자에 감염된 세포를 인식할 수 있는지 여부를 확인하기 위해 면역세포화학분석(immunocytochemistry, ICC), ELISA, 웨스턴 블롯을 수행하였다(도 4a).
4-1. 면역세포화학기법을 통한 인플루엔자 바이러스 감염 세포에 대한 항-M2e 항체 결합을 확인
인플루엔자 바이러스에 감염된 세포에 대한 항-M2e 항체 결합을 확인하기 위해 공 초점 현미경(confocal microscopy)을 이용한 면역세포화학분석을 수행하였다. 항-M2e 항체의 결합 능력을 평가하기 위해, 24 웰 플레이트의 커버 슬립에 MDCK 세포를 접종하고, 0.5 mL 배지에서 웰당 2 x 105 세포의 밀도로 성장시키고 밤새 부착되도록 두었다. 인플루엔자 감염 배지(MEM-비타민, 겐타마이신 및 4% BSA가 첨가된 DMEM 배지)에서 MDCK 세포를 인플루엔자 A 바이러스 균주(A/PR/8, A/CA/04/09 또는 A/Aquatic bird/Korea)로 감염시키고 20시간 동안 배양하였다. 세포를 PBS로 세척하고 10 % 포르말린 용액으로 10 분 동안 고정하였다. 세포를 면역화된 마우스의 항-M2e IgG 항체(1:100 희석)를 포함하는 혈청과 함께 실온에서 2 시간 동안 배양하였다. 상기 M2e IgG 항체를 포함하는 혈청은 M2e(x8) 면역화된 마우스로부터 56 일째에 얻은 혈청을 사용하였다. 항-M2e IgG 항체로 2 시간 동안 배양한 다음, Alexa Fluor 594-접합 당나귀 항-마우스 2 차 항체(1:200 희석; Abcam)를 상온에서 1 시간 동안 배양하였다. 핵은 Hoechst 33342 (1:5000 희석)로 염색하였다. 모든 샘플은 공 초점 레이저 스캐닝 현미경 (LSM 780; Carl Zeiss)으로 이미지화 하였다.
M2e는 대형 당 단백질인 헤마글루티닌(HA) 및 뉴라미니다제(NA)와 달리 크기가 작고 풍부한 단백질이며 바이러스의 막에 묻혀 있기 때문에, 항-M2e 항체의 항 바이러스 효과는 바이러스 감염을 직접 중화시키기보다는 감염된 세포막에 결합할 때의 항체 의존성 세포 독성(antibody dependent cellular cytotoxicity, ADCC) 유도에 의해 매개되는 것으로 알려져 있다. 즉, 항-M2e 항체가 바이러스에 감염된 세포의 원형질막에 결합하는 능력은 바이러스 감염으로부터의 보호와 직접적인 관련이 있는 것으로 예측된다.
실험에 사용된 바이러스 균주와 M2e 아미노산 서열은 다음과 같다 (표 2).
바이러스 균주 아형 M2e 아미노산 서열 서열번호
A/PR/8 H1N1 SLLTEVETPIRNEWGCRCNDGSD 4
A/CA/04/09 H1N1 SLLTEVETPTRNGWECKCSDSSD 5
A/Aquatic bird/Korea H5N2 SLLTEVETPTRSEWECRCSDSSD 6
공 초점 레이저 스캐닝 현미경(Confocal laser scanning microscopic) 이미지는 혈청의 항-M2e 항체가 바이러스의 아형에 관계없이 인플루엔자 바이러스에 감염된 MDCK 세포에 대해 현저한 결합을 나타내는 반면, 감염되지 않은 MDCK 세포에 대해서는 결합이 거의 관찰되지 않았다 (도 4b).
4-2. whole-cell ELISA를 통한 인플루엔자 바이러스 감염 세포에 대한 항-M2e 항체 결합을 확인
항-M2e 항체의 특이적 결합을 whole-cell ELISA(도 4c)로 확인하였다.
whole-cell ELISA의 경우, MDCK 세포를 0.2 mL 배지에서 웰당 1 x 104 세포의 밀도로 96-웰 플레이트에 접종하고 밤새 부착되도록 두었다. MDCK 세포를 인플루엔자 바이러스 균주(감염의 다중도 = 0.1)로 감염시키고, 면역화된 마우스로부터의 유래된 항-M2e IgG 항체(1:100 희석)를 함유하는 혈청과 함께 배양하였다. 상기 항-M2e IgG 항체를 포함하는 혈청은 M2e(x8) 면역화된 마우스로부터 56 일째에 얻은 혈청을 사용하였다. 그 후, 세포를 HRP-접합 염소 항-마우스 IgG 2 차 항체(1:5000 희석)와 함께 실온에서 1 시간 동안 배양하고 마이크로 플레이트 리더에서 450nm 흡광도로 측정하였다.
ELISA 결과는 혈청의 항-M2e 항체가 바이러스의 아형에 관계없이 인플루엔자 바이러스에 감염된 MDCK 세포에 대해 결합하는 것을 나타내었고, 감염되지 않은 MDCK 세포에 대해서는 결합이 거의 이루어지지 않음을 나타내었다(도 4c).
4-3. 웨스턴 블롯을 통한 인플루엔자 바이러스 감염 세포에 대한 항-M2e 항체 결합을 확인
항-M2e 항체의 이러한 특이적 결합을 웨스턴 블롯으로 확인하였다.
웨스턴 블롯 분석을 위해, MDCK 세포를 2 mL 배지에서 웰당 5 x 105 세포의 밀도로 6-웰 플레이트에 접종하고, 오버나잇 배양 후 상술한 바와 같이 인플루엔자 바이러스 균주(감염도 = 1)로 감염시켰다. 바이러스에 감염된 세포는 제조업체의 지침에 따라 단백질 추출 용액(PRO-PREPTM, iNtRON Biotechnology)을 사용하여 수확하고 용해한 다음 Bradford 분석으로 단백질 농도를 결정하였다. 단백질을 20% 겔에서 SDS-PAGE로 분리 한 다음 폴리비닐리덴 디플루오라이드(PVDF) 멤브레인으로 트랜스퍼하였다. 멤브레인을 TBS-T에서 5% 탈지유로 실온에서 2 시간 동안 블록하고 면역화된 마우스의 항-M2e IgG 항체(1:200 희석)를 포함하는 혈청과 함께 실온에서 2 시간 동안 배양하였다. 그 후 멤브레인을 HRP-접합 염소 항-마우스 IgG 2 차 항체(1:5000 희석)와 함께 실온에서 1 시간 동안 배양하여 밴드를 나타내고, ChemiDoc XRS 이미징 시스템(BIO-RAD, Hercules, CA)을 사용하여 이미지화하였다.
웨스턴 블롯 결과는 혈청의 항-M2e 항체가 바이러스의 아형에 관계없이 인플루엔자 바이러스에 감염된 MDCK 세포에 대해 결합하는 것을 나타내었고, 감염되지 않은 MDCK 세포에 대해서는 결합이 거의 이루어지지 않음을 나타내었다(도 4d).
상기 내용을 종합해보면, BP26-M2e 나노 백신으로 마우스를 면역화하여 항-M2e 항체를 생성할 수 있으며, 상기 항-M2e 항체는 다양한 인플루엔자 바이러스에 감염된 포유류 세포에 특이적으로 결합 할 수 있고, 이는 범용 백신으로 개발될 수 있는 BP26-M2e 나노 구조체의 가능성을 시사한다.
실시예 5: 바이러스 접종 실험을 통한 백신의 효과 평가
바이러스 접종 실험을 위해, 마우스를 다음과 같이 실시예 3-1의 방식과 동일한 방법으로 면역화하였다:
마우스를 다음과 같이 5개의 군으로 분류하였다; PBS 완충 비히클, (BP26-WT + M2e)/알룸(BP26-WT: 20 μg; M2e: 7.3 μg), BP26-M2e(x4) (25 μg), BP26-M2e(x8)(18 μg), BP26-M2e(x8)/알룸(BP26-M2e: 18 μg), 이들을 3주 간격으로 3회 양쪽 발바닥에 피하 주사.
최종 면역화 2 주 후에 마우스를 A/PR/8 인플루엔자 바이러스의 4xLD50을 포함하는 30 μL의 PBS를 비강 내로 접종하였다 (도 5a). 생쥐의 생존율, 체중 변화, 임상 점수 및 직장 온도를 바이러스 접종 후 16 일 동안 매일 모니터링하였다. 초기 체중에서 25 % 이상이 감소된 마우스를 인도적으로 안락사시키고 실험 종료점으로 포함하였다. 임상 점수는 도 5b에 설명된 기준에 따라 결정하였다. 인플루엔자 바이러스에 감염된 마우스는 인간과 달리 저체온을 나타내므로, 체온을 측정하기 위해 직장 온도를 측정하였다.
PBS를 처리한 군은 인플루엔자 바이러스에 감염된 마우스는 바이러스 접종 후 10일 이내에 30% 이상의 체중 감소, 임상 점수의 급격한 증가 및 직장 온도의 감소를 보였다.
알룸 어주번트와 함께 BP26-WT와 M2e의 물리적 혼합물을 처리한 군은 PBS 처리 군과 유사한 결과를 나타내었다.
BP26-M2e(x4)을 처리한 군은 체중이 크게 감소하더라도 생존율이 60 %까지 증가하였으며, 다른 증상은 접종 8 일 후에 점진적으로 완화되었다.
BP26-M2e(x8)로 처리한 군은 생존율이 80 %까지 현저하게 증가하고, 더 짧은 항원 반복을 갖는 BP26-M2e(x4)보다 임상 점수가 훨씬 낮은 경미한 증상(약간 구겨진 털)만을 나타내었다.
BP26-M2e(x8)나노 구조체에 알룸 어주번트를 추가하여 처리한 군은 인플루엔자 바이러스 감염 (100 % 생존)으로부터 마우스를 보호할 수 있으며, 약간의 체중 감소와 빠른 회복을 나타내었다(도 5c 내지 5f).
실시예 6: 폐 바이러스 역가의 측정
BP26-M2e 나노 백신에 의해 부여된 보호 면역을 추가로 확인하기 위해, 폐 바이러스 역가를 측정하였다.
마우스를 다음과 같이 실시예 3-1의 방식과 동일한 방법으로 면역화하였다:
마우스를 다음과 같이 5개의 군으로 분류하였다; PBS 완충 비히클, (BP26-WT + M2e)/알룸(BP26-WT: 20 μg; M2e: 7.3 μg), BP26-M2e(x4) (25 μg), BP26-M2e(x8)(18 μg), BP26-M2e(x8)/알룸(BP26-M2e: 18 μg), 이들을 3주 간격으로 3회 양쪽 발바닥에 피하 주사.
최종 면역화 2 주 후에 마우스를 A/PR/8 인플루엔자 바이러스의 4xLD50을 포함하는 30 μL의 PBS를 비강 내로 접종하였다. 인플루엔자 바이러스 접종 3일 후에 마우스를 안락사시키고 폐 균질현탁액을 얻었다. 폐 바이러스 역가는 MDCK 세포를 사용한 50% 조직배양감염용량(TCID50) 분석에 의해 결정하였다.
알룸 어주번트와 함께 BP26-WT + M2e의 물리적 혼합물을 사용한 면역화는 폐 바이러스 역가를 감소시키는데 실패한 반면, BP26-M2e(x8) 단독 또는 알룸 어주번트로 면역화한 마우스는 폐 바이러스 역가를 현저하게 감소시켰다 (도 5g).
이러한 결과는 BP26-M2e 나노 백신이 기존의 어주번트를 사용하지 않아도 인플루엔자 바이러스 감염에 대한 강력한 보호면역을 생성할 수 있으며, 항원의 길이를 조절하여 보호 효능을 조정할 수 있음을 나타낸다.
상기 결과로부터, 본 출원인은 브루셀라 외막 단백질 BP26의 자체 조립으로 형성된 단백질 나노 구조체를 기반으로 인플루엔자 바이러스 감염에 대한 범용 백신 플랫폼을 개발하였다. BP26의 유전적 조작은 M2e 표시 배럴모양 나노 백신(BP26-M2e)의 생성을 가능하게 하였다. BP26-M2e 나노 백신에 의한 면역은 마우스에서 높은 수준의 항-M2e 항체 생산을 유도할 수 있으며, 이들 항체는 인플루엔자 바이러스에 감염된 세포에 특이적으로 결합 할 수 있어, 어주번트를 사용하지 않고도 인플루엔자 감염으로부터 마우스를 효과적으로 보호하게 한다.
BP26-M2e 나노 백신의 면역 반응은 M2e 에피토프의 탠덤 반복 구조 길이를 조절하여 조정할 수 있다. BP26 기반 나노 구조체 백신은 다양한 바이러스에 대한 체액성 반응을 최적화하거나 최대화하기 위해 상대적으로 큰 항원과 다중 에피토프를 표시하도록 설계할 수 있다. 또한, BP26 기반 백신은 E. coli에서 단순 발현을 통해 고 수율로 생산할 수 있어 인간 또는 동물용으로 상용화 가능성이 높다.
본 발명이 유도하는 강한 면역반응은 BP26에 의해 형성되는 나노 구조체에 의한 것이다. 링커에 의해 BP26와 융합되는 폴리펩타이드는 제한이 없으므로, 본 발명의 나노 구조체는 다양한 병원체에 대한 면역을 유도할 수 있다.
따라서, 다목적 백신 플랫폼인 BP26 기반 나노 구조체 시스템의 고유한 기능은 SARS-CoV2, 인플루엔자 바이러스 등을 포함하는 다양한 바이러스, 세균 등에 대한 백신의 신속한 개발을 가능하게 할 것으로 예상된다.
실시예 7: BP26-포함 암 백신의 제조
본 발명자들은 BP26을 포함하는 나노구조체를 이용하여 암 백신 조성물을 제조하고자 하였다. 구체적으로 본 발명자들은 도 6에 나타낸 바와 같은 구조의 단백질 복합체를 제조하였다.
도 6에 나타낸 바와 같이, BP26 protein의 C-term 쪽에 mouse melanoma cell line B16-F10의 MHC class II neoantigen peptide인 M30 (27 amino acids)을 6개의 tandem repeat으로 display하는 fusion protein을 디자인하였다.
M30 peptide의 아미노산 서열 및 이를 인코딩하는 염기서열은 표 3에 나타내었다.
구분 서열 SEQ ID NO.
Amino acid sequence of M30 PSKPSFQEFVDWENVSPELNSTDQPFL SEQ ID NO: 8
Nucleotide sequence of M30 (1) CCGAGCAAACCGAGCTTCCAAGAGTTTGTGGACTGGGAAAACGTTAGCCCGGAGCTGAACAGCACCGATCAACCGTTCCTG SEQ ID NO: 9
Nucleotide sequence of M30 (2) CCGAGCAAGCCGAGCTTCCAAGAATTTGTGGACTGGGAGAACGTTAGCCCGGAACTGAACAGCACCGACCAACCGTTTCTG SEQ ID NO: 10
Nucleotide sequence of M30 (3) CCTTCTAAGCCGAGCTTCCAGGAGTTTGTGGACTGGGAGAATGTCTCTCCTGAGCTGAACAGCACTGACCAACCGTTCCTG SEQ ID NO: 11
Nucleotide sequence of M30 (4) CCTTCTAAACCGAGCTTCCAGGAATTTGTGGACTGGGAAAATGTGTCTCCTGAACTGAACAGCACTGATCAACCGTTTCTG SEQ ID NO: 12
Nucleotide sequence of M30 (5) CCTTCCAAACCGAGCTTCCAGGAGTTTGTGGACTGGGAAAACGTATCTCCCGAGCTGAACAGCACAGACCAACCGTTCCTG SEQ ID NO: 13
Nucleotide sequence of M30 (6) CCTTCAAAGCCGAGCTTCCAAGAGTTTGTGGACTGGGAGAATGTGAGCCCGGAGCTGAATAGCACCGACCAACCGTTCCTG SEQ ID NO: 14
BP26과 M30 사이 및 M30과 M30 사이는 flexible linker인 GGGSG를 통해 연결하였다. 특히 M30 peptide의 경우, MHC class II epitope로 작용하여 M30 antigen-specific CD4+ T cell response를 유도할 수 있기 때문에 CD8+ T cell 기반 antitumor immune response를 유도하는 데 집중했던 기존 항암 백신에서 더 나아가 CD4+ T cell response를 유도할 수 있는 항암 백신을 개발하고자 하였다.
실시예 8: BP26-포함 암 백신의 효능 평가
8-1. 암백신의 접종 및 종양 성장 억제 효능
도 7은 본 발명의 BP26 포함 암 백신의 효능을 평가하기 위한 면역 스케쥴을 나타낸 도이다.
도 7에 나타낸 바와 같이, 본 발명자들은 B16-F10 cancer cell의 피하주사를 통한 세포를 접종하였다(day 0). 그 다음, 종양세포 접종 후 4일 째부터 4일 간격으로 본 발명의 실시예 8에서 제조한 암백신 조성물(BP26 및 M30 tandem repeat의 fusion protein, BP26-M30)을 46.8μg/두씩 총 2회(day 4, day 8) 주사하여 면역화를 진행하였다. 마지막 면역화 진행 5일 후 마우스를 희생시키고 비장을 적출하여 비장세포를 분리하였다. 다른 실험군으로는 BP26-WT(25.3μg/두)과 M30 peptide(20μg/두)를 혼합한 수용성 혼합물(BP26-WT+M30), 및 본 발명의 암백신과 백신 어주번트인 CpG ODN의 혼합물(46.8μg/두의 BP26-M30 + 10μg/두의 CpG)을 각각 투여하였다. 상기 CpG ODN은 서열번호 15(5'-TCC ATG ACG TTC CTG ACG TT-3')의 뉴클레오타이드 서열을 포함하고 포스포로티오에이트 백본(phosphorothioate backbone)을 가진 올리고뉴클레오타이드로, 제노텍(대전, 대한민국)에서 구입하였다. 대조군으로는 PBS를 투여하였다(Control). 또한, 종양세포 접종 후 희생시까지 2일마다 종양의 부피를 측정하였다.
결과는 도 8 에 나타내었다.
도 8은 B16F10 종양 세포의 부피를 나타낸 것으로 종양세포의 성장 정도를 나타낸다. 도 8에 나타낸 바와 같이, 본 발명의 암백신 조성물(BP26-M30)을 마우스에 면역화 할 경우, 타 실험군인 BP26-WT 및 M30 peptide의 수용성 혼합물(BP26-WT+M30) 투여군 대비 종양의 성장을 억제할 수 있음을 확인하였다. 또한 본 발명의 암백신 조성물은 백신 어주번트인 CpG ODN을 추가 투여한 마우스 군(BP26-M30+CpG)과 유사하게 종양 성장을 억제함을 확인하였다.
8-2. 암백신의 접종 및 세포면역 반응의 활성화
본 발명자들은 IFN-γ를 분비하는 CD4+ T cell %를 확인하여, M30 antigen-specific한 T cell immune response가 유도되었는지를 확인하고자 하였다. 즉, 암 백신의 면역원성을 확인하고자 하였다.
항원-특이적 T 세포 반응을 평가하기 위해, 상기 분리된 비장 세포를 M30 peptide (10 μg/ml)로 생체 외에서(ex vivo) 1시간 동안 재 자극(M30 peptide ex vivo restimulation)시키고 CD4+ T 세포에 의해 생성된 INF-γ를 세포 내 사이토카인 염색 (intracellular cytokine staining, ICS)에 의해 정량화 하였다.
구체적으로 사이토카인의 세포 내 수송을 억제하기 위해 GolgiStopTM 또는 GolgiPlugTM (BD Biosciences)을 각 튜브에 첨가하였다. 세포를 5 시간 동안 인큐베이션하고, 4 ℃에서 20 분 동안 fixable viability dye eFluor450 (eBioscience, San Diego, CA, USA)으로 염색하여 사멸 세포를 구별한 후, 4 ℃에서 20 분 동안 항-CD3-PE/Cy7 및 항-CD4-FITC 항체로 염색하였다. 세포 내 사이토카인 염색의 경우, 세포를 Cytofix/CytopermTM 용액 (BD Biosciences)을 사용하여 투과시키고 PE-접합된 항-IFN-γ 항체와 함께 배양하였다. 샘플을 세척하고 유세포 분석에 의해 분석하였다.
도 9는 비장 세포의 유세포 분석을 통한 IFN-γ를 분비하는 CD4+ T 세포 비율을 확인하기 위한 게이팅 전략을 나타낸 도이다. FSC x SSC 게이팅이 크기와 과립화 여부에 기초하여 단일세포를 얻는데 사용되었고, 살아있는 세포만을 분석하기 위해 사멸된 세포는 제외시켰다. CD3, CD4 및 CD8은 T 세포 마커로 사용되었다. 최종적으로 CD3+CD4+ T 세포에서의 INF-γ 분비를 확인하였다.
도 10은 본 발명의 BP26 포함 암백신으로 면역화한 후 IFN-γ를 분비하는 CD4+ T cell %를 나타낸 도이다.
도 10에 나타낸 바와 같이, 본 발명의 BP26-M30 암 백신의 경우, 대조군 그룹 및 BP26-WT+M30 수용성 혼합물 투여 그룹 대비 M30 항원-특이적인 CD4+ T 세포 반응이 유도됨을 확인하였다. 또한, BP26-M30 및 CpG ODN 어주번트를 함께 투여할 경우 IFN-γ를 분비하는 CD4+ T cell %가 더 향상되어 항원-특이적인 세포 면역 반응을 좀 더 효과적으로 유도할 수 있음을 확인할 수 있었다.
상기 결과로부터, 본 발명의 BP26 platform은 influenza virus의 M2e peptide 뿐만 아니라 cancer neoantigen peptide를 display 할 경우에도 효과적으로 항원-특이적인 세포 면역 반응을 유도할 수 있음을 확인하였으며 인플루엔자 백신 뿐만 아니라 암 백신으로도 활용할 수 있는 가능성을 보여주었다.
본 발명은 BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질에 관한 것이다.

Claims (18)

  1. BP26 및 항원 폴리펩타이드를 포함하는 융합 단백질.
  2. 제1항에 있어서, 상기 BP26은 서열번호 1 또는 2의 아미노산 서열을 포함하는 것인, 융합 단백질.
  3. 제1항에 있어서, 상기 항원은 병원체 유래 항원, 또는 종양 유래 항원인, 융합 단백질.
  4. 제3항에 있어서, 상기 병원체는 바이러스, 세균, 리케차, 진균, 원충으로 이루어지는 군으로부터 선택되는 것인, 융합 단백질.
  5. 제1항에 있어서, 상기 병원체 유래 항원 폴리펩타이드는 M2e인 것인, 융합 단백질.
  6. 제5항에 있어서, 상기 M2e는 서열번호 3, 4, 5, 또는 6의 아미노산 서열을 포함하는 것인, 융합 단백질.
  7. 제1항에 있어서, 상기 융합 단백질은 상기 항원 폴리펩타이드를 1개 이상 포함하는 것인, 융합 단백질.
  8. 제1항에 있어서, 상기 항원 폴리펩타이드는 융합 단백질 내에서 연속적 또는 비연속적으로 연결된 것인, 융합 단백질.
  9. 제1항 내지 제8항 중 어느 한 항의 융합 단백질을 인코딩하는 뉴클레오타이드 서열을 포함하는 핵산 분자.
  10. 제9항의 핵산 분자를 포함하는 재조합 벡터.
  11. 제10항의 재조합 벡터를 포함하는 숙주세포.
  12. 제1항의 융합 단백질을 포함하는 나노 구조체.
  13. 제12항에 있어서, 상기 나노 구조체는 제1항의 융합 단백질을 2 이상 포함하는 것인, 나노 구조체.
  14. 제12항에 있어서, 상기 나노 구조체는 제1항의 융합 단백질을 8개 또는 16개를 포함하는 것인, 나노 구조체.
  15. 제1항의 융합 단백질, 제12항의 나노 구조체, 또는 이들의 조합을 포함하는 백신 조성물.
  16. 제15항에 있어서, 상기 백신 조성물은 전염성 병원체 감염증 예방용인 것인, 백신 조성물.
  17. 제15항에 있어서, 상기 백신 조성물은 암 백신용인, 백신 조성물.
  18. 제15항에 있어서, 상기 백신 조성물은 어주번트를 추가적으로 포함하는 것인, 백신 조성물.
PCT/KR2021/015113 2020-10-26 2021-10-26 Bp26 및 항원 폴리펩타이드를 포함하는 융합 단백질 WO2022092769A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP21886763.8A EP4234573A1 (en) 2020-10-26 2021-10-26 Fusion protein comprising bp26 and antigenic polypeptide
US18/139,003 US20230257426A1 (en) 2020-10-26 2023-04-25 Fusion protein comprising bp26 and antigenic polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200139699 2020-10-26
KR10-2020-0139699 2020-10-26

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/139,003 Continuation US20230257426A1 (en) 2020-10-26 2023-04-25 Fusion protein comprising bp26 and antigenic polypeptide

Publications (1)

Publication Number Publication Date
WO2022092769A1 true WO2022092769A1 (ko) 2022-05-05

Family

ID=81382837

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/015113 WO2022092769A1 (ko) 2020-10-26 2021-10-26 Bp26 및 항원 폴리펩타이드를 포함하는 융합 단백질

Country Status (4)

Country Link
US (1) US20230257426A1 (ko)
EP (1) EP4234573A1 (ko)
KR (1) KR20220055441A (ko)
WO (1) WO2022092769A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
CN105906717A (zh) * 2016-04-29 2016-08-31 吉林大学 布鲁氏菌多表位融合蛋白疫苗的制备及应用
EP2575876B1 (en) * 2010-05-26 2017-12-06 Selecta Biosciences, Inc. Multivalent synthetic nanocarrier vaccines
KR20200139699A (ko) 2018-03-30 2020-12-14 칸토 덴카 코교 가부시키가이샤 함불소 술파이드 화합물의 제조 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140131802A (ko) 2013-05-06 2014-11-14 한국과학기술원 Bp26 복합체의 채널 유사 구조 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
EP2575876B1 (en) * 2010-05-26 2017-12-06 Selecta Biosciences, Inc. Multivalent synthetic nanocarrier vaccines
CN105906717A (zh) * 2016-04-29 2016-08-31 吉林大学 布鲁氏菌多表位融合蛋白疫苗的制备及应用
KR20200139699A (ko) 2018-03-30 2020-12-14 칸토 덴카 코교 가부시키가이샤 함불소 술파이드 화합물의 제조 방법

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 584
CORPET ET AL., NUC. ACIDS RES., vol. 16, 1988, pages 10881 - 90
DATABASE PROTEIN 6 January 2020 (2020-01-06), ANONYMOUS : "MULTISPECIES: outer membrane protein BP26/OMP28 [Brucella]", XP055925789, retrieved from NCBI Database accession no. WP_002969580 *
FLOWER DR ET AL., EXPERT OPIN DRUG DISCOV, vol. 7, no. 9, September 2012 (2012-09-01), pages 807 - 17
H. NEURATHR.L. HILL: "The Proteins", 1979, ACADEMIC PRESS
HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151 - 3
HIGGINSSHARP, GENE, vol. 73, 1988, pages 237 - 44
HUANG ET AL., COMP. APPL. BIOSCI., vol. 8, 1992, pages 155 - 65
KANG SUKMO, KIM YUJIN, SHIN YUMI, SONG JI-JOON, JON SANGYONG: "Antigen-Presenting, Self-Assembled Protein Nanobarrels as an Adjuvant-Free Vaccine Platform against Influenza Virus", ACS NANO, AMERICAN CHEMICAL SOCIETY, US, vol. 15, no. 6, 22 June 2021 (2021-06-22), US , pages 10722 - 10732, XP055925793, ISSN: 1936-0851, DOI: 10.1021/acsnano.1c04078 *
MERRIFIELD, J. AMER. CHEM. SOC., vol. 85, 1963, pages 2149 - 54
NEEDLEMANWUNSCH, J. MOL. BIO., vol. 48, 1970, pages 443
PEARSON ET AL., METH. MOL. BIOL., vol. 24, 1994, pages 307 - 31
PEARSONLIPMAN, METHODS IN MOL. BIOL, vol. 24, 1988, pages 307 - 31
SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SCHEIT: "Nucleotide Analogs", 1980, JOHN WILEY
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
STEWART ET AL.: "Solid Phase Peptide Synthesis", 1984, PIERCE CHEM. CO., pages: 111
ZHU LIN, WANG QIUJU, WANG YUJIAN, XU YULIN, PENG DUO, HUANG HE, HU LIPING, WEI KAI, ZHU RUILIANG: "Comparison of Immune Effects Between Brucella Recombinant Omp10-Omp28-L7/L12 Proteins Expressed in Eukaryotic and Prokaryotic Systems", FRONTIERS IN VETERINARY SCIENCE, vol. 7, 1 January 2020 (2020-01-01), pages 576, XP055925785, DOI: 10.3389/fvets.2020.00576 *
ZYKOVA ANNA A., BLOKHINA ELENA A., KOTLYAROV ROMAN Y., STEPANOVA LIUDMILA A., TSYBALOVA LIUDMILA M., KUPRIANOV VICTOR V., RAVIN NI: "Highly Immunogenic Nanoparticles Based on a Fusion Protein Comprising the M2e of Influenza A Virus and a Lipopeptide", VIRUSES, MDPI, CH, vol. 12, no. 10, 6 October 2020 (2020-10-06), CH , pages 1133, XP055890943, ISSN: 1999-4915, DOI: 10.3390/v12101133 *

Also Published As

Publication number Publication date
US20230257426A1 (en) 2023-08-17
KR20220055441A (ko) 2022-05-03
EP4234573A1 (en) 2023-08-30

Similar Documents

Publication Publication Date Title
KR100600988B1 (ko) Ｄｎａ 면역화에서 인플루엔자 ｎｐ 유전자 ｄｎａ를 함께투여하여 면역반응을 증가시키는 방법
WO2019209079A1 (en) Nucleic acid molecules inserted expression regulation sequences, expression vector comprising nucleic acid moleclues and pharmaceutical use thereof
EP3440096A1 (en) A peptide with ability to penetrate cell membrane
PT1117435E (pt) Holotoxina da cólera mutante como adjuvante
WO2019195626A1 (en) T-cell inducing vaccine composition combinations and uses thereof
US5871746A (en) Cytotoxic T lymphocyte-inducing lipopeptides and use as vaccines
WO2020091529A1 (ko) 재조합 호흡기 세포융합 바이러스 f 단백질 및 이를 포함하는 백신 조성물
CA2778359A1 (en) Adjuvant for vaccines, vaccines that comprise said adjuvant and uses thereof
WO2022092769A1 (ko) Bp26 및 항원 폴리펩타이드를 포함하는 융합 단백질
WO2020005028A1 (ko) 중증 열성 혈소판 감소 증후군(sfts) 바이러스 감염 질환 예방 또는 치료용 백신 조성물
WO2011069408A1 (zh) 一种多肽免疫原及其制备方法和应用
EP2461825A2 (en) Anti-rsv immunogens and methods of immunization
WO2022045827A1 (ko) 신규한 코로나바이러스 재조합 스파이크 단백질, 이를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터 및 상기 벡터를 포함하는 코로나바이러스감염증 예방 또는 치료용 백신
EP2519263B1 (en) Lipopeptide- and lipoprotein-conjugates and its use
Arnon et al. Peptide-based synthetic recombinant vaccines with anti-viral efficacy
WO2017176076A1 (en) A peptide with ability to penetrate cell membrane
WO2022169339A1 (ko) 신규 핵산 분자
WO2022211373A1 (ko) 침팬지 아데노바이러스 혈청형 6의 돌기 유전자로 치환된 재조합 키메릭 아데노바이러스 벡터 및 그 응용
WO2023055154A1 (ko) 재조합된 약독화 rsv 생백신 및 이를 제조하는 방법
WO2023075421A1 (ko) 수지상 세포를 표적하는 신규한 펩타이드, 및 이를 포함하는 암 치료용 조성물
WO2023244044A1 (ko) 변형된 코로나바이러스 스파이크 항원 단백질 및 이의 용도
WO1999057295A1 (en) Recombinant virus expressing foreign dna encoding feline cd80, feline ctla-4 or feline cd86 and uses thereof
WO2024025397A1 (ko) 항원 전달용 재조합 융합 단백질 및 이의 이용
WO2024035185A1 (ko) 핵산 백신 제조용 플랫폼
CN113913393B (zh) 新型冠状病毒肺炎的重组新城疫病毒疫苗

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21886763

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021886763

Country of ref document: EP

Effective date: 20230526