WO2022075509A1 - Complexe médicament anticancéreux-aptamère de her2 et son utilisation - Google Patents

Complexe médicament anticancéreux-aptamère de her2 et son utilisation Download PDF

Info

Publication number
WO2022075509A1
WO2022075509A1 PCT/KR2020/013954 KR2020013954W WO2022075509A1 WO 2022075509 A1 WO2022075509 A1 WO 2022075509A1 KR 2020013954 W KR2020013954 W KR 2020013954W WO 2022075509 A1 WO2022075509 A1 WO 2022075509A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
her2
aptamer
pharmaceutical composition
anticancer
Prior art date
Application number
PCT/KR2020/013954
Other languages
English (en)
Korean (ko)
Inventor
반창일
서재홍
김지영
김윤재
Original Assignee
주식회사 엠디엡투스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엠디엡투스 filed Critical 주식회사 엠디엡투스
Publication of WO2022075509A1 publication Critical patent/WO2022075509A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5365—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • A61K31/5513—1,4-Benzodiazepines, e.g. diazepam or clozapine
    • A61K31/5517—1,4-Benzodiazepines, e.g. diazepam or clozapine condensed with five-membered rings having nitrogen as a ring hetero atom, e.g. imidazobenzodiazepines, triazolam
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/05—Dipeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers

Definitions

  • the present invention relates to a HER2 aptamer-anticancer drug complex and uses thereof, and more particularly, to a complex in which a HER2 aptamer consisting of SEQ ID NO: 1 targeting HER2-positive cancer is combined with an anticancer drug, and treatment of HER2-positive cancer using the same how, etc.
  • Cancer is one of the diseases that occupies the largest proportion of the causes of death of modern people. It is a disease caused by changes in normal cells due to mutations in genes caused by various causes. It refers to non-malignant tumors. Cancer is characterized by “uncontrolled cell growth”, and by this abnormal cell growth, a cell mass called a tumor is formed and penetrates into surrounding tissues, and in severe cases, it metastasizes to other organs of the body. . Cancer is an intractable chronic disease that causes pain to the patient and ultimately death, without being able to cure fundamentally in many cases even when treated with surgery, radiation, and drug therapy.
  • Drug treatment of cancer that is, anticancer drugs
  • cancer cells are effectively killed in the early stages to treat cancer, but eventually, cancer stem cells remaining in the body cannot be removed, resulting in cancer recurrence and/or Metastasis occurs actively, and eventually, problems showing resistance to existing anticancer therapies often occur.
  • the present inventors in order to significantly increase the therapeutic effect of HER2-positive cancer, not only can reduce side effects by targeting cancer cell lines with high HER2 expression, but also increase the therapeutic effect of the anticancer agent by effectively moving the anticancer agent into the cell, As a result of intensive research on effective anticancer agents that can significantly lower the incidence of cancer metastasis, recurrence, resistance to anticancer drugs, etc. by lowering the stem cell properties of stem cells, the present invention has been completed.
  • the present invention has been devised to solve the problems in the prior art as described above, and a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) including the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are combined
  • a HER2 aptamer Receptor tyrosine-protein kinase erbB-2 aptamer
  • An object of the present invention is to provide a pharmaceutical composition for preventing or treating HER2-positive cancer comprising as an active ingredient, and the like.
  • the present invention provides a pharmaceutical for the prevention or treatment of HER2-positive cancer comprising a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) including the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are bound as an active ingredient Provides an enemy composition.
  • a HER2 aptamer Receptor tyrosine-protein kinase erbB-2 aptamer
  • the anticancer substance is preferably maytansine derivatives, cisplatin, capecitabine, 5-fluorouracil, sub It may be auristatin derivatives, calicheamicin, duocarmycin, pyrrolobenzodiazepine, doxorubicin, SN-38, etc., and more preferably one of maytansine derivatives.
  • Mertansine which is a type, or an anticancer agent used for the treatment of cancer is not limited thereto.
  • the HER2-positive cancer is preferably breast cancer, stomach cancer, lung cancer, ovarian cancer, cervical cancer, endometrial cancer, vulvar cancer, bladder cancer, kidney cancer, prostate cancer, testicular cancer, penile cancer, gallbladder cancer , salivary adenocarcinoma, colorectal cancer, thyroid cancer, peritoneal cancer, liver cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, leukemia, malignant lymphoma, plasmacytoma, myeloma, sarcoma, etc., more preferably breast cancer or HER2 gene If the cancer is overexpressed, the present invention is not limited thereto.
  • the bond may be connected by a linker, and the linker is preferably thioether, disulfide, dipeptide, maleimidocaproyl, high It may be a drazone (hydrazone), a glucuronide linker, etc., and more preferably a Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker, or an aptamer and an anticancer substance. If there is a linker, it is not limited thereto.
  • the complex may include the HER2 aptamer and the anticancer substance in a weight ratio of preferably 1:0.5 to 200, more preferably, 1:1 to 1:100 by weight. may be included, but is not limited thereto.
  • the pharmaceutical composition targets HER-2 (Receptor tyrosine-protein kinase erbB-2).
  • the pharmaceutical composition is characterized by inhibiting the proliferation, survival, metastasis, recurrence, and anticancer drug resistance of cancer or cancer stem cells, cancer treatment caused by the pharmaceutical composition of the present invention
  • the effect is not limited thereto.
  • the present invention also provides a method for preventing or treating HER2-positive cancer comprising administering the pharmaceutical composition to a subject.
  • the present invention is a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) comprising the nucleotide sequence represented by SEQ ID NO: 1 and the use of a composition comprising a complex to which an anticancer substance is bound to prevent or treat HER2-positive cancer to provide.
  • HER2 aptamer Receptor tyrosine-protein kinase erbB-2 aptamer
  • the present invention is a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) containing the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are combined to produce a drug used for the prevention or treatment of HER2-positive cancer It provides a use for
  • the composition according to the present invention includes a complex in which a HER2-specific aptamer and an anti-cancer substance are bound as an active ingredient, and the HER2-specific aptamer acts specifically on HER2-positive cancer cells to introduce an anti-cancer agent into the cell to produce an anti-cancer agent.
  • the therapeutic effect be increased, but it is not toxic to cells in which the HER2 receptor does not exist, so side effects to anticancer drugs can be significantly reduced.
  • the therapeutic effect on HER2-positive carcinoma can be remarkably increased by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells.
  • FIG. 1 is a conceptual diagram schematically illustrating a method for synthesizing a HER2 aptamer-drug complex according to an embodiment of the present invention.
  • FIG. 2 is a view showing the results of ESI-MS confirmation of the molecular weight (A) of the HER2 aptamer and the molecular weight (B) of the HER2 aptamer-drug complex according to an embodiment of the present invention.
  • FIG. 3 is a view showing the results of confirming the anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention by flow cytometry.
  • FIG. 4 is a view showing the results of confirming the anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention by MTS assay.
  • FIG. 5 is a view showing the results of confirming the endocytosis of the HER2 aptamer-drug complex according to an embodiment of the present invention with Lyso Tracker Deep Red.
  • FIG. 6 is a view showing the results of confirming the cell death mechanism of the HER2 aptamer-drug complex according to an embodiment of the present invention by Western blotting.
  • FIG. 7 is a view showing the results of confirming the in vivo anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention using a mouse model.
  • FIG. 8 is a view showing the results of confirming the effect of suppressing Ki-67 expression and apoptosis of the HER2 aptamer-drug complex according to an embodiment of the present invention.
  • FIG. 9 is a view showing the results of confirming the ICD HER2 and cancer stem cell expression inhibitory effect of the HER2 aptamer-drug complex according to an embodiment of the present invention.
  • the HER2 aptamer-anticancer drug complex of the present invention is a complex in which a HER2 aptamer including the nucleotide sequence shown in SEQ ID NO: 1 and an anticancer substance are linked with an SMCC linker, and the HER2 aptamer effectively binds the anticancer drug to HER2-positive cancer cells.
  • a HER2 aptamer including the nucleotide sequence shown in SEQ ID NO: 1 and an anticancer substance are linked with an SMCC linker, and the HER2 aptamer effectively binds the anticancer drug to HER2-positive cancer cells.
  • aptamer refers to single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance.
  • ssDNA single-stranded DNA
  • RNA RNA having high specificity and affinity for a specific substance.
  • the previously developed method using an antibody takes a relatively long time and high cost because it is made using the immune system of a living body, and its stability is a problem because it is a protein, whereas an aptamer is relatively synthesized Since mass production is possible with a simple method and even cells, proteins, and even small organic substances can be target substances, new detection methods can be developed using them, and the specificity and stability are very high compared to the already developed antibodies.
  • a HER2 aptamer was used to induce a specific action only on HER2-positive cancer cells.
  • the aptamer may preferably consist of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
  • anticancer compound refers to a substance having anticancer activity capable of binding to an aptamer, preferably maytansine derivatives, cisplatin, capeci.
  • Tabine (capecitabine), 5-fluorouracil, auristatin derivatives, calicheamicin, duocarmycin, pyrrolobenzodiazepine, doxorubicin , SN-38, etc., more preferably mertansine, but not limited thereto, as long as it is an anticancer agent used for the treatment of cancer.
  • prevention refers to any action that suppresses or delays the onset of diseases such as cancer by administration of the composition according to the present invention.
  • treatment refers to any action in which symptoms such as cancer are improved or beneficially changed by administration of the composition according to the present invention.
  • the term “individual” refers to a subject to which the composition of the present invention can be administered, and the subject is not limited.
  • the term “pharmaceutical composition” may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition is intended for humans.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-free agents
  • a topical agent, solubilizer, isotonic agent, stabilizer, etc. may be mixed and used.
  • a base for topical administration, a base, excipient, lubricant, preservative, etc. may be used.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier for example, in the case of oral administration, tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. can be prepared in the form of, and in the case of injection, it can be prepared in the form of unit dose ampoules or multiple doses. there is.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like can be used.
  • it may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an e
  • the route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral or parenteral administration is preferable, for example, oral, intravenous, intramuscular, intraarticular, intrasynovial, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, intradermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, rectal, intrasternal, intralesional, intracranial, and the like.
  • the dosage of the pharmaceutical composition of the present invention may vary depending on the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. It may vary depending on factors, and it may be appropriately selected by those skilled in the art although it varies depending on the patient's condition, weight, degree of disease, drug form, administration route and period, and 0.0001 to 500 mg/kg or 0.001 to 0.001 to daily It can be administered at 500 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • HER2 aptamer 5'-AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA-3', SEQ ID NO: 1
  • a drug 10 g of amine-modified HER2 aptamer was dissolved in 0.1 M potassium phosphate buffer 4.05 g of N2'-deacetyl-N2'-[3-[[1-[[4-[[(2,5-dioxo-1-pyrrolidinyloxy) carbonyl]cyclohexyl]methyl]-2,5- dioxo-3-pyrrolidinyl]thio]-1-oxopropyl]-maytansine (DM1-SMCC, Cayman) was added and reacted at room temperature.
  • DM1-SMCC 5'-AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTC
  • the HER2 aptamer itself was identified as 26450.2 Da, and the HER2 aptamer-drug complex was identified as 27405.0 Da.
  • the final yield was confirmed to be 62.5%.
  • Example 2 HER2 aptamer-drug complex in vitro Check the anti-cancer effect
  • NMuMG a normal cell line that does not express HER2, SKBR3, a HER2-positive breast cancer cell line, and trastuzumab
  • a drug targeting HER2 The anticancer effect was confirmed using JIMT-1, a cell line resistant to More specifically, DM1 (Mertansine, anticancer drug alone experimental group), HER2 Ap (aptamer alone experimental group), and HER2-Ap-DM1 (HER2 aptamer-drug complex experimental group) were each treated at a concentration of 10 nM in each cell line. Then, incubated for 72 hours.
  • a control group (control, CTL) was treated with the same amount of DMSO. And the degree of apoptosis of cancer cells was measured through DNA content analysis using flow cytometry.
  • the cell cycle is divided into G1 (cell growth phase)-S (cell replication phase)-G2/M (cell division) depending on the amount of DNA in the cell.
  • G1 cell growth phase
  • S cell replication phase
  • G2/M cell division
  • DNA fragmentation occurs ( DNA fragmentation) appears, making DNA replication and division no longer possible, and the DNA content is significantly lower than that of G1, and as a result of such apoptosis, it appears on the cell cycle as Sub G1.
  • the results are shown in FIG. 3 .
  • HER2-specific Sub G1 appeared in the experimental group treated with the HER2 aptamer-drug complex.
  • the HER2-positive cell line SKBR3 50% or more of Sub G1 was confirmed.
  • Sub G1 (19.8%) appeared not only in HER2-positive cells but also in the normal cell line, NMuMG, indicating toxicity to normal cells, whereas in the case of HER2 aptamer-drug complex, cytotoxicity was not observed in normal cells. could confirm that it was not.
  • both DM1 and HER2 aptamer-drug complex were confirmed to exhibit cytotoxicity to JIMT-1, a trastuzumab-resistant breast cancer cell line, confirming the therapeutic potential for trastuzumab-resistant breast cancer.
  • the HER2 aptamer-drug complex specifically delivered DM1, an anticancer drug, to HER2-positive cells, had fewer side effects and excellent therapeutic efficacy, and could also treat trastuzumab-resistant breast cancer cells.
  • HER2 aptamer or HER2 aptamer-drug complex was added to each cell line at concentrations of 0, 0.1, 0.5, 1, 5, 10, 20 and 50 nM. After each treatment, the cells were cultured for 72 hours, and cell viability was confirmed through MTS assay. After that, all experiments were repeated at least three times, and the results were expressed as mean ⁇ standard deviation. Statistical significance was confirmed by Student's t-test, and if P ⁇ 0.05, it was judged to be statistically significant. * indicates P ⁇ 0.05, ** indicates P ⁇ 0.01, *** indicates P ⁇ 0.001, and NS (not significant) indicates no significance. The results are shown in FIG. 4 .
  • the HER2 aptamer itself had no anticancer effect, but the HER2 aptamer-drug complex exhibited an anticancer effect on the HER2-positive cell line.
  • the HER2 aptamer-drug complex synthesized in the same manner as in Example 1 moves into the cells of the HER2-positive cell line due to the HER2 aptamer
  • the HER2 aptamer or HER2 aptamer- The drug complex was treated at a concentration of 10 nM and incubated for 3 hours. Then, the distribution of lysosomes was confirmed by staining with Lyso Tracker Deep Red. The results are shown in FIG. 5 .
  • HER2 aptamer-drug complex was treated with 10 or 20 nM in BT474 and JIMT-1, which are HER2-positive breast cancer cell lines. and cultured for 72 hours.
  • DMSO was treated with the same amount, or 10 nM of HER2 aptamer alone was treated.
  • the activation of apoptosis-related factors was confirmed by Western blotting. The results are shown in FIG. 6 .
  • the HER2 aptamer-drug complex increased cleaved-caspase3/7 and cleaved-PARP, and decreased pro-PARP.
  • the HER2 aptamer-drug complex activates caspase-3/-7, a major factor in apoptosis, and induces fragmentation of PARP.
  • the HER2 aptamer-drug complex reduced the expression of HER2 receptor, HER3 receptor and phosphor-Akr (Ser473).
  • Example 5 HER2 aptamer-drug complex in vivo Confirmation of anticancer effect in
  • trastuzumab-resistant JIMT-1 cells (3x10 6 cells) were used in the mammary of 6-week-old Balb/c nude mice. They were xenografted on both sides (left and right) of the fat pad and bred with food and water. Animal breeding and all experimental procedures were conducted in accordance with the laws and regulations for animal experiments.
  • Ado-trastuzumab emtansine (T-DM1) at a concentration of 10 mg/kg, HER2 aptamer at a concentration of 2 mg/kg, and HER2 aptamer-drug complex After administration by intraperitoneal injection twice a week at a concentration of 1 mg/kg or 2 mg/kg for a total of 4 weeks, the size of the tumor was measured. As a control, DMSO was treated with the same amount. Statistical significance was confirmed by two-way ANOVA, and if P ⁇ 0.05, it was judged to be statistically significant. ** indicates P ⁇ 0.01, *** indicates P ⁇ 0.001. The results are shown in FIG. 7 .
  • the HER2 aptamer-drug complex significantly inhibited cancer growth.
  • T-DM1 it was confirmed that the growth of the tumor was promoted compared to the control group.
  • the HER2 aptamer-drug complex could act as a new therapeutic agent for HER2-positive cancer that has resistance to trastuzumab.
  • the HER2 aptamer-drug complex inhibits the expression of Ki-67, a cancer cell growth marker
  • the HER2 aptamer-drug complex (2 mg/kg) was administered in the same manner as in Example 5-1, and 4 weeks After euthanasia in tea, the tumor tissue was embedded in a paraffin block and immunohistochemical analysis was performed. And using Ki-67 antibody, Ki-67 positive cells were identified, and the degree of apoptosis was confirmed using TUNEL assay.
  • Statistical significance between groups was analyzed by one-way ANOVA and post-hoc test by Bonferroni's post hoc test. If P ⁇ 0.05, it was judged to be statistically significant. *** indicates P ⁇ 0.001. The results are shown in FIG. 8 .
  • the expression of Ki-67 was suppressed in the experimental group administered with the HER2 aptamer-drug complex, and it was confirmed that the number of TUNEL-positive cells was significantly increased, confirming that apoptosis was significantly increased.
  • the HER2 aptamer-drug complex inhibits the expression of ICD (intracellular domain) HER2 and cancer stem cells
  • the HER2 aptamer-drug complex was administered in the same manner as in Example 5-1, and at 4 weeks After euthanasia, tumor tissue was obtained.
  • the expression level of ICD HER2 and the ratio of cancer stem cells were confirmed using the ICD HER2 antibody 4B5 and the cancer stem cell factor CD44 antibody.
  • Statistical significance was confirmed by One-Way ANOVA, and if P ⁇ 0.05, it was judged to be statistically significant. * indicates P ⁇ 0.05, ** indicates P ⁇ 0.01, *** indicates P ⁇ 0.001.
  • the results are shown in FIG. 9 .
  • the HER2 aptamer-drug complex not only exhibited a therapeutic effect on HER2-positive cancer. It was confirmed that it can effectively inhibit cancer metastasis and recurrence by reducing the growth of cancer stem cells.
  • the HER2 aptamer and the drug are connected using an SMCC linker, and due to the HER2 aptamer, the HER2 aptamer reacts specifically to the HER2-positive cancer cell line and enters the cell.
  • an anticancer agent By effectively delivering an anticancer agent, it is possible to significantly increase the therapeutic effect on a cell line resistant to the anticancer agent, as well as significantly lower the side effect of the anticancer agent because it is not toxic to cells in which the HER2 receptor does not exist.
  • trastuzumab-resistant breast cancer showed a therapeutic effect on trastuzumab-resistant breast cancer, and the possibility of using it as a second or tertiary drug was confirmed for patients who are resistant to HER2 antibody drugs.
  • the therapeutic effect on HER2-positive carcinoma can be significantly increased by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells.
  • the present invention relates to a HER2 aptamer-anticancer drug complex and uses thereof, which respond specifically to a HER2-positive cancer cell line due to the HER2 aptamer and effectively deliver an anticancer agent into the cell, thereby providing a therapeutic effect on a cell line having resistance to an anticancer agent not only can significantly increase the HER2 receptor, but also show no toxicity to cells in which the HER2 receptor does not exist, thereby significantly reducing the side effects of anticancer drugs.
  • it showed a therapeutic effect on trastuzumab-resistant breast cancer, and the possibility of using it as a second or tertiary drug was confirmed for patients who are resistant to HER2 antibody drugs.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un complexe médicament anticancéreux-aptamère de HER2 et son utilisation, et plus particulièrement, un complexe dans lequel sont conjugués un aptamère de HER2 constitué de SEQ ID NO : 1 ciblant le cancer HER2-positif et un médicament anticancéreux, et une méthode de traitement du cancer HER2-positif l'utilisant.
PCT/KR2020/013954 2020-10-08 2020-10-13 Complexe médicament anticancéreux-aptamère de her2 et son utilisation WO2022075509A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0129774 2020-10-08
KR1020200129774A KR102247908B1 (ko) 2020-10-08 2020-10-08 Her2 압타머-항암 약물 복합체 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2022075509A1 true WO2022075509A1 (fr) 2022-04-14

Family

ID=75916059

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/013954 WO2022075509A1 (fr) 2020-10-08 2020-10-13 Complexe médicament anticancéreux-aptamère de her2 et son utilisation

Country Status (2)

Country Link
KR (1) KR102247908B1 (fr)
WO (1) WO2022075509A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150080417A (ko) * 2013-12-30 2015-07-09 경희대학교 산학협력단 링커를 통해 연결된 동일한 표적 물질에 결합하는 항체 및 앱타머를 포함하는 집게 분자 및 이의 용도
KR20160032989A (ko) * 2014-09-17 2016-03-25 포항공과대학교 산학협력단 Her-2 표적화 압타머 복합체 및 이의 용도
KR20170007806A (ko) * 2014-06-06 2017-01-20 레드우드 바이오사이언스 인코포레이티드 항-her2 항체-메이탄신 컨쥬게이트 및 이것의 사용 방법
KR20190066026A (ko) * 2016-10-07 2019-06-12 다이이찌 산쿄 가부시키가이샤 항 her2 항체-약물 콘주게이트 투여에 의한 내성암의 치료

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3156800A1 (fr) 2010-07-19 2017-04-19 F. Hoffmann-La Roche AG Biomarqueurs du plasma sanguin utilisables en association avec une polythérapie à base de bevacizumab à des fins de traitement du cancer du sein

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150080417A (ko) * 2013-12-30 2015-07-09 경희대학교 산학협력단 링커를 통해 연결된 동일한 표적 물질에 결합하는 항체 및 앱타머를 포함하는 집게 분자 및 이의 용도
KR20170007806A (ko) * 2014-06-06 2017-01-20 레드우드 바이오사이언스 인코포레이티드 항-her2 항체-메이탄신 컨쥬게이트 및 이것의 사용 방법
KR20160032989A (ko) * 2014-09-17 2016-03-25 포항공과대학교 산학협력단 Her-2 표적화 압타머 복합체 및 이의 용도
KR20190066026A (ko) * 2016-10-07 2019-06-12 다이이찌 산쿄 가부시키가이샤 항 her2 항체-약물 콘주게이트 투여에 의한 내성암의 치료

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
.: "Target Aptamer-Development of Targeted Therapy for Breast Cancer Using Drug Delivery System. ", RESEARCH AND DEVELOPMENT PROJECT FOR HEALTH AND MEDICAL TECHNOLOGY, MINISTRY OF HEALTH & WELFARE., KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION, 14 October 2019 (2019-10-14), pages 1 - 337, XP055921599, [retrieved on 20220516] *

Also Published As

Publication number Publication date
KR102247908B1 (ko) 2021-05-06

Similar Documents

Publication Publication Date Title
Savona et al. Phase Ib study of glasdegib, a hedgehog pathway inhibitor, in combination with standard chemotherapy in patients with AML or high-risk MDS
EP2218712B1 (fr) Combinaison d'une substance antiangiogénique et d'un complexe de platine antitumoral
MXPA04005678A (es) Formas de sal de e-2 -metoxi -n- (3- (4- (3-metil -piridin-3- iloxil ) fenilamino) quinazolin -6-il) alil) alil) acetamida, su preparacion y su uso contra el cancer.
US20080038267A1 (en) Treatment Of Cancer
Ichikawa et al. The antitumor effects of the quinoline-3-carboxamide linomide on Dunning R-3327 rat prostatic cancers
US11248016B2 (en) Glycolipids and pharmaceutical compositions thereof for use in therapy
KR101653451B1 (ko) Her-2 표적화 압타머 복합체 및 이의 용도
CN115768423A (zh) Egfr、kras、braf和其他靶标的抑制剂及其用途
KR101825637B1 (ko) 암 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2022075509A1 (fr) Complexe médicament anticancéreux-aptamère de her2 et son utilisation
WO2019083172A1 (fr) Composition pharmaceutique permettant la prévention ou le traitement du cancer, contenant comme principes actifs de la streptonigrine et de la rapamycine
WO2005120480A1 (fr) Agent renforçant un effet antitumoral, agent antitumoral et procédé de thérapie pour le cancer
Sundberg et al. Combined effect of gefitinib ('Iressa', ZD1839) and targeted radiotherapy with 211 At-EGF
US8507443B2 (en) Anticancer agent
WO2021241862A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer, comprenant un inhibiteur d'inositol polyphosphate multikinase utilisé comme principe actif
Krauer et al. Antitumor effect of 2′-deoxy-5-fluorouridine conjugates against a murine thymoma and colon carcinoma xenografts
Han et al. Erythro-austrobailignan-6 down-regulates HER2/EGFR/integrinβ3 expression via p38 activation in breast cancer
JP2003532669A (ja) 高濃度グルタチオンを伴う腫瘍の治療における置換アクリロイルディスタマイシン誘導体の使用
AU2004296129A1 (en) CHP-gemcitabin combined agent and use thereof as anti-tumoural active substances
KR101824205B1 (ko) 암 예방 또는 치료용 약학적 조성물 및 이의 용도
KR101828997B1 (ko) 암 예방 또는 치료용 약학적 조성물 및 이의 용도
WO2020162686A1 (fr) Composition de prévention ou de traitement du cancer, contenant de la manassantine a et un inhibiteur de point de contrôle immunitaire ou un inhibiteur du récepteur du facteur de croissance épithélial
KR102561285B1 (ko) 신규 her3 억제제 및 이를 포함하는 암 예방 또는 치료용약학 조성물
US20190343820A1 (en) Combination therapies for treating cancer
KR102277435B1 (ko) 소라페닙 저항성 간암 치료용 조성물 및 소라페닙 내성 간암 치료에 대한 정보 제공 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20956824

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC

122 Ep: pct application non-entry in european phase

Ref document number: 20956824

Country of ref document: EP

Kind code of ref document: A1