WO2022075509A1 - Her2 aptamer-anticancer drug complex and use of same - Google Patents

Her2 aptamer-anticancer drug complex and use of same Download PDF

Info

Publication number
WO2022075509A1
WO2022075509A1 PCT/KR2020/013954 KR2020013954W WO2022075509A1 WO 2022075509 A1 WO2022075509 A1 WO 2022075509A1 KR 2020013954 W KR2020013954 W KR 2020013954W WO 2022075509 A1 WO2022075509 A1 WO 2022075509A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
her2
aptamer
pharmaceutical composition
anticancer
Prior art date
Application number
PCT/KR2020/013954
Other languages
French (fr)
Korean (ko)
Inventor
반창일
서재홍
김지영
김윤재
Original Assignee
주식회사 엠디엡투스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엠디엡투스 filed Critical 주식회사 엠디엡투스
Publication of WO2022075509A1 publication Critical patent/WO2022075509A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5365—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • A61K31/5513—1,4-Benzodiazepines, e.g. diazepam or clozapine
    • A61K31/5517—1,4-Benzodiazepines, e.g. diazepam or clozapine condensed with five-membered rings having nitrogen as a ring hetero atom, e.g. imidazobenzodiazepines, triazolam
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/24—Heavy metals; Compounds thereof
    • A61K33/243—Platinum; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/05—Dipeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers

Definitions

  • the present invention relates to a HER2 aptamer-anticancer drug complex and uses thereof, and more particularly, to a complex in which a HER2 aptamer consisting of SEQ ID NO: 1 targeting HER2-positive cancer is combined with an anticancer drug, and treatment of HER2-positive cancer using the same how, etc.
  • Cancer is one of the diseases that occupies the largest proportion of the causes of death of modern people. It is a disease caused by changes in normal cells due to mutations in genes caused by various causes. It refers to non-malignant tumors. Cancer is characterized by “uncontrolled cell growth”, and by this abnormal cell growth, a cell mass called a tumor is formed and penetrates into surrounding tissues, and in severe cases, it metastasizes to other organs of the body. . Cancer is an intractable chronic disease that causes pain to the patient and ultimately death, without being able to cure fundamentally in many cases even when treated with surgery, radiation, and drug therapy.
  • Drug treatment of cancer that is, anticancer drugs
  • cancer cells are effectively killed in the early stages to treat cancer, but eventually, cancer stem cells remaining in the body cannot be removed, resulting in cancer recurrence and/or Metastasis occurs actively, and eventually, problems showing resistance to existing anticancer therapies often occur.
  • the present inventors in order to significantly increase the therapeutic effect of HER2-positive cancer, not only can reduce side effects by targeting cancer cell lines with high HER2 expression, but also increase the therapeutic effect of the anticancer agent by effectively moving the anticancer agent into the cell, As a result of intensive research on effective anticancer agents that can significantly lower the incidence of cancer metastasis, recurrence, resistance to anticancer drugs, etc. by lowering the stem cell properties of stem cells, the present invention has been completed.
  • the present invention has been devised to solve the problems in the prior art as described above, and a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) including the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are combined
  • a HER2 aptamer Receptor tyrosine-protein kinase erbB-2 aptamer
  • An object of the present invention is to provide a pharmaceutical composition for preventing or treating HER2-positive cancer comprising as an active ingredient, and the like.
  • the present invention provides a pharmaceutical for the prevention or treatment of HER2-positive cancer comprising a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) including the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are bound as an active ingredient Provides an enemy composition.
  • a HER2 aptamer Receptor tyrosine-protein kinase erbB-2 aptamer
  • the anticancer substance is preferably maytansine derivatives, cisplatin, capecitabine, 5-fluorouracil, sub It may be auristatin derivatives, calicheamicin, duocarmycin, pyrrolobenzodiazepine, doxorubicin, SN-38, etc., and more preferably one of maytansine derivatives.
  • Mertansine which is a type, or an anticancer agent used for the treatment of cancer is not limited thereto.
  • the HER2-positive cancer is preferably breast cancer, stomach cancer, lung cancer, ovarian cancer, cervical cancer, endometrial cancer, vulvar cancer, bladder cancer, kidney cancer, prostate cancer, testicular cancer, penile cancer, gallbladder cancer , salivary adenocarcinoma, colorectal cancer, thyroid cancer, peritoneal cancer, liver cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, leukemia, malignant lymphoma, plasmacytoma, myeloma, sarcoma, etc., more preferably breast cancer or HER2 gene If the cancer is overexpressed, the present invention is not limited thereto.
  • the bond may be connected by a linker, and the linker is preferably thioether, disulfide, dipeptide, maleimidocaproyl, high It may be a drazone (hydrazone), a glucuronide linker, etc., and more preferably a Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker, or an aptamer and an anticancer substance. If there is a linker, it is not limited thereto.
  • the complex may include the HER2 aptamer and the anticancer substance in a weight ratio of preferably 1:0.5 to 200, more preferably, 1:1 to 1:100 by weight. may be included, but is not limited thereto.
  • the pharmaceutical composition targets HER-2 (Receptor tyrosine-protein kinase erbB-2).
  • the pharmaceutical composition is characterized by inhibiting the proliferation, survival, metastasis, recurrence, and anticancer drug resistance of cancer or cancer stem cells, cancer treatment caused by the pharmaceutical composition of the present invention
  • the effect is not limited thereto.
  • the present invention also provides a method for preventing or treating HER2-positive cancer comprising administering the pharmaceutical composition to a subject.
  • the present invention is a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) comprising the nucleotide sequence represented by SEQ ID NO: 1 and the use of a composition comprising a complex to which an anticancer substance is bound to prevent or treat HER2-positive cancer to provide.
  • HER2 aptamer Receptor tyrosine-protein kinase erbB-2 aptamer
  • the present invention is a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) containing the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are combined to produce a drug used for the prevention or treatment of HER2-positive cancer It provides a use for
  • the composition according to the present invention includes a complex in which a HER2-specific aptamer and an anti-cancer substance are bound as an active ingredient, and the HER2-specific aptamer acts specifically on HER2-positive cancer cells to introduce an anti-cancer agent into the cell to produce an anti-cancer agent.
  • the therapeutic effect be increased, but it is not toxic to cells in which the HER2 receptor does not exist, so side effects to anticancer drugs can be significantly reduced.
  • the therapeutic effect on HER2-positive carcinoma can be remarkably increased by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells.
  • FIG. 1 is a conceptual diagram schematically illustrating a method for synthesizing a HER2 aptamer-drug complex according to an embodiment of the present invention.
  • FIG. 2 is a view showing the results of ESI-MS confirmation of the molecular weight (A) of the HER2 aptamer and the molecular weight (B) of the HER2 aptamer-drug complex according to an embodiment of the present invention.
  • FIG. 3 is a view showing the results of confirming the anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention by flow cytometry.
  • FIG. 4 is a view showing the results of confirming the anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention by MTS assay.
  • FIG. 5 is a view showing the results of confirming the endocytosis of the HER2 aptamer-drug complex according to an embodiment of the present invention with Lyso Tracker Deep Red.
  • FIG. 6 is a view showing the results of confirming the cell death mechanism of the HER2 aptamer-drug complex according to an embodiment of the present invention by Western blotting.
  • FIG. 7 is a view showing the results of confirming the in vivo anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention using a mouse model.
  • FIG. 8 is a view showing the results of confirming the effect of suppressing Ki-67 expression and apoptosis of the HER2 aptamer-drug complex according to an embodiment of the present invention.
  • FIG. 9 is a view showing the results of confirming the ICD HER2 and cancer stem cell expression inhibitory effect of the HER2 aptamer-drug complex according to an embodiment of the present invention.
  • the HER2 aptamer-anticancer drug complex of the present invention is a complex in which a HER2 aptamer including the nucleotide sequence shown in SEQ ID NO: 1 and an anticancer substance are linked with an SMCC linker, and the HER2 aptamer effectively binds the anticancer drug to HER2-positive cancer cells.
  • a HER2 aptamer including the nucleotide sequence shown in SEQ ID NO: 1 and an anticancer substance are linked with an SMCC linker, and the HER2 aptamer effectively binds the anticancer drug to HER2-positive cancer cells.
  • aptamer refers to single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance.
  • ssDNA single-stranded DNA
  • RNA RNA having high specificity and affinity for a specific substance.
  • the previously developed method using an antibody takes a relatively long time and high cost because it is made using the immune system of a living body, and its stability is a problem because it is a protein, whereas an aptamer is relatively synthesized Since mass production is possible with a simple method and even cells, proteins, and even small organic substances can be target substances, new detection methods can be developed using them, and the specificity and stability are very high compared to the already developed antibodies.
  • a HER2 aptamer was used to induce a specific action only on HER2-positive cancer cells.
  • the aptamer may preferably consist of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
  • anticancer compound refers to a substance having anticancer activity capable of binding to an aptamer, preferably maytansine derivatives, cisplatin, capeci.
  • Tabine (capecitabine), 5-fluorouracil, auristatin derivatives, calicheamicin, duocarmycin, pyrrolobenzodiazepine, doxorubicin , SN-38, etc., more preferably mertansine, but not limited thereto, as long as it is an anticancer agent used for the treatment of cancer.
  • prevention refers to any action that suppresses or delays the onset of diseases such as cancer by administration of the composition according to the present invention.
  • treatment refers to any action in which symptoms such as cancer are improved or beneficially changed by administration of the composition according to the present invention.
  • the term “individual” refers to a subject to which the composition of the present invention can be administered, and the subject is not limited.
  • the term “pharmaceutical composition” may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition is intended for humans.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-free agents
  • a topical agent, solubilizer, isotonic agent, stabilizer, etc. may be mixed and used.
  • a base for topical administration, a base, excipient, lubricant, preservative, etc. may be used.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier for example, in the case of oral administration, tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. can be prepared in the form of, and in the case of injection, it can be prepared in the form of unit dose ampoules or multiple doses. there is.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like can be used.
  • it may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an e
  • the route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral or parenteral administration is preferable, for example, oral, intravenous, intramuscular, intraarticular, intrasynovial, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, intradermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, rectal, intrasternal, intralesional, intracranial, and the like.
  • the dosage of the pharmaceutical composition of the present invention may vary depending on the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. It may vary depending on factors, and it may be appropriately selected by those skilled in the art although it varies depending on the patient's condition, weight, degree of disease, drug form, administration route and period, and 0.0001 to 500 mg/kg or 0.001 to 0.001 to daily It can be administered at 500 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • HER2 aptamer 5'-AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA-3', SEQ ID NO: 1
  • a drug 10 g of amine-modified HER2 aptamer was dissolved in 0.1 M potassium phosphate buffer 4.05 g of N2'-deacetyl-N2'-[3-[[1-[[4-[[(2,5-dioxo-1-pyrrolidinyloxy) carbonyl]cyclohexyl]methyl]-2,5- dioxo-3-pyrrolidinyl]thio]-1-oxopropyl]-maytansine (DM1-SMCC, Cayman) was added and reacted at room temperature.
  • DM1-SMCC 5'-AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTC
  • the HER2 aptamer itself was identified as 26450.2 Da, and the HER2 aptamer-drug complex was identified as 27405.0 Da.
  • the final yield was confirmed to be 62.5%.
  • Example 2 HER2 aptamer-drug complex in vitro Check the anti-cancer effect
  • NMuMG a normal cell line that does not express HER2, SKBR3, a HER2-positive breast cancer cell line, and trastuzumab
  • a drug targeting HER2 The anticancer effect was confirmed using JIMT-1, a cell line resistant to More specifically, DM1 (Mertansine, anticancer drug alone experimental group), HER2 Ap (aptamer alone experimental group), and HER2-Ap-DM1 (HER2 aptamer-drug complex experimental group) were each treated at a concentration of 10 nM in each cell line. Then, incubated for 72 hours.
  • a control group (control, CTL) was treated with the same amount of DMSO. And the degree of apoptosis of cancer cells was measured through DNA content analysis using flow cytometry.
  • the cell cycle is divided into G1 (cell growth phase)-S (cell replication phase)-G2/M (cell division) depending on the amount of DNA in the cell.
  • G1 cell growth phase
  • S cell replication phase
  • G2/M cell division
  • DNA fragmentation occurs ( DNA fragmentation) appears, making DNA replication and division no longer possible, and the DNA content is significantly lower than that of G1, and as a result of such apoptosis, it appears on the cell cycle as Sub G1.
  • the results are shown in FIG. 3 .
  • HER2-specific Sub G1 appeared in the experimental group treated with the HER2 aptamer-drug complex.
  • the HER2-positive cell line SKBR3 50% or more of Sub G1 was confirmed.
  • Sub G1 (19.8%) appeared not only in HER2-positive cells but also in the normal cell line, NMuMG, indicating toxicity to normal cells, whereas in the case of HER2 aptamer-drug complex, cytotoxicity was not observed in normal cells. could confirm that it was not.
  • both DM1 and HER2 aptamer-drug complex were confirmed to exhibit cytotoxicity to JIMT-1, a trastuzumab-resistant breast cancer cell line, confirming the therapeutic potential for trastuzumab-resistant breast cancer.
  • the HER2 aptamer-drug complex specifically delivered DM1, an anticancer drug, to HER2-positive cells, had fewer side effects and excellent therapeutic efficacy, and could also treat trastuzumab-resistant breast cancer cells.
  • HER2 aptamer or HER2 aptamer-drug complex was added to each cell line at concentrations of 0, 0.1, 0.5, 1, 5, 10, 20 and 50 nM. After each treatment, the cells were cultured for 72 hours, and cell viability was confirmed through MTS assay. After that, all experiments were repeated at least three times, and the results were expressed as mean ⁇ standard deviation. Statistical significance was confirmed by Student's t-test, and if P ⁇ 0.05, it was judged to be statistically significant. * indicates P ⁇ 0.05, ** indicates P ⁇ 0.01, *** indicates P ⁇ 0.001, and NS (not significant) indicates no significance. The results are shown in FIG. 4 .
  • the HER2 aptamer itself had no anticancer effect, but the HER2 aptamer-drug complex exhibited an anticancer effect on the HER2-positive cell line.
  • the HER2 aptamer-drug complex synthesized in the same manner as in Example 1 moves into the cells of the HER2-positive cell line due to the HER2 aptamer
  • the HER2 aptamer or HER2 aptamer- The drug complex was treated at a concentration of 10 nM and incubated for 3 hours. Then, the distribution of lysosomes was confirmed by staining with Lyso Tracker Deep Red. The results are shown in FIG. 5 .
  • HER2 aptamer-drug complex was treated with 10 or 20 nM in BT474 and JIMT-1, which are HER2-positive breast cancer cell lines. and cultured for 72 hours.
  • DMSO was treated with the same amount, or 10 nM of HER2 aptamer alone was treated.
  • the activation of apoptosis-related factors was confirmed by Western blotting. The results are shown in FIG. 6 .
  • the HER2 aptamer-drug complex increased cleaved-caspase3/7 and cleaved-PARP, and decreased pro-PARP.
  • the HER2 aptamer-drug complex activates caspase-3/-7, a major factor in apoptosis, and induces fragmentation of PARP.
  • the HER2 aptamer-drug complex reduced the expression of HER2 receptor, HER3 receptor and phosphor-Akr (Ser473).
  • Example 5 HER2 aptamer-drug complex in vivo Confirmation of anticancer effect in
  • trastuzumab-resistant JIMT-1 cells (3x10 6 cells) were used in the mammary of 6-week-old Balb/c nude mice. They were xenografted on both sides (left and right) of the fat pad and bred with food and water. Animal breeding and all experimental procedures were conducted in accordance with the laws and regulations for animal experiments.
  • Ado-trastuzumab emtansine (T-DM1) at a concentration of 10 mg/kg, HER2 aptamer at a concentration of 2 mg/kg, and HER2 aptamer-drug complex After administration by intraperitoneal injection twice a week at a concentration of 1 mg/kg or 2 mg/kg for a total of 4 weeks, the size of the tumor was measured. As a control, DMSO was treated with the same amount. Statistical significance was confirmed by two-way ANOVA, and if P ⁇ 0.05, it was judged to be statistically significant. ** indicates P ⁇ 0.01, *** indicates P ⁇ 0.001. The results are shown in FIG. 7 .
  • the HER2 aptamer-drug complex significantly inhibited cancer growth.
  • T-DM1 it was confirmed that the growth of the tumor was promoted compared to the control group.
  • the HER2 aptamer-drug complex could act as a new therapeutic agent for HER2-positive cancer that has resistance to trastuzumab.
  • the HER2 aptamer-drug complex inhibits the expression of Ki-67, a cancer cell growth marker
  • the HER2 aptamer-drug complex (2 mg/kg) was administered in the same manner as in Example 5-1, and 4 weeks After euthanasia in tea, the tumor tissue was embedded in a paraffin block and immunohistochemical analysis was performed. And using Ki-67 antibody, Ki-67 positive cells were identified, and the degree of apoptosis was confirmed using TUNEL assay.
  • Statistical significance between groups was analyzed by one-way ANOVA and post-hoc test by Bonferroni's post hoc test. If P ⁇ 0.05, it was judged to be statistically significant. *** indicates P ⁇ 0.001. The results are shown in FIG. 8 .
  • the expression of Ki-67 was suppressed in the experimental group administered with the HER2 aptamer-drug complex, and it was confirmed that the number of TUNEL-positive cells was significantly increased, confirming that apoptosis was significantly increased.
  • the HER2 aptamer-drug complex inhibits the expression of ICD (intracellular domain) HER2 and cancer stem cells
  • the HER2 aptamer-drug complex was administered in the same manner as in Example 5-1, and at 4 weeks After euthanasia, tumor tissue was obtained.
  • the expression level of ICD HER2 and the ratio of cancer stem cells were confirmed using the ICD HER2 antibody 4B5 and the cancer stem cell factor CD44 antibody.
  • Statistical significance was confirmed by One-Way ANOVA, and if P ⁇ 0.05, it was judged to be statistically significant. * indicates P ⁇ 0.05, ** indicates P ⁇ 0.01, *** indicates P ⁇ 0.001.
  • the results are shown in FIG. 9 .
  • the HER2 aptamer-drug complex not only exhibited a therapeutic effect on HER2-positive cancer. It was confirmed that it can effectively inhibit cancer metastasis and recurrence by reducing the growth of cancer stem cells.
  • the HER2 aptamer and the drug are connected using an SMCC linker, and due to the HER2 aptamer, the HER2 aptamer reacts specifically to the HER2-positive cancer cell line and enters the cell.
  • an anticancer agent By effectively delivering an anticancer agent, it is possible to significantly increase the therapeutic effect on a cell line resistant to the anticancer agent, as well as significantly lower the side effect of the anticancer agent because it is not toxic to cells in which the HER2 receptor does not exist.
  • trastuzumab-resistant breast cancer showed a therapeutic effect on trastuzumab-resistant breast cancer, and the possibility of using it as a second or tertiary drug was confirmed for patients who are resistant to HER2 antibody drugs.
  • the therapeutic effect on HER2-positive carcinoma can be significantly increased by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells.
  • the present invention relates to a HER2 aptamer-anticancer drug complex and uses thereof, which respond specifically to a HER2-positive cancer cell line due to the HER2 aptamer and effectively deliver an anticancer agent into the cell, thereby providing a therapeutic effect on a cell line having resistance to an anticancer agent not only can significantly increase the HER2 receptor, but also show no toxicity to cells in which the HER2 receptor does not exist, thereby significantly reducing the side effects of anticancer drugs.
  • it showed a therapeutic effect on trastuzumab-resistant breast cancer, and the possibility of using it as a second or tertiary drug was confirmed for patients who are resistant to HER2 antibody drugs.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a HER2 aptamer-anticancer drug complex and to a use of same, and more specifically, to a complex in which a HER2 aptamer consisting of SEQ ID NO.: 1 targeting HER2-positive cancer and an anticancer drug are conjugated, and a treatment method for HER2-positive cancer using same.

Description

HER2 압타머-항암 약물 복합체 및 이의 용도HER2 aptamer-anticancer drug complex and uses thereof
본 발명은 HER2 압타머-항암 약물 복합체 및 이의 용도에 관한 것으로, 보다 구체적으로 HER2 양성 암을 표적으로 하는 서열번호 1로 이루어지는 HER2 압타머와 항암 약물을 결합시킨 복합체 및 이를 이용한 HER2 양성 암의 치료 방법 등에 관한 것이다.The present invention relates to a HER2 aptamer-anticancer drug complex and uses thereof, and more particularly, to a complex in which a HER2 aptamer consisting of SEQ ID NO: 1 targeting HER2-positive cancer is combined with an anticancer drug, and treatment of HER2-positive cancer using the same how, etc.
암은 현대인의 사망원인에서 가장 큰 비중을 차지하고 있는 질환 중 하나로서 여러가지 원인에 의하여 발생된 유전자의 돌연변이로 인하여 정상세포가 변화하여 발생된 질병으로서, 정상적인 세포의 분화, 증식, 성장 형태 등을 따르지 않는 종양 중 악성인 것을 지칭한다. 암이란, “제어되지 않은 세포성장”으로 특징지어지며, 이러한 비정상적인 세포 성장에 의해 종양 (tumor)이라고 불리는 세포 덩어리가 형성되어 주위의 조직으로 침투되고, 심한 경우에는 신체의 다른 기관으로 전이되기도 한다. 암은 수술, 방사선 및 약물 요법 등으로 치료를 하더라도 많은 경우에 근본적인 치유가 되지 못하고 환자에게 고통을 주며 궁극적으로는 죽음에 이르게 하는 난치성 만성질환이다.Cancer is one of the diseases that occupies the largest proportion of the causes of death of modern people. It is a disease caused by changes in normal cells due to mutations in genes caused by various causes. It refers to non-malignant tumors. Cancer is characterized by “uncontrolled cell growth”, and by this abnormal cell growth, a cell mass called a tumor is formed and penetrates into surrounding tissues, and in severe cases, it metastasizes to other organs of the body. . Cancer is an intractable chronic disease that causes pain to the patient and ultimately death, without being able to cure fundamentally in many cases even when treated with surgery, radiation, and drug therapy.
암의 약물 치료, 즉, 항암제는 일반적으로 세포 독성을 가지고 있는 화합물로서 암세포를 공격해 사멸시키는 방식으로 암을 치료하는데, 암세포뿐만 아니라 정상세포에도 손상을 주기 때문에 높은 부작용을 나타낸다. 또한, 이러한 약물들을 이용한 항암 치료의 경우에는 초기에는 효과적으로 암 세포가 사멸되어 암이 치료되는 것으로 보여지지만, 결국 체내에 남아있는 암 줄기세포 (cancer stem cell)는 제거하지 못해 암의 재발 및/또는 전이가 활발히 일어나며, 결국 기존의 항암요법에 대한 내성을 나타내는 문제점들이 종종 발생하고 있다.Drug treatment of cancer, that is, anticancer drugs, are generally cytotoxic compounds that attack and kill cancer cells. In addition, in the case of anticancer treatment using these drugs, cancer cells are effectively killed in the early stages to treat cancer, but eventually, cancer stem cells remaining in the body cannot be removed, resulting in cancer recurrence and/or Metastasis occurs actively, and eventually, problems showing resistance to existing anticancer therapies often occur.
한편, HER2 (Receptor tyrosine-protein kinase erbB-2)는 1987년 처음 밝혀진 이후, HER2 유전자가 과발현된 암 환자의 경우 정상인 환자에 비하여 무병생존기간이 짧고 재발율이 높다는 것이 확인되며, 이를 표적으로 하는 다양한 항암제에 대한 연구가 활발히 진행되고 있으나, 여전히 항암제에 대한 내성 등의 발생 등의 이유로 치료 효과가 높지 않다(대한민국 특허공개번호 10-2013-0091750). On the other hand, since HER2 (Receptor tyrosine-protein kinase erbB-2) was first discovered in 1987, it was confirmed that cancer patients overexpressing the HER2 gene had shorter disease-free survival and a higher recurrence rate than normal patients. Although research on anticancer drugs is being actively conducted, the therapeutic effect is still not high due to the occurrence of resistance to anticancer drugs, etc. (Korean Patent Publication No. 10-2013-0091750).
따라서, 본 발명자들은 HER2 양성 암의 치료 효과를 현저히 높이기 위하여, HER2의 발현이 높은 암세포주를 표적으로 하여 부작용을 낮출 수 있을 뿐만 아니라, 항암제를 효과적으로 세포 내로 이동시켜 항암제의 치료 효과를 높이고, 암줄기세포의 줄기세포성을 낮추어 암의 전이, 재발, 항암제 내성 등의 발생률을 현저히 낮출 수 있는 효과적인 항암제에 대하여 예의 연구한 결과, 본 발명을 완성하였다.Therefore, in order to significantly increase the therapeutic effect of HER2-positive cancer, the present inventors not only can reduce side effects by targeting cancer cell lines with high HER2 expression, but also increase the therapeutic effect of the anticancer agent by effectively moving the anticancer agent into the cell, As a result of intensive research on effective anticancer agents that can significantly lower the incidence of cancer metastasis, recurrence, resistance to anticancer drugs, etc. by lowering the stem cell properties of stem cells, the present invention has been completed.
본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로, 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체를 유효성분으로 포함하는 HER2 양성 암의 예방 또는 치료용 약학적 조성물 등을 제공하는 것을 그 목적으로 한다.The present invention has been devised to solve the problems in the prior art as described above, and a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) including the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are combined An object of the present invention is to provide a pharmaceutical composition for preventing or treating HER2-positive cancer comprising as an active ingredient, and the like.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned can be clearly understood by those of ordinary skill in the art to which the present invention belongs from the following description. will be.
본 발명은 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체를 유효성분으로 포함하는 HER2 양성 암의 예방 또는 치료용 약학적 조성물을 제공한다.The present invention provides a pharmaceutical for the prevention or treatment of HER2-positive cancer comprising a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) including the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are bound as an active ingredient Provides an enemy composition.
본 발명의 일 구체예에 있어서, 상기 항암 물질은 바람직하게는 마이탄신 유도체 (maytansine derivatives), 씨스플라틴 (cisplatin), 카페시타빈 (capecitabine), 5-플루오로우라실 (5-fluorouracil), 아우리스타틴 유도체 (auristatin derivatives), 칼리키아미신 (calicheamicin), 듀오카마이신 (duocarmycin), 파이롤로벤조디아제핀 (pyrrolobenzodiazepine), 독소루비신 (doxorubicin), SN-38 등일 수 있으며, 더욱 바람직하게는 마이탄신 유도체의 한 종류인 메르탄신이나, 암의 치료에 사용되고 있는 항암제라면 이에 제한되지 않는다.In one embodiment of the present invention, the anticancer substance is preferably maytansine derivatives, cisplatin, capecitabine, 5-fluorouracil, sub It may be auristatin derivatives, calicheamicin, duocarmycin, pyrrolobenzodiazepine, doxorubicin, SN-38, etc., and more preferably one of maytansine derivatives. Mertansine, which is a type, or an anticancer agent used for the treatment of cancer is not limited thereto.
본 발명의 다른 구체예에 있어서, 상기 HER2 양성 암은 바람직하게는 유방암, 위암, 폐암, 난소암, 자궁경부암, 자궁내막암, 외음부암, 방광암, 신장암, 전립선암, 고환암, 음경암, 담낭암, 타액선암, 결장직장암, 갑상선암, 복막암, 간암, 췌장암, 두경부암, 흑색종, 교모세포종, 백혈병, 악성 림프종, 형질세포종, 골수종, 육종 등일 수 있으며, 더욱 바람직하게는 유방암이나, HER2 유전자가 과발현되는 암이라면 이에 제한되지 않는다.In another embodiment of the present invention, the HER2-positive cancer is preferably breast cancer, stomach cancer, lung cancer, ovarian cancer, cervical cancer, endometrial cancer, vulvar cancer, bladder cancer, kidney cancer, prostate cancer, testicular cancer, penile cancer, gallbladder cancer , salivary adenocarcinoma, colorectal cancer, thyroid cancer, peritoneal cancer, liver cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, leukemia, malignant lymphoma, plasmacytoma, myeloma, sarcoma, etc., more preferably breast cancer or HER2 gene If the cancer is overexpressed, the present invention is not limited thereto.
본 발명의 또 다른 구체예에 있어서, 상기 결합은 링커로 연결될 수 있으며, 상기 링커는 바람직하게는 싸이오에터 (thioether), 다이설파이드 (disulfide), 다이펩타이드, 말레이미도카프로일 (Maleimidocaproyl), 하이드라존 (hydrazone), 글루쿠로나이드 (glucuronide) 링커 등일 수 있으며, 더욱 바람직하게는 Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker 이나, 압타머와 항암 물질을 연결할 수 있는 링커라면 이에 제한되지 않는다.In another embodiment of the present invention, the bond may be connected by a linker, and the linker is preferably thioether, disulfide, dipeptide, maleimidocaproyl, high It may be a drazone (hydrazone), a glucuronide linker, etc., and more preferably a Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker, or an aptamer and an anticancer substance. If there is a linker, it is not limited thereto.
본 발명의 또 다른 구체예에 있어서, 상기 복합체는 HER2 압타머 및 항암 물질을 바람직하게는 1 : 0.5 내지 200의 중량비로 포함할 수 있으며, 더욱 바람직하게는, 1 : 1 내지 1 : 100의 중량비로 포함될 수 있으나, 이에 제한되지 않는다.In another embodiment of the present invention, the complex may include the HER2 aptamer and the anticancer substance in a weight ratio of preferably 1:0.5 to 200, more preferably, 1:1 to 1:100 by weight. may be included, but is not limited thereto.
본 발명의 또 다른 구체예에 있어서, 상기 약학적 조성물은 HER-2 (Receptor tyrosine-protein kinase erbB-2)를 표적으로 한다.In another embodiment of the present invention, the pharmaceutical composition targets HER-2 (Receptor tyrosine-protein kinase erbB-2).
본 발명의 또 다른 구체예에 있어서, 상기 약학적 조성물은 암 또는 암줄기세포의 증식, 생존, 전이, 재발, 항암제 내성을 억제하는 것을 특징으로 하나, 본 발명의 약학적 조성물에 의하여 발생되는 암 치료 효과라면 이에 제한되지 않는다.In another embodiment of the present invention, the pharmaceutical composition is characterized by inhibiting the proliferation, survival, metastasis, recurrence, and anticancer drug resistance of cancer or cancer stem cells, cancer treatment caused by the pharmaceutical composition of the present invention The effect is not limited thereto.
또한 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 HER2 양성 암의 예방 또는 치료 방법을 제공한다.The present invention also provides a method for preventing or treating HER2-positive cancer comprising administering the pharmaceutical composition to a subject.
또한 본 발명은 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체를 포함하는 조성물의 HER2 양성 암의 예방 또는 치료 용도를 제공한다.In addition, the present invention is a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) comprising the nucleotide sequence represented by SEQ ID NO: 1 and the use of a composition comprising a complex to which an anticancer substance is bound to prevent or treat HER2-positive cancer to provide.
또한 본 발명은 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체의 HER2 양성 암의 예방 또는 치료에 이용되는 약제를 생산하기 위한 용도를 제공한다.In addition, the present invention is a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) containing the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance are combined to produce a drug used for the prevention or treatment of HER2-positive cancer It provides a use for
본 발명에 따른 조성물은 HER2 특이적 압타머 및 항암 물질을 결합시킨 복합체를 유효성분으로 포함하며, 상기 HER2 특이적 압타머로 인하여 HER2 양성 암세포에 특이적으로 작용하여 세포 내부로 항암제를 유입시켜 항암제의 치료 효과를 높일 수 있을 뿐만 아니라, HER2 수용체가 존재하지 않는 세포에 대해서는 독성을 나타내지 않으므로 항암제에 대한 부작용을 현저히 낮출 수 있다. 또한, 암줄기세포의 줄기세포성을 감소시킴으로써 암의 증식, 암의 재발, 암의 전이, 항암제 내성 등을 효과적으로 억제함으로써, HER2 양성 암종에 대한 치료 효과를 현저히 높일 수 있다는 것을 확인하였다.The composition according to the present invention includes a complex in which a HER2-specific aptamer and an anti-cancer substance are bound as an active ingredient, and the HER2-specific aptamer acts specifically on HER2-positive cancer cells to introduce an anti-cancer agent into the cell to produce an anti-cancer agent. Not only can the therapeutic effect be increased, but it is not toxic to cells in which the HER2 receptor does not exist, so side effects to anticancer drugs can be significantly reduced. In addition, it was confirmed that the therapeutic effect on HER2-positive carcinoma can be remarkably increased by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells.
도 1은 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 합성 방법을 간략하게 나타낸 개념도이다.1 is a conceptual diagram schematically illustrating a method for synthesizing a HER2 aptamer-drug complex according to an embodiment of the present invention.
도 2는 본 발명의 일 실시예에 따른 HER2 압타머의 분자량 (A)과 HER2 압타머-약물 복합체의 분자량 (B)을 ESI-MS로 확인한 결과를 나타낸 도면이다.2 is a view showing the results of ESI-MS confirmation of the molecular weight (A) of the HER2 aptamer and the molecular weight (B) of the HER2 aptamer-drug complex according to an embodiment of the present invention.
도 3은 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 항암 효과를 flow cytometry로 확인한 결과를 나타낸 도면이다.3 is a view showing the results of confirming the anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention by flow cytometry.
도 4는 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 항암 효과를 MTS assay로 확인한 결과를 나타낸 도면이다.4 is a view showing the results of confirming the anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention by MTS assay.
도 5는 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 내포작용을 Lyso Tracker Deep Red로 확인한 결과를 나타낸 도면이다.5 is a view showing the results of confirming the endocytosis of the HER2 aptamer-drug complex according to an embodiment of the present invention with Lyso Tracker Deep Red.
도 6은 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 세포 사멸 기작을 웨스턴 블롯팅으로 확인한 결과를 나타낸 도면이다.6 is a view showing the results of confirming the cell death mechanism of the HER2 aptamer-drug complex according to an embodiment of the present invention by Western blotting.
도 7은 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 in vivo에서의 항암 효과를 마우스 모델을 이용하여 확인한 결과를 나타낸 도면이다.7 is a view showing the results of confirming the in vivo anticancer effect of the HER2 aptamer-drug complex according to an embodiment of the present invention using a mouse model.
도 8은 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 Ki-67 발현 억제 및 세포 사멸 효과를 확인한 결과를 나타낸 도면이다.8 is a view showing the results of confirming the effect of suppressing Ki-67 expression and apoptosis of the HER2 aptamer-drug complex according to an embodiment of the present invention.
도 9는 본 발명의 일 실시예에 따른 HER2 압타머-약물 복합체의 ICD HER2 및 암줄기세포 발현 억제 효과를 확인한 결과를 나타낸 도면이다.9 is a view showing the results of confirming the ICD HER2 and cancer stem cell expression inhibitory effect of the HER2 aptamer-drug complex according to an embodiment of the present invention.
본 발명의 HER2 압타머-항암 약물 복합체는 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머와 항암 물질을 SMCC 링커로 연결시킨 복합체로서, HER2 압타머에 의하여 항암 약물을 효과적으로 HER2 양성 암세포의 내부로 전달하여, 암의 증식을 효과적으로 억제할 수 있을 뿐만 아니라, 암줄기세포의 증식을 억제함으로써 암의 전이, 암의 재발, 항암제에 대한 내성을 효과적으로 감소시킴으로써 HER2 양성 암에 대한 치료 효과를 현저히 높일 수 있다.The HER2 aptamer-anticancer drug complex of the present invention is a complex in which a HER2 aptamer including the nucleotide sequence shown in SEQ ID NO: 1 and an anticancer substance are linked with an SMCC linker, and the HER2 aptamer effectively binds the anticancer drug to HER2-positive cancer cells. By delivering to the inside, not only can it effectively inhibit the proliferation of cancer, but also it can significantly increase the therapeutic effect on HER2-positive cancer by effectively reducing cancer metastasis, cancer recurrence, and resistance to anticancer drugs by inhibiting the proliferation of cancer stem cells. can
본 명세서에 있어서, "압타머 (aptamer)"란 특정 물질에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA (ssDNA) 또는 RNA를 총칭한다. 기존에 개발되어 있는 항체를 이용한 방법은 생체의 면역시스템을 이용하여 만들어지기 때문에 비교적 많은 시간이 들고 고비용이라는 점, 단백질이기 때문에 그 안정성이 문제가 되는 경우가 있는 반면, 압타머는 합성에 있어서, 비교적 단순한 방법으로 대량생산이 가능하고 세포, 단백질 그리고 작은 유기물질까지도 표적물질이 될 수 있기 때문에 이를 이용한 새로운 검출방법들의 개발이 가능하며, 그 특이성 및 안정성이 이미 개발되어 있는 항체에 비해 매우 높다. 본 발명에서는 HER2 양성 (positive) 암세포에만 특이적인 작용을 유도하기 위하여 HER2 압타머를 이용하였다. 상기 압타머는 바람직하게는 서열번호 1의 염기서열로 이루어 질 수 있으나, 이에 제한되는 것은 아니다.As used herein, the term "aptamer" refers to single-stranded DNA (ssDNA) or RNA having high specificity and affinity for a specific substance. The previously developed method using an antibody takes a relatively long time and high cost because it is made using the immune system of a living body, and its stability is a problem because it is a protein, whereas an aptamer is relatively synthesized Since mass production is possible with a simple method and even cells, proteins, and even small organic substances can be target substances, new detection methods can be developed using them, and the specificity and stability are very high compared to the already developed antibodies. In the present invention, a HER2 aptamer was used to induce a specific action only on HER2-positive cancer cells. The aptamer may preferably consist of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
본 명세서에 있어서, "항암 물질 (anticancer compound)"이란 압타머와 결합시킬 수 있는 항암 활성을 가지는 물질을 총칭하며, 바람직하게는 마이탄신 유도체 (maytansine derivatives), 씨스플라틴 (cisplatin), 카페시타빈 (capecitabine), 5-플루오로우라실 (5-fluorouracil), 아우리스타틴 유도체 (auristatin derivatives), 칼리키아미신 (calicheamicin), 듀오카마이신 (duocarmycin), 파이롤로벤조디아제핀 (pyrrolobenzodiazepine), 독소루비신 (doxorubicin), SN-38 등일 수 있으며, 더욱 바람직하게는 메르탄신이나, 암의 치료에 사용되고 있는 항암제라면 이에 제한되지 않는다.As used herein, the term “anticancer compound” refers to a substance having anticancer activity capable of binding to an aptamer, preferably maytansine derivatives, cisplatin, capeci. Tabine (capecitabine), 5-fluorouracil, auristatin derivatives, calicheamicin, duocarmycin, pyrrolobenzodiazepine, doxorubicin , SN-38, etc., more preferably mertansine, but not limited thereto, as long as it is an anticancer agent used for the treatment of cancer.
본 명세서에 있어서, “예방 (prevention)”이란 본 발명에 따른 조성물의 투여에 의해 암 등의 질환을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.As used herein, “prevention” refers to any action that suppresses or delays the onset of diseases such as cancer by administration of the composition according to the present invention.
본 명세서에 있어서, “치료 (treatment)”란 본 발명에 따른 조성물의 투여에 의해 암 등의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다. As used herein, “treatment” refers to any action in which symptoms such as cancer are improved or beneficially changed by administration of the composition according to the present invention.
본 명세서에 있어서, “개체 (individual)”란 본 발명의 조성물이 투여될 수 있는 대상을 말하며, 그 대상에는 제한이 없다. As used herein, the term “individual” refers to a subject to which the composition of the present invention can be administered, and the subject is not limited.
본 명세서에 있어서, “약학적 조성물 (pharmaceutical composition)”이란 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용가능한 담체는 경구투여시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용가능한 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구투여시에는 정제, 트로키, 캡슐, 엘릭서 (elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 당의정, 겔, 환제, 산제, 과립제, 좌제, 외용제, 용액, 현탁액, 서방형 제제, 슬러리 등으로 제형화하여 사용할 수도 있다. 한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.As used herein, the term “pharmaceutical composition” may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition is intended for humans. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-free agents A topical agent, solubilizer, isotonic agent, stabilizer, etc. may be mixed and used. For topical administration, a base, excipient, lubricant, preservative, etc. may be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. can be prepared in the form of, and in the case of injection, it can be prepared in the form of unit dose ampoules or multiple doses. there is. In addition, it may be formulated and used as dragees, gels, pills, powders, granules, suppositories, external preparations, solutions, suspensions, sustained-release preparations, slurries, and the like. Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like can be used. In addition, it may further include a filler, an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, a preservative, and the like.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 경구 또는 비경구 투여가 바람직하며, 예를 들어, 구강, 정맥내, 근육내, 관절내, 활액낭내, 동맥내, 골수내, 경막내, 심장내, 경피, 피내, 피하, 복강내, 비강내, 장관, 국소, 설하, 직장, 흉골내, 병소내, 두개골내 등이 포함된다. The route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral or parenteral administration is preferable, for example, oral, intravenous, intramuscular, intraarticular, intrasynovial, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, intradermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, rectal, intrasternal, intralesional, intracranial, and the like.
본 발명의 약학적 조성물의 투여량은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 500 mg/kg 또는 0.001 내지 500 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The dosage of the pharmaceutical composition of the present invention may vary depending on the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. It may vary depending on factors, and it may be appropriately selected by those skilled in the art although it varies depending on the patient's condition, weight, degree of disease, drug form, administration route and period, and 0.0001 to 500 mg/kg or 0.001 to 0.001 to daily It can be administered at 500 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.
[실시예][Example]
실시예 1: HER2 압타머-약물 복합체의 합성Example 1: Synthesis of HER2 aptamer-drug complex
HER2 압타머 (HER2 aptamer; 5'-AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA-3', 서열번호 1) 및 약물의 복합체를 합성하기 위하여, 0.1 M의 potassium phosphate buffer에 10 g의 amine-modified HER2 압타머를 용해시키고, 용해된 HER2 압타머에 4.05 g의 N2'-deacetyl-N2'-[3-[[1-[[4-[[(2,5-dioxo-1-pyrrolidinyloxy) carbonyl]cyclohexyl]methyl]-2,5-dioxo-3-pyrrolidinyl]thio]-1-oxopropyl]-maytansine (DM1-SMCC, Cayman)을 첨가하고 실온에서 반응시켰다. 그리고 isocratic High Performance Liquid Chromatography (JAI LC-500NEXT, samyang)와 reverse-phase c19 column (JAIGEL-ODS-AP-50LSP, 50 mm inner diameter (I.D.) x 500 mm, 20 μm)을 사용하여 recycling 기법으로 정제를 진행하였다. 보다 자세하게는, 이동상 완충용액 (mobile phase buffer)으로 0.1 M TEAA (Triethylammonium acetate) 및 25% (v/v) acetonitrile을 사용하였고, 100 mL/min의 유속 (flow rate)으로 진행하였으며, 대량 정제된 HER2 압타머-약물 복합체는 freeze dryer (FDU-8624, Operon)를 사용하여 동결 건조하였다. 대략적인 합성 과정은 도 1에 나타내었다. 그리고 합성된 HER2 압타머-약물 복합체를 확인하기 위하여, ESI-MS를 사용하여 HER2 압타머와 HER2 압타머-약물 복합체의 분자량을 각각 확인하였다. 그 결과는 도 2에 나타내었다.To synthesize a complex of HER2 aptamer (HER2 aptamer; 5'-AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA-3', SEQ ID NO: 1) and a drug, 10 g of amine-modified HER2 aptamer was dissolved in 0.1 M potassium phosphate buffer 4.05 g of N2'-deacetyl-N2'-[3-[[1-[[4-[[(2,5-dioxo-1-pyrrolidinyloxy) carbonyl]cyclohexyl]methyl]-2,5- dioxo-3-pyrrolidinyl]thio]-1-oxopropyl]-maytansine (DM1-SMCC, Cayman) was added and reacted at room temperature. And purified by recycling technique using isocratic High Performance Liquid Chromatography (JAI LC-500NEXT, samyang) and reverse-phase c19 column (JAIGEL-ODS-AP-50LSP, 50 mm inner diameter (I.D.) x 500 mm, 20 μm) proceeded. More specifically, 0.1 M TEAA (Triethylammonium acetate) and 25% (v/v) acetonitrile were used as a mobile phase buffer, and it was carried out at a flow rate of 100 mL/min. The HER2 aptamer-drug complex was freeze-dried using a freeze dryer (FDU-8624, Operon). The approximate synthesis process is shown in FIG. 1 . And in order to confirm the synthesized HER2 aptamer-drug complex, the molecular weights of the HER2 aptamer and the HER2 aptamer-drug complex were respectively confirmed using ESI-MS. The results are shown in FIG. 2 .
도 2에 나타난 바와 같이, HER2 압타머 자체는 26450.2 Da으로 확인되었으며, HER2 압타머-약물 복합체는 27405.0 Da으로 확인되었다. 또한, 최종 수득률은 62.5%로 확인되었다. 상기 결과를 통하여, HER2 압타머-약물 복합체 (HER2 압타머-MCC- Mertansine)가 정상적으로 제조된 것을 확인할 수 있었다.As shown in FIG. 2 , the HER2 aptamer itself was identified as 26450.2 Da, and the HER2 aptamer-drug complex was identified as 27405.0 Da. In addition, the final yield was confirmed to be 62.5%. Through the above results, it was confirmed that the HER2 aptamer-drug complex (HER2 aptamer-MCC- Mertansine) was normally prepared.
실시예 2: HER2 압타머-약물 복합체의 Example 2: HER2 aptamer-drug complex in vitroin vitro 항암 효과 확인 Check the anti-cancer effect
실시예 1과 동일한 방법으로 합성한 HER2 압타머-약물 복합체의 항암 효과를 확인하기 위하여, HER2가 발현되지 않는 정상 세포주인 NMuMG, HER2 양성 유방암 세포주인 SKBR3, 그리고 HER2를 표적으로 하는 약물인 trastuzumab에 대한 내성을 가지고 있는 세포주인 JIMT-1을 이용하여 항암 효과를 확인하였다. 보다 자세하게는, 각각의 세포주에 DM1 (Mertansine, 항암제 단독 실험군), HER2 Ap (압타머 단독 실험군), 및 HER2-Ap-DM1 (HER2 압타머-약물 복합체 실험군)을 각각 10 nM의 농도로 처리한 후, 72 시간 동안 배양하였다. 대조군 (control, CTL)은 DMSO를 동량 처리하였다. 그리고 유세포 측정기 (flow cytometry)를 이용하여 암세포의 사멸 정도를 DNA 함량분석을 통하여 측정하였다. 일반적으로 세포주기 (cell cycle)는 세포내 DNA의 함량에 따라 G1 (세포성장기)-S (세포복제기)-G2/M (세포분열기)로 나뉘어지는데, 세포사멸이 유도되면, DNA의 절편현상 (DNA fragmentation)이 나타나 더 이상 DNA 복제 및 분열이 불가능해지며, DNA의 함량이 G1보다 현저히 적어지게 되고, 이러한 세포사멸의 결과로 Sub G1으로써 세포 주기상에 나타나게 된다. 그 결과는 도 3에 나타내었다.In order to confirm the anticancer effect of the HER2 aptamer-drug complex synthesized in the same manner as in Example 1, NMuMG, a normal cell line that does not express HER2, SKBR3, a HER2-positive breast cancer cell line, and trastuzumab, a drug targeting HER2 The anticancer effect was confirmed using JIMT-1, a cell line resistant to More specifically, DM1 (Mertansine, anticancer drug alone experimental group), HER2 Ap (aptamer alone experimental group), and HER2-Ap-DM1 (HER2 aptamer-drug complex experimental group) were each treated at a concentration of 10 nM in each cell line. Then, incubated for 72 hours. A control group (control, CTL) was treated with the same amount of DMSO. And the degree of apoptosis of cancer cells was measured through DNA content analysis using flow cytometry. In general, the cell cycle is divided into G1 (cell growth phase)-S (cell replication phase)-G2/M (cell division) depending on the amount of DNA in the cell. When apoptosis is induced, DNA fragmentation occurs ( DNA fragmentation) appears, making DNA replication and division no longer possible, and the DNA content is significantly lower than that of G1, and as a result of such apoptosis, it appears on the cell cycle as Sub G1. The results are shown in FIG. 3 .
도 3에 나타난 바와 같이, HER2 압타머-약물 복합체를 처리한 실험군에서 HER2 특이적으로 Sub G1이 나타나는 것을 확인하였다. 특히, HER2 양성 세포주인 SKBR3에서는 50% 이상의 Sub G1이 확인되었다. 그러나 DM1의 경우에는 HER2 양성 세포뿐만 아니라, 정상 세포주인 NMuMG에서도 Sub G1 (19.8%)이 나타나, 정상 세포에 대한 독성을 나타내는 반면, HER2 압타머-약물 복합체의 경우에는 정상 세포에서는 세포 독성이 나타나지 않는 것을 확인할 수 있었다. 뿐만 아니라, DM1과 HER2 압타머-약물 복합체 모두 trastuzumab 저항성 유방암 세포주인 JIMT-1에 대한 세포독성을 나타내는 것으로 확인되어, trastuzumab 저항성 유방암에 대한 치료 가능성도 확인할 수 있었다. 상기 결과를 통하여, HER2 압타머-약물 복합체는 항암 약물인 DM1을 HER2 양성 세포에 특이적으로 전달하여 부작용이 적고 치료효능이 뛰어나며, trastuzumab 저항성 유방암 세포도 치료 가능하다는 사실을 확인할 수 있었다.As shown in FIG. 3 , it was confirmed that HER2-specific Sub G1 appeared in the experimental group treated with the HER2 aptamer-drug complex. In particular, in the HER2-positive cell line SKBR3, 50% or more of Sub G1 was confirmed. However, in the case of DM1, Sub G1 (19.8%) appeared not only in HER2-positive cells but also in the normal cell line, NMuMG, indicating toxicity to normal cells, whereas in the case of HER2 aptamer-drug complex, cytotoxicity was not observed in normal cells. could confirm that it was not. In addition, both DM1 and HER2 aptamer-drug complex were confirmed to exhibit cytotoxicity to JIMT-1, a trastuzumab-resistant breast cancer cell line, confirming the therapeutic potential for trastuzumab-resistant breast cancer. Through the above results, it was confirmed that the HER2 aptamer-drug complex specifically delivered DM1, an anticancer drug, to HER2-positive cells, had fewer side effects and excellent therapeutic efficacy, and could also treat trastuzumab-resistant breast cancer cells.
HER2 압타머-약물 복합체의 항암 효과를 보다 자세히 확인하기 위하여, 각각의 세포주에 HER2 압타머 또는 HER2 압타머-약물 복합체를 0, 0.1, 0.5, 1, 5, 10, 20 및 50 nM의 농도로 각각 처리한 다음 72 시간 동안 배양하고, MTS assay를 통하여 세포의 생존률을 확인하였다. 이후 모든 실험은 최소 세 번 이상 반복하였으며, 결과는 평균값 ± 표준편차로 나타내었다. 통계적 유의성은 Student's t-test로 확인하였고, P < 0.05이면, 통계적으로 유의성이 있다고 판단하였다. *는 P < 0.05, **는 P < 0.01, ***는 P < 0.001을 나타내고, NS (not significant)는 유의성이 없음을 나타낸다. 그 결과는 도 4에 나타내었다. In order to confirm the anticancer effect of the HER2 aptamer-drug complex in more detail, HER2 aptamer or HER2 aptamer-drug complex was added to each cell line at concentrations of 0, 0.1, 0.5, 1, 5, 10, 20 and 50 nM. After each treatment, the cells were cultured for 72 hours, and cell viability was confirmed through MTS assay. After that, all experiments were repeated at least three times, and the results were expressed as mean ± standard deviation. Statistical significance was confirmed by Student's t-test, and if P < 0.05, it was judged to be statistically significant. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and NS (not significant) indicates no significance. The results are shown in FIG. 4 .
도 4에 나타난 바와 같이, HER2 압타머 자체에는 항암 효과가 없으나, HER2 압타머-약물 복합체는 HER2 양성 세포주에 대하여 항암 효과를 나타내는 것을 확인하였다.As shown in FIG. 4 , it was confirmed that the HER2 aptamer itself had no anticancer effect, but the HER2 aptamer-drug complex exhibited an anticancer effect on the HER2-positive cell line.
실시예 3: HER2 압타머-약물 복합체의 세포 내 유입 확인Example 3: Confirmation of intracellular entry of HER2 aptamer-drug complex
실시예 1과 동일한 방법으로 합성한 HER2 압타머-약물 복합체가 HER2 압타머로 인하여, HER2 양성 세포주의 세포 내부로 이동하는지 확인하기 위하여, HER2 양성 유방암 세포주인 BT474 세포주에 HER2 압타머 또는 HER2 압타머-약물 복합체를 10 nM의 농도로 처리하고 3 시간 동안 배양하였다. 그리고 Lyso Tracker Deep Red로 염색하여 lysosome의 분포를 확인하였다. 그 결과는 도 5에 나타내었다. In order to check whether the HER2 aptamer-drug complex synthesized in the same manner as in Example 1 moves into the cells of the HER2-positive cell line due to the HER2 aptamer, the HER2 aptamer or HER2 aptamer- The drug complex was treated at a concentration of 10 nM and incubated for 3 hours. Then, the distribution of lysosomes was confirmed by staining with Lyso Tracker Deep Red. The results are shown in FIG. 5 .
도 5에 나타난 바와 같이, 대조군에서는 lysosome이 거의 관찰되지 않는 반면, HER2 압타머 또는 HER2 압타머-약물 복합체를 처리한 실험군에서는 lysosome이 파괴되어 세포 내부에 있는 효소가 세포질 중으로 방출되는 것 (황색 화살표)을 확인하였다. 상기 결과를 통하여, HER2 압타머는 HER2 양성 세포주에서 HER2를 인식함으로써 내포작용 (endocytosis)을 통해 항암제를 세포 내부로 이동시킬 수 있다는 것을 확인할 수 있었다.As shown in FIG. 5 , lysosome was hardly observed in the control group, whereas in the experimental group treated with HER2 aptamer or HER2 aptamer-drug complex, the lysosome was destroyed and the enzyme inside the cell was released into the cytoplasm (yellow arrow) ) was confirmed. Through the above results, it was confirmed that the HER2 aptamer can move the anticancer agent into the cell through endocytosis by recognizing HER2 in the HER2-positive cell line.
실시예 4: HER2 압타머-약물 복합체의 세포 사멸 기작 확인Example 4: Confirmation of apoptosis mechanism of HER2 aptamer-drug complex
실시예 1과 동일한 방법으로 합성한 HER2 압타머-약물 복합체가 세포 사멸을 나타내는 기작을 확인하기 위하여, HER2 양성 유방암 세포주인 BT474와 JIMT-1에 HER2 압타머-약물 복합체를 10 또는 20 nM로 처리하고, 72 시간 동안 배양하였다. 대조군으로는 DMSO를 동량 처리하거나, HER2 압타머를 단독으로 10 nM을 처리하였다. 그리고 세포 사멸 관련 인자들의 활성화를 웨스턴 블롯팅으로 확인하였다. 그 결과는 도 6에 나타내었다.In order to confirm the mechanism by which the HER2 aptamer-drug complex synthesized in the same manner as in Example 1 exhibits apoptosis, HER2 aptamer-drug complex was treated with 10 or 20 nM in BT474 and JIMT-1, which are HER2-positive breast cancer cell lines. and cultured for 72 hours. As a control group, DMSO was treated with the same amount, or 10 nM of HER2 aptamer alone was treated. And the activation of apoptosis-related factors was confirmed by Western blotting. The results are shown in FIG. 6 .
도 6에 나타난 바와 같이, HER2 압타머-약물 복합체는 cleaved-caspase3/7과 cleaved-PARP를 증가시키며, pro-PARP는 감소시키는 것을 확인하였다. 이를 통하여, HER2 압타머-약물 복합체가 세포 사멸의 주요 인자인 caspase-3/-7을 활성화 시키며, PARP의 분절을 유도하는 것을 확인할 수 있었다. 또한, HER2 압타머-약물 복합체가 HER2 수용체, HER3 수용체 및 phosphor-Akr (Ser473)의 발현을 감소시키는 것을 확인하였다.As shown in FIG. 6 , it was confirmed that the HER2 aptamer-drug complex increased cleaved-caspase3/7 and cleaved-PARP, and decreased pro-PARP. Through this, it was confirmed that the HER2 aptamer-drug complex activates caspase-3/-7, a major factor in apoptosis, and induces fragmentation of PARP. In addition, it was confirmed that the HER2 aptamer-drug complex reduced the expression of HER2 receptor, HER3 receptor and phosphor-Akr (Ser473).
실시예 5: HER2 압타머-약물 복합체의 Example 5: HER2 aptamer-drug complex in vivoin vivo 에서의 항암 효과 확인Confirmation of anticancer effect in
5.1. HER2 압타머-약물 복합체의 항암 효과 확인5.1. Confirmation of anticancer effect of HER2 aptamer-drug complex
실시예 1과 동일한 방법으로 합성한 HER2 압타머-약물 복합체가 in vivo에서도 항암 효과를 나타내는지 확인하기 위하여, trastuzumab 내성 JIMT-1 세포 (3x10 6 cells)를 6 주령의 Balb/c nude mice의 mammary fat pad의 양쪽 (좌, 우)에 이종 이식하고 먹이와 물을 주며 사육하였다. 동물 사육 및 모든 실험 절차는 동물 실험에 대한 법칙 및 규제에 의거하여 진행하였다. 그리고 종양의 크기가 약 100 mm 3에 도달하였을 때, Ado-trastuzumab emtansine (T-DM1)은 10 mg/kg의 농도로, HER2 압타머는 2 mg/kg의 농도로, HER2 압타머-약물 복합체는 1 mg/kg 또는 2 mg/kg의 농도로 주 2회씩 총 4주간 복강주사로 투여한 후에, 종양의 크기를 측정하였다. 대조군으로는 DMSO를 동량 처리하였다. 통계적 유의성은 Two-Way ANOVA로 확인하였고, P < 0.05이면, 통계적으로 유의성이 있다고 판단하였다. **는 P < 0.01, ***는 P < 0.001을 나타낸다. 그 결과는 도 7에 나타내었다.In order to confirm whether the HER2 aptamer-drug complex synthesized in the same manner as in Example 1 exhibits an anticancer effect in vivo , trastuzumab-resistant JIMT-1 cells (3x10 6 cells) were used in the mammary of 6-week-old Balb/c nude mice. They were xenografted on both sides (left and right) of the fat pad and bred with food and water. Animal breeding and all experimental procedures were conducted in accordance with the laws and regulations for animal experiments. And when the tumor size reached about 100 mm 3 , Ado-trastuzumab emtansine (T-DM1) at a concentration of 10 mg/kg, HER2 aptamer at a concentration of 2 mg/kg, and HER2 aptamer-drug complex After administration by intraperitoneal injection twice a week at a concentration of 1 mg/kg or 2 mg/kg for a total of 4 weeks, the size of the tumor was measured. As a control, DMSO was treated with the same amount. Statistical significance was confirmed by two-way ANOVA, and if P < 0.05, it was judged to be statistically significant. ** indicates P < 0.01, *** indicates P < 0.001. The results are shown in FIG. 7 .
도 7에 나타난 바와 같이, HER2 압타머-약물 복합체는 유의성있게 암의 성장을 억제시키는 것을 확인하였다. 반면, T-DM1의 경우에는 도리어 대조군과 비교하여 종양의 성장을 촉진시키는 것을 확인하였다. 상기 결과를 통하여, HER2 압타머-약물 복합체가 trastuzumab에 대한 내성을 가지고 있는 HER2 양성 암에 대한 새로운 치료제로서 작용할 수 있다는 것을 확인할 수 있었다.As shown in FIG. 7 , it was confirmed that the HER2 aptamer-drug complex significantly inhibited cancer growth. On the other hand, in the case of T-DM1, it was confirmed that the growth of the tumor was promoted compared to the control group. Through the above results, it was confirmed that the HER2 aptamer-drug complex could act as a new therapeutic agent for HER2-positive cancer that has resistance to trastuzumab.
5.2. HER2 압타머-약물 복합체의 Ki-67 발현 억제 및 세포 사멸 효과 확인5.2. Confirmation of Ki-67 expression inhibition and apoptosis effect of HER2 aptamer-drug complex
HER2 압타머-약물 복합체가 암세포 성장 표지인자인 Ki-67 발현을 억제하는지 확인하기 위하여, 실시예 5-1과 동일한 방법으로 HER2 압타머-약물 복합체 (2 mg/kg)를 투여하고, 4주 차에 안락사시킨 후에, 종양 조직을 파라핀 블록에 포매하여 면역조직화학 분석을 진행하였다. 그리고 Ki-67 항체를 이용하여, Ki-67 양성 세포를 확인하고, TUNEL assay를 이용하여 세포 사멸 정도를 확인하였다. 그룹간 통계적 유의성은 one-way ANOVA로 분석하였으며, Bonferroni's post hoc test로 사후검정하였고, P < 0.05이면, 통계적으로 유의성이 있다고 판단하였다. ***는 P < 0.001을 나타낸다. 그 결과는 도 8에 나타내었다.In order to determine whether the HER2 aptamer-drug complex inhibits the expression of Ki-67, a cancer cell growth marker, the HER2 aptamer-drug complex (2 mg/kg) was administered in the same manner as in Example 5-1, and 4 weeks After euthanasia in tea, the tumor tissue was embedded in a paraffin block and immunohistochemical analysis was performed. And using Ki-67 antibody, Ki-67 positive cells were identified, and the degree of apoptosis was confirmed using TUNEL assay. Statistical significance between groups was analyzed by one-way ANOVA and post-hoc test by Bonferroni's post hoc test. If P < 0.05, it was judged to be statistically significant. *** indicates P < 0.001. The results are shown in FIG. 8 .
도 8에 나타난 바와 같이, HER2 압타머-약물 복합체를 투여한 실험군에서 Ki-67의 발현이 억제되며, TUNEL 양성 세포수가 유의하게 증가되는 것을 확인하여, 세포 사멸이 현저히 증가된 것을 확인하였다. As shown in FIG. 8 , the expression of Ki-67 was suppressed in the experimental group administered with the HER2 aptamer-drug complex, and it was confirmed that the number of TUNEL-positive cells was significantly increased, confirming that apoptosis was significantly increased.
5.3. HER2 압타머-약물 복합체의 ICD HER2 및 암줄기세포 발현 억제 효과 확인5.3. Confirmation of the inhibitory effect of HER2 aptamer-drug complex on ICD HER2 and cancer stem cell expression
HER2 압타머-약물 복합체가 ICD (intracellular domain) HER2의 발현과 암줄기세포의 발현을 억제하는지 확인하기 위하여, 실시예 5-1과 동일한 방법으로 HER2 압타머-약물 복합체를 투여하고, 4주 차에 안락사시킨 후에, 종양 조직을 획득하였다. 그리고 ICD HER2 항체인 4B5와 암줄기세포인자인 CD44에 대한 항체를 이용하여, ICD HER2의 발현 정도와 암줄기세포의 비율을 확인하였다. 통계적 유의성은 One-Way ANOVA로 확인하였고, P < 0.05이면, 통계적으로 유의성이 있다고 판단하였다. *는 P < 0.05, **는 P < 0.01, ***는 P < 0.001을 나타낸다. 그 결과는 도 9에 나타내었다.In order to determine whether the HER2 aptamer-drug complex inhibits the expression of ICD (intracellular domain) HER2 and cancer stem cells, the HER2 aptamer-drug complex was administered in the same manner as in Example 5-1, and at 4 weeks After euthanasia, tumor tissue was obtained. In addition, the expression level of ICD HER2 and the ratio of cancer stem cells were confirmed using the ICD HER2 antibody 4B5 and the cancer stem cell factor CD44 antibody. Statistical significance was confirmed by One-Way ANOVA, and if P < 0.05, it was judged to be statistically significant. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001. The results are shown in FIG. 9 .
도 9에 나타난 바와 같이, HER2 압타머-약물 복합체를 투여한 실험군에서 ICD HER2의 발현 정도와 CD44의 비율이 현저히 감소된 것을 확인하였다. 상기 결과를 통하여, HER2 압타머-약물 복합체가 HER2 양성 암에 대한 치료 효과를 나타낼 뿐만 아니라. 암줄기세포의 성장을 감소시켜 암의 전이, 재발 등을 효과적으로 억제할 수 있다는 것을 확인할 수 있었다.As shown in FIG. 9 , it was confirmed that the ICD HER2 expression level and the CD44 ratio were significantly reduced in the experimental group administered with the HER2 aptamer-drug complex. Through the above results, the HER2 aptamer-drug complex not only exhibited a therapeutic effect on HER2-positive cancer. It was confirmed that it can effectively inhibit cancer metastasis and recurrence by reducing the growth of cancer stem cells.
상기 결과들을 통하여, 본 발명의 HER2 압타머-약물 복합체는 HER2 압타머와 약물 (항암제)가 SMCC 링커를 이용하여 연결되어 있으며, HER2 압타머로 인하여 HER2 양성 암세포주에 특이적으로 반응하고, 세포 내로 항암제를 효과적으로 전달함으로써 항암제에 대한 내성을 가진 세포주에 대해서 치료 효과를 현저히 높일 수 있을 뿐만 아니라, HER2 수용체가 존재하지 않는 세포에 대해서는 독성을 나타내지 않으므로 항암제에 대한 부작용을 현저히 낮출 수 있다. 또한, trastuzumab 저항성 유방암에 대한 치료 효과를 보여, HER2 항체의약품에 내성을 보이는 환자를 대상으로 제2차 혹은 제3차 약제로서의 사용 가능성도 확인하였다. 뿐만 아니라, 암줄기세포의 줄기세포성을 감소시킴으로써 암의 증식, 암의 재발, 암의 전이, 항암제 내성 등을 효과적으로 억제함으로써, HER2 양성 암종에 대한 치료 효과를 현저히 높일 수 있다는 것을 확인하였다.Through the above results, in the HER2 aptamer-drug complex of the present invention, the HER2 aptamer and the drug (anticancer agent) are connected using an SMCC linker, and due to the HER2 aptamer, the HER2 aptamer reacts specifically to the HER2-positive cancer cell line and enters the cell. By effectively delivering an anticancer agent, it is possible to significantly increase the therapeutic effect on a cell line resistant to the anticancer agent, as well as significantly lower the side effect of the anticancer agent because it is not toxic to cells in which the HER2 receptor does not exist. In addition, it showed a therapeutic effect on trastuzumab-resistant breast cancer, and the possibility of using it as a second or tertiary drug was confirmed for patients who are resistant to HER2 antibody drugs. In addition, it was confirmed that the therapeutic effect on HER2-positive carcinoma can be significantly increased by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.
본 발명은 HER2 압타머-항암 약물 복합체 및 이의 용도에 관한 것으로, HER2 압타머로 인하여 HER2 양성 암세포주에 특이적으로 반응하고, 세포 내로 항암제를 효과적으로 전달함으로써 항암제에 대한 내성을 가진 세포주에 대해서 치료 효과를 현저히 높일 수 있을 뿐만 아니라, HER2 수용체가 존재하지 않는 세포에 대해서는 독성을 나타내지 않으므로 항암제에 대한 부작용을 현저히 낮출 수 있다. 또한, trastuzumab 저항성 유방암에 대한 치료 효과를 보여, HER2 항체의약품에 내성을 보이는 환자를 대상으로 제2차 혹은 제3차 약제로서의 사용 가능성도 확인하였다. 또한, 암줄기세포의 줄기세포성을 감소시킴으로써 암의 증식, 암의 재발, 암의 전이, 항암제 내성 등을 효과적으로 억제함으로써, HER2 양성 암종에 대한 치료 효과를 현저히 높일 수 있기 때문에 다양한 HER2 양성 암종에 대한 치료제로 사용될 수 있을 것으로 기대된다.The present invention relates to a HER2 aptamer-anticancer drug complex and uses thereof, which respond specifically to a HER2-positive cancer cell line due to the HER2 aptamer and effectively deliver an anticancer agent into the cell, thereby providing a therapeutic effect on a cell line having resistance to an anticancer agent not only can significantly increase the HER2 receptor, but also show no toxicity to cells in which the HER2 receptor does not exist, thereby significantly reducing the side effects of anticancer drugs. In addition, it showed a therapeutic effect on trastuzumab-resistant breast cancer, and the possibility of using it as a second or tertiary drug was confirmed for patients who are resistant to HER2 antibody drugs. In addition, since it is possible to significantly increase the therapeutic effect on HER2-positive carcinomas by effectively inhibiting cancer proliferation, cancer recurrence, cancer metastasis, anticancer drug resistance, etc. by reducing the stem cell properties of cancer stem cells, It is expected to be used as a therapeutic agent.

Claims (10)

  1. 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체를 유효성분으로 포함하는, HER2 양성 암의 예방 또는 치료용 약학적 조성물.HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) comprising the nucleotide sequence represented by SEQ ID NO: 1, and a pharmaceutical composition for the prevention or treatment of HER2-positive cancer comprising a complex combined with an anticancer substance as an active ingredient .
  2. 제 1 항에 있어서,The method of claim 1,
    상기 항암 물질은 마이탄신 유도체 (maytansine derivatives), 씨스플라틴 (cisplatin), 카페시타빈 (capecitabine), 5-플루오로우라실 (5-fluorouracil), 아우리스타틴 유도체 (auristatin derivatives), 칼리키아미신 (calicheamicin), 듀오카마이신 (duocarmycin), 파이롤로벤조디아제핀 (pyrrolobenzodiazepine), 독소루비신 (doxorubicin), 및 SN-38 로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 약학적 조성물.The anticancer substance may include maytansine derivatives, cisplatin, capecitabine, 5-fluorouracil, auristatin derivatives, calicheamicin ( calicheamicin), duocarmycin, pyrrolobenzodiazepine, doxorubicin, and SN-38, characterized in that at least one selected from the group consisting of, a pharmaceutical composition.
  3. 제 1 항에 있어서,The method of claim 1,
    상기 HER2 양성 암은 유방암, 위암, 폐암, 난소암, 자궁경부암, 자궁내막암, 외음부암, 방광암, 신장암, 전립선암, 고환암, 음경암, 담낭암, 타액선암, 결장직장암, 갑상선암, 복막암, 간암, 췌장암, 두경부암, 흑색종, 교모세포종, 백혈병, 악성 림프종, 형질세포종, 골수종 및 육종으로 이루어진 군으로부터 선택된 어느 하나 이상인 것을 특징으로 하는, 약학적 조성물.The HER2-positive cancer is breast cancer, stomach cancer, lung cancer, ovarian cancer, cervical cancer, endometrial cancer, vulvar cancer, bladder cancer, kidney cancer, prostate cancer, testicular cancer, penile cancer, gallbladder cancer, salivary gland cancer, colorectal cancer, thyroid cancer, peritoneal cancer, Liver cancer, pancreatic cancer, head and neck cancer, melanoma, glioblastoma, leukemia, malignant lymphoma, plasmacytoma, characterized in that any one or more selected from the group consisting of myeloma and sarcoma, a pharmaceutical composition.
  4. 제 1 항에 있어서,The method of claim 1,
    상기 결합은 싸이오에터 (thioether), 다이설파이드 (disulfide), 다이펩타이드, 말레이미도카프로일 (Maleimidocaproyl), 하이드라존 (hydrazone), 및 글루쿠로나이드 (glucuronide)로 이루어진 군으로부터 선택된 어느 하나 이상의 링커로 연결되는 것을 특징으로 하는, 약학적 조성물.The bond is any one or more selected from the group consisting of thioether, disulfide, dipeptide, maleimidocaproyl, hydrazone, and glucuronide. A pharmaceutical composition, characterized in that it is linked by a linker.
  5. 제 4 항에 있어서,5. The method of claim 4,
    상기 링커는 Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker 인 것을 특징으로 하는, 약학적 조성물.The linker is a Succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) linker, characterized in that the, pharmaceutical composition.
  6. 제 1항에 있어서,The method of claim 1,
    상기 복합체는 HER2 압타머 및 항암 물질을 1 : 0.5 내지 200의 중량비로 포함하는 것을 특징으로 하는, 약학적 조성물.The complex comprises a HER2 aptamer and an anticancer substance in a weight ratio of 1: 0.5 to 200, a pharmaceutical composition.
  7. 제 1 항에 있어서,The method of claim 1,
    상기 약학적 조성물은 HER-2 (Receptor tyrosine-protein kinase erbB-2)를 표적으로 하는 것을 특징으로 하는, 약학적 조성물.The pharmaceutical composition is characterized in that it targets HER-2 (Receptor tyrosine-protein kinase erbB-2), the pharmaceutical composition.
  8. 제 1 항에 있어서,The method of claim 1,
    상기 약학적 조성물은 암의 증식, 생존, 전이, 재발 또는 항암제 내성을 억제하는 것을 특징으로 하는, 약학적 조성물.The pharmaceutical composition is characterized in that it inhibits cancer proliferation, survival, metastasis, recurrence or resistance to anticancer drugs, the pharmaceutical composition.
  9. 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체를 유효성분으로 포함하는 조성물을 개체에 투여하는 단계를 포함하는, HER2 양성 암의 예방 또는 치료 방법.HER2 comprising the step of administering to an individual a composition comprising, as an active ingredient, a complex in which a HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) comprising the nucleotide sequence represented by SEQ ID NO: 1 and an anticancer substance is bound, HER2 A method for preventing or treating benign cancer.
  10. 서열번호 1로 표시되는 염기서열을 포함하는 HER2 압타머 (Receptor tyrosine-protein kinase erbB-2 aptamer) 및 항암 물질이 결합된 복합체를 포함하는 조성물의 HER2 양성 암의 예방 또는 치료 용도.HER2 aptamer (Receptor tyrosine-protein kinase erbB-2 aptamer) comprising the nucleotide sequence represented by SEQ ID NO: 1 and the use of a composition comprising a complex to which an anticancer substance is bound to prevent or treat HER2-positive cancer.
PCT/KR2020/013954 2020-10-08 2020-10-13 Her2 aptamer-anticancer drug complex and use of same WO2022075509A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200129774A KR102247908B1 (en) 2020-10-08 2020-10-08 HER2 aptamer-anticancer drug complex and use thereof
KR10-2020-0129774 2020-10-08

Publications (1)

Publication Number Publication Date
WO2022075509A1 true WO2022075509A1 (en) 2022-04-14

Family

ID=75916059

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/013954 WO2022075509A1 (en) 2020-10-08 2020-10-13 Her2 aptamer-anticancer drug complex and use of same

Country Status (2)

Country Link
KR (1) KR102247908B1 (en)
WO (1) WO2022075509A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150080417A (en) * 2013-12-30 2015-07-09 경희대학교 산학협력단 An antibody-aptamer pincer comprising antibody and aptamer specifically binding to the same target material conjugated via linker and use thereof
KR20160032989A (en) * 2014-09-17 2016-03-25 포항공과대학교 산학협력단 HER-2 targeted aptamer complex and use thereof
KR20170007806A (en) * 2014-06-06 2017-01-20 레드우드 바이오사이언스 인코포레이티드 Anti-her2 antibody-maytansine conjugates and methods of use thereof
KR20190066026A (en) * 2016-10-07 2019-06-12 다이이찌 산쿄 가부시키가이샤 Anti-HER2 Antibody-Drug Conjugate Treatment of Metastatic Carcinoma

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105327347A (en) 2010-07-19 2016-02-17 霍夫曼-拉罗奇有限公司 Blood plasma biomarkers for bevacizumab combination therapies for treatment of breast cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150080417A (en) * 2013-12-30 2015-07-09 경희대학교 산학협력단 An antibody-aptamer pincer comprising antibody and aptamer specifically binding to the same target material conjugated via linker and use thereof
KR20170007806A (en) * 2014-06-06 2017-01-20 레드우드 바이오사이언스 인코포레이티드 Anti-her2 antibody-maytansine conjugates and methods of use thereof
KR20160032989A (en) * 2014-09-17 2016-03-25 포항공과대학교 산학협력단 HER-2 targeted aptamer complex and use thereof
KR20190066026A (en) * 2016-10-07 2019-06-12 다이이찌 산쿄 가부시키가이샤 Anti-HER2 Antibody-Drug Conjugate Treatment of Metastatic Carcinoma

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
.: "Target Aptamer-Development of Targeted Therapy for Breast Cancer Using Drug Delivery System. ", RESEARCH AND DEVELOPMENT PROJECT FOR HEALTH AND MEDICAL TECHNOLOGY, MINISTRY OF HEALTH & WELFARE., KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION, 14 October 2019 (2019-10-14), pages 1 - 337, XP055921599, [retrieved on 20220516] *

Also Published As

Publication number Publication date
KR102247908B1 (en) 2021-05-06

Similar Documents

Publication Publication Date Title
Savona et al. Phase Ib study of glasdegib, a hedgehog pathway inhibitor, in combination with standard chemotherapy in patients with AML or high-risk MDS
EP2218712B1 (en) Combination of anti-angiogenic substance and anti-tumor platinum complex
MXPA04005678A (en) Salt forms of e-2- methoxy -n-(3 -(4- (3-methyl- pyridin-3 -yloxy)- phenylamino)- quinazolin -6-yl) -allyl)- acetamide, its preparation and its use against cancer.
Ichikawa et al. The antitumor effects of the quinoline-3-carboxamide linomide on Dunning R-3327 rat prostatic cancers
KR20070050918A (en) Treatment of cancer
KR101653451B1 (en) HER-2 targeted aptamer complex and use thereof
US20190382433A1 (en) Glycolipids and pharmaceutical compositions thereof for use in therapy
WO2019083172A1 (en) Pharmaceutcal composition for preventing or treating cancer, containing streptonigrin and rapamycin as active ingredients
KR101825637B1 (en) A pharmaceutical composition for prevention or treatment of cancer and use thereof
WO2022075509A1 (en) Her2 aptamer-anticancer drug complex and use of same
Kanzawa et al. Anti-tumour activities of a new benzo [c] phenanthridine agent, 2, 3-(methylenedioxy)-5-methyl-7-hydroxy-8-methoxybenzo [c] phenanthridinium hydrogensulphate dihydrate (NK109), against several drug-resistant human tumour cell lines
Sundberg et al. Combined effect of gefitinib ('Iressa', ZD1839) and targeted radiotherapy with 211 At-EGF
US8507443B2 (en) Anticancer agent
WO2021241862A1 (en) Pharmaceutical composition for cancer prevention or treatment, comprising inositol polyphosphate multikinase inhibitor as active ingredient
Krauer et al. Antitumor effect of 2′-deoxy-5-fluorouridine conjugates against a murine thymoma and colon carcinoma xenografts
JP2003532669A (en) Use of substituted acryloyldistamycin derivatives in the treatment of tumors with high glutathione concentrations
Han et al. Erythro-austrobailignan-6 down-regulates HER2/EGFR/integrinβ3 expression via p38 activation in breast cancer
AU2004296129A1 (en) CHP-gemcitabin combined agent and use thereof as anti-tumoural active substances
KR101824205B1 (en) A pharmaceutical composition for prevention or treatment of cancer and use thereof
KR101828997B1 (en) A pharmaceutical composition for prevention or treatment of cancer and use thereof
CN113893351A (en) Composition and application thereof in preparation of medicine for treating cancer
WO2020162686A1 (en) Composition for preventing or treating cancer, containing manassantin a and immune checkpoint inhibitor or epithelial growth factor receptor inhibitor
KR102561285B1 (en) Novel HER3 inhibitor and pharmaceutical composition for preventing or treating for cancer comprising the same
US20190343820A1 (en) Combination therapies for treating cancer
KR102277435B1 (en) Compositions for treating sorafenib-resistant liver cancer and Methods for providing information on treating sorafenib-resistant liver cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20956824

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC

122 Ep: pct application non-entry in european phase

Ref document number: 20956824

Country of ref document: EP

Kind code of ref document: A1