WO2022060095A1 - 장내 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물 - Google Patents

장내 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물 Download PDF

Info

Publication number
WO2022060095A1
WO2022060095A1 PCT/KR2021/012617 KR2021012617W WO2022060095A1 WO 2022060095 A1 WO2022060095 A1 WO 2022060095A1 KR 2021012617 W KR2021012617 W KR 2021012617W WO 2022060095 A1 WO2022060095 A1 WO 2022060095A1
Authority
WO
WIPO (PCT)
Prior art keywords
disease
parkinson
cck
bdnf
dyn
Prior art date
Application number
PCT/KR2021/012617
Other languages
English (en)
French (fr)
Inventor
최정혜
오명숙
김동현
정미란
최진규
Original Assignee
경희대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경희대학교 산학협력단 filed Critical 경희대학교 산학협력단
Publication of WO2022060095A1 publication Critical patent/WO2022060095A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/2835—Movement disorders, e.g. Parkinson, Huntington, Tourette
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/50—Determining the risk of developing a disease

Definitions

  • the present invention relates to a composition for diagnosis and treatment of Parkinson's disease comprising neuropeptide and neurotrophin, and more specifically, to a Parkinson's disease using the level of neuropeptide and neurotrophin protein or mRNA encoding the same found in the intestine. It relates to a composition for diagnosis and treatment of diseases.
  • Parkinson's disease the second most common degenerative brain disease after Alzheimer's disease, is a disease caused by a decrease in dopamine concentration as dopaminergic neurons in the substantia nigra of the midbrain gradually die.
  • the number of Parkinson's disease patients increased from 3 million in 1990 to 6.2 million in 2015, and is expected to increase to 14.2 million in 2040.
  • Parkinson's disease mainly occurs in elderly patients, and it has been reported that 1-1.5% of the elderly over 60 years of age suffer from Parkinson's disease. However, the exact cause of Parkinson's disease is still unknown.
  • Parkinson's disease causes a decrease in motor function, and the three main symptoms are tremor, stiffness, and tremor, but other symptoms that patients can have are known to be much more diverse. Parkinson's disease starts very slowly and it is not possible to determine exactly when the disease started, and there is no definitive diagnosis method until now. Parkinson's disease is being diagnosed by a method for diagnosing , postural instability, etc. (J Neurol Neurosurg Psychiatry. 2008 Apr; 79(4): 368-76). There is a limitation in that early diagnosis is impossible because it is possible. In addition, drug therapy for the treatment of Parkinson's disease, deep brain stimulation, etc. have different therapeutic effects depending on the patient, and there is a problem in that Parkinson's disease cannot be cured. Therefore, there is a need to develop a diagnostic technology capable of diagnosing Parkinson's disease early and establishing a treatment plan accordingly and a technology capable of treating Parkinson's disease.
  • the present inventors paid attention to the fact that 70% of Parkinson's disease patients experience gastrointestinal disorders in the early stage of the onset of Parkinson's disease, and as a result of efforts to develop a method for diagnosing and treating Parkinson's disease at an early stage, the intestinal
  • the present invention was completed by confirming that neuropeptide and neurotrophin can be utilized for diagnosis and treatment of Parkinson's disease.
  • an object of the present invention is to provide a composition for diagnosing Parkinson's disease, comprising an agent capable of measuring the level of one or more proteins selected from the group consisting of CCK, Dyn A and BDNF or mRNA encoding the same.
  • Another object of the present invention is to provide a kit for diagnosing Parkinson's disease, comprising the composition for diagnosing Parkinson's disease.
  • the present invention provides information for diagnosing Parkinson's disease, comprising measuring the level of one or more proteins selected from the group consisting of CCK, Dyn A and BDNF or mRNA encoding them in a biological sample derived from a subject. Another purpose is to provide
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating Parkinson's disease, comprising one or more selected from the group consisting of CCK, Dyn A and BDNF or an agonist thereof as an active ingredient. .
  • the present inventors include an agent capable of measuring the level of one or more proteins selected from the group consisting of CCK, Dyn A and BDNF or mRNA encoding the same, for diagnosing Parkinson's disease A composition is provided.
  • the level of the protein or mRNA encoding the same may be measured in the large intestine (colon).
  • the composition may be one capable of early diagnosis of Parkinson's disease.
  • the agent capable of measuring the expression of mRNA is a sense and antisense primer or probe that complementarily binds to the mRNA of one or more genes selected from the group consisting of CCK, Dyn A and BDNF.
  • the agent capable of measuring the protein may be an antibody that specifically binds to one or more proteins selected from the group consisting of CCK, Dyn A, and BDNF.
  • the present invention also provides a kit for diagnosing Parkinson's disease, comprising the composition for diagnosing Parkinson's disease.
  • the present invention provides information for diagnosing Parkinson's disease, comprising measuring the level of one or more proteins selected from the group consisting of CCK, Dyn A and BDNF or mRNA encoding them in a biological sample derived from a subject.
  • the present invention provides a pharmaceutical composition for preventing or treating Parkinson's disease, comprising one or more selected from the group consisting of CCK, Dyn A and BDNF or an agonist thereof as an active ingredient.
  • the composition may be a composition, characterized in that it is administered to the colon, abdominal cavity or oral cavity.
  • neuropeptides and neurotropins in which the expression of proteins and mRNA encoding them are decreased in the large intestine and colon of patients with Parkinson's disease were identified. It is expected to be able to diagnose or treat Parkinson's disease as it has excellent therapeutic effect on Parkinson's disease.
  • FIG. 1 is a mouse model induced by a neurotoxic substance using TH immunostaining (tyrosine hydroxylase immunostaining) to identify dopaminergic neurons in the striatum (ST) and substantia nigra pars compacta (SNpc).
  • TH immunostaining tyrosine hydroxylase immunostaining
  • ST striatum
  • SNpc substantia nigra pars compacta
  • FIG. 1a is a result of observing a mouse model treated with MPTP
  • FIG. 1b is a result of observing a mouse model treated with MPTP/p.
  • Figure 2 is the result of observing the exercise capacity of the control group and the Parkinson's disease-induced mouse model with the Rota-rod test
  • Figure 2a is the rotarod of the mouse model and control (vehicle group) induced by MPTP treatment.
  • Figure 2b is the rotarod test results of the mouse model and control (vehicle group) induced by MPTP / p treatment.
  • FIG. 3 shows 12 neuropeptides and 4 neurons in the large intestine ( FIG. 3A ) and the small intestine ( FIG. 3B ) of a Parkinson’s disease mouse model and control group (vehicle group) induced by MPTP treatment.
  • FIG. 6 shows (A) CCK, (B) Dyn A, (C) BDNF in the large intestine and colon of a mouse model induced by MPTP/p treatment and a vehicle-treated mouse model (control group). It is the result of confirming the expression change of the protein.
  • FIG. 8 shows the results of RT-PCR ( FIG. 8a ) and Western blotting ( FIG. 8b ) of BDNF, CCK, and Dyn A expression levels after treatment with 6-shogaol.
  • the present invention provides a composition for diagnosing Parkinson's disease, comprising an agent capable of measuring the level of a neuropeptide or neurotrophin protein or mRNA encoding the same.
  • neuropeptide is a generic term for all peptides found in the nervous system, coexisting with other neurotransmitters at the nerve cell terminal, and controlling secretion through interaction or exhibiting a unique function.
  • the types of neuropeptides are not limited thereto, but NPY (neuropeptide Y), ghrelin, VIP (Vasoactive intestinal peptide), CRF (Corticotropin-releasing factor), GLP-1 (Glucagon-like peptide-1), leptin, peptide YY , calcitonin gene-related peptide, galanin, CCK (Cholecystokinin), Dyn A (Dynorphin A) and neurotensin.
  • the expression of CCK (Cholecystokinin) and Dyn A (Dynorphin A) proteins and mRNA encoding them among various neuropeptides of the large intestine and colon of a mouse model induced by Parkinson's disease was significantly reduced. It was confirmed that it can be used for diagnosis and treatment of Parkinson's disease. Therefore, in the present invention, the neuropeptide may be one or more selected from the group consisting of CCK and Dyn A.
  • neurotrophin refers to a hormone and a protein that grows nerves, and inhibits nerve cell death by maintaining nerve cells, or triggers new nerve formation.
  • Neurotrophins may be, but are not limited to, brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), Neurotrophin3 (NT3), and Neurotrophin5 (NT5).
  • BDNF brain-derived neurotrophic factor
  • NNF nerve growth factor
  • NT3 Neurotrophin3
  • NT5 Neurotrophin5
  • neurotrophin may be BDNF.
  • the level of one or more diagnostic proteins selected from the group consisting of CCK, Dyn A, and BDNF or mRNA encoding the same may be measured in the intestine, particularly in the large intestine.
  • a diagnostic method for measuring one or more mRNAs and proteins selected from the group consisting of CCK, Dyn A and BDNF in the large intestine is a mouse model induced by MPTP treatment showing general Parkinson's disease symptoms, as well as early and chronic Parkinson's disease.
  • the control group vehicle group
  • significant reductions in mRNA and protein expression can be confirmed in both cases, so that not only general Parkinson's disease patients but also conventional diagnosis It was confirmed that Parkinson's disease can be diagnosed even for patients who show only early symptoms of Parkinson's disease that cannot be diagnosed by this method.
  • measuring the expression of one or more selected from the group consisting of CCK, Dyn A and BDNF can be a useful diagnostic method for Parkinson's disease.
  • Parkinson's disease is a chronic progressive degenerative disease of the nervous system characterized by major symptoms such as tremors, involuntary tremors, stiffness and postural instability, which are major symptoms, and the Parkinson's disease is Parkinson's disease showing early symptoms. could be sick
  • Parkinson's disease showing the early symptoms is a state in which three or more symptoms among the four main symptoms of Parkinson's disease, tremor, involuntary tremor, rigidity, and postural instability, are not yet seen or only basic, partial symptoms, and the existing Parkinson's disease Parkinson's disease is a difficult disease to diagnose.
  • the agent capable of measuring the level of mRNA may be a sense and antisense primer, or a probe that complementarily binds to the mRNA of one or more genes selected from the group consisting of CCK, Dyn A and BDNF. .
  • the primer is a short gene sequence serving as a starting point of DNA synthesis, and refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, and the like.
  • the primers may be synthesized and used with a length of typically 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, etc. by a known method.
  • the primer can be used to perform a polymerase chain reaction, and preferably can be used for a real-time polymerase chain reaction.
  • the primer can initiate DNA synthesis in the presence of a reagent for polymerization (eg, Taq DNA polymerase) and four different deoxynucleoside triphosphates (dNTPs) in an appropriate buffer and temperature.
  • a reagent for polymerization eg, Taq DNA polymerase
  • dNTPs deoxynucleoside triphosphates
  • the probe refers to a nucleic acid capable of specifically binding to mRNA having a length of several bases to several hundreds of bases produced through enzymatic chemical separation and purification or synthesis.
  • the presence or absence of mRNA can be checked by labeling radioactive isotopes or enzymes, and it can be designed and modified by a known method.
  • the agent capable of measuring the level of the protein may be an antibody that specifically binds to one or more proteins selected from the group consisting of CCK, Dyn A, and BDNF.
  • analysis methods include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay, Northern blotting , a DNA chip, etc. may be used, but the present invention is not limited thereto.
  • analysis methods include Western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunoassay. Radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter, FACS), protein chip (protein chip), but is not limited thereto.
  • the protein expression level in the control group and the mRNA expression level in a biological sample of a Parkinson's disease patient or suspected Parkinson's disease patient can be confirmed, and whether or not Parkinson's disease onset can be diagnosed or predicted by comparing the expression levels.
  • the present invention provides a kit for diagnosing Parkinson's disease, comprising the composition for diagnosing Parkinson's disease.
  • the kit includes, but is not limited to, an ELISA kit, an immunochromatographic test strip, a radiation division immunoassay device, a flow-through device, a DNA chip, and an RT-PCR kit. It may be selected from the group that is, more preferably an ELISA kit or an RT-PCR kit.
  • the diagnostic kit of the present invention may further include appropriate reagents and tools used for analysis, in addition to the diagnostic composition capable of measuring the level of the neuropeptide and neurotrophin protein or mRNA encoding the same as described above,
  • reagents and tools include suitable carriers, labels capable of producing a detectable signal, solubilizing agents, detergents, and the like.
  • the labeling material is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator.
  • Suitable carriers include, but are not limited to, soluble carriers such as physiologically acceptable buffers known in the art such as PBS, insoluble carriers such as polystyrene, polyethylene, polypropylene, polyester, Polyacrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof may be used.
  • physiologically acceptable buffers known in the art such as PBS
  • insoluble carriers such as polystyrene, polyethylene, polypropylene, polyester, Polyacrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof may be used.
  • a reagent capable of detecting an antibody bound to a marker protein for example, a labeled secondary antibody, chromopores, an enzyme (eg, conjugated to an antibody) and a substrate thereof may include
  • an antibody specific for the quantitative control protein may be included.
  • kit is an RT-PCR kit, in addition to each pair of primers specific for a marker gene, a test tube or other suitable container, reaction buffer (with varying pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-polymer It may include enzymes such as enzymes and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like, and may also include a pair of primers specific to a gene used as a quantitative control.
  • reaction buffer with varying pH and magnesium concentration
  • dNTPs deoxynucleotides
  • Taq-polymer it may include enzymes such as enzymes and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like, and may also include a pair of primers specific to a gene used as a quantitative control.
  • the diagnostic kit is a DNA chip kit, it may include a substrate to which cDNA or oligo bases corresponding to genes or fragments thereof are attached.
  • a subject Information provision method comprising measuring the level of one or more proteins selected from the group consisting of CCK, Dyn A and BDNF or mRNA encoding them in a biological sample derived from a subject Information provision method.
  • the biological sample is one or more proteins selected from the group consisting of CCK, Dyn A and BDNF due to the occurrence of Parkinson's disease or tissue, cells, whole blood, serum, samples such as, but not limited to, plasma, saliva, sputum, cerebrospinal fluid, or urine.
  • the Parkinson's disease diagnosis and therapeutic effect of the composition according to the present invention was confirmed through specific examples.
  • CCK, Dyn A, BDNF and NT 5 are significant protein expression was decreased, but the expression of NT 5 did not show a significant difference (see Example 2-2).
  • the protein levels of CCK, Dyn A and BDNF were measured in the large intestine of the MPTP/p-induced Parkinson's disease-induced mouse model and the control group, compared to the MPTP-induced Parkinson's disease-induced mouse model. It was confirmed that the protein expression of CCK, Dyn A and BDNF was significantly decreased even in the MPTP/p model showing early or chronic Parkinson's disease symptoms, and it was confirmed that it can be effectively used for diagnosis and treatment of early or chronic Parkinson's disease (conduction). see example 3).
  • the protein levels of CCK, Dyn A and BDNF were measured in the colon of a mouse model showing Parkinson's disease-like symptoms and dopaminergic nerve damage by treatment with enterobacteriaceae PM ( Proteus mirablis ). Similarly to the model treated with MPTP and MPTP/p, it was confirmed that the protein expression of CCK, Dyn A, and BDNF was significantly reduced, confirming that it can be used to diagnose Parkinson's disease-like symptoms in which dopaminergic nerves are damaged (see Example 4).
  • the present invention provides a pharmaceutical composition for preventing or treating Parkinson's disease, comprising at least one selected from the group consisting of CCK, Dyn A and BDNF or an agonist thereof as an active ingredient to provide.
  • Prevention of the present invention means any action that inhibits or delays the onset of a disease by administration of the composition according to the present invention.
  • treatment includes therapeutic effects such as inhibiting or stopping the progression of a disease or disorder, reducing the rate of progression, ameliorating and alleviating symptoms, or preventing disease for a biological subject (eg, human or animal).
  • the agonist is a composition capable of enhancing the expression of the CCK, Dyn A and BDNF proteins or mRNA encoding them, and CCK, Dyn A and BDNF proteins or mRNA itself, or CCK in the intestine.
  • a composition that can enhance the expression of proteins or mRNA of CCK, Dyn A and BDNF by affecting the growth of microorganisms affecting the production of Dyn A and BDNF, but is not limited thereto, but is not limited thereto It may be all (6-shogaol).
  • 6-shogaol may have a structure of 1-(4-hydroxy-3-methoxyphenyl)-4-decen-3-one and may have a structure of Formula 1 below. .
  • the pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenously, subcutaneously, applied to the skin, nasal passages, or airways) according to a desired method, and the dosage may vary depending on the patient's condition and body weight, disease Although it varies depending on the degree, drug form, route and time of administration, it may be appropriately selected by those skilled in the art.
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is commonly used in formulation, and includes saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol or liposome, but is limited thereto. It does not, and may further include other conventional additives, such as antioxidants or buffers, if necessary.
  • diluents, dispersants, surfactants, binders or lubricants may be additionally added to form an injectable formulation such as an aqueous solution, suspension or emulsion, pill, capsule, granule, or tablet.
  • formulations can be preferably made according to each component using the method disclosed in Remington's literature.
  • the pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated as an injection, an inhalant, an external preparation for skin, or an oral intake.
  • Solid preparations for oral administration may include tablet pills, powders, granules, capsules, etc., and these solid preparations include one or more compounds and at least one excipient, for example, starch, calcium carbonate, sucrose or lactose. It can be prepared by mixing (lactose), gelatin, etc., and lubricants such as magnesium stearate and talc in addition to simple excipients can be used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is.
  • Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories.
  • non-aqueous solvent and suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, etc. may be used.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount to the colon, abdominal cavity or oral cavity of a Parkinson's disease patient.
  • the term "administration" refers to introducing the pharmaceutical composition of the present invention to a subject by any suitable method, and the administration route can be administered through various routes, either oral or parenteral, as long as it can reach the target tissue. .
  • the pharmaceutical composition of the present invention may be appropriately administered to a subject according to a conventional method, dosage, and frequency of administration used in the art according to the purpose or necessity, and the amount of the pharmaceutical composition of the present invention actually administered and
  • the frequency of administration may be appropriately determined depending on various factors such as the type of symptom to be treated, administration route, sex, health status, diet, age and weight of the subject, and the severity of the disease.
  • the term "pharmaceutically effective amount” means an amount sufficient to inhibit or alleviate Parkinson's disease with a reasonable benefit/risk ratio applicable to medical use, and the effective dose level is determined by the type and severity of the subject, age, sex , drug activity, drug sensitivity, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs, and other factors well known in the medical field.
  • the present invention provides a method for preventing or treating Parkinson's disease comprising administering the composition to an individual.
  • the term “individual” refers to all animals, including humans, that may or have developed Parkinson's disease. By administering the composition of the present invention to a subject, Parkinson's disease can be alleviated or treated.
  • ECL Enhanced chemiluminescence
  • EMD Millipor Billerica, MA, USA
  • TBS buffer Tris-buffered saline
  • CCK, Dyn A, BDNF and NT 4/5 antibodies were purchased from Abcam Biotechnology (Cambridge, England)
  • ⁇ -actin antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
  • RT-PCR real-time reverse transcription polymerase chain reaction
  • the Easy Blue kit and protein lysis buffer were purchased from Intron Biotechnology (Seoul, South Korea), and the First-Strand cDNA synthesis kit was purchased and used from Amersham Pharmacia Biotech (Oakville, ON, Canada).
  • SYBR Premix Ex Taq was manufactured by Takara (Tokyo, Japan), and the enzyme-linked immunosorbent assay (ELISA) kit for CCK, Dyn A, or BDNF is Ray Biotech, Inc (Peachtree Corners, GA, USA).
  • MPTP-induced PD mouse model was prepared by injecting MPTP hydrochloride (30 mg/kg/day in saline) in saline intraperitoneally for 5 days. and a vehicle-treated group, a control group for comparison, was prepared by injecting the same amount of saline in the same manner.
  • TH immunostaining, a dopaminergic neuron marker was performed, and then the striatum (ST) was examined through a scanning electron microscope (SEM). ) and substantia nigra pars compacta (SNpc) stained dopaminergic neurons, as shown in FIG. It was confirmed that the Parkinson's disease mouse model was well produced.
  • the Parkinson's disease mouse model produced in this way was analyzed for movement after 7 days had elapsed after the last MPTP hydrochloride injection, and after completing the movement analysis, it was sacrificed for detailed analysis of intestinal tissue.
  • MPTP/p-induced Parkinson's disease mouse model is a saline solution with MPTP hydrochloride (25 mg/kg/day in saline ip) with probenecid ( 100 mg/kg/day in 5% NaHCO 3 , ip) and 10 injections were prepared (10 injections were administered at intervals of 3.5 days on a 5-week schedule).
  • a vehicle-treated group which is a control group for comparison, was prepared by injecting the same amount of sterile saline in the same manner.
  • Probenecid is pre-injected 30 minutes prior to the injection of MPTP hydrochloride, and probenecid prevents the natural clearance of MPTP and chronically depletes striatal dopamine for 6 months after injection, the neurotoxicity of MPTP. For strengthening, it was used as an adjuvant.
  • TH immunostaining a dopaminergic neuron marker, was performed, and then, through a scanning electron microscope (SEM), striatum, ST) and substantia nigra pars compacta (SNpc) stained dopaminergic neurons were observed, and as shown in FIG. By confirming that the neurons were significantly reduced, it was confirmed that the Parkinson's disease mouse model was well constructed.
  • the prepared mouse model exhibited early and chronic Parkinson's disease symptoms compared to the MPTP-treated mouse model of Parkinson's disease.
  • kinetic analysis was performed the day after 10 injections of MPTP and probenecid, and after kinetic analysis, the mice were sacrificed for detailed analysis of intestinal tissues.
  • mice were anesthetized with carbon dioxide (CO 2 ) and sacrificed, then the mouse mid-abdominal skin was cut with scissors, and the rectum/distal colon was gently smoothed with dressing forceps. By pulling, the tissues of the large intestine were isolated. In addition, in order to isolate the small intestine, the small intestine was pulled out from the mesentery, and the small intestine was cut across the small intestine away from the pylorus to isolate the small intestine tissue. The prepared large intestine and small intestine tissues were stored at a temperature of -80 °C.
  • a rotarod test was performed 7 days after the last injection of MPTP or the day after the last injection of MPTP/p.
  • the device for testing consisted of a rotating spindle with a diameter of 7.3 cm and 5 separate compartments configured to simultaneously test 5 rats. After the first test performed at a rotation speed of 8 rpm for 3 minutes, the next day the test was performed by increasing the rotation speed to 11 rpm, and the time each rat remained on the rotating rod was repeated three times with an interval of 5 minutes. Through the test, a maximum of 300 seconds was recorded for each test, and the average time of the three tests was calculated and shown in the data. As a result, significant movement in both MPTP (Fig. 2a) or MPTP/p (Fig. 2b)-treated Parkinson's disease mouse models A decrease in ability was observed.
  • RT-PCR Reverse transcription polymerase chain reaction
  • qRT-PCR real-time reverse transcription polymerase chain reaction
  • RNA Reverse transcription was performed on a total of 1 ⁇ g of RNA using the First-Strand cDNA synthesis kit, and the reverse transcribed RNA was extracted using the Easy Blue kit.
  • the primers for PCR the primers in Table 1 were used, and as a result of amplifying cDNA using the Thermal Cycler Dice Real Time PCR system and SYBR Premix Ex Taq and analyzing the dissociation curve, a single peak (single peak) was able to confirm Expression of the gene of interest was analyzed using the Ct comparison (comparative Ct) method, which is a method of normalizing the Ct (threshold cycle) average value of the target cDNA with reference to GAPDH.
  • Ct comparison comparative Comparative Ct
  • Mouse serum was collected using EDTA as an anticoagulant, and the collected samples were centrifuged at a strength of 1000 x g for 15 minutes at 2-8°C within 30 minutes after collection. After the first centrifugation, in order to completely remove platelets, centrifugation was performed again at a strength of 10,000 x g for 10 minutes at 2-8 °C.
  • Neuropeptides (CCK, Dyn A) and neurotrophin (BDNF) in serum obtained through centrifugation were measured using an EIA kit manufactured by RayBiotech.
  • a protein lysis buffer was used to extract the protein from the tissue, and the concentration of the extracted protein was measured by Bradford assay. Proteins were separated through 10-15% sodium dodecyl sulfate polyacrylamide gel electrophoresis electrophoresis. After electrophoresis, the proteins in the gel were electroblotted for 1 hour, transferred to polyvinylidene fluoride membranes, and the membranes were 5% skimmed milk and Tween 20 (TBS-T). After incubation for 30 minutes at 20 °C using TBS buffer (Tris-buffered saline) supplemented with The antibody was incubated overnight at 4 °C in 5% skim milk and TBS-T.
  • TBS buffer Tris-buffered saline
  • HRP horseradish peroxidase
  • Example 2 Measurement of mRNA levels of neuropeptide and neurotrophin in the intestine of a mouse model induced by MPTP treatment
  • Parkinson's disease mouse model In order to measure the mRNA expression of neuropeptide and neurotrophin in the intestine (small intestine and large intestine) of a control group (vehicle group) and a mouse model induced by MPTP treatment, movement disorders in a Parkinson's disease mouse model By observing (mortor impairment) and degeneration of nigrostriatal dopaminergic neurons, it was confirmed that Parkinson's disease was induced, and 12 neuropeptides (NPY, ghrelin, VIP, CRF, GLP-1, leptin, peptide YY, calcitonin gene-related peptide, galanin, CCK, Dyn A and neurotensin) and four neurotrophins (BDNF, NGF, NT3 and NT5) mRNA were analyzed by qRT-PCR As a result of the measurement, as shown in Figure 3a, two neuropeptides CCK (0.57 ⁇ 0.09; *p ⁇ 0.05), Dyn A (0.40 ⁇ 0.14
  • Control vehicle group
  • serum serum
  • mice 2-1 and 2-2 two As a result of observing the protein levels of neuropeptide and one neurotrophin through ELISAkit, as shown in FIG. 5, CCK, Dyn A, and BDNF all showed a tendency to decrease, but a significant decrease in level could not be confirmed.
  • CCK, Dyn A, and BDNF all showed a tendency to decrease, but a significant decrease in level could not be confirmed.
  • the measured values of individual factors were summed in various combinations to obtain the average value and the p value was calculated using the Mann Whiteny Test, as shown in Table 2 below, the statistical significance was confirmed with the p value 0.023.
  • Control average MPTP induction group mean P-value BDNF 2.480 2.020 0.495 CCK 1.687 1.436 0.110 Dyn A 3.070 2.558 0.604 BDNF+CCK 4.167 3.456 0.338 BDNF+Dyn A 5.549 4.578 0.074 CCK+ DynA 4.757 3.993 0.423 BDNF+ CCK+ DynA 7.237 6.014 0.023*
  • Example 3 Measurement of protein expression of neuropeptide and neurotrophin in the colon of a mouse model induced by MPTP/p treatment
  • CCK, Dyn A and BDNF confirmed that the expression of the protein or mRNA encoding the protein revealed in Example 2 is reduced through Western blotting in the colon of a mouse model induced by chronic Parkinson's disease by MPTP/p treatment of protein expression was observed.
  • the protein expression of CCK (0.45 ⁇ 0.03; * p ⁇ 0.05), Dyn A (0.50 ⁇ 0.04; * p ⁇ 0.05) and BDNF (0.64 ⁇ 0.09; * p ⁇ 0.05) was significant.
  • Example 4 Measurement of protein expression of neuropeptide and neurotrophin in the colon of a mouse model induced with Parkinson's disease-like symptoms by PM treatment
  • neuropeptides and neurotropins in which the expression of proteins and mRNA encoding them are decreased in the large intestine and colon of Parkinson's disease patients were identified, and Parkinson's disease was prevented early by utilizing the neuropeptides and neurotropins. It is expected to be used in the diagnosis or treatment of Parkinson's disease as it has excellent therapeutic effect on Parkinson's disease.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물에 관한 것으로, 파킨슨병이 유도된 마우스 모델의 장내에서 뉴로펩타이드인 CCK, Dyn A와 뉴로트로핀인 BDNF의 mRNA 및 단백질의 발현이 감소한다는 사실을 밝혀내어, 상기 장내의 뉴로펩타이드와 뉴로트로핀이 파킨슨병의 진단을 위해 사용될 수 있음을 확인하였다. 본 발명의 뉴로펩타이드 및 뉴로트로핀을 활용한 파킨슨병 진단 및 치료용도는 기존의 진단방법에 의해 진단할 수 없었던 조기증상을 보이는 파킨슨병을 진단할 수 있으며, 파킨슨병에 대한 치료효과도 뛰어난바, 파킨슨병의 진단 또는 치료에 유용하게 활용될 수 있다.

Description

장내 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물
본 발명은 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물에 관한 것으로, 보다 구체적으로, 장내에서 발견되는 뉴로펩타이드 및 뉴로트로핀의 단백질 또는 이를 암호화하는 mRNA의 수준을 이용한 파킨슨병의 진단 및 치료용 조성물에 관한 것이다.
파킨슨병은 알츠하이머병 다음으로 흔한 퇴행성 뇌 질환으로서, 중뇌의 흑질(substantia nigra)에 존재하는 도파민 신경세포가 점차 사멸됨에 따라 도파민의 농도가 낮아져서 일어나는 질병이다. 파킨슨병 환자수는 1990년 300만명에서 2015년 620만명으로 증가하였고, 2040년에는 1420만명으로 그 숫자가 증가할 것으로 예상되고 있다. 파킨슨병은 주로 고령의 환자들에게 주로 발생하여 60세 이상 노인가운데 1~1.5%가 파킨슨병을 앓고 있다고 보고되고 있으나, 최근에는 50대 이하 중년 또는 20~30대에서도 파킨슨병이 보고되고 있어 심각성을 더해가고 있으나, 아직까지도 파킨슨병의 정확한 원인은 밝혀지지 않은 상태이다.
파킨슨병에 걸리면 운동기능의 감퇴가 나타나게 되고, 주요한 3대 증상으로는 진전, 강직, 서동이 있으나, 이외에도 환자들이 가질 수 있는 증상들은 훨씬 다양한 것으로 알려져 있다. 파킨슨병은 아주 서서히 시작하여 언제부터 병이 시작되었는지 정확하게 파악할 수 없고, 진단 또한 현재까지 확실한 진단방법이 없고, 파킨슨병이 어느정도 진행된 후에 나타나는 운동장애인 휴식 떨림, 경직, 근 긴장 이상, 서동, 보행 곤란, 자세 불안정 등을 진단하는 방법으로 파킨슨병을 진단하고 있는 실정인데(J Neurol Neurosurg Psychiatry. 2008 Apr; 79(4): 368-76), 이러한 진단 방법은 파킨슨병이 진행된 후에야 비로소 파킨슨병 진단이 가능하기에 조기 진단이 불가능하다는 한계가 있다. 또한, 파킨슨병의 치료를 위한 약물요법, 뇌심부자극술 등은 환자에 따라 치료효과가 상이하고, 파킨슨병을 완치할 수 없는 문제점이 있다. 따라서 파킨슨병을 조기에 진단하여, 그에 따른 치료계획을 수립할 수 있게 하는 진단 기술 및 파킨슨병을 치료할 수 있는 기술의 개발이 필요한 실정이다.
상기와 같은 배경하에, 본 발명자들은 파킨슨병 환자들의 70%가 파킨슨병 발병 초기에 위장장애를 경험한다는 사실에 주목하여, 파킨슨병을 조기에 진단 및 치료할 수 있는 방법을 개발하기 위해 노력한 결과, 장내의 뉴로펩타이드(neuropeptide) 및 뉴로트로핀(neurotrophin)이 파킨슨병의 진단 및 치료에 활용될 수 있음을 확인함으로써 본 발명을 완성하였다.
이에, 본 발명은 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정할 수 있는 제제를 포함하는, 파킨슨병 진단용 조성물을 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 파킨슨병 진단용 조성물을 포함하는, 파킨슨병 진단용 키트를 제공하는 것을 다른 목적으로 한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정하는 단계를 포함하는, 파킨슨병 진단을 위한 정보제공 방법을 제공하는 것을 또 다른 목적으로 한다.
또한, 본 발명은 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상 또는 이의 작용제(agonist)를 유효성분으로 포함하는, 파킨슨병 예방 또는 치료용 약학적 조성물을 제공하는 것을 또 다른 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기와 같은 본 발명의 목적을 달성하기 위해, 본 발명자들은 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정할 수 있는 제제를 포함하는, 파킨슨병 진단용 조성물을 제공한다.
본 발명의 일구현예로, 상기 단백질 또는 이를 암호화하는 mRNA의 수준은 대장(large intestine, colon)에서 측정하는 것일 수 있다.
본 발명의 다른 구현예로, 상기 조성물은 파킨슨병을 조기에 진단할 수 있는 것일 수 있다.
본 발명의 또 다른 구현예로, 상기 mRNA의 발현을 측정할 수 있는 제제는 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머 또는 프로브일 수 있다.
본 발명의 또 다른 구현예로, 상기 단백질을 측정할 수 있는 제제는 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질에 특이적으로 결합하는 항체일 수 있다.
또한, 본 발명은 상기 파킨슨병 진단용 조성물을 포함하는, 파킨슨병 진단용 키트를 제공한다.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정하는 단계를 포함하는, 파킨슨병 진단을 위한 정보제공 방법을 제공한다.
또한, 본 발명은 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상 또는 이의 작용제(agonist)를 유효성분으로 포함하는, 파킨슨병 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일구현예로, 상기 조성물은 대장, 복강 또는 구강에 투여하는 것을 특징으로 하는, 조성물일 수 있다.
본 발명에서는 파킨슨병 환자의 대장(large intestine, colon)에서 단백질 및 이를 암호화하는 mRNA의 발현이 감소하는 뉴로펩타이드 및 뉴로트로핀을 확인하였고, 상기 뉴로펩타이드 및 뉴로트로핀을 활용하여 파킨슨병을 조기에 진단할 수 있고, 파킨슨병에 대한 치료효과도 뛰어난바, 파킨슨병의 진단 또는 치료에 사용될 수 있을 것으로 기대된다.
단, 본 발명의 효과는 상기 효과로 한정되는 것은 아니며, 본 발명의 상세한 설명 또는 청구범위에 기재된 발명의 구성으로부터 추론 가능한 모든 효과를 포함하는 것으로 이해되어야 한다.
도 1은 신경독성물질에 의해 파킨슨병 유도된 마우스 모델을 TH 면역염색법(tyrosine hydroxylase immunostaining)을 활용하여 선조체(striatum, ST) 및 흑질치밀부(substantia nigra pars compacta, SNpc)의 도파민 뉴런을 확인하여 파킨슨병 유도 여부 확인한 결과로서, 도 1a는 MPTP 처리한 마우스 모델을 관찰한 결과이고, 도 1b는 MPTP/p 처리한 마우스 모델을 관찰한 결과이다.
도 2는 대조군과 파킨슨병 유도된 마우스 모델의 운동능력을 로타로드 테스트(Rota-rod test)로 관찰한 결과로서, 도 2a는 MPTP 처리에 의해 유도된 마우스 모델 및 대조군(vehicle 군)의 로타로드 테스트 결과이고, 도 2b는 MPTP/p 처리에 의해 유도된 마우스 모델 및 대조군(vehicle 군)의 로타로드 테스트 결과이다.
도 3은 MPTP 처리에 의해 유도된 파킨슨병 마우스 모델 및 대조군(vehicle 군)의 대장(large intestine, colon)(도 3a) 및 소장(도 3b)에서 12개의 뉴로펩타이드(neuropeptides) 및 4개의 뉴로트로핀(neurotrophin)의 mRNA 발현의 변화를 확인한 결과로서, 각각 (A) NPY, (B) ghrelin, (C) VIP, (D) CRF, (E) GLP-1, (F) leptin, (G) peptide YY, (H) calcitonin gene-related peptide, (I) galanin, (J) CCK, (K) Dyn A, (L) neurotensin, (M) BDNF, (N) NGF, (O) NT3, (P) NT5의 발현변화를 확인한 결과이다.
도 4는 MPTP 처리되어 파킨슨병 유도된 마우스 모델 및 대조군(vehicle 군)의 대장(large intestine, colon)에서 (A) CCK, (B) Dyn A, (C) BDNF, (D) NT5 단백질의 발현 수준을 확인한 결과이다,
도 5는 MPTP 처리되어 파킨슨병 유도된 마우스 모델 및 대조군(vehicle 군)의 혈청에서 (A) CCK, (B) Dyn A, (C) BDNF 단백질의 발현변화 및 이의 조합된 발현 수준을 확인한 결과이다.
도 6는 MPTP/p 처리되어 파킨슨병 유도된 마우스 모델 및 비히클(vehicle) 처리한 마우스 모델(대조군)의 대장(large intestine, colon)에서 (A) CCK, (B) Dyn A, (C) BDNF 단백질의 발현변화를 확인한 결과이다.
도 7은 PM 처리되어 파킨슨병 유사 증상 및 도파민 신경 손상을 보이는 마우스 모델 및 비히클(vehicle) 처리한 마우스 모델(대조군)의 대장(large intestine, colon)에서 (A) CCK, (B) Dyn A, (C) BDNF 단백질의 발현변화를 확인한 결과이다.
도 8은 6-쇼가올을 처리한 다음, BDNF, CCK, Dyn A의 발현수준 RT-PCR(도 8a) 및 웨스턴 블롯팅(도 8b)으로 확인한 결과이다.
본 발명자들은 파킨슨병을 조기에 진단 및 치료할 수 있는 방법을 개발하기 위해 노력한 결과, 파킨슨병이 걸린 동물 모델의 장내에서 뉴로펩타이드(neuropeptide) 및 뉴로트로핀(neurotrophin)의 발현변화가 발생한다는 것을 확인하였으며, 유의한 발현의 변화를 나타내는 뉴로펩타이드 및 뉴로트로핀이 파킨슨병의 진단 및 치료에 활용될 수 있음을 확인함으로써 본 발명을 완성하였다.
이에, 본 발명은 뉴로펩타이드 또는 뉴로트로핀의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정할 수 있는 제제를 포함하는, 파킨슨병 진단용 조성물을 제공한다.
본 발명에 있어서, 뉴로펩타이드(neuropeptide)는 신경계에서 발견되는 모든 펩타이드를 총칭하는 말로서, 신경세포 말단에서 다른 신경전달물질들과 공존하면서 상호작용을 통해 분비를 조절하거나, 고유의 기능을 나타낸다. 뉴로펩타이드의 종류는 이에 제한되는 것은 아니지만, NPY(neuropeptide Y), ghrelin, VIP(Vasoactive intestinal peptide), CRF(Corticotropin-releasing factor), GLP-1(Glucagon-like peptide-1), leptin, peptide YY, calcitonin gene-related peptide, galanin, CCK(Cholecystokinin), Dyn A(Dynorphin A) 및 neurotensin일 수 있다.
본 발명에서는 파킨슨병이 유도된 마우스 모델의 대장(large intestine, colon)의 다양한 뉴로펩타이드 중, CCK(Cholecystokinin) 및 Dyn A(Dynorphin A)의 단백질 및 이를 암호화하는 mRNA의 발현이 유의적으로 감소한 것을 확인하여, 파킨슨병의 진단 및 치료용도로 사용할 수 있음을 확인하였다. 따라서, 본 발명에서 뉴로펩타이드는 CCK 및 Dyn A로 이루어진 군에서 선택되는 하나 이상일 수 있다.
본 발명에 있어서, 뉴로트로핀(neurotrophin)은 신경을 성장시키는 호르몬 및 단백질을 의미하며, 신경세포를 유지하여 신경세포 사멸을 억제하거나, 새로운 신경형성을 촉발한다. 뉴로트로핀은 이에 제한되는 것은 아니지만, BDNF(Brain-derived neurotrophic factor), NGF(nerve growth factor), NT3(Neurotrophin3) 및 NT5(Neurotrophin5)일 수 있다.
본 발명에서는 파킨슨병이 유도된 마우스 모델의 대장(large intestine, colon)의 다양한 뉴로트로핀 중, BDNF(Brain-derived neurotrophic factor)의 단백질 및 이를 암호화하는 mRNA의 발현이 유의적으로 감소한 것을 확인하여, 파킨슨병의 진단 및 치료용도로 사용할 수 있음을 확인하였다. 따라서 본 발명에서 뉴로트로핀은 BDNF일 수 있다.
상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 진단을 위한 단백질 또는 이를 암호화하는 mRNA의 수준은 장내, 특히 대장(large intestine, colon)에서 측정하는 것일 수 있다.
대장에서 상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 mRNA 및 단백질을 측정하는 진단 방법은, 일반적인 파킨슨병의 증상을 나타내는 MPTP 처리에 의해 유도된 마우스 모델뿐만 아니라, 조기 및 만성적인 파킨슨병의 증상을 나타내는 MPTP/p 처리에 의해 유도된 마우스 모델을 대조군(vehicle 군)과 비교할 때, 모두 유의한 정도의 mRNA 및 단백질의 발현 저하를 확인할 수 있어, 일반적인 파킨슨병 환자는 물론 기존의 진단 방법으론 진단할 수 없는 파킨슨병의 조기증상만 나타나는 환자에 대해서도 파킨슨병을 진단할 수 있음을 확인했으며, 혈청 및 소장 등에서는 대조군과 비교할 때 발현의 유의적인 차이가 나타나지 않음을 확인함으로써, 대장에서 상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 발현을 측정하는 것이 유용한 파킨슨병의 진단방법이 될 수 있다는 사실을 확인하였다.
본 발명에 있어서, 파킨슨병(Parkinson's disease)은 주요증상인 서동, 비자발적 떨림, 강직 및 자세불안 등의 주요 증상 등이 특징적으로 나타나는 신경계의 만성 진행성 퇴행성 질환으로서, 상기 파킨슨병은 조기증상을 보이는 파킨슨병일 수 있다.
상기 조기증상을 보이는 파킨슨병이란, 파킨슨병의 주요한 4가지 증상인 서동, 비자발적 떨림, 강직 및 자세불안 중 3가지 이상의 증상이 아직 보이지 않거나 단지 기본적이며, 부분적인 증상만을 보이는 상태로서, 기존의 파킨슨병 진단방식으로는 진단에 어려움이 있는 파킨슨병이다.
본 발명에 있어서, 상기 mRNA의 수준을 측정할 수 있는 제제는 상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있다.
본 발명에 있어서, 상기 프라이머(Primer)는 DNA 합성의 기시점이 되는 짧은 유전자 서열로서, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화 등으로 변형시킬 수 있다. 본 발명에 있어서 프라이머는 중합효소연쇄반응을 수행하는데 이용할 수 있고, 바람직하게는 실시간 중합효소연쇄반응에 이용될 수 있다. 상기 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(예컨대, Taq DNA 중합효소) 및 상이한 4가지 dNTP(deoxynucleoside triphosphate)의 존재 하에서 DNA 합성을 개시할 수 있다.
본 발명에 있어서, 상기 프로브(Probe)는 효소 화학적인 분리정제 또는 합성과정을 거쳐 제작된 수 염기 내지 수백 염기 길이의 mRNA와 특이적으로 결합할 수 있는 핵산을 의미한다. 방사성 동위원소나 효소 등을 표지하여 mRNA의 존재 유무를 확인할 수 있으며, 공지된 방법으로 디자인하고 변형시켜 사용할 수 있다.
본 발명에 있어서, 상기 단백질의 수준을 측정할 수 있는 제제는 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질에 특이적으로 결합하는 항체일 수 있다.
상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 유전자의 mRNA 발현 수준을 측정하는 경우, 분석 방법으로는 RT-PCR, 경쟁적 RT-PCR, 실시간 RT-PCR, RNase 보호 분석법, 노던 블로팅, DNA 칩 등을 사용할 수 있으나, 본 발명은 이에 제한되지 않는다. 상기 방법들을 통하여 대조군에서의 mRNA 발현량과 파킨슨병 환자 또는 파킨슨병 의심 환자의 생물학적 시료 내의 mRNA 발현량을 확인할 수 있고, 이들 발현량의 정도를 비교함으로써 파킨슨병 발병 여부를 진단 또는 예측할 수 있다.
상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질의 발현 수준을 측정하는 경우, 분석 방법으로는 웨스턴 블랏, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: Radioimmunoassay), 방사 면역확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), 유세포분석(Fluorescence Activated Cell Sorter, FACS), 단백질 칩(protein chip) 등이 있으나 이로 제한되는 것은 아니다. 상기 방법들을 통하여 대조군에서의 단백질 발현량과 파킨슨병 환자 또는 파킨슨병 의심 환자의 생물학적 시료 내의 mRNA 발현량을 확인할 수 있고, 이들 발현의 수준을 비교함으로써 파킨슨병 발병 여부를 진단 또는 예측할 수 있다.
본 발명의 다른 양태로서, 본 발명은 상기 파킨슨병 진단용 조성물을 포함하는, 파킨슨병 진단용 키트를 제공한다.
본 발명에 있어서, 상기 키트는, 이에 한정되는 것은 아니나, ELISA 키트, 면역크로마토그래피 시험 스트립, 방사 분할 면역검정 디바이스, 플로우-쓰로우(flow-through) 디바이스, DNA 칩 및 RT-PCR 키트로 구성되는 군으로부터 선택되는 것일 수 있으며, 더욱 바람직하게는 ELISA 키트 또는 RT-PCR 키트일 수 있다.
본 발명의 진단용 키트는, 상기한 바와 같은 뉴로펩타이드 및 뉴로트로핀의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정할 수 있는 진단용 조성물 외에, 분석에 사용되는 적절한 시약 및 도구를 더 포함할 수 있으며, 이러한 시약 및 도구로는 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지, 용해제, 세정제 등이 포함된다. 또한, 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다.
적합한 담체로는, 이에 한정되지는 않으나, 가용성 담체, 예를 들어 당 분야에 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS, 불용성 담체, 예를 들어 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로스 및 이들의 조합일 수 있다.
상기 진단용 키트가 ELISA 키트인 경우, 바람직하게 마커 단백질에 결합된 항체를 검출할 수 있는 시약, 예를 들면 표지된 2차 항체, 발색단(chromopores), 효소(예:항체와 접합) 및 그의 기질을 포함할 수 있다. 또한, 정량 대조구 단백질에 특이적인 항체를 포함할 수 있다.
상기 키트가 RT-PCR 키트인 경우, 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있으며, 또한 정량 대조구로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.
상기 진단용 키트가 DNA칩 키트인 경우, 유전자 또는 그의 단편에 해당하는 cDNA나 올리고 염기가 부착되어 있는 기판을 포함할 수 있다.
본 발명의 또 다른 양태로서, 피검체 유래의 생물학적 시료에서 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정하는 단계를 포함하는, 파킨슨병 진단을 위한 정보제공 방법을 제공한다.
본 발명에 있어서, 상기 생물학적 시료는 파킨슨병의 발생에 의해 상기 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준의 차이가 발생한 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨와 같은 시료를 포함하나, 이에 제한되지는 않는다.
본 발명에 있어서, 구체적인 실시예를 통해 본 발명에 따른 상기 조성물의 파킨슨병 진단 및 치료효과를 확인하였다.
본 발명의 일 실시예에서는, 신경독성물질(MPTP, MPTP/p)에 의해 파킨슨병 유도된 마우스와 대조군(vehicle 군)의 대장 및 소장에서 12개의 뉴로펩타이드 및 4개의 뉴로트로핀의 mRNA의 발현변화를 관찰한 결과, 소장에서는 유의한 발현 변화가 관찰되지 않았으나, 대장에서는 2개의 뉴로펩타이드(CCK, Dyn A) 및 2개의 뉴로트로핀(BDNF, NT 5)의 mRNA 발현이 유의하게 감소한 것을 확인 하였다(실시예 2-1 참조).
본 발명의 다른 실시예에서는, MPTP에 의해 파킨슨병 유도된 마우스 모델과 대조군의 대장에서 CCK, Dyn A, BDNF 및 NT 5의 단백질 발현을 관찰한 결과, CCK, Dyn A 및 BDNF는 유의한 단백질 발현의 감소가 나타났으나, NT 5의 발현은 유의한 차이를 보여주지 않았다(실시예 2-2 참조). 상기 실험예 2-1 및 2-2를 통해 CCK, Dyn A 및 BDNF의 단백질 및 이를 암호화하는 mRNA의 수준에 유의한 차이를 보이는 상기 CCK, Dyn A, BDNF의 단백질 발현의 변화를 MPTP에 의해 파킨슨병 유도된 마우스와 대조군의 혈청에서 확인한 결과, 대장에서의 결과와 달리, 3가지 모두 유의한 발현의 차이를 보여주지 않아, 다른 조직이 아닌, 대장에서 CCK, Dyn A 및 BDNF의 발현을 측정하는 것이 파킨슨병 진단에 효과적임을 확인하였다(실시예 2-3 참조).
본 발명의 또 다른 실시예에서는, MPTP/p에 의해 파킨슨병 유도된 마우스 모델과 대조군의 대장에서 CCK, Dyn A 및 BDNF의 단백질 수준을 측정하였는데, MPTP에 의해 유도된 파킨슨병 유도 마우스 모델에 비해 초기 또는 만성 파킨슨병 증상을 보이는 MPTP/p 모델에서도 CCK, Dyn A 및 BDNF의 단백질 발현이 유의하게 감소한 것을 확인하여, 초기 또는 만성 파킨슨병의 진단 및 치료를 위해서도 효과적으로 사용될 수 있음을 확인하였다(실시예 3 참조).
본 발명의 또 다른 실시예에서는, 장내균인 PM(Proteus mirablis)의 처리에 의해 파킨슨병 유사 증상 및 도파민 신경의 손상을 보여주는 마우스 모델의 대장에서 CCK, Dyn A 및 BDNF의 단백질 수준을 측정하였는데, 이 때에도 MPTP 및 MPTP/p를 처리한 모델의 경우와 유사하게 상기 CCK, Dyn A 및 BDNF의 단백질 발현이 유의하게 감소한 것을 확인하여, 도파민 신경이 손상된 파킨슨병 유사증상의 진단에도 활용될 수 있음을 확인하였다(실시예 4 참조).
이에, 본 발명의 또 다른 양태로서, 본 발명은 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상 또는 이의 작용제(agonist)를 유효성분으로 포함하는, 파킨슨병 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 "예방"이란 본 발명에 따른 조성물의 투여에 의해 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다.
본 발명에서, "치료"는 생물학적 대상체(예: 인간 또는 동물)을 목적으로 하는 질병이나 질환의 진행 억제 혹은 중지, 진행 속도 감소, 증상 개선 및 완화, 또는 질병예방 등의 치료 효과를 포함한다.
본 발명에 있어서, 작용제(agonist)란 상기 CCK, Dyn A 및 BDNF의 단백질 또는 이를 암호화하고 있는 mRNA의 발현을 증진시킬 수 있는 조성물로서, CCK, Dyn A 및 BDNF의 단백질 또는 mRNA 자체이거나 장내에서 CCK, Dyn A 및 BDNF의 생산에 영향을 주는 미생물의 생육에 영향을 주어 CCK, Dyn A 및 BDNF의 단백질 또는 mRNA의 발현을 증진시킬 수 있는 조성물을 의미하고, 이에 제한되는 것은 아니지만, 6-쇼가올(6-shogaol)일 수 있다.
본 발명에 있어서, 6-쇼가올(6-shogaol)은 1-(4-hydroxy-3-methoxyphenyl)-4-decen-3-one의 구조를 가지는 것으로서 하기 화학식 1의 구조를 가지는 것일 수 있다.
[화학식 1]
Figure PCTKR2021012617-appb-img-000001
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구투여(예를 들어, 정맥 내, 피하, 피부, 비강 또는 기도에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다
본 발명에 따른 약학적 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 제제 시에 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 사이클로덱스트린, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올 또는 리포좀 등을 포함하지만 이에 한정되지 않으며, 필요에 따라 항산화제 또는 완충액 등 다른 통상의 첨가제를 더 포함할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 또는 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액 또는 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립, 또는 정제로 제제화할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제화에 관해서는 레밍턴의 문헌에 개시되어 있는 방법을 이용하여 각 성분에 따라 바람직하게 제제화할 수 있다. 본 발명의 약학적 조성물은 제형에 특별한 제한은 없으나 주사제, 흡입제, 피부 외용제 또는 경구 섭취제 등으로 제제화할 수 있다.
경구투여를 위한 고형제제에는 정제환제, 산제, 과립제, 캡슐제 등이 포함될 수 있으며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있으며, 단순한 부형제 이외에도 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용될 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함될 수 있다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
상기 본 발명의 약학적 조성물은 파킨슨병 환자의 대장, 복강 또는 구강에 약학적으로 유효한 양으로 투여할 수 있다.
본 발명에서 용어, "투여"는 어떠한 적절한 방법으로 대상에게 본 발명의 약학적 조성물을 도입하는 것을 말하며, 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.
본 발명의 약학적 조성물은 목적 또는 필요에 따라 당업계에서 사용되는 통상적인 방법, 투여량에 및 투여 횟수에 따라 적절하게 개체에 투여될 수 있으며, 실제로 투여되는 본 발명의 약학적 조성물의 양 및 투여 횟수는 치료하고자 하는 증상의 종류, 투여 경로, 성별, 건강 상태, 식이, 개체의 연령 및 체중, 및 질환의 중증도와 같은 다양한 인자에 의해 적절하게 결정될 수 있다.
본 발명에서의 용어 "약학적으로 유효한 양"은 의학적 용도에 적용 가능한 합리적인 수혜/위험 비율로 파킨슨병을 억제 또는 완화하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
또한, 본 발명의 또 다른 양태로서, 본 발명은 상기 조성물을 개체에 투여하는 단계를 포함하는 파킨슨병의 예방 또는 치료 방법을 제공한다.
본 발명의 용어 "개체"란, 상기 파킨슨병이 발병될 가능성이 있거나, 또는 발병된 인간을 포함한 모든 동물을 의미한다. 본 발명의 조성물을 개체에 투여함으로써, 파킨슨병을 완화 또는 치료할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 실험 준비 및 수행 방법
1-1. 화학 물질 및 시약
Enhanced chemiluminescence(ECL) 시약은 EMD Millipor(Billerica, MA, USA)에서 구입했으며, TBS 버퍼(Tris-buffered saline)는 Boster Biological Technology Ltd.(Wuhan, China)에서 구입하여 사용하였다. CCK, Dyn A, BDNF 및 NT 4/5의 항체들은 Abcam Biotechnology(Cambridge, England)에서 구입하여 사용하였으며, β-actin 항체들은 Santa Cruz Biotechnology(Santa Cruz, CA, USA)에서 구입한 것을 사용하였다. 실시간 역전사 중합효소연쇄반응(real-time reverse transcription polymerase chain reaction, RT-PCR)을 위한 올리고 뉴클레오티드(oligonucleotide) 프라이머(primer)는 Bioneer(Seoul, South Korea)에서 조달된 것을 사용하였다. Easy Blue kit 및 단백질 용해 완충액(protein lysis buffer)은 Intron Biotechnology(Seoul, South Korea)에서 구입하여 사용하였고, First-Strand cDNA synthesis kit은 Amersham Pharmacia Biotech(Oakville, ON, Canada)에서 구입하여 사용하였다. SYBR Premix Ex Taq는 Takara(Tokyo, Japan)에서 제조된 것을 사용하였으며, CCK, Dyn A 또는 BDNF를 위한 효소결합면역흡착검사(Enzyme-linked immunosorbent assay, ELISA) 키트는 Ray Biotech, Inc(Peachtree Corners, GA, USA)에서 구입하였다.
1-2. 동물 모델
① 실험에 사용된 쥐(mice)는 수컷 C57BL/6 쥐; 7 주령 쥐(MPTP-induced PD mice; n=10/그룹) 및 12 주령 쥐(MPTP/p-induced PD mice; n=10/그룹)를 포함하며, 모두 Daehan Biolink(Eumseong, South Korea)에서 구입하여 사용하였다. 구입한 쥐는 7일간의 적응 기간을 거친 후에, 23±1 ℃의 온도 및 60 ± 10 %의 상대 습도에서 12 시간을 명암주기로 하여, 각 그룹을 별개의 케이지에 수용하고 물에 자유롭게 접근할 수 있는 상태로 관리하였다. 모든 동물 연구는 실험실 동물 관리 원칙(NIH 발행 번호 80-23, 1996 년 개정) 및 대한민국 서울 경희대 학교 동물 관리 및 사용 지침(승인 번호: KHUASP (SE) -17-129 및 KHUASP (SE) -18-140)에 의해 허가된 방법을 따라 수행되었다.
② MPTP에 의해 유도된 파킨슨병 마우스 모델(MPTP-induced PD mouse model)은 식염수에 포함된 MPTP 염산염(MPTP hydrochloride)(30 mg/kg/day in saline)을 5일동안 복강에 주사하는 방법으로 제조하였고, 비교를 위한 대조군인 비히클(vehicle-treated group)군도 동일한 방법으로 같은 양의 식염수를 주사하여 제조하였다. 이렇게 제작된 파킨슨병 마우스 모델이 잘 제작되었는지 확인하기 위해, 도파민성 뉴런 마커인 TH 면역염색법(Tyrosine hydroxylase immunostaining)을 수행한뒤, 주사전자현미경(scanning electron microscope, SEM)을 통해 선조체(striatum, ST) 및 흑질치밀부(substantia nigra pars compacta, SNpc)에서 염색된 도파민성 뉴런을 관찰한 결과, 도 1a에서 나타난 바와 같이, 대조군보다 MPTP를 주입한 마우스의 선조체 및 흑질치밀부에서 도파민성 뉴런이 유의하게 감소한 것을 확인하여, 파킨슨병 마우스 모델이 잘 제작되었다는 사실을 확인하였다. 이렇게 제작된 파킨슨병 마우스 모델은 마지막 MPTP 염산염 주입 뒤, 7일의 시간이 경과한 후에 운동분석을 수행하였고, 운동분석을 마친 뒤, 장내 조직 세부분석을 위해 희생되었다.
③ MPTP/p에 의해 유도된 파킨슨병 마우스 모델(MPTP/p-induced PD mouse model)은 식염수에 MPTP 염산염(MPTP hydrochloride)(25 mg/kg/day in saline i.p.)을 프로베네시드(probenecid)(100 mg/kg/day in 5% NaHCO3, i.p.)과 함께 10회 주사하여 제조하였다(10회 주사는 5주 일정으로 3.5일 간격을 두고 주사하였다). 비교를 위한 대조군인 비히클(vehicle-treated group)군도 동일한 방법으로 같은 양의 살균된 식염수를 주사하여 제조하였다. 프로베네시드는 MPTP 염산염 주입 30분전에 미리 주입되는데, 프로베네시드는 MPTP가 자연적으로 제거되는 것을 방지하여, 주사 후 6개월 동안 선조체(striatal)의 도파민이 만성적으로 결핍시키는 방법을 통해, MPTP의 신경독성을 강화시키기에, 보조제로 사용하였다. 이렇게 제작된 파킨슨병 마우스 모델이 잘 제작되었는지 확인하기 위해, 도파민성 뉴런 마커인 TH 면역염색법(Tyrosine hydroxylase immunostaining)을 수행한뒤, 주사전자현미경(scanning electron microscope, SEM)을 통해, 선조체(striatum, ST) 및 흑질치밀부(substantia nigra pars compacta, SNpc)에서 염색된 도파민성 뉴런을 관찰한 결과, 도 1b에 나타난 바와 같이, 대조군보다 MPTP/p를 주입한 마우스의 선조체 및 흑질치밀부에서 도파민성 뉴런이 유의하게 감소한 것을 확인하여, 파킨슨병 마우스 모델이 잘 제작되었다는 사실을 확인하였다. 이렇게 제작된 마우스 모델은 기존에 알려진 바와 같이 MPTP만 처리한 파킨슨병 마우스 모델에 비해 조기 및 만성적인 파킨슨병의 증상을 나타내었다. MPTP/p 처리에 의해 유도된 파킨슨병 마우스 모델에 대하여 MPTP 및 프로베네시드를 10회 주사를 놓은 다음날 운동분석을 수행하였으며, 운동분석을 마친 후, 장내 조직 세부분석을 위해 희생시켰다.
1-3. 마우스 장 해부
실험을 위해, 마우스를 이산화탄소(CO2)로 마취하고, 희생시킨 후, 가위로 마우스 중간 복부 피부(mid-abdominal skin)를 자르고, 드레싱 집게로 직장(rectum)/원위 결장(distal colon)을 부드럽게 당겨, 대장(large intestine)의 조직을 분리하였다. 또한, 소장을 분리하기 위해, 장간막(mesentery)에서 소장(small intestine)을 뽑아내고, 유문(pylorus)에서 떨어져 있는 소장을 가로질러 절단하여 소장 조직을 분리하였다. 이렇게 준비된 대장 및 소장 조직은 -80 ℃의 온도에서 보관되었다.
1-4. 로타로드 테스트(rota-rod test)
파킨슨병 마우스 모델에서 운동 감소증(hypokinesia)을 측정하기 위해, 로타로드 테스트를 수행하였다. 로타로드 테스트는 MPTP 마지막 주입 후 7일 또는 MPTP/p의 마지막 주입한 다음날 수행하였다. 테스트를 위한 장치는 직경 7.3cm의 회전 스핀들(rotating spindle)과 쥐 5마리를 동시에 실험할 수 있도록 구성된 5개의 개별 구획으로 구성되었다. 3 분 동안 8rpm의 회전 속도로 수행한 첫날의 테스트 이후에, 이튿날은 회전속도를 11rpm으로 증가하여 테스트를 수행하였고, 각각의 쥐가 회전하는 막대에 남아있는 시간은 5분의 간격을 둔 3번의 테스트를 통해 각 시험당 최대 300초로 기록하였으며, 3번의 테스트의 평균 시간을 산출하여 데이터에 나타낸 결과, MPTP(도 2a) 또는 MPTP/p(도 2b) 처리한 파킨슨병 마우스 모델 모두에서 유의한 운동능력의 감소를 관찰할 수 있었다.
1-5. 역전사 중합효소연쇄반응(RT-PCR) 및 실시간 역전사 중합효소연쇄반응(qRT-PCR)
First-Strand cDNA synthesis kit를 활용하여 총 1 μg의 RNA에 대한 역전사를 수행하였으며, Easy Blue kit를 활용하여 역전사된 RNA를 추출하였다. PCR을 위한 프라이머는 하기 표 1의 프라이머를 사용하였고, Thermal Cycler Dice Real Time PCR system 및 SYBR Premix Ex Taq를 활용하여 cDNA를 증폭하고 해리 곡선(dissociation curve)을 분석한 결과, 단일 피크(single peak)를 확인할 수 있었다. 관심 유전자의 발현은 표적 cDNA의 Ct(threshold cycle) 평균값을 GAPDH을 참조하여 정규화하는 방법인 Ct 비교(comparative Ct) 방법을 사용하여 분석하였다.
Gene name Forward primer sequences
(5'-3')		 Reverse primer sequences
(5'-3')
NPY GCCACGATGCTAGGTAACAA TTGATGTAGTGTCGCAGAGC
Ghrelin CCAGAAAGCCCAGAGAAAGG CTCTTTGACCTCTTCCCAGA
VIP TACAGCAGACTTCTGGGTCA TGTAACTCCCTCTTGCCTGT
CRF GAGCCCAAGTACGTTGAGAG TTCTCCTCCCTTGGTAGGTG
GLP-1 CTCTGTCTACACCTGTTCGC TGGGAATGATCTGGGGTTCT
Leptin AGGAGTTGACTCTTTCCGGA CTTTTCTTGGGGCTCACTGT
Peptide YY GCTCTGTTCTCCAAACTGCT AACATGCAAGTGAAGTCGGT
Calcitonin gene-related peptide CTCCTCGGCAGAGAAACTTC AGCCTCTGGTAAAGCCTGTA
galanin GAGAAGAGAGGTTGGACCCT TGTAACTCCCTCTTGCCTGT
CCK CCTCTGGTTGGGGTGTAACC AGTCAAGCCAAATGCAGACA
Dyn A GGTGGTCCTTGTGTGCTGTA TCCCCAAGTCCTCCTTGTCA
Neurotensin ATCAGCAAAGCAAGTCCTCC TCATGCATGTCTCCTGCTTC
BDNF ACTTCAGCGAGCTCAATGAG AAAGCGTCTTTTCCGAGGTT
NGF AGTTCAGCGAGCTCAATGAG GCGTCGAATCCTGTTGAGAG
NT3 GGAGGAAACGCTATGCAGAA CGAATGTCAATGGCTGAGGA
NT5 GCAGGTAGATCATGGCCATC CCTCCAGGCAATCTTCTGTC
GAPDH GAGTCAACGGATTTGGTCGT TTGATTTTGGAGGGATCTCG
1-6. 효소결합면역흡착검사(ELISA)
항응고제로 EDTA를 사용하여 마우스 혈청(serum)을 수집하였으며, 수집된 표본을 수집 후 30분 이내에 2-8℃에서 15분 동안 1000 x g의 강도로 원심분리 하였다. 1차 원심분리 후, 혈소판을 완전히 제거하기 위해, 2-8℃에서 10분 동안 10,000 x g의 강도로 원심분리를 다시 수행하였다. 원심분리를 통해 얻어진 혈청의 neuropeptides(CCK, Dyn A) 및 neurotrophin(BDNF)는 RayBiotech에서 제조된 EIA kit를 사용하여 측정되었다.
1-7. 웨스턴 블로팅(Western blotting)
조직에서 단백질을 추출하기 위해 단백질 용해 완충액(protein lysis buffer)을 사용했으며, 추출된 단백질의 농도는 Bradford assay에 의해 측정되었다. 단백질은 10-15%의 소듐도데실설페이트폴리아크릴아미드겔(sodium dodecyl sulfate polyacrylamide gel electrophoresis) 전기 영동을 통해 분리되었다. 전기 영동 후, 겔의 단백질을 1시간동안 전기블로팅(electroblotting)하여, 폴리비닐리덴플루오라이드막(polyvinylidene fluoride membranes)으로 옮겼고, 막은 5%의 탈지유(skimmed milk) 및 Tween 20(TBS-T)로 보완된 TBS 버퍼(Tris-buffered saline)을 차단용액(blocking solution)으로 사용하여 20 ℃의 온도에서 30분동안 배양한 뒤, 희석된 CCK, Dyn A, BDNF, NT5 및 B-actin의 1차 항체와 함께 5%의 탈지유와 TBS-T안에서 4 ℃의 온도로 밤새 배양하였다. 배양이 끝난 후, 막을 4회 세척하여 1차 항체를 제거하였고, 그 후, 실온에서 horseradish 과산화 효소(horseradish peroxidase, HRP)를 첨가하여 1시간 동안 추가로 배양하였다. 배양을 마친 뒤, ECL 용액으로 3분 동안 추가 배양한 뒤, Image Quant LAS-4000(Fujifilm Life science, Tokyo, Japan)를 통해 면역반응밴드의 시각화 및 분석을 수행했다.
1-8. 통계 분석
모든 통계적인 매개변수(parameter)는 GraphPad Prism 5.0 프로그램을 이용하여 계산하였고, 값은 평균 ± 표준 편차(SD)로 표현하였다. 산출된 데이터는 양측 테스트(two-tailed test)와 함께 Student`s t-test를 통해 분석되었고, p value가 0.05 이하인 경우 통계적으로 유의한 것으로 간주하였다.
실시예 2. MPTP 처리에 의해 파킨슨병 유도된 마우스 모델의 장내에서 뉴로펩타이드 및 뉴로트로핀의 mRNA 수준 측정
2-1. 파킨슨병 유도된 마우스 모델의 소장 및 대장에서 뉴로펩타이드 및 뉴로트로핀의 mRNA 수준 측정
대조군(vehicle 군)과 MPTP 처리에 의해 파킨슨병 유도된 마우스 모델의 장내(소장 및 대장)에서 뉴로펩타이드(neuropeptide) 및 뉴로트로핀(neurotrophin)의 mRNA 발현을 측정하기 위해 파킨슨병 마우스 모델의 운동장애(mortor impairment) 및 흑질선조체(nigrostriatal) 도파민 뉴런의 퇴화를 관찰함으로써, 파킨슨병이 유도되었음을 확인하였고, 이렇게 준비된 마우스 모델 및 대조군(vehicle 군)의 소장 및 대장에서 12개의 뉴로펩타이드(NPY, ghrelin, VIP, CRF, GLP-1, leptin, peptide YY, calcitonin gene-related peptide, galanin, CCK, Dyn A 및 neurotensin)와 4개의 뉴로트로핀(BDNF, NGF, NT3 및 NT5)의 mRNA를 qRT-PCR을 활용하여 측정한 결과, 도 3a에 나타난 바와 같이, 2개의 뉴로펩타이드인 CCK(0.57 ± 0.09; *p<0.05), Dyn A(0.40 ± 0.14; *p<0.05) 및 2개의 뉴로펩타이드 BDNF(0.42 ± 0.11; *p<0.05), NT5(0.53 ± 0.09; *p<0.05)의 mRNA 발현이 대장에서 유의하게 감소한 것을 확인 하였다. 다만, 도 3b에서 나타난 바와 같이, 소장에서는 mRNA의 발현이 유의하게 차이가 나지 않음을 확인할 수 있었는데, 이러한 결과를 통해 몇몇 뉴로펩타이드와 뉴로트로핀이 MPTP로 유도된 파킨슨병 마우스 모델 대장에서 현저하게 감소되어 있음을 확인할 수 있었다.
2-2. 파킨슨병 유도된 마우스 모델의 대장에서 뉴로펩타이드 및 뉴로트로핀의 단백질 발현 측정
대조군(vehicle 군)과 MPTP 처리에 의해 파킨슨병 유도된 마우스 모델의 대장에서, 상기 실험예 2-1에서 mRNA의 발현이 감소한 2개의 뉴로펩타이드 및 2개의 뉴로트로핀의 mRNA가 암호화하는 단백질 수준을 웨스턴 블로팅(western blotting)을 통해 관찰한 결과, 도 4에 나타난 바와 같이, CCK(0.63 ± 0.15; * p <0.05), Dyn A(0.65 ± 0.19; * p <0.05) 및 BDNF(0.76 ± 0.07; * p <0.05)의 단백질 발현은 유의하게 감소하였으나, NT 5의 단백질 발현은 파킨슨병 유도된 마우스 모델과 대조군 사이에 차이가 거의 없음을 확인할 수 있었다.
2-3. 파킨슨병 유도된 마우스 모델의 혈청에서 뉴로펩타이드 및 뉴로트로핀의 단백질 발현 측정
대조군(vehicle 군)과 MPTP 처리에 의해 파킨슨병 유도된 마우스 모델의 혈청(serum)에서 상기 실험예 2-1 및 2-2를 통해 확인한, 단백질 또는 이를 암호화하는 mRNA의 수준이 모두 감소하는 2개의 뉴로펩타이드 및 1개의 뉴로트로핀의 단백질 수준을 ELISAkit를 통해 관찰한 결과, 도 5에 나타난 바와 같이, CCK, Dyn A 및 BDNF 모두에서 감소되는 경향성을 보였으나, 유의한 수준의 저하를 확인할 수 없었다. 다만, 개별인자 측정값을 다양한 조합으로 합하여 평균값을 구하고 Mann Whiteny　Test를 이용하여 p value를 계산했을 때, 하기 표 2에 나타낸 바와같이 p value 0.023으로 통계적인 유의성을 확인할 수 있었다.
　 Control 평균 MPTP 유도군 평균 P-value
BDNF 2.480 2.020 0.495
CCK 1.687 1.436 0.110
Dyn A 3.070 2.558 0.604
BDNF+CCK 4.167 3.456 0.338
BDNF+Dyn A 5.549 4.578 0.074
CCK+ DynA 4.757 3.993 0.423
BDNF+ CCK+ DynA 7.237 6.014 0.023*
실시예 3. MPTP/p 처리에 의해 파킨슨병 유도된 마우스 모델의 대장에서 뉴로펩타이드 및 뉴로트로핀의 단백질 발현 측정
MPTP/p 처리에 의해 만성적인 파킨슨병 유도된 마우스 모델의 대장에서 웨스턴 블로팅을 통해 상기 실시예 2를 통해 밝혀진 단백질 또는 이를 암호화하는 mRNA의 발현이 모두 저하되는 것으로 확인된 CCK, Dyn A 및 BDNF의 단백질 발현을 관찰하였다. 그 결과, 도 6에 나타난 바와 같이 CCK(0.45 ± 0.03; * p <0.05), Dyn A(0.50 ± 0.04; * p <0.05) 및 BDNF (0.64 ± 0.09; * p <0.05)의 단백질 발현이 유의하게 감소한 것을 확인하여, MPTP 처리에 의해 유도된 일반 파킨슨병 모델뿐만 아니라, MPTP/p 처리에 의해 제작된 초기 및 만성 파킨슨병 증상을 보이는 마우스 모델의 대장에서도 CCK, Dyn A 및 BDNF의 단백질 발현이 감소를 관찰하여, 본 발명의 진단 방법이 파킨슨병의 조기진단에도 활용될 수 있음을 확인했다.
실시예 4. PM 처리에 의해 파킨슨병 유사 증상 유도된 마우스 모델의 대장에서 뉴로펩타이드 및 뉴로트로핀의 단백질 발현 측정
① 파킨슨병과 같은 행동 및 도파민 신경의 손상이 발생한다고 밝혀진 장내균인 PM(Proteus mirablis)을 마우스에 처리한 후, 대장(large intestine, colon)에서 웨스턴 블로팅을 통해 상기 실시예 2를 통해 밝혀진 단백질 또는 이를 암호화하는 mRNA의 발현이 모두 저하되는 것으로 확인된 CCK, Dyn A 및 BDNF의 단백질 발현을 관찰하였다. 그 결과, PM을 처리한 마우스의 대장에서도 상기 CCK, Dyn A 및 BDNF의 단백질 발현이 감소하는 것을 확인하였고, 본 발명의 진단 방법이 도파민 신경의 손상이 발생하여 파킨슨병과 유사한 증상(운동장애 등)을 보이는 경우에도 활용될 수 있음을 확인했다.
② CCK, Dyn A 또는 BDNF의 작용제(agonist)인 6-쇼가올(6-shogaol)을 세포독성이 없는 농도(0.2-5 μM)로 처리한 다음, STC1 intestinal enteroendocrine cells과 Caco-2 intestinal epithelial cells에 24시간 처리한후 RT-PCR 및 Western blotting을 이용해 BDNF, CCK, Dyn A의 mRNA 발현(도 8a) 및 단백질 발현(도 8b)의 수준을 확인했을 때, 6-쇼가올을 처리한 세포에서 BDNF, CCK, Dyn A의 발현이 증가하는 것을 확인하였다.
상기 진술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에서는 파킨슨병 환자의 대장(large intestine, colon)에서 단백질 및 이를 암호화하는 mRNA의 발현이 감소하는 뉴로펩타이드 및 뉴로트로핀을 확인하였고, 상기 뉴로펩타이드 및 뉴로트로핀을 활용하여 파킨슨병을 조기에 진단할 수 있고, 파킨슨병에 대한 치료효과도 뛰어난바, 파킨슨병의 진단 또는 치료에 사용될 수 있을 것으로 기대된다.

Claims (12)

  1. CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정할 수 있는 제제를 포함하는, 파킨슨병 진단용 조성물.
  2. 제 1항에 있어서,
    상기 단백질 또는 이를 암호화하는 mRNA의 수준은 대장(large intestine, colon)에서 측정하는 것을 특징으로 하는, 조성물.
  3. 제 1항에 있어서,
    상기 조성물은 파킨슨병을 조기에 진단할 수 있는 것을 특징으로 하는, 조성물.
  4. 제 1항에 있어서,
    상기 mRNA의 수준을 측정할 수 있는 제제는 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 유전자의 mRNA에 상보적으로 결합하는 센스 및 안티센스 프라이머 또는 프로브인 것을 특징으로 하는, 조성물.
  5. 제 1항에 있어서,
    상기 단백질의 수준을 측정할 수 있는 제제는 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질에 특이적으로 결합하는 항체인 것을 특징으로 하는, 조성물.
  6. 제 1항 내지 제 5항 중, 어느 한 항의 파킨슨병 진단용 조성물을 포함하는, 파킨슨병 진단용 키트.
  7. 피검체 유래의 생물학적 시료에서 CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상의 단백질 또는 이를 암호화하는 mRNA의 수준을 측정하는 단계를 포함하는, 파킨슨병 진단을 위한 정보제공 방법.
  8. CCK, Dyn A 및 BDNF로 이루어진 군에서 선택되는 하나 이상 또는 이의 작용제(agonist)를 유효성분으로 포함하는, 파킨슨병 예방 또는 치료용 약학적 조성물.
  9. 제8항에 있어서,
    상기 작용제(agonist)는 6-쇼가올(6-shogaol)인 것을 특징으로 하는, 조성물.
  10. 제 8항에 있어서,
    상기 조성물은 대장, 복강 또는 구강에 투여하는 것을 특징으로 하는, 조성물.
  11. 제8항의 약학적 조성물을 개체에 투여하는 단계를 포함하는, 파킨슨병 예방 또는 치료방법.
  12. 제8항의 약학적 조성물의 파킨슨병 치료용도.
PCT/KR2021/012617 2020-09-15 2021-09-15 장내 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물 WO2022060095A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0118664 2020-09-15
KR20200118664 2020-09-15

Publications (1)

Publication Number Publication Date
WO2022060095A1 true WO2022060095A1 (ko) 2022-03-24

Family

ID=80777275

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/012617 WO2022060095A1 (ko) 2020-09-15 2021-09-15 장내 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물

Country Status (2)

Country Link
KR (1) KR102603135B1 (ko)
WO (1) WO2022060095A1 (ko)

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
AHN SORA, LIU QUAN FENG, JANG JAE-HWAN, PARK JEONGHUN, JEONG HA JIN, KIM YOUNGMAN, KIM DONG-HEE, JEONG GUWON, OH SEUNG TACK, PARK : "Gami–Chunggan Formula Prevents Motor Dysfunction in MPTP/p-Induced and A53T α-Synuclein Overexpressed Parkinson’s Disease Mouse Model Though DJ-1 and BDNF Expression", FRONTIERS IN AGING NEUROSCIENCE, vol. 11, pages 1 - 15, XP055912057, DOI: 10.3389/fnagi.2019.00230 *
CHOI JIN GYU, JEONG MIRAN, JOO BOH RAH, AHN JI-HYE, WOO JEONG-HWA, KIM DONG-HYUN, OH MYUNG SOOK, CHOI JUNG-HYE: "Reduced Levels of Intestinal Neuropeptides and Neurotrophins in Neurotoxin-Induced Parkinson Disease Mouse Models", JOURNAL OF NEUROPATHOLOGY AND EXPERIMENTAL NEUROLOGY, vol. 80, no. 1, 1 January 2021 (2021-01-01), NEW YORK, NY. , pages 15 - 20, XP055912081, ISSN: 0022-3069, DOI: 10.1093/jnen/nlaa113 *
HOWELLS D.W., PORRITT M.J., WONG J.Y.F., BATCHELOR P.E., KALNINS R., HUGHES A.J., DONNAN G.A.: "Reduced BDNF mRNA Expression in the Parkinson's Disease Substantia Nigra", EXPERIMENTAL NEUROLOGY, vol. 166, no. 1, 1 November 2000 (2000-11-01), AMSTERDAM, NL , pages 127 - 135, XP055912065, ISSN: 0014-4886, DOI: 10.1006/exnr.2000.7483 *
PALASZ EWELINA, WYSOCKA ADRIANNA, GASIOROWSKA ANNA, CHALIMONIUK MALGORZATA, NIEWIADOMSKI WIKTOR, NIEWIADOMSKA GRAZYNA: "BDNF as a Promising Therapeutic Agent in Parkinson’s Disease", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 21, no. 3, pages 1170, XP055912078, DOI: 10.3390/ijms21031170 *
SHIM SEHWAN; KIM SOKHO; KWON YOUNG-BAE; KWON JUNGKEE: "Protection by [6]-shogaol against lipopolysaccharide-induced toxicity in murine astrocytes is related to production of brain-derived neurotrophic factor", FOOD AND CHEMICAL TOXICOLOGY, vol. 50, no. 3, 1 January 1900 (1900-01-01), GB , pages 597 - 602, XP028904430, ISSN: 0278-6915, DOI: 10.1016/j.fct.2011.11.042 *
VIDAL-MARTÍNEZ GUADALUPE, VARGAS-MEDRANO JAVIER, GIL-TOMMEE CAROLINA, MEDINA DAVID, GARZA NATHAN T., YANG BARBARA, SEGURA-ULATE IS: "FTY720/Fingolimod Reduces Synucleinopathy and Improves Gut Motility in A53T Mice", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 291, no. 39, 1 September 2016 (2016-09-01), US , pages 20811 - 20821, XP055912069, ISSN: 0021-9258, DOI: 10.1074/jbc.M116.744029 *

Also Published As

Publication number Publication date
KR102603135B1 (ko) 2023-11-16
KR20220036358A (ko) 2022-03-22

Similar Documents

Publication Publication Date Title
US20210164051A1 (en) Methods of detection and analysis of nucleic acid in neural-derived exosomes
WO2016137164A2 (ko) 바실러스 속 세균 유래 세포밖 소포체를 포함하는 임신관련 질환 치료용 조성물
WO2017010789A1 (ko) 마약 중독 여부 진단용 바이오마커 및 마약 중독 여부 진단용 키트
US20140147856A1 (en) Intestinal Permeability Assay for Neurodegenerative Diseases
WO2022119243A1 (ko) 천식 또는 천식 악화 진단용 pcr 키트 및 이를 이용한 천식 또는 천식 악화 진단을 위한 정보의 제공방법
KR102118631B1 (ko) 관절염 진단용 조성물 및 이를 포함하는 키트
WO2022060095A1 (ko) 장내 뉴로펩타이드 및 뉴로트로핀을 포함하는 파킨슨병의 진단 및 치료용 조성물
WO2022031072A1 (ko) 버피 코트 시료에 사용하기 위한 췌장암 진단용 조성물
WO2019147080A1 (ko) 세균 메타게놈 분석을 통한 우울증 진단방법
WO2018105921A2 (ko) 지방간의 진단 또는 치료를 위한 류신 지퍼 단백질의 용도
Morré et al. Is Chlamydia pneumoniae present in the central nervous system of multiple sclerosis patients?
Rossi et al. Diabetes mellitus in tropical chronic pancreatitis is not just a secondary type of diabetes
WO2022025387A1 (ko) Microrna조합을 이용한 비알코올 지방간염 진단용 바이오마커
WO2022102885A1 (ko) 엑소좀 유래 miRNA를 이용한 아토피성 피부염 상관 스트레스 진단기술
WO2020138561A1 (ko) 뇌수막염 진단을 위한 정보제공방법
WO2024080651A1 (ko) Thada 마커를 이용한 설폰요소제 의존성 예측용 조성물 및 그 예측 방법
Halim et al. Haematological alteration in Leprosy patients treated with dapsone
WO2021174741A1 (zh) 二甲基小檗胺类化合物在抑制SARS-CoV-2中的用途
WO2022045768A1 (ko) 당뇨병 치료제에 대한 약물반응성 예측용 마이크로 rna 바이오마커 및 이의 용도
WO2020231221A1 (ko) G-CSF 및 IL-1β를 이용한 호중구성 폐 염증질환의 진단, 예방 또는 치료용 조성물
WO2019093585A1 (ko) 다발성 골수종 환자에서 레날리도마이드 및 덱사메타손의 치료에 대한 예후 예측용 바이오 마커
WO2022114878A1 (ko) 섬유증의 진단 또는 치료용 조성물
WO2023158207A1 (ko) 심방세동 진단을 위한 엑소좀 내 긴 비암호화 rna 바이오마커 및 이의 용도
WO2020256529A1 (ko) 신장이식 후 bk 바이러스 감염성 신병증의 진단 또는 신장이식 후 환자의 예후 예측을 위한 소변 엑소좀 바이오마커
WO2023043257A1 (ko) Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21869717

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21869717

Country of ref document: EP

Kind code of ref document: A1