WO2023043257A1 - Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물 - Google Patents

Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2023043257A1
WO2023043257A1 PCT/KR2022/013870 KR2022013870W WO2023043257A1 WO 2023043257 A1 WO2023043257 A1 WO 2023043257A1 KR 2022013870 W KR2022013870 W KR 2022013870W WO 2023043257 A1 WO2023043257 A1 WO 2023043257A1
Authority
WO
WIPO (PCT)
Prior art keywords
smpd1
expression
gene
osteoarthritis
articular cartilage
Prior art date
Application number
PCT/KR2022/013870
Other languages
English (en)
French (fr)
Inventor
최제용
차상국
김한
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220114733A external-priority patent/KR20230040906A/ko
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Publication of WO2023043257A1 publication Critical patent/WO2023043257A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating osteoarthritis containing a Smpd1 modulator as an active ingredient.
  • Osteoarthritis is known as a degenerative joint disease mainly caused by the degeneration of articular cartilage cells, inhibiting the formation of normal articular cartilage extracellular matrix (cartilage ECM synthesis) and promoting cartilage destruction due to the death of articular cartilage cells. come.
  • osteoarthritis is not simply an incidental disease caused by aging and mechanical load, but a chronic metabolic disease caused by cholesterol metabolism like arteriosclerosis. Degradative enzymes are increased to destroy cartilage tissue. Mechanical stress, including joint instability and injury, and aging-related factors that predispose to osteoarthritis and metabolic triggers are potential mechanisms for osteoarthritis.
  • cartilage tissue constituting a joint does not normally regenerate in vivo once damaged. When the cartilage tissue of these joints is damaged, daily activities are limited along with severe pain, and when chronic, it causes fatal osteoarthritis, which interferes with normal life or occupational activities.
  • rheumatoid arthritis unlike degenerative arthritis caused by the destruction of cartilage cells and cartilage tissue, the progression of the disease by an autoimmune reaction is known to be an important causative factor.
  • Rheumatoid arthritis is a chronic autoimmune disease characterized by inflammation and proliferation of synovial cells, and unlike degenerative arthritis, osteoporosis and bone erosion of bones around joints occur.
  • Rheumatoid arthritis progresses when inflammation of the synovial membrane spreads to the joint capsule, ligament, and tendon, and invades the bone. Therefore, degenerative arthritis and rheumatoid arthritis have completely different causes and stages of progression, and their treatment methods are also different.
  • NSAIDs non-steroidal anti-inflammatory drugs
  • penicillamine steroid hormones
  • TNF inhibitors TNF inhibitors
  • interleukin inhibitors JAK inhibitors
  • anti-CD related inhibitors suitable for blocking the inflammatory mechanism.
  • applicable NSAID drugs and steroid hormones are used in patients with degenerative arthritis for the purpose of relieving joint pain and inflammation, but since they relieve only symptoms rather than treating the disease itself, they cannot serve as a practical therapeutic agent for degenerative arthritis.
  • degenerative arthritis which is mainly caused by destruction of cartilage cells and cartilage tissue, has a different cause and phenomenon from inflammatory arthritis, rheumatoid arthritis, so the treatment method for osteoarthritis is inevitably different from the treatment method for rheumatoid arthritis.
  • osteoarthritis in order to prevent or slow down the progression of osteoarthritis, it is necessary to diagnose osteoarthritis at an early stage, but until now, only image analysis methods such as X-ray by visiting an orthopedic or rheumatology department have been known as a method of diagnosing osteoarthritis.
  • the present invention provides a biomarker composition for diagnosing osteoarthritis by confirming changes in the expression or activity level of Smpd1, and a diagnostic kit capable of measuring the expression level of the biomarker, a method for diagnosing osteoarthritis using the biomarker, and a therapeutic agent for osteoarthritis. It is intended to provide a screening method.
  • compositions for preventing or treating degenerative arthritis containing a Smpd1 expression or activity inhibitor as an active ingredient.
  • the present invention provides a biomarker composition for diagnosing osteoarthritis, containing Smpd1 (Sphingomyelin phosphodiesterase 1) gene or a protein encoded by the gene as an active ingredient.
  • Smpd1 Sphingomyelin phosphodiesterase 1
  • the present invention provides a kit for diagnosing osteoarthritis containing, as an active ingredient, an agent for measuring the expression or activity level of Smpd1 (Sphingomyelin phosphodiesterase 1) gene or a protein encoded by the gene.
  • Smpd1 Sphingomyelin phosphodiesterase 1
  • the present invention comprises the steps of confirming the expression or activity level of the Smpd1 gene or the protein encoded by the gene in a biological sample isolated from the subject; comparing the expression or activity level of the gene or the protein encoded by the gene with a normal control group; and diagnosing osteoarthritis when the expression or activity level of the gene or the protein encoded by the gene is higher than that of a normal control group.
  • the present invention comprises the steps of treating a candidate substance to a biological sample isolated from an arthritis patient; Checking the expression or activity level of the Smpd1 gene or a protein encoded by the gene in the sample treated with the candidate substance; comparing the expression or activity level of the gene or the protein encoded by the gene with a normal control group; and selecting a candidate substance whose expression or activity level of the gene or the protein encoded by the gene is lower than that of a normal control group.
  • the present invention provides a pharmaceutical composition for preventing or treating osteoarthritis, containing an Smpd1 expression or activity inhibitor as an active ingredient.
  • Smpd1 increased expression of Smpd1 was confirmed in damaged articular cartilage and aged articular cartilage of animal models, and increased expression of Smpd1 was also confirmed in articular cartilage of patients with osteoarthritis.
  • Smpd1 protein processing the influx of ox-LDL (Oxidized low-density lipoprotein) involved in cholesterol metabolism into cells increases, and Type II collagen, which plays an important role in maintaining the homeostasis of articular cartilage, is reduced and the extracellular matrix of articular cartilage It was confirmed that the expression of MMP13, which decomposes, was increased, and type II collagen was increased and MMP13 was decreased due to inhibition of Smpd1.
  • ox-LDL Oxidized low-density lipoprotein
  • ceramide produced by Smpd1 also increased CH25H, CYP7B1 and ROR ⁇ gene expression, confirming Type II collagen that plays an important role in maintaining articular cartilage homeostasis, confirming that Smpd1 induces degeneration of articular cartilage and osteoarthritis.
  • the expression of Smpd1 by the inflammatory factors IL-1 ⁇ and TNF ⁇ and the expression of Smpd1 protein in osteoarthritis patients increased, the Smpd1 can be provided as a biomarker for diagnosing osteoarthritis, and the inhibitor of Smpd1 expression or activity It can be provided as a therapeutic agent for osteoarthritis.
  • Figure 2 shows the results of fluorescence immunological staining confirming the change in the expression level of Smpd1 in aged articular cartilage.
  • the inventors of the present invention confirmed an increase in the expression level of Smpd1 in damaged articular cartilage and aged articular cartilage of animal models, and also confirmed that the expression of Smpd1 increased in articular cartilage of patients with osteoarthritis.
  • Smpd1 protein processing increases the influx of ox-LDL (Oxidized low-density lipoprotein) involved in cholesterol metabolism into cells, reduces Type II collagen, which plays an important role in maintaining the homeostasis of articular cartilage, and restores the extracellular matrix of articular cartilage. It was confirmed that the expression of degrading MMP13 was increased, and type II collagen was increased and MMP13 was decreased by inhibition of Smpd1.
  • ox-LDL Oxidized low-density lipoprotein
  • ceramide produced by Smpd1 also increased the expression of CH25H, CYP7B1, and ROR ⁇ genes along with Smpd1, and it was confirmed that the expression of Type II collagen, which plays an important role in maintaining articular cartilage homeostasis, decreased. It was confirmed that osteoarthritis was induced. Furthermore, the present invention was completed to provide a biomarker for diagnosing osteoarthritis and a therapeutic agent for osteoarthritis by confirming that Smpd1 expression by inflammatory factors IL-1 ⁇ and TNF ⁇ and Smpd1 protein expression in osteoarthritis patients increased.
  • the present invention can provide a biomarker composition for diagnosing osteoarthritis, containing Smpd1 (Sphingomyelin phosphodiesterase 1) gene or a protein encoded by the gene as an active ingredient.
  • Smpd1 Sphingomyelin phosphodiesterase 1
  • Expression of the Smpd1 gene or a protein encoded by the gene may be increased in a damaged joint compared to a normal control group.
  • the Smpd1 gene or a protein encoded by the gene may induce osteoarthritis by activating the CH25H-CYP7B1-RORa signaling process.
  • the CH25H-CYP7B1-RORa signaling process may be activated by increased cholesterol in degenerated chondrocytes to increase cartilage matrix decomposition enzymes, thereby destroying cartilage tissue and causing osteoarthritis.
  • the Smpd1 (Sphingomyelin phosphodiesterase 1) is NCBI assessment number. It may be NM_000543.5.
  • a “biomarker” is an indicator that can detect changes in the body, and can measure the normal or pathological state of an organism, that is, the diagnosis of osteoarthritis, the degree of response to drugs, and the like.
  • diagnosis refers to determining whether or not osteoarthritis has occurred or whether there is a possibility (risk) of developing osteoarthritis, determining a subject's susceptibility to osteoarthritis or at least one symptom of osteoarthritis, and determining whether a subject has osteoarthritis Determining whether or not currently has, determining the prognosis of a subject suffering from osteoarthritis, or using therametrics (e.g., monitoring a subject's condition to provide information about treatment efficacy) ). It also includes primary diagnosis of a clinical condition or diagnosis of a recurrent disease.
  • the present invention may provide a kit for diagnosing osteoarthritis containing, as an active ingredient, an agent for measuring the expression or activity level of Smpd1 (Sphingomyelin phosphodiesterase 1) gene or a protein encoded by the gene.
  • Smpd1 Sphingomyelin phosphodiesterase 1
  • the agent may be a primer or probe that specifically binds to the Smpd1 gene, an antibody, peptide, aptamer, or compound that specifically binds to a protein encoded by the gene.
  • a "primer” is a nucleic acid sequence having a short free 3'hydroxl group, which can form base pairing with a complementary template and a short nucleic acid sequence that functions as a starting point for template strand copying. it means.
  • a primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and different four nucleotide triphosphates in an appropriate buffer and temperature.
  • the primer may be a sense and antisense nucleic acid having a sequence of 7 to 50 nucleotides as the gene-specific primer, and does not change the basic properties of the primer that serves as the starting point of DNA synthesis
  • additional features may be incorporated.
  • probe refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases to several hundreds of bases in length that can specifically bind to mRNA, and is labeled, so that the presence or absence of a specific mRNA, expression quantity can be checked.
  • the probe may be formed in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, an RNA probe, or the like. Appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.
  • antibody is a term known in the art and refers to a specific immunoglobulin directed against an antigenic site.
  • the antibody in the present invention refers to an antibody that specifically binds to Smpd1, and the antibody can be prepared according to a conventional method in the art.
  • peptide has the advantage of high binding force to a target substance, and does not undergo denaturation even during heat/chemical treatment.
  • it can be attached to other proteins and used as a fusion protein. Specifically, since it can be used by attaching it to a polymer protein chain, it can be used as a diagnostic kit and a drug delivery material.
  • aptamer is a special kind of single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure and can bind to a target molecule with high affinity and specificity. It means a kind of polynucleotide composed of. As described above, aptamers can specifically bind to antigenic substances in the same way as antibodies, but are more stable than proteins, have a simple structure, and are composed of polynucleotides that are easy to synthesize, so they can be used instead of antibodies. can
  • the present invention comprises the steps of confirming the expression or activity level of the Smpd1 gene or the protein encoded by the gene in a biological sample isolated from the subject;
  • a method for providing information for diagnosing osteoarthritis comprising diagnosing osteoarthritis when the expression or activity level of the gene or the protein encoded by the gene is higher than that of the normal control group.
  • the biological sample may be selected from the group consisting of cells, tissues, cartilage, joint fluid, blood, urine and saliva, but is not limited thereto.
  • the present invention comprises the steps of treating a candidate substance to a biological sample isolated from an arthritis patient;
  • a method for screening an osteoarthritis therapeutic agent includes selecting a candidate substance having a reduced expression or activity level of the gene or a protein encoded by the gene than that of a normal control group.
  • the biological sample may be selected from the group consisting of cells, tissues, cartilage, joint fluid, blood, urine and saliva, but is not limited thereto.
  • the candidate substance is a substance used in screening to examine whether it affects the expression or activity of the Smpd1 or the Smpd1 mRNA, and may be an Smpd1 inhibitor according to the present invention.
  • the protein expression or activity level is measured by Western blot, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Okteroni immunodiffusion method, rocket It can be measured by one or more methods selected from the group consisting of immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, flow cytometry (FACS), and protein chip, but is limited thereto. it is not going to be
  • the expression level of the gene was determined by RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), and Northern blotting. blotting) and DNA microarray chip, but is not limited thereto.
  • the present invention can provide a pharmaceutical composition for preventing or treating osteoarthritis containing an Smpd1 expression or activity inhibitor as an active ingredient.
  • the Smpd1 expression or activity inhibitor may be selected from the group consisting of an antisense nucleotide complementary to Smpd1 mRNA, small interfering RNA (siRNA), and short hairpin RNA (shRNA).
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • the Smpd1 expression or activity inhibitor may be selected from the group consisting of antibodies, peptides, aptamers, compounds, and natural products that specifically bind to Smpd1.
  • the Smpd1 expression or activity inhibitor may be selected from the group consisting of tricyclic antidepressant (TCA), amitriptyline, duloxetine, and fluoxetine.
  • the pharmaceutical composition for preventing or treating osteoarthritis containing the Smpd1 inhibitor as an active ingredient is prepared according to a conventional method in the form of injections, granules, powders, tablets, pills, capsules, suppositories, gels, suspensions, Any one formulation selected from the group consisting of emulsions, drops, and liquids may be used.
  • a pharmaceutical composition for preventing or treating osteoarthritis containing a Smpd1 inhibitor as an active ingredient is suitable carriers, excipients, disintegrants, sweeteners, coating agents, expanding agents, and lubricants commonly used in the manufacture of pharmaceutical compositions.
  • Flavors, antioxidants, buffers, bacteriostats, diluents, dispersants, surfactants may further include one or more additives selected from the group consisting of binders and lubricants.
  • carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil may be used, and solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules.
  • solid preparations may be prepared by mixing at least one or more excipients, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the composition.
  • excipients for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, solutions for oral use, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included in addition to commonly used simple diluents such as water and liquid paraffin.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • As a base material of the suppository witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.
  • the pharmaceutical composition is administered in a conventional manner through intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or intradermal routes.
  • the preferred dosage of the Smpd1 inhibitor may vary depending on the condition and weight of the subject, the type and severity of the disease, the type of drug, the route and duration of administration, and may be appropriately selected by a person skilled in the art. According to one embodiment of the present invention, but not limited thereto, the daily dosage may be 0.01 to 200 mg/kg, specifically 0.1 to 200 mg/kg, and more specifically 0.1 to 100 mg/kg. Administration may be administered once a day or divided into several administrations, and the scope of the present invention is not limited thereby.
  • the 'subject' may be a mammal including a human, but is not limited to these examples.
  • Rabbit polyclonal anti-smpd1, anti-MMP13, anti-Runx1, anti-Runx2, anti-actin and anti-Lamin B antibodies were purchased from Abcam (Abcam, MA, USA), and C8 ceramide was from Avanti (Alabama, USA).
  • ox-LDL and dil-ox-LDL were purchased from Invitrogen, and recombinant mouse Smpd1 was purchased from cloud clone (WUHAN, PRC).
  • the protein analysis experiment through human-derived articular cartilage is a study in which a part of the cartilage tissue obtained during surgery from an osteoarthritis patient is used for laboratory research with the consent of the patient, and all experiments were conducted under the approval of the deliberation result of the committee (2022-01-010 -001).
  • Isolation of subcultured cells of articular chondrocytes was extracted from the hind limb joints of mice aged 5-6 days after birth. units/ml) and streptomycin (100 units/ml), and cultured in a constant temperature and humidity incubator at 37°C and 5% (v/v) CO 2 .
  • chondrocytes were treated with IL-1 ⁇ or TNF- ⁇ for 24 hours and then observed using fluorescence immunological staining.
  • mice The hind limbs of the mice were separated, fixed in 4% PFA (paraformalehyde) overnight at 4° C., and after decalcification with 10% EDTA at 4° C. for 3 weeks, paraffin samples were prepared. After rehydration, paraffin sections cut from the center of the articular cartilage were immersed in Weigert's iron hematoxin solution to stain cell nuclei, and after staining the cartilage using safranin O solution, they were mounted and analyzed under a microscope.
  • PFA paraformalehyde
  • articular cartilage paraffin sections were blocked with 1% BSA for 1 hour and reacted with Smpd1 antibody for 1 hour at room temperature. After reacting with the secondary antibody to which the fluorescence is attached for 1 hour, cell nuclei were stained with DAPI, mounted, and analyzed under a microscope.
  • ox-LDL attached with fluorescent dil was treated for 4 hours, and internalization into cells was examined using a fluorescence microscope. observed.
  • RNA was extracted 24 hours after treatment of chondrocytes with Smpd1, C8 ceramide, and fluoxetine. .
  • Total RNA was extracted using an RNA extraction kit (Easy-blue), and 2 ⁇ g of total RNA was synthesized into cDNA using reverse transcriptase.
  • Real-time PCR was performed by mixing 2 ⁇ SYBR green PCR master mixture (5 ⁇ l) and specific primer (0.2 ⁇ l) with 0.5 ⁇ l of the synthesized cDNA. Primers used for real-time PCR are shown in Table 1, and the primers were designed using Primer Express software (ABI).
  • the protein was extracted from the patient's articular cartilage by dividing the damaged section and the non-damaged section.
  • Smpd1 Sphingomyelin phosphodiesterase 1, ASM
  • chondrocytes were treated with ceramide.
  • articular cartilage cells were treated with recombinant mouse Smpd1 (hereinafter referred to as rmSmpd1), and expression of articular cartilage and osteoarthritis marker genes was observed.
  • rmSmpd1 recombinant mouse Smpd1
  • the Smpd1 CH25H-CYP7B1-ROR ⁇ axis promotes the expression of degradation factors such as MMP13 in articular cartilage cells, which is closely related to the homeostasis destruction of articular cartilage.
  • the expression of Smpd1 decreased by fluoxetine, the expression of Type II collagen (Col2) and Aggrecan (AGC), which are important for maintaining homeostasis, increased, and the expression of MMP13, which induces cartilage degeneration, was confirmed to decrease.
  • ox-LDL was located outside the cells, but in the articular cartilage cells in which the inflammatory environment was induced by treating IL-1 ⁇ or TNF ⁇ , the internalization of ox-LDL into cells increased. was able to confirm
  • rmSmpd1 protein was treated with articular chondrocytes, and then internalization of ox-LDL was observed by fluorescence immunological staining.
  • Smpd1 promotes the internalization of ox-LDL in articular chondrocytes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Epidemiology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 Smpd1을 유효성분으로 함유하는 골관절염 진단용 바이오마커 조성물 및 이의 용도에 관한 것으로, 보다 상세하게는 동물모델의 손상된 관절연골 및 노화된 관절연골에서 Smpd1의 발현 수준 증가가 확인되었으며, 동물모델의 손상된 관절연골과 노화된 관절연골에서 Smpd1의 발현증가를 확인하였으며, Smpd1이 콜레스테롤 대사에 관여하는 ox-LDL (Oxidized low-density lipoprotein)의 세포내로의 유입이 증가하고, 관절연골의 항상성을 유지에 중요한 역할을 하는 Type II collagen을 감소 및 관절연골 세포외기질을 분해하는 MMP13의 발현을 증가시키는 것을 확인하였으며, Smpd1의 억제로 Type II collagen이 증가하고 MMP13이 감소함을 확인하였다. 또한 Smpd1에 의해 생성되는 세라마이드도, CH25H, CYP7B1 및 RORα 유전자 발현을 증가, 관절연골의 항상성을 유지에 중요한 역할을 하는 Type II collagen 발현 감소를 확인하여, Smpd1이 관절연골의 변성과 골관절염을 유도함을 확인하였다. 나아가, 염증인자 IL-1β 및 TNFα에 의한 Smpd1 발현과 골관절염 환자의 Smpd1 단백질 발현이 증가함을 확인함에 따라, 상기 Smpd1을 골관절염 진단을 위한 바이오마커로 제공될 수 있으며, 상기 Smpd1 발현 또는 활성 억제제는 골관절염 치료제로 제공될 수 있다.

Description

Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물
본 발명은 Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물에 관한 것이다.
골관절염 (osteoarthritis, OA)은 주로 관절연골세포의 변성으로 정상적인 관절연골외세포기질 형성 (cartilage ECM synthesis) 저해 및 관절연골세포의 사멸로 인한 연골조직 파괴 (cartilage destruction) 촉진으로 오는 퇴행성관절 질환으로 알려져 왔다. 최근 들어 골관절염은 퇴행성관절염이 단순히 노화와 기계적 부하에 따른 부수적인 질병이 아니라 동맥경화처럼 콜레스테롤 대사에 의해 유발되는 만성대사성질환으로, 퇴행 연골세포에서 증가한 콜레스테롤은 CH25H-CYP7B1-RORα축의 활성화로 연골기질 분해효소가 증가하여 연골조직을 파괴한다. 관절 불안정성과 손상을 포함한 기계적 스트레스 및 골관절염에 걸리기 쉽게 하는 노화 관련 인자들과 대사성 유발 인자들이 잠재적인 골관절염을 일으키는 기작들이다. 이러한 인자들은 다양한 이화 및 동화 인자들을 생산하는 독특한 세포 타입인 연골세포 내 생화학적 경로들의 활성화로 인해 Mmp (Matrix metalloproteinase)에 의한 ECM (extracellular matrix)의 분해, 그리고 연골세포의 탈분화 (dedifferentiation) 및 아팝토시스 (apoptosis)를 통한 ECM 합성의 중단을 초래한다. 특히, 관절을 이루고 있는 연골조직은 한번 손상되게 되면 정상적으로 생체 내에서 재생이 되지 않는다. 이러한 관절의 연골조직이 손상되면 심한 통증과 함께 일상 활동에 제한받게 되며, 만성화되면 치명적인 골관절염을 유발하게 되어 정상적인 생활이나 직업적인 활동을 방해하게 된다.
반면, 류마티스 관절염 (rheumatoid arthritis, RA)의 경우, 연골세포 및 연골조직 파괴로 인해 유발되는 퇴행성 관절염과는 달리, 자가면역반응에 의한 질환의 진행이 중요한 원인 인자로 알려져 있다. 류마티스 관절염은 활막 세포의 염증과 증식을 특징으로 하는, 만성 자가면역 질환 (autoimmune diseases)으로서, 퇴행성관절염과 달리 관절 주위 뼈의 골다공증 및 골미란 등이 발생한다. 류마티스 관절염은 활막 (synovial membrane)의 염증이 관절막 (joint capsule)과 인대 (ligament), 건 (tendon)으로 퍼지고, 뼈로 침범하여 진행되게 된다. 따라서, 퇴행성관절염과 류마티스 관절염은 그 발병 원인 및 진행단계가 전혀 상이하며, 이의 치료 방법도 상이하다.
지금까지 알려진 류마티스 관절염 치료제로는 염증 기전을 차단하기 위해 적당한 비스테로이드성 항염증 약물(NSAIDs), 페니실아민, 스테로이드성 호르몬, TNF 억제제, 인터류킨 억제제, JAK 억제제, 항-CD 관련 억제제 등이 이에 해당한다. 관절 통증 및 염증 완화 목적으로 NSAID 약물 및 스테로이드성 호르몬이 퇴행성관절염 환자에 사용되고 있지만, 이는 질병 자체를 치료하기보다는 증상만을 완화하므로 실질적인 퇴행성관절염 치료제의 역할은 될 수 없다. 그뿐만 아니라, 연골세포 및 연골조직 파괴로 주로 발생하는 퇴행성관절염은 그 발병 원인과 현상이 염증성 관절염인, 류마티스 관절염과는 엄연히 달라서, 골관절염 치료 방법 역시 류마티스 관절염 치료 방법과는 다를 수밖에 없다.
따라서, 골관절염의 진행을 막거나 늦추기 위해서는 골관절염을 조기에 진단할 필요가 있으나, 현재까지는 골관절염을 진단하는 방법으로 정형외과나 류마티스 내과를 방문하여 X-ray와 같은 이미지 분석 방법만이 알려진 실정이다.
본 발명은 Smpd1의 발현 또는 활성 수준 변화를 확인하여 골관절염을 진단하기 위한 바이오마커 조성물 및 상기 바이오마커를 발현 수준을 측정할 수 있는 진단키트를 제공하며, 상기 바이오마커를 이용한 골관절염 진단방법, 골관절염 치료제 스크리닝 방법을 제공하고자 한다.
또한, Smpd1 발현 또는 활성 억제제를 유효성분으로 함유하는 퇴행성 관절염 예방 또는 치료용 약학조성물을 제공하고자 한다.
본 발명은 Smpd1 (Sphingomyelin phosphodiesterase 1) 유전자 또는 상기 유전자에 의해 인코딩되는 단백질을 유효성분으로 함유하는 골관절염 진단용 바이오마커 조성물을 제공한다.
본 발명은 Smpd1 (Sphingomyelin phosphodiesterase 1) 유전자 또는 상기 유전자에 의해 인코딩되는 단백질의 발현 또는 활성 수준을 측정하는 제제를 유효성분으로 함유하는 골관절염 진단용 키트를 제공한다.
본 발명은 개체로부터 분리된 생물학적 시료에서 Smpd1 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 확인하는 단계; 상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 정상대조군과 비교하는 단계; 및 상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준이 정상대조군보다 증가한 경우, 골관절염으로 진단하는 단계를 포함하는 골관절염 진단을 위한 정보를 제공하는 방법을 제공한다.
본 발명은 관절염 환자로부터 분리된 생물학적 시료에 후보물질을 처리하는 단계; 상기 후보물질이 처리된 시료에서 Smpd1 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 확인하는 단계; 상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 정상대조군과 비교하는 단계; 및 상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준이 정상대조군보다 감소한 후보물질을 선택하는 단계를 포함하는 골관절염 치료제 스크리닝 방법을 제공한다.
또한, 본 발명은 Smpd1 발현 또는 활성 억제제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학조성물을 제공한다.
본 발명에 따르면, 동물모델의 손상된 관절연골과 노화된 관절연골에서 Smpd1의 발현증가를 확인하였고, 골관절염 환자의 관절연골에서도 Smpd1의 발현증가를 확인하였다. Smpd1 단백질 처리에서 콜레스테롤 대사에 관여하는 ox-LDL (Oxidized low-density lipoprotein)의 세포내로의 유입이 증가하고, 관절연골의 항상성을 유지에 중요한 역할을 하는 Type II collagen을 감소 및 관절연골 세포외기질을 분해하는 MMP13의 발현을 증가시키는 것을 확인하였으며, Smpd1의 억제로 Type II collagen이 증가하고 MMP13이 감소함을 확인하였다. 또한 Smpd1에 의해 생성되는 세라마이드도, CH25H, CYP7B1 및 RORα 유전자 발현을 증가, 관절연골의 항상성을 유지에 중요한 역할을 하는 Type II collagen를 확인하여, Smpd1이 관절연골의 변성과 골관절염을 유도함을 확인하였다. 나아가, 염증인자 IL-1β 및 TNFα에 의한 Smpd1 발현과 골관절염 환자의 Smpd1 단백질 발현이 증가함을 확인함에 따라, 상기 Smpd1을 골관절염 진단을 위한 바이오마커로 제공될 수 있으며, 상기 Smpd1 발현 또는 활성 억제제는 골관절염 치료제로 제공될 수 있다.
도 1은 골관절염 모델의 손상된 관절연골에서 Smpd1의 발현 수준 변화를 확인한 형광면역학 염색과 사프라닌 O 염색 및 OARSI (OsteoArthritis Research Society International) 스코어 분석 결과이다.
도 2는 노화된 관절연골에서 Smpd1의 발현 수준 변화를 확인한 형광면역학 염색 결과이다.
도 3은 골관절염 환자의 손상된 관절연골에서의 Smpd1 단백질 발현이 증가함을 확인한 결과이다.
도 4는 Smpd1/세라마이드(세라마이드)와 CH25H-CYP7B1-RORα 신호전달 활성 간의 연관성을 확인한 실시간 PCR 분석 결과이다.
도 5는 Smpd1에 의한 관절연골 표지자의 발현 변화를 실시간 PCR로 확인한 결과이다.
도 6는 Smpd1의 발현 억제를 통해 연골세포의 항상성 유지 및 변성 억제를 확인한 결과이다.
도 7는 관절연골 세포의 염증성 반응유도 전, 후의 Smpd1 발현 변화를 형광면역학 염색으로 확인한 결과이다.
도 8은 관절연골 세포에서의 염증성 인자 IL-1β 및 TNFα에 의한 ox-LDL의 내재화(internalization) 증가를 확인한 결과이다.
도 9는 Smpd1 투여에 의한 ox-LDL의 내재화 증가를 확인한 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명의 발명자들은 동물모델의 손상된 관절연골 및 노화된 관절연골에서 Smpd1의 발현 수준 증가를 확인하였으며, 골관절염 환자의 관절연골에서도 Smpd1의 발현이 증가하는 것을 확인하였다. Smpd1 단백질 처리에서 콜레스테롤 대사에 관여하는 ox-LDL (Oxidized low-density lipoprotein)의 세포내로의 유입이 증가하고, 관절연골의 항상성 유지에 중요한 역할을 하는 Type II collagen을 감소 및 관절연골 세포외기질을 분해하는 MMP13의 발현을 증가시키는 것을 확인하였으며, Smpd1의 억제로 Type II collagen이 증가하고 MMP13이 감소함을 확인하였다. 또한 Smpd1에 의해 생성되는 세라마이드도 Smpd1과 더불어 CH25H, CYP7B1, RORα 유전자 발현을 증가시켰고, 관절연골의 항상성 유지에 중요한 역할을 하는 Type II collagen 발현이 감소함을 확인하여, Smpd1이 관절연골의 변성과 골관절염을 유도함을 확인하였다. 나아가 염증인자 IL-1β 및 TNFα에 의한 Smpd1 발현과 골관절염 환자의 Smpd1 단백질 발현이 증가함을 확인하여, 골관절염 진단을 위한 바이오마커 및 골관절염 치료제를 제공하기 위해 본 발명을 완성하였다.
본 발명은 Smpd1 (Sphingomyelin phosphodiesterase 1) 유전자 또는 상기 유전자에 의해 인코딩되는 단백질을 유효성분으로 함유하는 골관절염 진단용 바이오마커 조성물을 제공할 수 있다.
상기 Smpd1 유전자 또는 상기 유전자에 의해 인코딩되는 단백질은 정상대조군과 비교하여 손상된 관절에서 발현이 증가하는 것일 수 있다.
상기 Smpd1 유전자 또는 상기 유전자에 의해 인코딩되는 단백질은 CH25H-CYP7B1-RORα 신호전달 과정을 활성화시켜 골관절염을 유도하는 것일 수 있다.
상기 CH25H-CYP7B1-RORα 신호전달 과정은 퇴행 연골세포에 증가한 콜레스테롤에 의해 활성화되어 연골기질 분해 효소를 증가시킴으로써 연골조직을 파괴해 골관절염을 발병시키는 것일 수 있다.
상기 Smpd1 (Sphingomyelin phosphodiesterase 1)는 NCBI assession number. NM_000543.5 일 수 있다.
본 명세서에서 "바이오마커"란, 몸 안의 변화를 알아낼 수 있는 지표로서, 생명체의 정상 또는 병리적인 상태, 즉, 골관절염에 대한 진단, 약물에 대한 반응 정도 등을 측정할 수 있다.
본 명세서에서 "진단"이란, 골관절염의 발병 여부 또는 발병 가능성(위험성)을 확인하는 것으로, 골관절염 또는 골관절염의 적어도 하나 이상의 증상에 대한 대상(subject)의 감수성(susceptibility)을 판정하는 것, 대상이 골관절염을 현재 가졌는지 아닌지를 판정하는 것, 골관절염에 걸린 대상의 예후(prognosis)를 판정하는 것, 또는 테라메트릭스(therametrics)(예를 들어, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)을 포함한다. 또한, 임상 상태의 일차 진단 또는 재발한 질병의 진단을 포함한다.
본 발명은 Smpd1 (Sphingomyelin phosphodiesterase 1) 유전자 또는 상기 유전자에 의해 인코딩되는 단백질의 발현 또는 활성 수준을 측정하는 제제를 유효성분으로 함유하는 골관절염 진단용 키트를 제공할 수 있다.
상기 제제는 Smpd1 유전자에 특이적으로 결합하는 프라이머 또는 프로브, 상기 유전자에 의해 인코딩되는 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물일 수 있다.
본 발명에서 "프라이머"는 짧은 자유 3말단 수산화기(free 3'hydroxl group)를 가지는 핵산 서열로, 상보적인 주형과 염기쌍을 형성할 수 있고 주형 가닥 복사를 위한 시작 시점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. 본 발명에 따른 조성물에서, 상기 프라이머는, 상기 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산일 수 있고, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 한, 추가의 특징을 혼입할 수 있다.
본 발명에서 "프로브"는 mRNA와 특이적으로 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며, 라벨링 되어 있어서 특정 mRNA의 존재 유무, 발현 양을 확인할 수 있다. 프로브는 올리고뉴클레오타이드(oligonucleotide) 프로브, 단쇄 DNA(single strand DNA) 프로브, 이중쇄 DNA(double strand DNA) 프로브, RNA 프로브 등의 형태로 형성될 수 있다. 적절한 프로브 및 혼성화 조건은 당해 기술 분야에 공지된 기술에 따라 적절히 선택될 수 있다.
본 발명에서 "항체"는 당해 기술분야에 공지된 용어로서 항원성 부위에 대하여 지시되는 특이적인 면역글로불린을 의미한다. 본 발명에서의 항체는 Smpd1에 대해 특이적으로 결합하는 항체를 의미하며, 당해 기술분야의 통상적인 방법에 따라 항체를 제조할 수 있다.
본 발명에서 "펩타이드"는 표적 물질에 대한 결합력이 높은 장점이 있고, 열/화학 처리 시에도 변성이 일어나지 않는다. 또한 분자 크기가 작기 때문에 다른 단백질에 붙여서 융합 단백질로의 이용이 가능하다. 구체적으로 고분자 단백질 체인에 붙여서 이용이 가능하므로 진단 키트 및 약물전달 물질로 이용될 수 있다.
본 발명에서 "앱타머(aptamer)"는 그 자체로 안정된 삼차 구조를 가지면서 표적 분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 특별한 종류의 단일가닥 핵산(DNA, RNA, 또는 변형핵산)으로 구성된 폴리뉴클레오티드의 일종을 의미한다. 상술한 바와 같이, 앱타머는 항체와 동일하게 항원성 물질에 특이적으로 결합할 수 있으면서도, 단백질보다 안정성이 높고, 구조가 간단하며, 합성이 용이한 폴리뉴클레오티드로 구성되어 있으므로, 항체를 대체하여 사용될 수 있다.
본 발명은 개체로부터 분리된 생물학적 시료에서 Smpd1 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 확인하는 단계;
상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 정상대조군과 비교하는 단계; 및
상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준이 정상대조군보다 증가한 경우, 골관절염으로 진단하는 단계를 포함하는 골관절염 진단을 위한 정보를 제공하는 방법을 제공할 수 있다.
상기 생물학적 시료는 세포, 조직, 연골, 관절액, 혈액, 뇨 및 타액으로 이루어진 군에서 선택되는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명은 관절염 환자로부터 분리된 생물학적 시료에 후보물질을 처리하는 단계;
상기 후보물질이 처리된 시료에서 Smpd1 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 확인하는 단계;
상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 정상대조군과 비교하는 단계; 및
상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준이 정상대조군보다 감소한 후보물질을 선택하는 단계를 포함하는 골관절염 치료제 스크리닝 방법을 제공할 수 있다.
상기 생물학적 시료는 세포, 조직, 연골, 관절액, 혈액, 뇨 및 타액으로 이루어진 군에서 선택되는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 후보물질은 상기 Smpd1 또는 상기 Smpd1 mRNA의 발현 또는 활성에 영향을 미치는지를 검사하기 위하여 스크리닝에서 이용되는 물질로, 본 발명에 따른 Smpd1 억제제일 수 있다.
상기 단백질 발현 또는 활성 수준은 웨스턴 블랏, 효소면역분석법(Enzyme-linked immunosorbent assay; ELISA), 방사선면역분석(Radioimmunoassay; RIA), 방사면역확산법(Radioimmunodiffusion), 오우크테로니 면역 확산법, 로케트(rocket) 면역 전기영동, 조직면역염색, 면역침전 분석법(Immunoprecipitation assay), 보체고정분석법(Complement Fixation Assay), 유세포 분석법(FACS) 및 단백질 칩으로 이루어진 군에서 선택된 어느 하나 이상의 방법으로 측정할 수 있으나, 이에 한정되는 것은 아니다.
상기 유전자의 발현 수준은 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA: RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 마이크로 어레이칩으로 이루어진 군에서 선택된 어느 하나 이상의 방법으로 측정할 수 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 Smpd1 발현 또는 활성 억제제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학조성물을 제공할 수 있다.
상기 Smpd1 발현 또는 활성 억제제는 Smpd1 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(small interfering RNA; siRNA), 및 짧은 헤어핀 RNA(short hairpin RNA; shRNA)로 이루어진 군에서 선택된 것일 수 있다.
상기 Smpd1 발현 또는 활성 억제제는 Smpd1에 특이적으로 결합하는 항체, 펩타이드, 앱타머, 화합물 및 천연물로 이루어진 군에서 선택된 것일 수 있다.
상기 Smpd1 발현 또는 활성 억제제는 TCA (Tricyclic antidepressant), 아미트리프틸린 (Amitriptyline), 둘록세틴 (Duloxetine) 및 플루옥세틴(Fluoxetin)으로 이루어진 군에서 선택되는 것일 수 있다.
본 발명의 한 구체예에서, 상기 Smpd1 억제제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학조성물은 통상적인 방법에 따라 주사제, 과립제, 산제, 정제, 환제, 캡슐제, 좌제, 겔, 현탁제, 유제, 점적제 또는 액제로 이루어진 군에서 선택된 어느 하나의 제형을 사용할 수 있다.
본 발명의 다른 구체예에서, Smpd1 억제제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학조성물은 약학조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕해제, 감미제, 피복제, 팽창제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 일실시예에 따르면 상기 약학 조성물은 정맥내, 동맥내, 복강내, 근육내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 대상체로 투여할 수 있다.
상기 Smpd1 억제제의 바람직한 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 일실시예에 따르면 이에 제한되는 것은 아니지만 1일 투여량이 0.01 내지 200 mg/kg, 구체적으로는 0.1 내지 200 mg/kg, 보다 구체적으로는 0.1 내지 100 mg/kg 일 수 있다. 투여는 하루에 한 번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
본 발명에 있어서, 상기 '대상체'는 인간을 포함하는 포유동물일 수 있으나, 이들 예에 한정되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
<실험예>
하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.
1. 시약
Rabbit polyclonal anti-smpd1, anti-MMP13, anti-Runx1, anti-Runx2, anti-actin 및 anti-Lamin B 항체는 Abcam (Abcam, MA, USA)에서 구입하였으며, C8 세라마이드는 Avanti (Alabama , USA)에서 구입하였고, ox-LDL과 dil-ox-LDL은 Invitrogen에서, recombinant mouse Smpd1 은 cloud clone (WUHAN, PRC)에서 구입하여 사용하였다.
2. 실험동물관리
수컷 12 주령 마우스를 이용하여 내측반월판 불안정화 (Destabilization of the Medial Meniscus ; DMM) 골관절염 유도 수술을 진행하여 8 주 뒤에 관절연골의 변성을 관찰하였으며, 4 개월 마우스와 12 개월 수컷 마우스를 사용하여 Smpd1의 발현을 관찰하였다. SPF (Specific Pathogen Free) 실험동물 사육실 (온도 25℃, 상대습도 60%)에서 1 주일간 적응시킨 후 사용하였으며, 사료는 일반식 (Super bead Co, Korea)을 섭취시켰으며, 모든 동물실험은 경북대학교 동물실험윤리위원회 가이드라인을 따라 수행하였다. (동물실험승인번호: KNU 2011-67).
3.임상실험
인체유래 관절연골을 통한 단백질 분석실험은 골관절염 환자에서 수술 중 얻게 되는 연골조직 일부를 환자의 동의하에 실험실 연구에 사용하는 연구로 위원회에서의 심의 결과 승인하에 모든 실험을 진행하였다 (2022-01-010-001).
4. 세포배양 및 세포 실험
관절연골세포의 계대배양세포의 분리는 생후 5-6일 마우스의 뒷다리 관절에서 추출되었으며, 관절세포는 DMEM에 (Lonza, Rockland, ME, USA), 10% (v/v) FBS, 페니실린 (100 units/㎖)과 스트렙토마이신 (100 units/㎖)을 넣고, 37℃, 5% (v/v) CO2 항온항습배양기에서 배양하였다. 시험관 내 골관절염모델의 재현을 위하여 IL-1β또는 TNF-α를 24시간 동안 연골세포에 처리 후 형광면역학 염색을 이용하여 관찰하였다.
5. 사프라닌 O 염색
마우스의 뒷다리를 분리하여 4% PFA (paraformalehyde)에 4℃에서 오버나잇으로 고정하고 10% EDTA로 4℃에서 3주간 탈회 후 파라핀 샘플을 제작하였다. 관절연골을 중심으로 자른 파라핀 절편을 재수화 후 Weigert's 철헤마톡신린 용액에 담그어 세포핵을 염색하고, 사프라닌 O 용액을 이용하여 연골을 염색한 후 마운팅하고 현미경으로 분석하였다.
6. 형광면역학 염색
관절연골 파라핀절편을 재수화 후 1% BSA를 이용하여 1시간 블로킹 시키고 Smpd1 항체와 1시간 상온에서 반응시킨다. 그리고 형광이 부착된 2차 항체와 1시간 반응 후 DAPI로 세포핵을 염색시키고 마운팅하고 현미경으로 분석하였다. ox-LDL의 세포내로의 내재화(internalization) 실험은 IL-1β, TNF-α 또는 Smpd1을 24시간 처리 후 형광 딜(dil)이 부착된 ox-LDL를 4시간 처리하여 세포 내로의 내재화를 형광현미경을 관찰하였다.
7. 웨스턴 블롯
인체유래 관절연골을 통한 단백질 분석 실험은 골관절염 환자에서 수술 중 얻게 되는 연골조직 일부를 환자의 동의하에 사용되어 RIPA 완충재에 용해하여 단백질 농도를 측정하고 전기영동을 시행하고 웨스턴 블롯을 진행하였다. 단백질을 PVDF 막에 이동시켜 5% 스킴 밀크로 블록킹 한 후 Rabbit polyclonal anti-smpd1, anti-MMP13, anti-Runx1, anti-Runx2, anti-actin 또는 anti-Lamin B를 각기 반응 후 HRP가 달린 2차 항체와 반응하였다. 최종 ECL 용액을 이용하여 암실에서 디벨롭핑 후 단백질의 발현 정도를 분석하였다.
8. 실시간 PCR (Real-time PCR)
Smpd1과 C8 세라마이드 및 플루옥세틴(fluoxetine)에 의한 관절연골항상성유지와 골관절염유도 표지자의 유전자 발현변화를 확인하기 위해 Smpd1과 C8 세라마이드 및 플루옥세틴(fluoxetine)를 연골세포에 처리 후 24시간 뒤에 총 RNA를 추출하였다. RNA 추출 Kit (Easy-blue)를 이용하여 총 RNA를 추출하고, 2 ㎍의 총 RNA을 역전사효소를 이용하여 cDNA로 합성하였다. 합성된 cDNA 0.5 ㎕에 2× SYBR green PCR master mixture (5 ㎕)와 specific primer (0.2 ㎕)를 섞어서 real-time PCR을 수행하였다. Real-time PCR에 사용한 프라이머는 표 1과 같으며, 프라이머는 Primer Express software (ABI)를 이용하여 디자인하였다.
Oligo name Sequence 5'-3'
QRT-Smpd1-F-Mouse AAC TCT GAG CCG ACC ACT AGC T
QRT-Smpd1-R-Mouse GTC CAG GAC CAC ATG AGA GCT T
QRT-CH25H-F-Mouse GTG CTG GAC GTC CTG TAT CC
QRT-CH25H-R-Mouse AGC ACG TCG AAG AAG GTC AG
QRT-CYP7B1-F-MOUSE GTG CGA AAG GGA GAC TTG GT
QRT-CYP7B1-R-MOUSE AGC GGC TGT AGT TTA GTC CT
QRT-RORA-F-MOUSE AAATGAAACAATAACAACGAAGAC
QRT-RORA-R-MOUSE TGG ACT CTG CTG TTA CCC G
QRT-Type II collagen-F-MOUSE TTCCACTTCAGCTATGGCGA
QRT-Type II collagen-R-MOUSE GACGTTAGCGGTGTTGGGAG
QRT-Aggrecan-F-MOUSE GAGAGAGGCGAATCGAACGA
QRT-Aggrecan-R-MOUSE CGTGAAGGGCAGCTGGTAAT
QRT-RORA-F-MOUSE GCCAGAACTTCCCAACCATG
QRT-RORA-R-MOUSE TCAGAGCCCAGAATTTTCTCC
<실시예 1> 관절염 동물모델의 손상된 관절연골에서 Smpd1 발현 확인
수컷 12주령 마우스를 이용하여 내측반월판 불안정화 (Destabilization of the Medial Meniscus ; DMM) 골관절염 유도 수술을 진행하고, 8주 뒤에 사프라닌 O 염색과 OARSI (OsteoArthritis Research Society International)을 이용하여 관절연골의 변성 정도와 골관절염의 발생 정도를 평가하고 형광면역학염색으로 smpd1의 발현 수준을 확인하였다.
그 결과, 도 1과 같이 골관절염모델에서 형광면역염색을 통하여 Smpd1이 증가를 확인하였다.
상기 결과로부터 Smpd1의 증가는 관절연골의 파괴 및 골관절염의 발생과 밀접한 연관성이 있음이 확인되었다.
<실시예 2> 노화된 관절연골에서 Smpd1 발현 확인
노화된 연골과 Smpd1의 연관성을 확인하기 위해, 4개월인 마우스와 12개월인 마우스의 관절연골을 이용하여 Smpd1의 발현 수준을 확인하였다.
그 결과, 도 2와 같이 노화된 관절연골에서 Smpd1의 발현이 증가되는 것을 확인되었다.
상기 결과로부터 Smpd1이 노화로 인한 관절연골의 변성 및 골관절염 발생과 밀접한 연관성이 있음이 확인되었다.
<실시예 3> 골관절염환자 관절연골에서 Smpd1 발현 확인
골관절염 환자의 관절연골에서 Smpd1 증가 여부를 확인하기 위해, 환자의 관절연골을 손상구간과 비 손상구간을 구분하여 단백질을 추출하였다.
그 결과, 도 3와 같이 골관염 손상구간에서 Smpd1이 증가하였으며, 골관절염 표지자인 MMP13과 RUNX2가 증가함과 동시에 정상적인 관절연골 보호인자인 RUNX1이 감소함을 확인하였다.
<실시예 4> Smpd1/세라마이드 (세라마이드)와 골관절염 간의 연관성 확인
앞선 실험에서 관절염과 노화된 관절에서 발현이 증가된 Smpd1 (Sphingomyelin phosphodiesterase 1, ASM)은 스핑고미엘린을 가수분해하여 세라마이드 (세라마이드)를 생성하는 중요한 리소좀 효소로 Smpd1/세라마이드가 연골기질 분해 효소를 증가시켜 연골을 파괴하는 CH25H-CYP7B1-RORα에 주는 영향을 확인하기 위해, 연골세포에 세라마이드를 처리하였다.
그 결과, 도 4A 및 도 4B와 같이 세라마이드에 의하여 Smpd1 자체의 발현이 증가하고 CH25H, CYP7B1 및 RORα의 발현이 증가되는 것을 확인하였으며, 관절연골의 항상성유지 유전자인 Type II collagen과 Aggrecan이 감소되는 것을 실시간 PCR로 확인하였다.
상기 결과로부터 관절연골세포에 Smpd1과 세라마이드 간의 양성 되먹임이 조절됨을 알 수 있었으며, CH25H-CYP7B1-RORα축에 의한 연골의 항상성 파괴와 밀접한 연관성이 있음이 확인되었고, 상기 Smpd1 발현 또는 활성 억제제는 골관절염 예방 또는 치료제로 사용될 수 있다.
<실시예 5> Smpd1의 CH25H-CYP7B1-RORα에 주는 영향 확인
Smpd1이 직접적으로 CH25H-CYP27B1-RORα에 주는 영향을 검증하기 위하여 관절연골세포에 recombinant mouse Smpd1(이하, rmSmpd1라 함.)을 처리하여 관절연골과 골관절염 표지유전자 발현을 관찰하였다.
그 결과, 도 5와 같이 관절연골의 항상성 유지 유전자인 Runx1과 Type II collagen의 감소, 지질대사 관련 중요 효소인 CYP27B1의 증가 및 관절연골을 파괴하고 골관절염을 유발하는 세포외기질 분해인자인 MMP13의 증가를 함을 확인할 수 있었다.
이를 통해, 관절연골세포에 Smpd1 CH25H-CYP7B1-RORα축을 통하여 MMP13등 분해인자의 발현을 촉진하여 관절연골의 항상성 파괴와 밀접한 연관성이 있음을 확인할 수 있었다.
<실시예 6> Smpd1의 발현 억제를 통한 연골세포의 항상성 유지 및 변성 억제 확인
시험관 내 Smpd1의 발현 억제를 통한 연골의 변성과 항상성에 주는 영향을 확인하기 위해 연골세포에 Smpd1의 억제제인 플루옥세틴(fluoxetine)을 처리하여 유전자 발현변화를 관찰하였다.
그 결과, 도 6과 같이 플루옥세틴에 의하여 Smpd1의 발현이 감소하고 항상성 유지에 중요한 Type II collagen (Col2)와 Aggrecan (AGC)의 발현이 증가하고 연골의 변성을 유도하는 MMP13의 발현이 감소함을 확인하였다.
이를 통해, Smpd1의 억제는 연골의 항상성을 유지하고 변성을 억제할 수 있음을 알 수 있었다.
<실시예 7> 염증성 인자의 작용하에 Smpd1 발현 및 분비 변화 확인
시험관 내 염증성 인자 유도 골관절염 모델에서 Smpd1의 발현변화를 관찰하기 위하여 IL-1β 및 TNFα와 같은 염증 인자들에 의한 관절연골 세포에서 Smpd1의 발현양상을 형광면역학적 염색하여 관찰하였다.
그 결과, 도 7과 같이, 관절연골세포 자체의 Smpd1 발현은 반점 양상으로 세포막 표면에 위치하여 있음을 확인하였고, Smpd1이 관절연골 세포의 세포막 표면에 위치는 변화 없으나 정상군에 비하여 발현이 증가하는 동시에 세포 밖으로 분비되는 양상을 확인할 수 있었다.
<실시예 8> 관절연골세포에서의 염증성 인자 IL-1β과 TNFα에 의한 ox-LDL의 내재화(internalization) 증가
손상된 관절염골세포에서의 ox-LDL의 내재화를 관찰하기 위하여 IL-1β와 TNF-α을 관절연골세포에 처리하여 염증성 환경을 유도하였다.
그 결과, 도 8과 같이, 대조군에서는 ox-LDL이 세포의 밖에 위치하여 있지만, IL-1β 이나 TNFα를 처리하여 염증성 환경 유도를 진행한 관절연골세포에서는 ox-LDL의 세포내로의 내재화가 증가하였음을 확인할 수 있었다.
이를 통해, 관절연골세포에서의 염증성 유도는 ox-LDL의 세포내로의 내재화를 촉진함을 알 수 있었다.
<실시예 9> Smpd1의 투여에 의한 ox-LDL의 내재화 증가 확인
Smpd1의 투여로 관절연골세포에서의 ox-LDL의 내재화를 관찰하기 위하여 rmSmpd1 단백질을 관절연골세포에 처리한 후 형광면역학염색으로 ox-LDL의 내재화를 관찰하였다.
그 결과, 도 9와 같이, 대조군에서는 ox-LDL이 관절연골세포의 밖에 위치하여 있지만, Smpd1을 처리 한 그룹에서는 농도에 따라 세포내로의 내재화가 증가함을 확인할 수 있었다.
이를 통해, Smpd1가 ox-LDL의 관절연골세포내의 내재화를 촉진함을 알 수 있었다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 갖춘 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (12)

  1. Smpd1 (Sphingomyelin phosphodiesterase 1) 유전자 또는 상기 유전자에 의해 인코딩되는 단백질을 유효성분으로 함유하는 골관절염 진단용 바이오마커 조성물.
  2. 청구항 1에 있어서, 상기 Smpd1 유전자 또는 상기 유전자에 의해 인코딩되는 단백질은 정상대조군과 비교하여 손상된 관절에서 발현이 증가되는 것을 특징으로 하는 골관절염 진단용 바이오마커 조성물.
  3. 청구항 1에 있어서, 상기 Smpd1 유전자 또는 상기 유전자에 의해 인코딩되는 단백질은 CH25H-CYP7B1-RORα 신호전달 과정을 활성화시켜 골관절염을 유도하는 것을 특징으로 하는 골관절염 진단용 바이오마커 조성물.
  4. Smpd1 (Sphingomyelin phosphodiesterase 1) 유전자 또는 상기 유전자에 의해 인코딩되는 단백질의 발현 또는 활성 수준을 측정하는 제제를 유효성분으로 함유하는 골관절염 진단용 키트.
  5. 청구항 4에 있어서, 상기 제제는 Smpd1 유전자에 특이적으로 결합하는 프라이머 또는 프로브, 상기 유전자에 의해 인코딩되는 단백질에 특이적으로 결합하는 항체, 펩타이드, 앱타머 또는 화합물인 것을 특징으로 하는 골관절염 진단용 키트.
  6. 개체로부터 분리된 생물학적 시료에서 Smpd1 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 확인하는 단계;
    상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 정상대조군과 비교하는 단계; 및
    상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준이 정상대조군보다 증가한 경우, 골관절염으로 진단하는 단계를 포함하는 골관절염 진단을 위한 정보를 제공하는 방법.
  7. 청구항 6에 있어서, 상기 생물학적 시료는 세포, 조직, 연골, 혈액, 뇨 및 타액으로 이루어진 군에서 선택되는 것을 특징으로 하는 골관절염 진단을 위한 정보를 제공하는 방법.
  8. 관절염 환자로부터 분리된 생물학적 시료에 후보물질을 처리하는 단계;
    상기 후보물질이 처리된 시료에서 Smpd1 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 확인하는 단계;
    상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준을 정상대조군과 비교하는 단계; 및
    상기 유전자 또는 상기 유전자에 의해 인코딩된 단백질의 발현 또는 활성 수준이 정상대조군보다 감소한 후보물질을 선택하는 단계를 포함하는 골관절염 치료제 스크리닝 방법.
  9. Smpd1 발현 또는 활성 억제제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학조성물.
  10. 청구항 9에 있어서, 상기 Smpd1 발현 또는 활성 억제제는 Smpd1 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(small interfering RNA; siRNA), 및 짧은 헤어핀 RNA(short hairpin RNA; shRNA)로 이루어진 군에서 선택된 것을 특징으로 하는 골관절염 예방 또는 치료용 약학조성물.
  11. 청구항 9에 있어서, 상기 Smpd1 발현 또는 활성 억제제는 Smpd1에 특이적으로 결합하는 항체, 펩타이드, 앱타머, 화합물 및 천연물로 이루어진 군에서 선택된 것을 특징으로 하는 골관절염 예방 또는 치료용 약학조성물.
  12. 청구항 9에 있어서, 상기 Smpd1 발현 또는 활성 억제제는 TCA (Tricyclic antidepressant), 아미트리프틸린 (Amitriptyline), 둘록세틴(Duloxetine) 및 플루옥세틴(Fluoxetin)으로 이루어진 군에서 선택되는 것을 특징으로 하는 골관절염 예방 또는 치료용 약학조성물.
PCT/KR2022/013870 2021-09-16 2022-09-16 Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물 WO2023043257A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2021-0123974 2021-09-16
KR20210123974 2021-09-16
KR10-2022-0114733 2022-09-13
KR1020220114733A KR20230040906A (ko) 2021-09-16 2022-09-13 Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물

Publications (1)

Publication Number Publication Date
WO2023043257A1 true WO2023043257A1 (ko) 2023-03-23

Family

ID=85603283

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/013870 WO2023043257A1 (ko) 2021-09-16 2022-09-16 Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물

Country Status (1)

Country Link
WO (1) WO2023043257A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090042270A (ko) * 2006-08-23 2009-04-29 노파르티스 아게 스핑고미엘린 억제제로서의 아미드
KR101521117B1 (ko) * 2013-05-07 2015-05-18 경북대학교 산학협력단 Ａｓｍ 억제제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
WO2017208001A1 (en) * 2016-06-03 2017-12-07 Babraham Institute Biomarkers for platelet disorders

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090042270A (ko) * 2006-08-23 2009-04-29 노파르티스 아게 스핑고미엘린 억제제로서의 아미드
KR101521117B1 (ko) * 2013-05-07 2015-05-18 경북대학교 산학협력단 Ａｓｍ 억제제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 조성물
WO2017208001A1 (en) * 2016-06-03 2017-12-07 Babraham Institute Biomarkers for platelet disorders

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BECKMANN NADINE: "Identification of novel clinical applications for acid sphingomyelinase inhibitors", PHD THESIS, UNIVERSITÄT DUISBURG - ESSEN, 1 June 2017 (2017-06-01), XP093048153, Retrieved from the Internet <URL:https://duepublico2.uni-due.de/servlets/MCRFileNodeServlet/duepublico_derivate_00044032/DissNBeckmann.pdf> [retrieved on 20230519] *
SCHUCHMAN EDWARD H.: "Acid ceramidase and the treatment of ceramide diseases: The expanding role of enzyme replacement therapy", BIOCHIMICA ET BIOPHYSICA ACTA. MOLECULAR BASIS OF DISEASE., AMSTERDAM, NL, vol. 1862, no. 9, 4 May 2016 (2016-05-04), NL , pages 1459 - 1471, XP029661002, ISSN: 0925-4439, DOI: 10.1016/j.bbadis.2016.05.001 *
TAKAHASHI IKUKO, TSUTOMU TAKAHASHI, TAMAKI ABE, WATARU WATANABE, GORO TAKADA: "Distribution of acid sphingomyelinase in human various body fluids", THE TOHOKU JOURNAL OF EXPERIMENTAL MEDICINE, vol. 192, no. 1, 1 September 2000 (2000-09-01), pages 61 - 66, XP093048150, DOI: 10.1620/tjem.192.61 *
TAN CONGE, WANG JIANGUO, FENG WENZHE, DING WEIJUN, WANG MIQU: "Preliminary Correlation Between Warm Needling Treatment for Knee Osteoarthritis of Deficiency-Cold Syndrome and Metabolic Functional Genes and Pathways", JOURNAL OF ACUPUNCTURE AND MERIDIAN STUDIES, ELSEVIER, AMSTERDAM, NL, vol. 3, no. 3, 1 September 2010 (2010-09-01), AMSTERDAM, NL , pages 173 - 180, XP093048152, ISSN: 2005-2901, DOI: 10.1016/S2005-2901(10)60033-7 *

Similar Documents

Publication Publication Date Title
Mehta et al. Mitochondrial bioenergetic deficits in C9orf72 amyotrophic lateral sclerosis motor neurons cause dysfunctional axonal homeostasis
JP6253596B2 (ja) アシル補酵素ａ：リゾカルジオリピン・アシル基転移酵素１（ａｌｃａｔ１）の発現、機能または活性の阻害物質を同定する方法
JP6205403B2 (ja) 骨・軟部に発生する巨細胞性腫瘍または軟骨肉腫の予防または治療剤
JP2015514966A5 (ko)
Carino et al. The bile acid activated receptors GPBAR1 and FXR exert antagonistic effects on autophagy
WO2013119033A1 (ko) Ｕｂａｐ２를 포함하는 골다공증 진단 및 치료효과 평가용 바이오 마커 조성물
WO2014178653A1 (ko) 지방세포 분화 과정에서 인간 작은 류신 지퍼 단백질의 용도
WO2023043257A1 (ko) Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물
WO2018174506A1 (ko) Sulf2 유전자를 이용한 소라페닙 치료에 대한 감수성 예측방법 및 sulf2 저해제를 포함하는 암 치료용 조성물
WO2018105921A2 (ko) 지방간의 진단 또는 치료를 위한 류신 지퍼 단백질의 용도
WO2018212503A1 (ko) 조혈모세포의 항상성 유지에 관여하는 cotl1 단백질 및 이의 용도
WO2010055977A1 (ko) ＧＡＢＡ Ｂ 수용체 및 ｐ-ＣＲＥＢ를 이용한 신경 질환 치료제의 스크리닝 방법
WO2017023002A1 (ko) 비알콜성 지방간 조절인자 14-3-3 단백질
WO2016209013A1 (ko) 비만 진단용 마커 tm4sf19 및 이를 이용한 방법
WO2020197209A2 (ko) 아이티아이에이치원을 표적으로 하는 고혈당 관련 질환 치료용 물질의 스크리닝 방법
KR20230040906A (ko) Smpd1 조절제를 유효성분으로 함유하는 골관절염 예방 또는 치료용 약학 조성물
WO2023022432A1 (ko) 퇴행성 관절염 예방, 치료 또는 진단용 조성물
WO2021025412A1 (ko) 보체 성분 c8 감마를 이용한 알츠하이머병의 진단방법
WO2020080739A1 (ko) 고프로락틴혈증의 진단용 조성물 및 약물 치료의 반응성을 예측하기 위한 정보를 제공하는 방법
WO2021210762A1 (ko) 항암제 내성 암 치료용 항암 보조제, 약학 조성물 및 이를 포함하는 키트
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
WO2011007936A1 (ko) 모체 간질에 의한 태아의 신경기능장애 질환의 진단방법 및 이의 치료제의 스크리닝 방법
WO2011145905A2 (ko) Ｇａｂａ 수용체를 이용한 임신 중 알코올 노출에 의한 태아의 신경질환 예방용 제제의 스크리닝 방법
WO2022019626A1 (ko) 대장암 전이 억제제 스크리닝 방법
WO2021101259A1 (ko) Cotl1을 유효성분으로 포함하는 골질환 또는 비만 진단용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22870341

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE