WO2022005012A1 - Sirt7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물 - Google Patents

Sirt7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2022005012A1
WO2022005012A1 PCT/KR2021/005819 KR2021005819W WO2022005012A1 WO 2022005012 A1 WO2022005012 A1 WO 2022005012A1 KR 2021005819 W KR2021005819 W KR 2021005819W WO 2022005012 A1 WO2022005012 A1 WO 2022005012A1
Authority
WO
WIPO (PCT)
Prior art keywords
sirt7
pharmaceutical composition
present
preventing
allergic diseases
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2021/005819
Other languages
English (en)
French (fr)
Inventor
김태훈
변준형
이기정
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea University Research and Business Foundation
Original Assignee
Korea University Research and Business Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea University Research and Business Foundation filed Critical Korea University Research and Business Foundation
Priority to US18/002,877 priority Critical patent/US12553049B2/en
Publication of WO2022005012A1 publication Critical patent/WO2022005012A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A61P27/14—Decongestants or antiallergics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications

Definitions

  • the present invention relates to the treatment and prevention of allergic diseases, and more particularly, to an allergy immunomodulatory method for inhibiting SIRT7 (Sirtuin 7) in nasal epithelial cells to suppress allergic mediators.
  • immunotherapy that induces tolerance by administering an allergen frequently causes side effects such as edema, urticaria, and dyspnea depending on the dose administered. As it is involved in the regulation of the mechanism or immune cells acting on it, symptoms recur when treatment is stopped.
  • the present inventors have developed a fundamental treatment and prevention method for allergic diseases through a method of inhibiting antigen recognition among the upper stages of the immune response so as to reduce the Th2 immune response.
  • the present invention has been completed by identifying the correlation between SIRT7 overexpression and allergic disease, and the technical task of the present invention is to track the expression level of SIRT7 and a pharmaceutical composition for the prevention or treatment of allergic diseases capable of regulating SIRT7 expression or activity To provide a screening method for a drug for preventing or treating allergic disease through
  • the present invention provides a pharmaceutical composition for preventing or treating allergic diseases comprising a SIRT7 inhibitor.
  • the present invention provides a method for preventing or treating an allergic disease comprising administering a SIRT7 inhibitor to a subject.
  • the present invention also provides the use of a SIRT7 inhibitor for the manufacture of a medicament for the prophylaxis or treatment of allergic diseases.
  • the SIRT7 inhibitor refers to a substance that inhibits the expression or activity of SIRT7, and preferably acts specifically on a SIRT7 protein or gene.
  • the SIRT7 expression inhibitory substance may decrease the level of SIRT7 in the cell by decreasing the expression level of SIRT7 or promoting degradation, and the SIRT7 activity inhibitory substance may specifically bind to SIRT7 and reduce its activity.
  • the SIRT7 inhibitor may be at least one selected from the group consisting of siRNA, aptamer, antisense oligonucleotide, and compound specific for SIRT7 gene or protein.
  • siRNA refers to a small RNA fragment with a size of 21-25 nucleotides produced by cleaving double-stranded RNA by Dicer, which specifically binds to mRNA having a complementary sequence and inhibits expression.
  • siRNA can be synthesized chemically or enzymatically. The method for preparing siRNA is not particularly limited, and methods known in the art may be used.
  • a method for direct chemical synthesis of siRNA a method for synthesizing siRNA using in vitro transcription, a method for cleaving long double-stranded RNA synthesized by in vitro transcription using an enzyme , an expression method through intracellular delivery of an shRNA expression plasmid or viral vector, and an expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette, but is not limited thereto.
  • the pharmaceutical composition of the present invention may be for nasal administration, and may be provided in an aerosol or spray formulation.
  • the allergic disease may be rhinitis in particular, and the subject may be a mammal, preferably a human, in need of prevention or treatment of an allergic disease.
  • the individual in need of the prevention of the allergic disease may have a history of developing symptoms of an allergic disease, or may be an individual having a genetic factor.
  • the present invention comprises the steps of (1) administering a candidate substance to nasal epithelial cells; (2) determining the SIRT7 expression level of the cell; and (3) determining a candidate substance that reduces the expression level of SIRT7 as a drug for preventing or treating allergic diseases compared to a control group not treated with the candidate substance; do.
  • the nasal epithelial cells of step (1) may be those in which overexpression of SIRT7 is genetically induced.
  • the present invention By inhibiting SIRT7 of nasal epithelial cells, the present invention induces antigen marker cell activation and T cell maturation to inhibit cytokine (TSLP) secretion, which causes an inflammatory response, thereby blocking the upper stage of allergic reaction and fundamentally preventing allergic diseases. It can be treated and prevented.
  • TSLP cytokine
  • FIG. 2 is a graph comparing the protein expression level of SIRT7 in the inferior turbinate of normal and allergic patients and micrographs of tissues.
  • TSLP allergy mediating substance
  • the present inventors suppressed the SIRT7 expression gene in human intranasal epithelial cells, confirmed the reduction of thymic stromal lymphopoietin (TSLP) secreted from nasal epithelial cells, and decreased secretion of allergen mediators when SIRT7 was inhibited through siRNA.
  • TSLP thymic stromal lymphopoietin
  • the present invention provides a pharmaceutical composition for preventing and treating allergic diseases comprising an agent that inhibits the expression or activity of SIRT7.
  • the present inventors confirmed the expression level of SIRT7 through staining of the inferior turbinate tissue of allergic patients. As a result, the expression of SIRT7 was increased overall in the inferior turbinate tissue, but it was confirmed that the expression was particularly increased in epithelial cells. Accordingly, the pharmaceutical composition of the present invention may be provided for nasal administration, and may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.
  • prophylaxis means all acts of delaying allergic diseases and symptoms by administration of the composition according to the present invention
  • treatment is the improvement or beneficial change of allergic disease symptoms by administration of the pharmaceutical composition according to the present invention. means all actions.
  • the subject subject to administration of the pharmaceutical composition of the present invention is not limited as long as it is a mammal, preferably a human, and more specifically, an allergic rhinitis patient.
  • carrier is also called a vehicle, and refers to a compound that facilitates the addition of proteins or peptides into cells or tissues.
  • DMSO dimethyl sulfoxide
  • carrier is also called a vehicle, and refers to a compound that facilitates the addition of proteins or peptides into cells or tissues.
  • DMSO dimethyl sulfoxide
  • diot is defined as a compound that is diluted in water that not only stabilizes the biologically active form of the target protein or peptide but also dissolves the protein or peptide.
  • Salts dissolved in buffer solutions are used as diluents in the art.
  • a commonly used buffer solution is phosphate buffered saline because it mimics the salt state of human solutions. Because buffer salts can control the pH of a solution at low concentrations, buffer diluents rarely modify the biological activity of a compound.
  • the compounds containing azelaic acid may be administered to a human patient as such, or as a pharmaceutical composition admixed with other ingredients as in combination therapy or in admixture with suitable carriers or excipients.
  • the pharmaceutical composition for preventing or treating allergic diseases according to the present invention is formulated in the form of external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. and sterile injection solutions, respectively, according to conventional methods.
  • excipient and diluent that may be included in the composition, lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the compound, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc.
  • lubricants such as magnesium stearate talc are also used.
  • Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • composition of the present invention may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc. can
  • a suitable dosage of the pharmaceutical composition of the present invention is variously prescribed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity of the patient. can be
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person of ordinary skill in the art to which the present invention pertains. Or it can be prepared by putting it in a large-capacity container.
  • the formulation may be in the form of a solution, suspension, or emulsion in oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant or stabilizer.
  • the inferior turbinate tissue was collected from 10 patients without allergic rhinitis (NT) and 10 patients with allergic rhinitis (AT), and RNA was extracted and converted into cDNA.
  • Real-time PCR was performed for cDNA to compare the gene expression of HDAC1, HDAC2, HDAC3, HDAC9, SIRT6, and SIRT7, respectively. As a result, a significant difference was confirmed between the two groups in the SIRT7 expression level (FIG. 1).
  • RNA samples and protein samples were collected by adding reagent or 5X sample buffer, and confirmed by real-time PCR and western blotting, respectively. As a result, it was confirmed that SIRT7 was overexpressed in epithelial cells isolated from allergic rhinitis patients (A, B in FIG. 2).
  • the collected inferior turbinate tissue After dehydrating the collected inferior turbinate tissue, it was made into a paraffin block, cut to a thickness of 0.4um, and fixed on a slide. After that, the deparaffinized tissue was stained using SIRT7 antibody, stained with Hematoxylin, dehydrated, covered with a cover glass, and observed under a microscope. As a result, it was confirmed that SIRT7 was increased overall in the inferior turbinate of allergic rhinitis patients, but SIRT7 expression was increased especially in the epithelial cell part ( FIG. 2C ).
  • siRNA used in the experiment is summarized in Table 1 below.
  • the present invention can be applied to medicines for the treatment of allergic diseases, particularly rhinitis, external use, and health functional foods.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pulmonology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)

Abstract

본 발명은 알레르기 질환 치료와 예방에 관한 것이며, 상세하게는 비강 상피 세포의 SIRT7을 저해하여 알레르기 매개 물질을 억제하는 알레르기 면역조절법에 관한 것으로서, 본 발명은 비강 상피 세포의 SIRT7를 저해함으로써 알레르기 항원을 인식하여 면역반응을 일으키는 면역세포들을 유인하는 상피세포의 cytokine(TSLP) 분비를 억제시켜 알레르기 반응의 상위 단계를 차단하여 알레르기 질환을 근본적으로 치료 및 예방할 수 있다.

Description

SIRT7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물
본 발명은 알레르기 질환 치료와 예방에 관한 것이며, 상세하게는 비강 상피 세포의 SIRT7(Sirtuin 7)을 저해하여 알레르기 매개 물질을 억제하는 알레르기 면역조절법에 관한 것이다.
알레르기 질환의 예방 및 치료에 있어서 기존 사용되는 면역 조절 방법들은 크게 나누어 1) 알레르기 환자에게 원인 알러젠을 점진적으로 투여하여 알러젠에 대한 내성을 유발하여 질환의 경과를 변경시키는 면역요법과 2) 여러 가지 요인들에 의해 발생한 Th2 면역 반응을 감소시켜 알레르기 반응을 억제하는 면역 조절 치료가 있다.
그러나, 1) 알러젠을 투여하여 내성을 유발하는 면역요법은 투여 용량에 따라 부종이나 두드러기, 호흡곤란과 같은 부작용이 빈번하게 발생하며 2) 기 발생한 Th2 면역 반응을 감소시키는 면역 조절 치료는 알레르기의 하위 기전이나 그에 작용하는 면역 세포들의 조절에 관여하므로 치료를 중단할 경우 증상이 재발하는 양상을 보인다.
이에, 본 발명자들은 Th2 면역 반응을 감소시킬 수 있도록 면역반응의 상위단계 중에서도 항원 인식을 저해하는 방안을 통한 알레르기 질환의 근본적 치료 및 예방 방법을 개발하였다.
본 발명은 SIRT7의 과발현과 알레르기 질환의 상관관계를 규명하여 완성된 것으로서, 본 발명이 이루고자 하는 기술적 과제는 SIRT7 발현 또는 활성 조절이 가능한 알레르기 질환의 예방 또는 치료용 약학적 조성물과 SIRT7의 발현 수준 추적을 통한 알레르기 질환 예방 또는 치료용 약물의 스크리닝 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 SIRT7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 SIRT7 억제제를 개체에 투여하는 단계를 포함하는 알레르기 질환 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 알레르기 질환 예방 또는 치료 약제의 제조를 위한 SIRT7 억제제의 용도를 제공한다.
본 발명의 일 구현예로서, 상기 SIRT7 억제제는 SIRT7의 발현 또는 활성을 억제하는 물질을 의미하여, SIRT7 단백질 또는 유전자에 특이적으로 작용하는 것이 바람직하다. 상기 SIRT7 발현 억제 물질은 SIRT7의 발현량을 감소시키거나 분해를 촉진함으로서 세포 내의 SIRT7의 수준을 감소시키는 것일 수 있으며, SIRT7 활성 억제 물질은 SIRT7과 특이적으로 결합하여 그 활성을 감소시키는 것일 수 있다. 본 발명에서 SIRT7 억제제는 SIRT7 유전자 또는 단백질에 특이적인 siRNA, 앱타머(aptamer), 안티센스 올리고뉴클레오티드 및 화합물로 이루어진 군으로부터 선택되는 1종 이상일 수 있다.
본 발명에서 "siRNA"는 이중가닥의 RNA가 다이서에 의해 절단되어 생성되는 21-25 뉴클레오티드 크기의 작은 RNA 조각으로 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 발현을 억제하는 것을 말한다. siRNA는 화학적으로 또는 효소학적으로 합성될 수 있다. siRNA의 제조방법으로는 특별히 한정되지 않으며, 당업계에 공지된 방법을 사용할 수 있다. 예를 들면, siRNA를 직접 화학적으로 합성하는 방법, 시험관 내(in vitro) 전사를 이용한 siRNA의 합성법, 시험관 내(in vitro) 전사에 의해 합성된 긴 이중-가닥 RNA를 효소를 이용하여 절단하는 방법, shRNA 발현 플라스미드나 바이러스성 벡터의 세포내 전달을 통한 발현법 및 PCR(polymerase chain reaction) 유도 siRNA 발현 카세트(cassette)의 세포 내 전달을 통한 발현법 등이 있으나 이에 한정되는 것은 아니다.
한편, 본 발명의 약학적 조성물은 비강 투여용일 수 있으며, 에어로졸 또는 스프레이 제형으로 제공될 수 있다.
또한, 본 발명에서 알레르기 질환은 특히 비염일 수 있으며, 상기 개체는 알레르기 질환의 예방 또는 치료가 필요한 포유류, 바람직하게는 인간일 수 있다. 상기 알레르기 질환의 예방이 필요한 개체는 알레르기 질환의 증상이 발생한 이력이 있거나, 유전적 요인을 갖는 개체일 수 있다.
또한, 본 발명은 (1) 비강상피세포에 후보물질을 투여하는 단계; (2) 상기 세포의 SIRT7 발현 수준을 확인하는 단계; 및 (3) 후보물질을 처리하지 않은 대조군과 비교하여 SIRT7의 발현 수준을 감소시키는 후보물질을 알레르기 질환 예방 또는 치료 약물로 판정하는 단계;를 포함하는 알레르기 질환 예방 또는 치료용 약물의 스크리닝 방법을 제공한다.
본 발명의 일 구현예로서, 상기 (1) 단계의 비강상피세포는 유전공학적으로 SIRT7의 과발현이 유도된 것일 수 있다.
본 발명은 비강 상피 세포의 SIRT7를 저해함으로써 항원표지세포의 활성화와 T 세포의 성숙을 유도하여 염증반응을 야기하는 cytokine(TSLP) 분비를 억제시켜 알레르기 반응의 상위 단계를 차단하고 알레르기 질환을 근본적으로 치료 및 예방할 수 있다.
도 1은 정상과 알레르기 환자의 하비갑개에서 유전자 발현 수준을 비교한 결과로서, 알레르기 환자에서 SIRT7 과발현 확인한 도면이다.
도 2는 정상과 알레르기 환자의 하바갑개에서 SIRT7의 단백질 발현 수준을 비교한 그래프와 조직의 현미경 사진이다.
도 3은 siRNA를 이용하여 SIRT7을 저해한 결과 알레르기 매개 물질(TSLP)이 감소됨을 확인한 도면이다.
본 발명자들은 인체 비강내 상피세포에서 SIRT7 발현유전자를 억제하여 비강 상피세포에서 분비되는 알레르기 매개 물질(TSLP: Thymic stromal lymphopoietin)의 감소를 확인하고, siRNA를 통한 SIRT7의 억제시 알레르기 매개 물질의 분비 감소를 확인하여 SIRT7과 알레르기 질환의 상관관계 규명으로부터 본 발명을 완성하였다.
이에, 본 발명은 SIRT7의 발현 또는 활성을 억제하는 제제를 포함하는 알레르기 질환의 예방 및 치료용 약학적 조성물을 제공한다.
한편, 본 발명자들은 알레르기 환자의 하비갑개 조직 염색을 통해 SIRT7의 발현 수준을 확인한 결과, 하비갑개 조직 전반적으로 SIRT7의 발현이 증가하였지만 특히 상피세포에서 각별한 발현 증가를 확인할 수 있었다. 따라서, 본 발명의 약학적 조성물은 비강투여용으로 제공될 수 있으며, 약학적 조성물의 제조에 통상적으로 사용되는 적절한 담체, 부형제, 및 희석제를 더 포함할 수 있다.
본 발명에서 예방이란 본 발명에 따른 조성물의 투여에 의해 알레르기 질환과 그 증상을 지연시키는 모든 행위를 의미하고, 치료란 본 발명에 따른 약학적 조성물의 투여에 의해 알레르기 질환 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다. 또한, 본 발명의 약학적 조성물의 투여 대상 개체는 포유류라면 제한되지 아니하나, 바람직하게는 인간일 수 있고, 보다 구체적으로 알레르기 비염 환자일 수 있다.
본 발명에서 "담체(carrier)"란 비이클(vehicle)이라고도 불리며, 세포 또는 조직 내로의 단백질 또는 펩타이드의 부가를 용이하게 하는 화합물을 의미하는 것으로서, 예를 들어 디메틸술폭사이드(DMSO)는 생물체의 세포 또는 조직 내로의 많은 유기물의 투입을 용이하게 하는 통상 사용되는 담체이다.
본 발명에서 "희석제(diluent)"란 대상 단백질 또는 펩타이드의 생물학적 활성 형태를 안정화시킬 뿐만 아니라, 단백질 또는 펩타이드를 용해시키게 되는 물에서 희석되는 화합물로 정의된다. 버퍼 용액에 용해되어 있는 염은 당해 분야에서 희석제로 사용된다. 통상 사용되는 버퍼 용액은 포스페이트 버퍼 식염수이며, 이는 인간 용액의 염 상태를 모방하고 있기 때문이다. 버퍼 염은 낮은 농도에서 용액의 pH를 제어할 수 있기 때문에, 버퍼 희석제가 화합물의 생물학적 활성을 변형하는 일은 드물다. 여기에 사용된 아젤라산을 함유하는 화합물들은 인간 환자에게 그 자체로서, 또는 결합 요법에서와 같이 다른 성분들과 함께 또는 적당한 담체나 부형제와 함께 혼합된 약학적 조성물로서, 투여될 수 있다.
또한, 본 발명에 따른 알레르기 질환 예방 또는 치료용 약학적 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 외용제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있으며, 상기 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 분해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 약학적 조성물은 경구 또는 비경구, 바람직하게는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 근육 주입, 정맥내 주입, 피하 주입, 복강 주입, 국소 투여, 경피 투여 등으로 투여할 수 있다.
본 발명의 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다.
본 발명의 약학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 대용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 이하 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
[실시예]
실시예 1. 알레르기 비염환자의 유전자 발현 확인
알레르기 비염이 없는 환자 10명(NT), 알레르기 비염이 있는 환자 10명(AT)의 하비갑개조직을 채취하여 RNA를 추출 후 cDNA로 변환하였다. cDNA를 각각 HDAC1, HDAC2, HDAC3, HDAC9, SIRT6, SIRT7의 유전자 발현을 비교하기 위해 real time PCR을 진행하였다. 그 결과, SIRT7 발현수준에서 양 그룹에 유의미한 차이를 확인하였다(도 1).
실시예 2. SIRT7 발현과 알레르기 비염과의 관계 확인
내시경으로 하비갑개의 위치를 확인 후 의료용 솔로 하비갑개 표면을 긁어서 상피세포를 채취하여 배양접시에서 1주일동안 2일에 한 번씩 배양액을 교체해주면서 배양하여 접시내에 상피세포가 충분히 자란 것을 확인한 후에 RNA extract reagent나 5X sample buffer를 넣어 RNA시료와 단백질 시료를 채취하여 각각 real time PCR과 western blotting 하여 확인하였다. 그 결과 알러지 비염 환자에서 분리한 상피세포에서 SIRT7이 과발현된 것을 확인하였다(도 2에 A, B).
채취한 하비갑개 조직을 탈수시킨 후 파라핀블록으로 만들어 0.4um 두께로 잘라서 슬라이드위에 고정시켰다. 그 후 탈파라핀화시킨 조직을 SIRT7 antibody를 이용하여 staining 시킨 후에 Hematoxylin으로 염색시키고 탈수시켜서 cover glass를 덮고 현미경으로 관찰하였다. 그 결과, 알러지 비염 환자의 하비갑개의 전반적으로 SIRT7이 증가했지만 특히 상피세포 부분에서 SIRT7의 발현이 증가되어있음을 확인하였다(도 2에 C).
실시예 3. siRNA를 이용한 SIRT7 발현 및 TSLP 분비 감소 확인
분리배양한 상피세포에 commercial하게 판매하는 SIRT7 siRNA와 본 연구진이 제작한 SIRT7 sequence(si1 또는 si2)를 처리하여 5x sample buffer로 단백질 시료를 채취하여 western blotting한 결과 si2 sequence를 처리한 세포에서 SIRT7 발현이 현저하게 저해되는 것을 확인하였다.
실험에 이용한 siRNA 구체적인 정보는 하기 표 1에 정리하였다.
Commercial siRNA 회사이름 Santacruz
제품명-Cat. No SIRT7 siRNA(h) - sc63030
si1 sequence guide RNA 5' ACUUUCUUCCUUUUUGUGCGU 3' 서열번호 1
Passenger RNA 5' GCACAAAAAGGAAGAAAGUGA 3' 서열번호 2
si2 sequence guide RNA 5' UGAUUACGUCACUUUCUUCCU 3' 서열번호 3
Passenger RNA 5' GAAGAAAGUGACGUAAUCACG 3' 서열번호 4
이어서, 상기 실시예 2에서 채취한 상피세포 배양액을 이용하여 별도로 TSLP ELISA를 진행한 결과 commercial siRNA와 si2 처리군에서 TSLP 분비가 유의미하게 감소하였음을 확인하였다(도 3).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 알레르기 질환, 특히 비염 치료를 위한 의약, 의약외용, 및 건강기능식품 등에 적용될 수 있다.

Claims (8)

  1. SIRT7 발현 또는 활성을 억제하는 제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 제제는 SIRT7 유전자 또는 단백질에 특이적으로 결합하는 siRNA, 앱타머(aptamer), 안티센스 올리고뉴클레오티드 및 화합물로 이루어진 군으로부터 선택된 1종 이상인 것을 특징으로 하는, 약학적 조성물.
  3. 제2항에 있어서,
    상기 siRNA는 서열번호 1 또는 서열번호 3의 염기서열을 포함하는 20~40 nt의 올리고뉴클레오티드인 것을 특징으로 하는, 약학적 조성물.
  4. 제1항에 있어서,
    상기 조성물은 비강투여용인 것을 특징으로 하는, 약학적 조성물.
  5. (1) 비강상피세포에 후보물질을 투여하는 단계;
    (2) 상기 세포의 SIRT7 발현 수준을 확인하는 단계; 및
    (3) 후보물질을 처리하지 않은 대조군과 비교하여 SIRT7의 발현 수준을 감소시키는 후보물질을 알레르기 질환 예방 또는 치료 약물로 판정하는 단계;를 포함하는 알레르기 질환 예방 또는 치료용 약물의 스크리닝 방법.
  6. 제4항에 있어서,
    상기 (1) 단계의 비강상피세포는 유전공학적으로 SIRT7의 과발현이 유도된 것을 특징으로 하는, 스크리닝 방법.
  7. SIRT7 발현 또는 활성을 억제하는 제제를 개체에 투여하는 단계를 포함하는 알레르기 질환 예방 또는 치료 방법.
  8. 알레르기 질환 예방 또는 치료 약제의 제조를 위한 SIRT7 발현 또는 활성을 억제하는 제제의 용도.
PCT/KR2021/005819 2020-06-30 2021-05-10 Sirt7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물 Ceased WO2022005012A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/002,877 US12553049B2 (en) 2020-06-30 2021-05-10 Pharmaceutical composition containing SIRT7 inhibitor for preventing or treating allergic diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200079761 2020-06-30
KR10-2020-0079761 2020-06-30

Publications (1)

Publication Number Publication Date
WO2022005012A1 true WO2022005012A1 (ko) 2022-01-06

Family

ID=79316389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/005819 Ceased WO2022005012A1 (ko) 2020-06-30 2021-05-10 Sirt7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물

Country Status (3)

Country Link
US (1) US12553049B2 (ko)
KR (1) KR102608364B1 (ko)
WO (1) WO2022005012A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007535518A (ja) * 2004-04-30 2007-12-06 トポターゲット ジャーマニィ アーゲー ヒストンデアセチラーゼ阻害剤を含んで成る製剤
KR20140123701A (ko) * 2013-04-15 2014-10-23 가톨릭대학교 산학협력단 신규한 간암치료 타겟으로서 sirt7의 용도
KR101915115B1 (ko) * 2010-05-03 2018-11-05 큐알엔에이, 인크. 시르투인 (sirt)에 대한 자연 안티센스 전사체의 저해에 의한 시르투인 (sirt) 관련된 질환의 치료
CN109507430A (zh) * 2018-09-06 2019-03-22 重庆医科大学 Sirt7的功能与用途

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2356977B1 (de) * 2011-02-02 2017-12-27 Symrise AG Zubereitungen mit Holzextrakten von Gleditschien

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007535518A (ja) * 2004-04-30 2007-12-06 トポターゲット ジャーマニィ アーゲー ヒストンデアセチラーゼ阻害剤を含んで成る製剤
KR101915115B1 (ko) * 2010-05-03 2018-11-05 큐알엔에이, 인크. 시르투인 (sirt)에 대한 자연 안티센스 전사체의 저해에 의한 시르투인 (sirt) 관련된 질환의 치료
KR20140123701A (ko) * 2013-04-15 2014-10-23 가톨릭대학교 산학협력단 신규한 간암치료 타겟으로서 sirt7의 용도
CN109507430A (zh) * 2018-09-06 2019-03-22 重庆医科大学 Sirt7的功能与用途

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YUAN Y., Q LIU, J ZHAO, H TANG, J SUN : "SIRT1 attenuates murine allergic rhinitis by downregulated HMGB 1/TLR4 pathway", SCANDINAVIAN JOURNAL OF IMMUNOLOGY, vol. 87, no. 6, 30 June 2018 (2018-06-30), XP055883881, DOI: 10.1111/sji.12667 *

Also Published As

Publication number Publication date
US12553049B2 (en) 2026-02-17
US20230332155A1 (en) 2023-10-19
KR102608364B1 (ko) 2023-12-01
KR20220002086A (ko) 2022-01-06

Similar Documents

Publication Publication Date Title
EA023009B1 (ru) Ингибитор hcv сериновой протеазы, полученный из макроциклического пролина, и фармацевтическая композиция, предназначенная для лечения вирусной инфекции
WO2020080861A1 (ko) Syt11 억제제를 유효성분으로 포함하는 위암 치료용 조성물
WO2012064146A9 (ko) Ｇｋｎ １을 함유하는 항암용 조성물
Shrestha et al. Bumped kinase inhibitor 1369 is effective against Cystoisospora suis in vivo and in vitro
WO2024029904A1 (ko) Hapln1을 포함하는 항산화 조성물 및 이를 이용한 세포의 항산화 방법
KR102676323B1 (ko) Fis1 활성화에 의한 조골세포 활성화를 통한 골형성 촉진 유도용 또는 골질환 치료용 조성물
KR102608364B1 (ko) Sirt7 억제제를 포함하는 알레르기 질환 예방 또는 치료용 약학적 조성물
WO2012008674A1 (ko) 마크로락틴 에이 및 그 유도체를 유효성분으로 함유하는 항혈관신생효과를 갖는 조성물
CN113917145B (zh) 人capn7基因的用途及相关产品
EP4282423A1 (en) Pharmaceutical composition for prevention or treatment of inflammatory disease or pain, comprising mesenchymal stem cells expressing ptx-3, timp1 and bdnf as active ingredient
US20120087980A1 (en) Stimulation of neuroregeneration by flavonoid glycosides
KR101273747B1 (ko) Ｓｔａ-21을 유효성분으로 함유하는 관절염의 예방 및 치료용 조성물
Hikawa et al. Interleukin-12 p40-homodimer production in sensory dorsal root ganglion neurons
CN106822864A (zh) 一种抑制前蛋白转化酶枯草溶菌素9表达的方法
WO2021149971A1 (ko) 신규 화합물 및 이의 용도
US20120269863A1 (en) Methods and compositions for regulating lymphocyte activity
KR102117525B1 (ko) Pde4b 저해제를 유효성분으로 함유하는 만성 부비동염에서의 비용종 발생의 예방 및 치료용 약학 조성물
KR101803224B1 (ko) 매트릭스 gla 단백질을 유효성분으로 함유하는 미오스타틴 활성 저해용 조성물
US12569495B2 (en) Inhibitors of porcine reproductive and respiratory syndrome virus
KR102259058B1 (ko) Herpud1 억제제를 유효성분으로 포함하는 결핵의 예방 또는 치료용 약학 조성물
KR100377455B1 (ko) 락토페린의 신규한 용도
KR20250027480A (ko) 스트레스 과립 형성 억제제를 유효성분으로 포함하는 결핵의 예방 또는 치료용 약학 조성물
WO2024172409A1 (ko) 돈태반 가수분해물을 포함하는 갱년기 우울증 또는 골다공증 예방 또는 치료용 조성물
WO2024096354A1 (ko) Ifitm3 억제제를 포함하는 신장암 예방 또는 치료용 약학적 조성물
US9562231B2 (en) Therapeutic agent for corneal epithelial disorder

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21832305

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21832305

Country of ref document: EP

Kind code of ref document: A1

WWG Wipo information: grant in national office

Ref document number: 18002877

Country of ref document: US