WO2021261626A1 - 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물 - Google Patents

다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물 Download PDF

Info

Publication number
WO2021261626A1
WO2021261626A1 PCT/KR2020/008303 KR2020008303W WO2021261626A1 WO 2021261626 A1 WO2021261626 A1 WO 2021261626A1 KR 2020008303 W KR2020008303 W KR 2020008303W WO 2021261626 A1 WO2021261626 A1 WO 2021261626A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
ppn
intestinal flora
composition
improving intestinal
Prior art date
Application number
PCT/KR2020/008303
Other languages
English (en)
French (fr)
Inventor
이상목
정동현
정은경
김민경
최승훈
최윤재
조종수
강상기
홍량
김휘수
한건구
Original Assignee
주식회사 인실리코
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 인실리코 filed Critical 주식회사 인실리코
Publication of WO2021261626A1 publication Critical patent/WO2021261626A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A23K10/18—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions of live microorganisms
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/163—Sugars; Polysaccharides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/716—Glucans
    • A61K31/719—Pullulans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/716—Glucans
    • A61K31/721—Dextrans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K2035/11—Medicinal preparations comprising living procariotic cells
    • A61K2035/115—Probiotics

Definitions

  • the present invention relates to a synbiotic composition for improving intestinal flora comprising polysaccharide nanoparticles, and more particularly, as probiotics Pediococcus acidilactici or Lactobacillus plantarum ( Lactobacillis plantarum ) strain It relates to a new biotic composition for improving intestinal flora comprising polysaccharide nanoparticles as prebiotics.
  • the gut microbiota refers to the totality of microorganisms living in the gut that are formed early in life and actively exchange and interactively influence with the host and each other throughout life.
  • the intestinal flora based on 100 times more abundant genes than humans, has various effects on the physiology of the host, such as intestinal mucosal immunity, nutrient absorption, and bile acid metabolism.
  • the imbalance of the intestinal flora is the cause of various diseases such as colon disease, dementia, cancer, or obesity.
  • the intestinal flora is constantly changing due to various factors such as diet, pathogenic infection, antibiotic exposure, and aging.
  • the intestinal flora which has been formed within a few years of life, maintains a stable state (symbiosis) that does not cause major changes in the physiology of the host with a small degree of change throughout life.
  • symbiosis a stable state that does not cause major changes in the physiology of the host with a small degree of change throughout life.
  • dysbiosis states of imbalance
  • LPS lipopolysaccharide
  • a component of the cell wall of Gram-negative bacteria is an endotoxin that causes inflammation. act as a cause
  • High blood endotoxin level serum LPS level
  • endotoxemia and various diseases derived therefrom is a result of an imbalance in the intestinal flora and an indicator of the risk of disease occurrence.
  • Representative methods that the majority agree on to maintain and improve the intestinal flora include the systematic method of securing microbial diversity and the component method of suppressing the proportion of harmful bacteria among specific microorganisms in the flora and increasing the proportion of beneficial bacteria There is this.
  • a representative strategy for this is the introduction of probiotics, prebiotics, or a combination thereof, synbiotics, into the host.
  • Korean Patent Registration No. 10-1381794 discloses a synbiotic food composition containing tagarose and probiotic lactic acid bacteria.
  • a specific method for improving intestinal flora using synbiotics has not yet been proposed.
  • the present inventors prepared polysaccharide nanoparticles (phthalyl dextran nanoparticles, PDN; phthalyl pullulan nanoparticles, PPN) using polysaccharide polymers such as dextran and pullulan, and then simply mixed them with probiotics to create new biotechnology. After developing a composition in the form of ticks and feeding it to a host (rat) with an unstable intestinal flora, changes in the intestinal flora and physiological changes of the host were confirmed. The present invention is based on this.
  • an object of the present invention is to provide a composition for improving intestinal flora that can suppress the specific gravity of harmful bacteria in the intestinal flora and increase the specific gravity of beneficial bacteria to secure diversity of intestinal microflora.
  • the present invention provides a new biotic composition for improving intestinal flora comprising a lactic acid bacteria strain as probiotics and polysaccharide nanoparticles as prebiotics.
  • the present invention provides a feed additive comprising the composition for improving intestinal flora.
  • the present invention provides a health functional food additive comprising the composition for improving intestinal flora.
  • the present invention provides a pharmaceutical composition for improving intestinal flora comprising the composition for improving intestinal flora.
  • the synbiotic composition for improving intestinal flora reduces the proportion of harmful bacteria in the intestinal flora in an imbalanced state (dysbiosis) due to rapid changes in the intestinal flora due to antibiotic exposure or pathogen infection, and increases the proportion of beneficial bacteria in the intestine By ensuring the diversity of the flora and the high relative abundance of beneficial bacteria, it is possible to maintain and improve the intestinal flora.
  • the synbiotic composition for improving intestinal flora improves the production of antibacterial proteins by probiotics through a self-defense mechanism, thereby exhibiting high antibacterial activity against gram-positive and negative pathogens compared to probiotics itself, thereby improving the colonization of the intestinal flora. Alterations can inhibit or treat pathogenic intestinal infections to prevent a decrease in the diversity of the microbiota.
  • the synbiotic composition for improving intestinal flora according to the present invention may reduce the level of endotoxin in the blood, thereby strengthening the intestinal barrier, and preventing or alleviating inflammation.
  • the synbiotic composition for improving intestinal flora according to the present invention may exhibit physiological changes such as weight gain, feed intake increase, and colon length increase.
  • Figure 2 shows the results of analysis by confocal microscopy and FACS of the introduction of PDN (A) and dextran (B) by PA in a vehicle, temperature and time-dependent manner.
  • PA/D dextran-treated PA
  • PA/PDN PDN-treated PA
  • AD pathogens
  • Figure 4 shows the biological effect of PDN on PA, (A) pediosin production by Bradford assay, (B) pediosin activity by growth inhibitory diameter of Listeria monocytogenes (AU / ml), (C) 16S Relative mRNA expression of pedA-D compared to rRNA expression, (D) expression levels of groEL , groES , dnaK and dnaJ for 16S rRNA were quantified by qRT-PCR (data as mean ⁇ SEM of 3 independent experiments Indicated, statistical significance was analyzed between PA and other groups by one-way ANOVA and Tukey's test (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001).
  • FIG 5 shows physiological changes in mice after feeding synbiotics according to an embodiment of the present invention, (A) body weight change, (B) feed intake change, (C) colon length change by group will be.
  • C control; T1 group: PA; T2 group: PA with dextran; T3 group: PA with PDN)
  • Figure 6 shows changes in the intestinal microflora of mice after feeding synbiotics according to an embodiment of the present invention,
  • A a control mouse or PA, a mouse treated with PA with dextran or PA with PDN From the unweighted principal coordinate analysis (PCoA) plot of the mouse gut microbiota,
  • B the number of observed OTUs in the mouse gut microbiota
  • C the result of measuring the number of viable E.
  • Figure 10 confirms the FITC fluorescence intensity and location of FITC-PPN3 after staining the LP cell membrane using a membrane-binding dye (FM4-64).
  • A The intensity of FITC fluorescence is maximum at the center of the LP
  • B It was confirmed that FITC fluorescence was seen in the bacteria.
  • Fig. 12 relates to the antibacterial ability of LP/PPN against E. coli and LM, in which LP treated with PPN or pullulan and gram-negative E. coli or gram-positive LM were co-cultured, and E.
  • the growth inhibition rate for coli (A) and LM (C) was calculated as CFU.
  • growth inhibition diameters of E. coli (B) and LM (D) on LB and BHI agar plates were measured (data are presented as mean ⁇ SEM of three independent experiments.
  • Statistical significance is one-way variance Analysis of statistical significance between LPs treated with P and LPs treated with PPN by one-way ANOVA and Turkey's test ( ** p ⁇ 0.01 and *** p ⁇ 0.001)).
  • FIG. 13 is an analysis of the mechanism of improvement of antibacterial activity, (A) measuring the growth of LP in the LP group treated with PPN or pullulan, (B) measuring the pH of the culture medium, and proteinase K After treatment, the antibacterial efficacy of LP / PPN against E. coli (C) and LM (D) was measured, (E) the relative mRNA expression level of planS compared to the 16S rRNA expression level was measured, and (F) The isolated plantaricin was measured by SDS-PAGE. The data confirming the mRNA expression level are presented as the mean ⁇ SEM of three independent experiments. Analysis of statistical significance between groups by one-way ANOVA and Turkey's test ( * p ⁇ 0.05, ** p ⁇ 0.01, and *** p ⁇ 0.001)).
  • mice 15 is a comparison of (A) body weight change, (B) feed intake change, and (C) colon length change of mice after feeding synbiotics according to an embodiment of the present invention by group.
  • C control group; T1 group: no LP group; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: with pullulan and PPN LP)
  • T1 group no LP group
  • T2 group LP without pullulan or PPN
  • T3 group LP with pullulan
  • T4 group LP with PPN
  • T5 group with pullulan and PPN LP
  • FIG. 17 shows blood endotoxin (EU/ml) levels for each group to which E. coli was orally administered.
  • C control group; T1 group: no LP group; T2 group: LP without pullulan or PPN; T3 group: LP with pullulan; T4 group: LP with PPN; T5 group: with pullulan and PPN LP)
  • PCoA principal coordinate analysis
  • PCoA principal coordinate analysis
  • FIG. 20 shows changes in the intestinal microbiota of mice after feeding synbiotics according to an embodiment of the present invention, (A) the number of observed OTUs in the mouse gut microbiota, (B) E in the mouse fecal sample. coli O157:H7 viable cell count measurement results, (C) changes in the ratio of Proteobacteria phyla in the intestinal microflora, (D) lactic acid bacteria (LAB) in feces, and counting results using a selective medium (MRS agar), (E) The content of Lactobacillus (Lactobacillus .spp.) in the feces, (F) shows the content of Bifidobacterium (Bifidobacterium spp.) in the feces.
  • T1 group no LP group
  • T2 group LP without pullulan or PPN
  • T3 group LP with pullulan
  • T4 group LP with PPN
  • T5 group with pullulan and PPN LP
  • 21 and 22 schematically show a synbiotic pay schedule according to an embodiment of the present invention.
  • the term 'antibacterial' refers to bactericidal activity or inhibition of microbial growth in a microbial population, particularly Escherichia coli and/or methicillin-resistant Staphylococcus aureus.
  • antibacterial means that the number of microorganisms as measured after 24 hours is significantly reduced compared to a control.
  • probiotics' refers to probiotics that have a beneficial effect on the host by improving the intestinal flora.
  • 'prebiotics' refers to substances that are not digested and are decomposed by specific intestinal microorganisms to induce the growth and activity of probiotics.
  • 'dysbiosis' refers to a state in which the intestinal flora is unstable and the effect of pathogen infection is maximized.
  • microbiome' refers to microorganisms existing in a specific environment and their entire genetic information, and refers to a collection of genomes that refer to the entire genetic information of a single organism. Therefore, 'Human Microbiome' refers to microorganisms living inside and outside the human body and their entire genetic information.
  • An embodiment of the present invention provides a synbiotics composition for improving intestinal flora, which includes a lactic acid bacteria strain as probiotics and polysaccharide nanoparticles as prebiotics.
  • the lactic acid bacteria are Pediococcus pentosaceus , or Pediococcus acidilactici , Lactobacillus lactis subsp. or Lactococcus lactis, and It may be one or more lactic acid bacteria selected from the group consisting of Lactobacilli lux plantarum.
  • the lactic acid bacteria may produce an antibacterial protein.
  • Antibacterial protein is a protein biosynthesized in useful microorganisms such as lactic acid bacteria, yeast, photosynthetic bacteria, and Bacillus bacteria, or a glycoprotein combined with protein and carbohydrate, and is a substance with an antibacterial effect produced to defend the microorganism itself.
  • the type of the antimicrobial protein is different depending on the microorganism strain producing the antimicrobial protein.
  • Antimicrobial proteins produced from lactic acid bacteria include Pediococcus pentosaceus ( Pediococcus pentosaceus ) or Pediococcus acidilactici ( Pediococcus acidilactici ) Pediocin produced from, Lactobacillus lactis subsp.
  • nisin produced from Lactococcus lactis or nisin produced from Lactococcus lactis, sakacin produced from Lactobacillus sake, and salivaricin produced from Lactobacillus salivarius ), heveticin or lactocin produced from Lactobacillus helveticus, acidophilucin or lactacin produced from Lactobacillus acidophilus (lactacin), plantaricin or plantacin produced from Lactobacillus plantarum, mersacidin produced from bacillus spp, Enterococcus faecalis ( It may be a cytolysin produced from Enterococcus faecalis, an Entericin produced from Enterococcus faecium, and a gassericin produced from Lactobacillus gasseri.
  • the antimicrobial protein is preferably at least one antimicrobial protein selected from the group consisting of pediocin, nisin, plantaricin and plantacin. .
  • the lactic acid bacteria strain may be Pediococcus acidilactici that produces pediocin.
  • the present invention may be in the Phedi O Lactococcus her CD rakti when (Pediococcus acidilactici) is Phedi O Lactococcus her CD rakti when (Pediococcus acidilactici) KCTC 21,088.
  • the lactic acid bacteria strain may be Lactobacillus plantarum producing plantaricin (Lactobacillus plantarum).
  • the Lactobacillus plantarum ( Lactobacillus plantarum ) may be LP 177 isolated from pig intestines. LP 177 exhibits a strong antibacterial action against E. coli K99.
  • Prebiotics generally defined as indigestible food ingredients, induce the growth or activity of beneficial microorganisms in the gastrointestinal tract and provide beneficial health effects to the host.
  • polysaccharides are used as prebiotics.
  • Non-limiting examples of the polysaccharide include cellulose, inulin, pullulan, starch, dextran, pectin, and the like.
  • the dextran is increasingly used as a prebiotic source due to its complex branched glucan composed of ⁇ (1 ⁇ 6) glycosidic linkages between straight-chain glucose molecules and ⁇ (1 ⁇ 3) linkages between branches. This linkage cannot be digested by pancreatic enzymes in the upper gastrointestinal tract (GI), but can be fermented by the gut microbiota.
  • GI upper gastrointestinal tract
  • the pullulan is a water-soluble polysaccharide produced by Aureobasidium pullulans , a type of fungus, in which pullulan is a maltotriose unit connected by an ⁇ -1,6 bond.
  • the pullulan is Lactobacillus Planta column is used as prebiotics in (Lactobacillus plantarum) can be fermented in butyrate and propionate by Lactobacillus Planta column (Lactobacillus plantarum). Butyrate may modulate intestinal barrier function, and propionate may treat DSS-induced intestinal dysfunction.
  • the polysaccharide is preferably a polysaccharide having a hydrophobic residue.
  • Polysaccharide is a structure obtained from nature and has no hydrophobic residue, but the polysaccharide used in the method according to an embodiment of the present invention is artificially formed by an ester bond to the primary alcohol group of the polysaccharide.
  • a hydrophobic group It is a structure that introduces Examples of the hydrophobic residue include acetate, propionate, butyrate, phthalate, cholesterol, mercaptosuccinic acid, and methyl glutaric acid. etc.
  • Polysaccharides having such a hydrophobic moiety introduced therein may be self-assembled into nanoparticles by a hydrophobic effect in a hydrophilic solvent.
  • the polysaccharide having a hydrophobic residue can enhance the biosynthesis of the antimicrobial protein by increasing the activity and stimulation of microorganisms.
  • the hydrophobic residue is at least one selected from the group consisting of acetate, propionate, butyrate, phthalate, cholesterol, mercaptosuccinic acid and methyl glutaric acid, and the polysaccharide is cellulose, It is preferable that at least one selected from the group consisting of inulin, pullulan, starch, dextran and pectin.
  • polysaccharides having such a hydrophobic residue include acetyl inulin, phthalyl inulin, phthalyl dextran, phthalyl starch, and phthalyl pullulan. ), cholesteryl pullulan, propyl inulin, and the like.
  • the polysaccharide nanoparticles may be phthalyl dextran nanoparticles (PDN).
  • PDN phthalyl dextran nanoparticles
  • phthalyl dextran nanoparticles in which a hydrophobic phthalyl group is introduced into dextran by ester bonding between a hydroxyl group in dextran and carboxylic acid in phthalic acid were prepared.
  • polysaccharide nanoparticles may be phthalyl pullulan nanoparticles (PPN).
  • PPN phthalyl pullulan nanoparticles
  • phthalyl pullulan nanoparticles in which a hydrophobic phthalyl group was introduced into pullulan by ester bonding between a hydroxyl group in pullulan and a carboxylic acid in phthalic acid were prepared.
  • the synbiotic composition may be a formulation in which the lactic acid bacteria strain and the polysaccharide nanoparticles are blended.
  • the synbiotic composition may be a formulation in which Pediococcus acidilactici and phthalyl dextran nanoparticles (PDN) are mixed.
  • PDN Pediococcus acidilactici and phthalyl dextran nanoparticles
  • the synbiotic composition may be a formulation in which Lactobacillus plantarum and phthalyl pullulan nanoparticles (PPN) are mixed.
  • PPN phthalyl pullulan nanoparticles
  • the polysaccharide nanoparticles can be introduced into lactic acid bacteria cells to increase the activity and stimulation of microorganisms, thereby enhancing the biosynthesis of antimicrobial proteins.
  • the process of introducing polysaccharide nanoparticles into lactic acid bacteria cells was confirmed to be a time, temperature, and carrier-dependent process.
  • the present invention provides a feed additive comprising the synbiotic composition for improving intestinal flora.
  • the feed additive may be prepared in powder or granular form, and if necessary, organic acids such as citric acid, humic acid, adipic acid, lactic acid, malic acid, or phosphates such as sodium phosphate, potassium phosphate, acidic pyrophosphate, polyphosphate, Polyphenol, catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included.
  • organic acids such as citric acid, humic acid, adipic acid, lactic acid, malic acid, or phosphates such as sodium phosphate, potassium phosphate, acidic pyrophosphate, polyphosphate, Polyphenol, catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included
  • the feed additive may include grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds based on rape, soybean, and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Sugar and dairy products, for example, may further include dry ingredients made of various types of milk powder and whey powder, and in addition, may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.
  • the feed additive may be administered to the animal alone or in combination with other feed additives in an edible carrier.
  • the feed additives can be easily administered to the animal as a top dressing, directly mixing them into the feed, or as an oral formulation separate from the feed.
  • a pharmaceutically acceptable edible carrier as is well known in the art to prepare an immediate release or sustained release formulation.
  • Such edible carriers may be solid or liquid, for example corn starch, lactose, sucrose, soy flakes, peanut oil, olive oil, sesame oil and propylene glycol.
  • the feed additive may be a tablet, capsule, powder, troche or sugar-containing tablet or top dressing in microdispersed form.
  • the feed additive may be in the form of a gelatin soft capsule, or a syrup or suspension, emulsion, or solution.
  • the feed additive may contain, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a solution accelerator, and the like.
  • the feed additive may be used by being added to animal feed by immersion, spraying, or mixing.
  • the feed additive can be applied to a number of animal diets, including mammals and poultry.
  • mammals and poultry As the mammal, it can be used for pigs, cattle, sheep, goats, laboratory rodents, and laboratory rodents, as well as pets (eg, dogs, cats), etc., and as the poultry, chickens, turkeys, ducks, geese, pheasants, and quail and the like.
  • the present invention provides a health functional food additive comprising the synbiotic composition for improving intestinal flora.
  • the health functional food additive may be added to the composition for improving intestinal flora as it is or may be used together with other foods or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined depending on the purpose of its use (prophylactic, health or therapeutic treatment).
  • the synbiotic of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material.
  • the mixed amount may be less than the above range, and since there is no problem in terms of safety, the mixed amount may be used in an amount greater than the above range.
  • Examples of foods to which the synbiotics can be added include dairy products, various soups, beverages, teas, drinks, and vitamin complexes, and include all health foods in a conventional sense.
  • the present invention provides a pharmaceutical composition for improving intestinal flora comprising the synbiotic composition for improving intestinal flora.
  • the pharmaceutical composition may be administered orally or parenterally, and it is preferable to select an external skin application or an intrarectal injection method for parenteral administration.
  • the pharmaceutical composition may further include commonly used excipients, disintegrants, sweeteners, lubricants, flavoring agents, and the like.
  • the pharmaceutical composition may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additive includes microcrystalline cellulose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, gum arabic, Powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sorbitol, talc, etc. may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the pharmaceutical composition.
  • Solid preparations for oral administration include powders, granules, tablets, capsules, soft capsules, pills, and the like.
  • Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, aerosols, etc.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives are included.
  • can Preparations for parenteral administration include powders, granules, tablets, capsules, sterilized aqueous solutions, solutions, non-aqueous solutions, suspensions, emulsions, syrups, suppositories, aerosols, etc.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the preferred dosage of the pharmaceutical composition varies depending on the absorption of the active ingredient in the body, the inactivation rate and excretion rate, the age, sex and condition of the patient, and the severity of the disease to be treated, but may be appropriately selected by those skilled in the art. However, for a desirable effect, in the case of oral administration, it is generally recommended to administer the composition of the present invention at an amount of 0.0001 to 100 mg/kg, preferably 0.001 to 100 mg/kg of the composition of the present invention per kg of body weight per day to adults. good. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • LB Lysogeny broth
  • MRS MRS broth
  • BHI Brain Heart Infusion
  • phthalyl dextran nanoparticles in which a hydrophobic phthalyl group was introduced into the dextran were prepared by ester bonding between a hydroxyl group in dextran and a carboxylic acid in phthalic acid.
  • the surface of the PDN prepared in Example 1 was measured with a scanning electron microscope (FE-SEM) (Carl Zeiss, SUPRA 55VP-SEM). As shown in Figure 1 (B), the shape of the PDN was a spherical nanometer scale.
  • FE-SEM scanning electron microscope
  • the particle size was measured with a dynamic light scattering (DLS) spectrophotometer (Otsuka Electronics, DLS-7000). As shown in FIG. 1D , the average size of the PDN was 238.7 nm with a polydispersity index of 0.220.
  • DLS dynamic light scattering
  • the amount of phthalyl groups in PDN was measured with a 600 MHz 1 H nuclear magnetic resonance (NMR) spectrometer (Bruker, AVANCE 600). As shown in FIG. 1C , the protons of dextran and phthalic acid in PDN were confirmed to be 3.8 and 7.4-7.7 ppm, respectively. In addition, the phthalyl group of PDN was 27.6 mol% based on the total of the protons of the dextran group and the phthalyl group.
  • NMR nuclear magnetic resonance
  • the surface charge (zeta potential) was measured with an electrophoretic light scattering photometer (Otsuka Electronics, ELS-8000). As shown in FIG. 1D , it was confirmed that the surface charge was -27.32 Mv. This is due to the carboxylic acid in the phthalyl group of the PDN.
  • fluorescence isothiocyanate (FITC)-labeled PDN and dextran were prepared, respectively. After mixing 5 mg of FITC and PDN and dextran dissolved in 1 ml of DMSO, respectively, the mixture was stirred in the dark at room temperature for 4 hours. Thereafter, the reaction was dropped into 10 ml of ethanol to remove unreacted FITC, and FITC-labeled PDN (FITC-PDN) and dextran (FITC-dextran) were recovered by centrifugation at 19,000 x g for 10 minutes, respectively. Then, 200 ml of DAPI (4,6-diamidino-2-phenylindol, 2 ug/ml) solution was treated and reacted for 10 minutes.
  • DAPI 4,6-diamidino-2-phenylindol, 2 ug/ml
  • FITC-PDN or FITC-dextran 0.5% (w/v) FITC-PDN or FITC-dextran was treated with the PA 2.0 x 10 5 CFU/ml cultured in 1 ml of MRS liquid medium, and incubated at 37° C. for 3 minutes, 5 minutes and 10 minutes. Samples washed three times with 1 ml of PBS were measured by flow cytometry (BD Biosciences, BD FACSCanto2) and a confocal laser microscope, and the results are shown in FIG. 2 . FITC-PDN or FITC-dextran was shown in green, and PA was stained in blue with DAPI (4',6-diamidino-2-phenylindole).
  • glucose, galactose and fructose were used as transport blockers of PDN.
  • Gram-positive and Gram-negative bacteria were cultured at 37° C. in a shaking incubator (255 rpm) and used in subsequent experiments or stored at -70° C. in 15% (v/v) glycerol.
  • the pathogenic strains were provided by the Agricultural Microorganisms Bank (KACC).
  • agar diffusion test 120 ⁇ l of the gram-negative pathogen (2.0x10 8 CFU/ml) was plated on an LB agar plate. Next, a paper disc was placed on the agar smeared with the pathogen, and 120 ⁇ l (2.0 ⁇ 10 8 CFU/ml) of PA [incubated with 0.5% (w/v) PDN or dextran] was applied onto the paper disc. was dropped into After incubation at 37°C for 20 hours, the zone of inhibition was measured. In the case of Gram-positive pathogens, 1.0 ⁇ 10 5 CFU/ml of PA and Listeria monocytogenes were plated on Oxford agar for co-culture after indicating as BHI broth. BHI agar was used for the agar diffusion test.
  • PA / PDN significantly higher antibacterial activity against both gram-negative and positive pathogens than untreated PA or PA treated with dextran alone (PA / D). was found to represent
  • the growth inhibition rate was calculated as the diameter of the inhibition region.
  • PA / PDN was confirmed to exhibit a wider region of inhibition than PA / D or PA alone.
  • pediosin The production of pediosin by PA was quantitatively analyzed by the Bradford method, pediosin activity test, and quantitative real-time PCR (qRT-PCR).
  • PA protein obtained by treating PA with nothing
  • PA/D protein obtained by treating PA with dextran
  • PA/PDN protein obtained by treating PA with PDN (Bradford assay)
  • Pediocin was purified using the ASM purification method and then quantified using a bovine serum albumin standard curve.
  • Figure 4 (A) the production of pediosin by PA / PDN was confirmed to be 2.2 times and 1.7 times higher than PA and PA / D, respectively.
  • qRT-PCR was performed to measure the expression of genes involved in pediosin biosynthesis. Specifically, the expression level of stress-related genes including heat shock-related genes such as groEL , groES , dnaK and dnaJ after PDN introduction into PA was measured.
  • RNA extraction was performed using the TRIzol® MaxTM Bacterial RNA Isolation Kit purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Total RNA extraction was performed according to the manufacturer's instructions.
  • cDNA was synthesized from 1 ⁇ g of RNA using ReverTra Ace ® qPCR RT Master Mix and gDNA remover purchased from TOYOBO CO., LTD (Dojima, Osaka, Japan).
  • RT-PCR was performed with SYBR qPCR Mix using a one-step real-time PCR protocol.
  • the primer sequences used at this time are as shown in Table 1 below.
  • the relative expression level of each gene was calculated using the ⁇ Ct method based on the expression level of 0.01 ng of 16S RNA Cdna in 1 ng of primer.
  • Target gene expression was normalized to the relative expression of the 16s rRNA gene used as an internal control in each sample. Data are presented as fold change relative to probiotic control.
  • mice were housed at a control temperature (22 ⁇ 2° C.) with a 12 hour light/dark cycle. Animals were fed ad libitum a standard mouse chow and were always provided with distilled water. After 7 days of acclimatization, mice were randomly assigned to 4 groups (10 BALB/C mice per group). The control group continued to feed as before.
  • group T1 a single dose of 10 8 CFU Pediococcus acidilactici (PA) in saline solution was administered by oral gavage.
  • Groups T2 and T3 received a single dose of dextran (0.5% w/v) treated PA or PDN (0.5% w/v) treated PA, respectively.
  • E.coli O157:H7 (10 9 CFU) was administered via oral gavage for 3 days in 0.2 ml of 1% NaHCO 3 ( E. coli O157: treatment for 30 minutes before administration of H7).
  • mice's body weight and food intake were monitored daily throughout the entire experimental period. Changes in PA and E. coli were counted by measuring viable CFU using fecal samples (10 mg/ml) collected daily, starting from the first day of pathogen administration. Specifically, the collected feces were smeared on MRS liquid medium and MacConkey agar medium, and then cultured at 37° C. for 20 hours, and then CFU was counted. At the end of the experiment, mice were euthanized using CO 2 , and intestinal samples and fecal samples were collected. Each collected fecal sample was used for measuring the number of viable cells and for DNA extraction.
  • the T3 group fed the PA/PDN supplemented diet increased body weight after 13 days compared to the body weight of 7 days.
  • the body weight decreased in the control group on the 13th day compared to the 7th day, whereas the body weight increased in the T2 and T3 groups.
  • FIG. 5B it was confirmed that the average feed intake per animal of the T3 group fed the PA/PDN supplemented diet was higher than that of the other groups.
  • the observed OTU (observed OTU) was identified as a diversity index of each fecal sample.
  • Microbiota were analyzed using QIIME (Quantitative Insights Into Microbial Ecology) v1.9.1 software. OTU picking was performed using the userarch61 method (parameter setting: s 0.1). Representative sequences were aligned using PyNAST. Representative sequences were taxonomically assigned using the uclust consensus taxonomy allocator. The OTU table was normalized to 16,660 reads per sample by single rarefaction and further analyzed.
  • Alpha diversity indices (OTU observations) were calculated from 16,660 sequence reads per sample with rarity of 10 iterations. Principal coordinate analysis (PCoA) was performed based on weighted UniFrac distances, and the effect of treatment on the microbiota was evaluated using the ANOSIM statistical test. The abundance of the microbial taxa was expressed as a percentage of the total 16 S rRNA gene sequences.
  • the number of OTUs observed was 1692.0 ( ⁇ 171.8), 1798.0 ( ⁇ 155.3), 1866.0 ( ⁇ 229.5) and 1946.0 ( ⁇ 163.4) for the control group, T1, T2 and T3 groups, respectively. ) was.
  • the T3 group fed a diet supplemented with PA/PDN showed significantly higher microbial diversity than the control group.
  • the amount of a specific microorganism in the fecal sample was quantified by performing quantitative PCR (qPCR) using a primer specific for a specific microorganism along with the measurement of the viable cell count.
  • E.coli O157: H7 As shown in (C) of Figure 6, E.coli O157: H7, the oral administration start, in all of the four mouse group fecal E. coli O157: H7 had no colony formation by, after a day on average in the feces of all treatment groups Approximately 4 log 10 (CFU/mg feces) of E. coli were observed.
  • CFU/mg feces CFU/mg feces
  • the number of viable cells of E. coli O157:H7 was 3.69 log 10 for the control group, 3.00 log 10 for T1, 2.80 log 10 for T2, and 1.57 log 10 for T3. It was confirmed that it was significantly different from this control group.
  • the lactic acid bacteria content in the feces was verified by measuring the number of viable cells by Qpcr using E. coli O157:H7-specific marker intimin and using MRS agar medium.
  • the intimin level was confirmed to be significantly lower in the three groups orally administered probiotics compared to the control group (4.2 times) (T1: 1.78 times, T2: 2.05 times, and T3: 0.95 times) pear), that is, it can be seen that the feeding of probiotics eliminates pathogens in the intestine.
  • the amount of Pediococcus acidilactici in the PA fed group was slightly higher than that of the control group (6.18 fold) (T1: 8.29 fold, T2: 6.20 fold, and T3: 7.24 times).
  • the primers used were as described in Table 3 below, and qPCR was performed in the above-described manner.
  • the V4 region of the bacterial 16S rRNA gene was amplified from total extracted DNA using Takara Ex Taq polymerase (Takara Bio, Shiga, Japan) and 515F-806 R primer pair.
  • the amplification program consisted of 1 cycle at 94°C for 3 minutes, 40 cycles at 94°C for 45 seconds, 55°C for 1 minute, and 40 cycles at 72°C for 1.5 minutes, and finally 1 cycle at 72°C for 10 minutes.
  • a DNA library was constructed using the Illumina TruSeq DNA Sample Preparation Kit, and paired-end sequencing of the amplicons (2x300 bp) was completed on Illumina MiSeq (manufactured by Macrogen, Seoul, Korea).
  • the identified 16S rRNA gene sequence was stored in the NCBI Sequence Read Archive (SRA) database (accession number: SRR7867415).
  • the relative abundance of intestinal microorganisms was determined from the results of mass sequencing through Illumina Miseq sequencing.
  • lactic acid bacteria which is a representative beneficial bacteria in the feces
  • the amount of lactic acid bacteria (LAB) in the feces was measured based on CFU, and also molecularly genetically specific to Bifidobacterium spp.
  • the primers described in Table 3 above. was quantified using
  • PA/PDN not only inhibits the harmful bacteria Proteobacteria , but also regulates the gut microbiota in such a way as to increase microbial diversity, abundance and levels of some beneficial bacteria.
  • Pullulan used in the present invention was purchased from Shandong Freda Biotechnology Co., Ltd. (Shandong, China), and other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA). ) was purchased from Lysogeny broth (LB), LB agar, MRS broth, MacConkey agar medium and brain heart infusion (BHI) broth for bacterial culture were purchased from BD Difco (Sparks, MD, USA).
  • phthalyl pullulan nanoparticles in which a hydrophobic phthalyl group was introduced into pullulan were prepared by ester bonding between a hydroxyl group in pullulan and a carboxylic acid in phthalic acid.
  • PPN3 phthalic anhydride:flurane
  • the reaction was carried out at 54° C. for 48 hours under nitrogen.
  • the produced PPN was first dialyzed in DMF to remove unreacted phthalic anhydride, and then placed in distilled water at 4° C. for 24 hours to form self-assembled nanoparticles of phthalyl pullulan. After ultracentrifugation of the prepared PPN, unreacted pullulan was removed. Finally, PPN was lyophilized and stored at -20°C until use.
  • PPN3 was confirmed to have a spherical shape with a nanometer size.
  • the particle size was measured with a dynamic light scattering (DLS) spectrophotometer (Otsuka Electronics, DLS-7000).
  • DLS dynamic light scattering
  • the size of the nanoparticles was 140.0, 108.9, and 82.1 nm for PPN1, PPN2, and PPN3, respectively. From this, it can be seen that the particle size decreases with an increase in the number of bound phthalic acid groups in the pullulan.
  • PPN degree of substitution of the phthalyl moiety in PPN was confirmed by 1 H-NMR spectroscopy, and phthalic acid for sugar protons (C1 positions of ⁇ -1,6 and ⁇ -1,4 glycosidic bonds, 4.68 and 5.00 ppm, respectively) The ratio of protons (7.4-77 ppm) was determined and calculated. According to the degree of substitution of phthalic acid, PPN was named as follows: PPN1 (DS: 30.90 mol%), PPN2 (DS: 50.45 mol%) and PPN3 (DS: 68.50 mol%). ((A) of FIG. 8)
  • the surface charge (zeta potential) was measured with an electrophoretic light scattering photometer (Otsuka Electronics, ELS-8000). As shown in FIG. 8B , the surface charges of PPN1, PPN2, and PPN3 were -38.09, -38.45, and -33.84 mV, respectively. Due to unreacted carboxyl groups in the phthalic acid groups, PPN exhibited a negative zeta potential.
  • fluorescence isothiocyanate (FITC)-labeled PPN (FITC-PPN) and pullulan (FITC-pullulan) were prepared, respectively.
  • FITC-labeled PPN FITC-PPN
  • pullulan dissolved in 100 ml PPN or 2 ml dimethyl sulfoxide (DMSO). After stirring for 4 hours in an opaque tube at room temperature, it was dialyzed at 4°C for 24 hours with distilled water. Finally, FITC-labeled PPN (FITC-PPN) and pullulan were lyophilized and stored at -20°C until use.
  • the LP 177 (2.0x10 6 CFU/ml) cultured in 1 ml of MRS liquid medium was treated with 0.5% (w/v) FITC-PPN or FITC-pullulan, and incubated at 37° C. for 2 hours.
  • Samples washed three times with 1 ml of PBS were measured by flow cytometry (BD Biosciences, BD FACSCanto2) and a confocal laser microscope, and the results are shown in FIG. 9 . Samples were washed with PBS and analyzed by flow cytometry and confocal laser scanning microscopy (CLSM) (SP8X STED Leica, Wetzlar, Germany).
  • CLSM flow cytometry and confocal laser scanning microscopy
  • the LP was treated with FITC-PPN3 and the localization of FITC-PPN3 was confirmed with the Z-section mode of the CLSM.
  • the fluorescence intensities of FITC and DAPI were highest at the center of the LP, and it was confirmed that PPN was introduced into the LP.
  • the cell membrane was stained using a membrane-bound dye (FM4-64) as a negative control, and then the FITC fluorescence intensity and location of FITC-PPN3 was confirmed.
  • FM4-64 membrane-bound dye
  • the intensity of FITC fluorescence was maximum at the center of the LP, and it was confirmed that FITC fluorescence appeared in the bacteria.
  • glucose, galactose, fructose and PPN3 were used as transport blockers of PPN.
  • the LP (2.0x10 6 CFU/ml) cultured in 1 ml of MRS liquid medium was pre-cultured with 10% (w/v) glucose, galactose, fructose or PPN3 at 37° C. for 10 minutes, followed by 0.5% ( w/v) FITC-PPN3.
  • Samples washed three times with 1 ml of PBS were measured by flow cytometry (BD Biosciences, BD FACSCanto2) and a confocal laser microscope, and the results are shown in FIG. 9 .
  • LPs E. coli K99 and Listeria monocytogenes (LM) were treated with pullulan, LP against representative gram-negative and gram-positive pathogens.
  • LP177 was cultured in MRS broth
  • E. coli K99 was cultured in LB broth
  • LM was cultured in BHI broth.
  • LP and LM were co-cultured in BHI broth under similar conditions described above.
  • the antibacterial activity of the LP/PPN group was higher than that of untreated LP or LP/P against E. coli and LM.
  • the smaller the size of the nanoparticles the stronger the antimicrobial activity of the LP.
  • the antibacterial activity of LP/PPN was confirmed by the agar diffusion test.
  • the pH of the culture medium of LPs after treatment with PPN or pullulan was also measured to evaluate lactic acid production. As shown in (B) of FIG. 13 , it was confirmed that the pH curve of LP with or without PPN or pullulan showed no significant change between groups. Therefore, it can be seen that the introduction of PPN into LP does not negatively affect the growth of LP.
  • RNA extraction was performed using the TRIzol® MaxTM Bacterial RNA Isolation Kit purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Total RNA extraction was performed according to the manufacturer's instructions.
  • cDNA was synthesized from 1 ⁇ g of RNA using ReverTra Ace ® qPCR RT Master Mix and gDNA remover purchased from TOYOBO CO., LTD (Dojima, Osaka, Japan).
  • RT-PCR was performed with SYBR qPCR Mix using a one-step real-time PCR protocol. Primer sequences are as shown in Table 4 below.
  • Relative gene expression was calculated using the -2 ⁇ Ct method.
  • the plantarisin gene planS was selected and 16S rRNA was used for normalization. As shown in (E) of Figure 13, after treatment with PPN or pullulan for 8 hours, the expression level of planS is higher in PPN-treated LP than in untreated or pullulan-treated LP, so the expression of planS is antibacterial in PPN-treated LP It was confirmed that the activity was improved.
  • inulin nanoparticles introduced into PA were found to induce a stress response in PA (Cui et al., 2018; Kim et al., 2018).
  • stress-related genes such as heat shock proteins dnaK and dnaJ
  • 14 (A) and (B) after treatment with PPN or pullulan for 8 hours, the expression levels of dnaK and dnaJ were found to be significantly higher in PPN-treated LPs than in untreated LPs. From this, it can be seen that the introduction of PPN into LP induced a stress response.
  • the control group continued to feed as before.
  • a single dose of 10 8 CFU Lactobacillus plantarum (LP) in saline solution was administered by oral gavage.
  • a single dose of flurane (0.5% w/v) and LP mixture or PPN (0.5% wv) and LP mixture was administered to the T3 and T4 groups, respectively.
  • the T5 group was administered a single dose of pullulan (0.5% w/v) and PPN (0.5% w/v) treated LP.
  • the test group was continuously administered the test diet for 7 days, but 6 days after the test diet, E.coli K99: 0.2ml/mouse (1x10 9 CFU) was administered through oral gavage for 3 days in 0.2 ml of 1% NaHCO 3 (Treatment for 30 minutes before administration of E. coli K99) was administered together.
  • Antibiotics a mixture of ampicillin, gentamicin, neomycin and vancomycin cancer
  • mice body weight and food intake were monitored daily throughout the entire experimental period. Starting from day 1 of pathogen administration, LP and E. coli were counted as viable CFUs from daily fecal samples (10 mg/ml). The feces were spread on both MRS agar and MacConkey agar medium, and then incubated at 37°C for 20 hours. At the end of the experiment, mice were euthanized with CO 2 .
  • Intestinal samples and feces were collected from the intestines and used for bioburden and microbiota analysis.
  • T4 and T5 supplemented with synbiotics
  • the average dietary intake per animal in the group was found to be the highest.
  • the change in colon length was measured.
  • the increase in colon length was positively correlated with weight gain (correlation ratio: 0.408).
  • 15C the T4 group supplemented with the LP/PPN combination had the longest colon length compared to the other groups, and the T2, T3, T4 and T5 groups supplemented with probiotics or synbiotics were treated with probiotics or synbiotics. It was found to have a longer colon length compared to the T1 group not supplemented with probiotics.
  • the cecal weight was also measured. As shown in FIG. 16 , the T1 group administered with only E. coli K99 and not supplemented with probiotics or synbiotics had the largest cecal weight, whereas the T2 to T5 groups supplemented with probiotics or synbiotics had the cecal weight of group C. lowered to a level closer to
  • the intestinal barrier function plays an important role in maintaining normal intestinal function by preventing the entry of harmful substances such as intestinal bacteria, toxins, and the gram-negative bacterial LPS into other tissues or the systemic circulation.
  • probiotics or synbiotics were not supplemented.
  • the serum LPS level was the highest in the T1 group, and in the groups supplemented with probiotics or synbiotics, in particular, the blood endotoxin in the T4 group and T5 group administered with LP/PPN and LP/P/PPN, respectively. was found to be low.
  • Viable cell count and quantitative PCR were used to quantify the amount of specific microorganisms from fecal samples.
  • the viable cell counts of E. coli and lactic acid bacteria were evaluated by plating fecal samples on MacConkey agar medium and MRS agar medium, respectively.
  • the number of viable E. coli cells is approximately 3 to 4 log 10 (CFU / mg of feces) in the T1 group compared to other groups treated with probiotics or synbiotics, approximately 7 log 10 ( CFU/mg of feces), and the T4 and T5 groups had the lowest number of E. coli viable cells compared to T2 and T3. From this, it can be seen that the PPN fed to the T4 and T5 groups induces the antibacterial ability of E. coli.
  • the number of viable LAB cells was evaluated on MRS agar plates. As shown in FIG. 20(D), the number of viable LAB cells in group C was approximately 3-4 log10 (CFU/mg of feces), whereas in the probiotic or synbiotic-treated group (T2, T3, T4 and T5) The number of viable LAB cells was found to be approximately 5-6 log10 (CFU/mg of feces). In the T1 group, only 2-3 log10 (CFU/mg of feces) was present, and it can be seen that the intestinal microflora was definitely destroyed by antibiotic treatment, and recovered by treatment with probiotics and synbiotics.
  • Lactobacillus (LAB), a representative beneficial bacteria in feces, was identified by CFU count and measured using a Bifidobacterium spp. specific marker.
  • Bifidobacterium spp. was found to be significantly more abundant in T4 and T5 supplied with LP/PPN.
  • LP/PPN not only inhibits the effects of pathogen infection, such as inhibiting Proteobacteria , but also regulates the gut microbiota in such a way as to increase microbial diversity, abundance and levels of some beneficial bacteria. have.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Husbandry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biotechnology (AREA)
  • Physiology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nutrition Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 프로바이오틱스로서 유산균 균주 및 프리바이오틱스로서 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물, 및 이를 포함하는 사료 첨가제, 건강기능식품 첨가제 및 약학적 조성물에 관한 것이다.

Description

다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물
본원 발명은 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물에 관한 것으로, 보다 상세하게는 프로바이오틱스로서 페디오코커스 애시디락티시(Pediococcus acidilactici) 또는 락토바실럭스 플란타럼(Lactobacillis plantarum) 균주를 포함하고, 프리바이오틱스로서 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물에 관한 것이다.
장내 균총(gut microbiota)은 생애 초기에 형성되어 일생에 걸쳐 숙주 및 상호 간 활발하게 쌍방향적 영향을 주고받는 장내 서식하는 미생물의 총체를 의미한다. 장내 균총은 인간에 비해 100배 이상 풍부한 유전자를 바탕으로 장 점막 면역, 영양 물질 흡수, 담즙산 대사 등 숙주의 생리에 다양하게 영향을 끼친다. 특히, 최근 장내 균총의 불균형은 대장 질환, 치매, 암, 혹은 비만 등 다양한 질병의 원인으로 작용한다고 알려져 장내 균총의 균형을 유지, 회복 및 개선시키는 것이 건강 유지 및 질병 예방/치료에 중요하다.
장내 균총은 식단, 병원균 감염, 항생제 노출, 노화 등 다양한 요인들에 의해 끊임없이 변화하고 있다. 일반적으로 생후 수 년 내 형성을 완료한 장내 균총은 일생 동안 그 변화의 정도가 작고 숙주의 생리에 큰 변화를 초래하지 않는 안정된 상태(symbiosis)를 유지하지만, 항생제 노출 혹은 병원균 감염 등의 이유로 급격하게 변화하여 불균형의 상태(dysbiosis)가 될 경우 각종 질병에 취약해지게 된다. 특히, 그람 음성균 세포벽 구성물질인 지질다당류(lipopolysaccharide; LPS)는 염증을 유발하는 내독소 물질(endotoxin)로써, 장내 균총 불균형 시 장 주변 혹은 혈류에 고농도로 분포하게 되어 염증성 장 질환 및 다양한 대사질환의 원인으로 작용한다.
한편, 일반적으로 장내 균총의 상태를 나타내는 척도로는 균총의 다양성(diversity), 유익균의 높은 상대적 풍부도(relative abundance) 등을 들 수 있다. 내독소 혈증과 그로부터 파생되는 다양한 질환의 원인인 높은 혈중 내독소 수준(serum LPS level)은 장내 균총의 불균형으로 인한 결과인 동시에 질병 발생 위험을 나타내는 지표이다.
장내 균총을 유지, 개선하는데 있어 다수가 동의하는 대표적인 방법에는 미생물의 다양성을 확보하는 시스템적 측면의 방법과, 균총 내 특정 균들 중 유해균의 비중을 억제하고, 유익균의 비중을 늘리는 구성요소 측면의 방법이 있다. 이를 위한 대표적인 전략으로는 프로바이오틱스(probiotics), 프리바이오틱스(prebiotics) 혹은 이들의 조합인 신바이오틱스(synbiotics)의 숙주 내 도입이 있다.
신바이오틱스와 관련하여, 대한민국 등록특허 제10-1381794호는 타가로스 및 프로바이오틱 유산균을 함유하는 신바이오틱 식품 조성물을 개시하고 있다. 그러나, 아직까지 신바이오틱스를 이용한 장내 균총 개선의 구체적인 방법은 제시되고 있지 않은 실정이다.
본 발명자들은 덱스트란(dextran), 플루란(pullulan) 등의 다당류 고분자를 이용하여 다당류 나노입자 (phthalyl dextran nanoparticle, PDN; phthalyl pullulan nanoparticle, PPN)를 제조한 뒤, 이를 프로바이오틱스와 단순 혼합하여 신바이오틱스 형태의 조성물을 개발하고, 이를 장내 균총이 불안정한 숙주(쥐)에 급여한 후 숙주의 장내 균총 변화와 생리적 변화를 확인하였다. 본 발명은 이에 기초한 것이다.
상기한 문제점을 해결하기 위해, 본 발명은 장내 균총 내 유해균의 비중을 억제하고, 유익균의 비중을 늘려 장내 미생물의 다양성을 확보할 수 있는 장내 균총 개선용 조성물을 제공하는 것을 목적으로 한다.
상기한 목적을 달성하기 위해, 본 발명은 프로바이오틱스로서 유산균 균주 및 프리바이오틱스로서 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물을 제공한다.
또한, 본 발명은 상기 장내 균총 개선용 조성물을 포함하는 사료 첨가제를 제공한다.
또한, 본 발명은 상기 장내 균총 개선용 조성물을 포함하는 건강기능식품 첨가제를 제공한다.
또한, 본 발명은 상기 장내 균총 개선용 조성물을 포함하는 장내 균총 개선용 약학적 조성물을 제공한다.
본 발명에 따른 장내 균총 개선용 신바이오틱스 조성물은 항생제 노출 혹은 병원균 감염 등의 이유로 장내 균총이 급격하게 변화하여 불균형의 상태(dysbiosis)에 있는 장내 균총의 유해균 비중을 감소시키고, 유익균 비중을 늘려 장내 균총의 다양성(diversity), 유익균의 높은 상대적 풍부도(relative abundance) 등을 확보할 수 있도록 함으로써 장내 균총을 유지 및 개선할 수 있다.
본 발명에 따른 장내 균총 개선용 신바이오틱스 조성물은 자기 방어 기작을 통해 프로바이오틱스에 의한 항균성 단백질의 생산을 향상시켜 프로바이오틱스 자체에 비해 그람 양성 및 음성 병원체에 대한 높은 항균 활성을 나타냄으로써 장내 균총의 군집을 변경시켜 병원성 장 감염을 억제 또는 치료하여 미생물총의 다양성 감소를 예방할 수 있다.
본 발명에 따른 장내 균총 개선용 신바이오틱스 조성물은 혈중 내독소 수준을 감소시켜 장내 장벽 강화, 및 염증 예방 내지 완화 효과를 나타낼 수 있다.
본 발명에 따른 장내 균총 개선용 신바이오틱스 조성물은 체중 증가, 사료 섭취량 증가, 결장길이(colon length) 증가 등의 생리적 변화를 나타낼 수 있다.
도 1은 (A) PDN 합성의 반응식이고, (B) SEM으로 관찰한 PDN의 형태이고, (C) 1H NMR에서 PDN 중 프탈산의 몰%를 계산한 것이고, (D) DLS에 의한 PDN 크기의 측정 결과 및 ELS에 의한 제타 전위이다(배율: 10,000X; 축척바=2 μm).
도 2는 운반체, 온도 및 시간 의존적 방식으로 PA에 의한 PDN(A) 및 덱스트란 (B)의 도입을 공초점 현미경 및 FACS로 분석한 결과이다.
도 3은 병원체(A-D)에 대한 PA, 덱스트란으로 처리한 PA(PA/D) 및 PDN으로 처리한 PA(PA/PDN)의 항균 활성을 나타낸 것이다(데이터를 3번의 독립 실험의 평균±SEM으로 표시함. 일원 분산 분석(one-way ANOVA) 및 Tukey's test에 의해 각 그룹 간의 통계적 유의성을 분석(*p < 0.05, **p < 0.01, ***p < 0.001)).
도 4는 PA에 대한 PDN의 생물학적 효과를 나타낸 것으로, (A) 브래드포드 분석에 의한 페디오신 생산, (B) Listeria monocytogenes의 성장 억제 직경에 의한 페디오신 활성(AU/ml), (C) 16S rRNA 발현과 비교한 pedA-D의 상대적 mRNA 발현, (D) 16S rRNA에 대한 groEL, groES, dnaK 및 dnaJ 의 발현 수준을 qRT-PCR로 정량화한 것이다(데이터를 3번의 독립 실험의 평균±SEM으로 표시함. 일원 분산 분석(one-way ANOVA) 및 Tukey's test에 의해 PA 및 다른 그룹 간의 통계적 유의성을 분석(*p < 0.05, **p < 0.01, ***p < 0.001)).
도 5는 본 발명의 일 실시예에 따른 신바이오틱스를 급여 후 마우스의 생리적 변화를 나타낸 것으로, (A) 체중 변화, (B) 사료 섭취량 변화, (C) 결장 길이의 변화를 그룹 별로 비교한 것이다. (C: 대조군; T1 그룹: PA; T2 그룹: 덱스트란을 갖는 PA; T3 그룹: PDN을 갖는 PA)
도 6은 본 발명의 일 실시예에 따른 신바이오틱스를 급여 후 마우스의 장 미생물총의 변화를 나타낸 것으로, (A) 대조군 마우스 또는 PA, 덱스트란을 갖는 PA 또는 PDN을 갖는 PA로 처리한 마우스로부터 마우스 장 미생물군의 비가중 주좌표 분석(PCoA) 플롯, (B) 마우스 장 미생물총의 observed OTU의 수, (C) 마우스 분변 시료 중 E.coli O157:H7의 생균수 측정 결과, (D) 마우스 분별 시료 중 E.coli O157:H7(인티민)의 비율, (E) 장 미생물총의 Proteobacteria 문의 비율 변화, (F) 분변 내 유산균(LAB)의 함량, (G) 분변 내 비피도박테리움(Bifidobacterium spp.)의 함량을 나타낸 것이다. (C: 대조군; T1 그룹: PA; T2 그룹: 덱스트란을 갖는 PA; T3 그룹: PDN을 갖는 PA)
도 7은 PPN(프탈릴 풀루란 나노입자)의 화학 합성 반응을 나타낸 것이다.
도 8은 (A) 1H NMR에서 PPN 중 프탈산의 몰%를 계산한 것이고, (B) ELS에 의한 제타 전위이고, (C) DLS에 의한 PPN 크기의 측정 결과이고, (D) SEM으로 관찰한 PPN의 형태이다(배율: 10,000X; 축척바=100 nm).
도 9는 LP에 의한 PPN의 도입 여부를 분석한 결과로서(FITC-PPN은 녹색으로 도시되고, LP는 DAPI로 청색으로 염색됨), 2시간의 처리 후에 PPN의 도입을 FACS로 정량화하고 통계적으로 분석하여, (A) Z-섹션 이미지로 LP에 PPN의 도입 여부를 보여준 것이고, (B) 10% (w/v) 글루코스, 프럭토스, 갈락토스 또는 PPN3로 전배양된 LP를 0.5% (w/v) FITC-PPN3로 37℃에서 2시간 동안 처리하고, CLSM 및 FACS로 관찰한 것이다(공초점 및 FACS 데이터는 세 번의 독립 실험을 대표하는 것이고, 평균 값을 막대 차트에 독립 FACS 실험의 평균±SEM으로 나타냄. 통계적 유의성을 일원 분산 분석(one-way ANOVA) 및 Turkey's test에 의한 각 그룹 간의 통계적 유의성을 분석함(*** p <0.001). 축척바=10㎛.)
도 10은 막 결합 염료(FM4-64)를 이용하여 LP 세포막을 염색한 뒤 FITC-PPN3의 FITC 형광 세기 및 위치를 확인한 것으로, (A) FITC 형광의 세기는 LP의 중심에서 최대이고 (B) FITC 형광이 박테리아 내에 보이는 것을 확인한 것이다.
도 11은 (A) LP를 0.5% (w/v) FITC-풀루란, FITC-PPN1, FITC-PPN2 및 FITC-PPN3로 37℃에서 2시간 동안 처리하고, CLSM 및 FACS로 관찰한 것이고, (B) LP를 0.5% (w/v) FITC-PPN3으로 4℃, 20℃, 37℃에서 2시간 동안 처리하고, CLSM 및 FACS로 관찰한 것이다(공초점 및 FACS 데이터는 세 번의 독립 실험을 대표하는 것이고, 평균 값을 막대 차트에 독립 FACS 실험의 평균±SEM으로 나타냄. 통계적 유의성을 일원 분산 분석(one-way ANOVA) 및 Turkey's test에 의한 각 그룹 간의 통계적 유의성을 분석함(*** p <0.001). 축척바=2㎛.).
도 12는 E.coli 및 LM에 대한 LP/PPN의 항균 능력에 관한 것으로, PPN 또는 풀루란으로 처리된 LP와 그람 음성 E.coli 또는 그람 양성 LM을 공배양 (co-culture)하고, E.coli(A) 및 LM(C) 대한 성장 저해율을 CFU로 계산한 것이다. 또한, 유사하게, LB 및 BHI 한천 플레이트 상에 E.coli(B) 및 LM(D)의 성장 억제 직경을 측정한 것이다(데이터는 3번의 독립 실험의 평균±SEM으로 나타냄. 통계적 유의성을 일원 분산 분석(one-way ANOVA) 및 Turkey's test에 의한 P로 처리한 LP와 PPN으로 처리한 LP간의 통계적 유의성을 분석함(** p <0.01 및 *** p <0.001)).
도 13은 항균력의 향상 메커니즘을 분석한 것으로, PPN 또는 풀루란으로 처리된 LP 그룹 중의 (A) LP의 성장을 측정한 것이고, (B) 배양 배지의 pH를 측정한 것이고, 프로테이나제 K 처리 후 E.coli(C) 및 LM(D)에 대한 LP/PPN의 항균 효능을 측정한 것이고, (E)16S rRNA 발현 수준과 비교한 planS의 상대적 mRNA발현 수준을 측정한 것이고, (F) 분리된 플란타리신을 SDS-PAGE로 측정한 것이다. mRNA 발현 수준을 확인한 데이터는 3번의 독립 실험의 평균±SEM으로 나타냄. 일원 분산 분석(one-way ANOVA) 및 Turkey's test에 의한 그룹 간의 통계적 유의성을 분석함(* p <0.05, ** p <0.01, 및 *** p <0.001)).
도 14는 PPN으로 처리된 LP에서 스트레스 반응과 관련된 유전자 분석 결과로서, 16S rRNA에 대한 dnaK(A) 및 dnaJ(B)의 발현 수준을 qRT-PCR로 정량화한 것이다(데이터는 3번의 독립 실험의 평균±SEM으로 나타냄. 일원 분산 분석(one-way ANOVA) 및 Turkey's test에 의한 LP와 다른 그룹 간의 통계적 유의성을 분석함(* p <0.05, ** p <0.01, 및 *** p <0.001).)
도 15는 본 발명의 일 실시예에 따른 신바이오틱스를 급여 후 마우스의 (A) 체중 변화, (B) 사료 섭취량 변화, (C) 결장 길이의 변화를 그룹 별로 비교한 것이다. (C: 대조군; T1 그룹: LP 미처리군; T2 그룹: 풀루란 또는 PPN을 갖지 않는 LP; T3 그룹: 풀루란을 갖는 LP; T4 그룹: PPN을 갖는 LP; T5 그룹: 풀루란 및 PPN을 갖는 LP)
도 16은 본 발명의 일 실시예에 따른 신바이오틱스를 급여 후 마우스의 맹장 무게를 측정한 결과를 그룹 별로 비교한 것이다. (C: 대조군; T1 그룹: LP 미처리군; T2 그룹: 풀루란 또는 PPN을 갖지 않는 LP; T3 그룹: 풀루란을 갖는 LP; T4 그룹: PPN을 갖는 LP; T5 그룹: 풀루란 및 PPN을 갖는 LP)
도 17은 E. coli 를 경구 투여한 그룹 별 혈중 내독소(EU/ml) 수준을 나타낸 것이다. (C: 대조군; T1 그룹: LP 미처리군; T2 그룹: 풀루란 또는 PPN을 갖지 않는 LP; T3 그룹: 풀루란을 갖는 LP; T4 그룹: PPN을 갖는 LP; T5 그룹: 풀루란 및 PPN을 갖는 LP)
도 18 은 비가중 UniFrac 거리에 기초한 주좌표 분석(PCoA) 결과이다. (C: 대조군; T1 그룹: LP 미처리군; T2 그룹: 풀루란 또는 PPN을 갖지 않는 LP; T3 그룹: 풀루란을 갖는 LP; T4 그룹: PPN을 갖는 LP; T5 그룹: 풀루란 및 PPN을 갖는 LP)
도 19는 가중 UniFrac 거리에 기초한 주좌표 분석(PCoA) 결과이다. (C: 대조군; T1 그룹: LP 미처리군; T2 그룹: 풀루란 또는 PPN을 갖지 않는 LP; T3 그룹: 풀루란을 갖는 LP; T4 그룹: PPN을 갖는 LP; T5 그룹: 풀루란 및 PPN을 갖는 LP)
도 20은 본 발명의 일 실시예에 따른 신바이오틱스를 급여 후 마우스의 장 미생물총의 변화를 나타낸 것으로, (A) 마우스 장 미생물총의 observed OTU의 수, (B) 마우스 분변 시료 중 E.coli O157:H7의 생균수 측정 결과, (C) 장 미생물총의 프로박테리아(Proteobacteria) 문의 비율 변화, (D) 분변 내 유산균(LAB)의 선별배지 (MRS 한천)을 이용한 계수 결과, (E) 분변 내 락토바실러스(Lactobacillus.spp.)의 함량, (F) 분변 내 비피도박테리움(Bifidobacterium spp.)의 함량을 나타낸 것이다. (C: 대조군; T1 그룹: LP 미처리군; T2 그룹: 풀루란 또는 PPN을 갖지 않는 LP; T3 그룹: 풀루란을 갖는 LP; T4 그룹: PPN을 갖는 LP; T5 그룹: 풀루란 및 PPN을 갖는 LP)
도 21 및 도 22는 본 발명의 일 실시예에 따른 신바이오틱스 급여 스케줄을 도식적으로 나타낸 것이다.
이하, 첨부된 도면을 참조하여 본 발명에 따른 바람직한 실시예를 상세히 설명하되, 도면 부호에 관계없이 동일하거나 유사한 구성 요소는 동일한 참조 번호를 부여하고 이에 대한 중복되는 설명은 생략하기로 한다.
또한, 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다. 또한, 첨부된 도면은 본 발명의 사상을 쉽게 이해할 수 있도록 하기 위한 것일 뿐, 첨부된 도면에 의해 본 발명의 사상이 제한되는 것으로 해석되어서는 아니됨을 유의해야 한다.
본 명세서에서, '항균'이란 용어는 미생물 집단, 특히 대장균(escherichia coli) 및/또는 메티실린-내성 황색포도상구균(Staphylococcus aureus)에서 살균 활성 또는 미생물 성장 저해를 뜻한다. 본 명세서에서 사용된 바와 같이, "항균"이란 용어는 24시간 후에 측정하였을 때 미생물의 수가 대조군에 비하여 유의적으로 감소함을 의미한다.
본 명세서에서, '프로바이오틱스(probiotics)'는 장내 균총을 개선시킴으로서 숙주에게 유익한 영향을 주는 생균제제를 의미한다.
본 명세서에서, '프리바이오틱스(prebiotics)'는 소화되지 않고 특정 장내미생물에 의해서 분해되어 프로바이오틱스의 성장과 활성을 유도하는 물질을 의미한다.
본 명세서에서, '디스비오시스(Dysbiosis)'는 장내 균총이 불안정한 상태, 병원균 감염 효과가 극대화된 상태를 의미한다.
본 명세서에서, '미생물총(Microbiome)'은 특정 환경에 존재하고 있는 미생물들과 이들의 유전정보 전체를 말하는 것으로, 단일 생명체의 유전정보 전체를 뜻하는 게놈(Genome)들의 집합체를 뜻한다. 따라서 '인체 미생물총(Human Microbiome)'은 인간 몸체 안팎에 서식하고 있는 미생물들과 그들의 유전정보 전체를 말한다.
본 발명의 일 실시예는 프로바이오틱스(probiotics)로서 유산균 균주 및 프리바이오틱스(prebiotics)로서 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스(synbiotics) 조성물을 제공한다.
상기 유산균은 페디오코커스 펜토사세우스(Pediococcus pentosaceus), 또는 페디오코커스 애시디락티시(Pediococcus acidilactici), 락토바실러스 락티스 속(Lactobacillus lactis subsp.) 또는 락토코커스 락티스(Lactococcus lactis), 및 락토바실럭스 플란타럼(Lactobacillis plantarum)으로 이루어진 군으로부터 선택되는 1종 이상의 유산균일 수 있다.
상기 유산균은 항균성 단백질을 생산할 수 있다. 항균성 단백질은 유산균, 효모, 광합성균, 바실러스균 등 유용한 미생물에서 생합성되는 단백질 또는 단백질과 탄수화물이 결합된 당단백질로, 미생물 자신을 스스로 방어하기 위해 생산하는 항균 효과가 있는 물질이다.
상기 항균성 단백질은 항균성 단백질을 생산하는 미생물 균주에 따라 종류가 상이하다. 유산균에서 생산된 항균성 단백질로는 페디오코커스 펜토사세우스(Pediococcus pentosaceus) 또는 페디오코커스 애시디락티시(Pediococcus acidilactici)에서 생산된 페디오신(pediocin), 락토바실러스 락티스 속(Lactobacillus lactis subsp.) 또는 락토코커스 락티스(Lactococcus lactis)에서 생산된 니신(nisin), 락토바실러스 사케(Lactobacillus sake)에서 생산된 사카신(sakacin), 락토바실러스 살리바리우스 (Lactobacillus salivarius)에서 생산된 살리바리신(salivaricin), 락토바실러스 헬베티쿠스(Lactobacillus helveticus)에서 생산된 헬베티신(heveticin) 또는 락토신(lactocin), 락토바실러스 아시도필루스(Lactobacillus acidophilus)에서 생산된 아시도필루신(acidophilucin) 또는 락타신(lactacin), 락토바실러스 플란타럼(Lactobacillus plantarum)에서 생산된 플란타리신(plantaricin) 또는 플란타신(plantacin), 바실러스 종(bacillus spp)에서 생산된 메르사시딘(mersacidin), 엔테로코커스 패칼리스(Enterococcus faecalis)에서 생산된 시톨리신(cytolysin), 엔테로코커스 패시움(Enterococcus faecium)에서 생산된 엔테리신(Entericin), 락토바실러스 가세리(Lactobacillus gasseri)에서 생산된 가세리신(gassericin) 등일 수 있다.
본 발명의 일 실시예에서, 상기 항균성 단백질은 페디오신(pediocin), 니신(nisin), 플란타리신(plantaricin) 및 플란타신(plantacin)으로 이루어진 군으로부터 선택되는 1종 이상의 항균성 단백질인 것이 바람직하다.
본 발명의 일 실시예에서, 상기 유산균 균주는 페디오신을 생산하는 페디오코커스 애시디락티시(Pediococcus acidilactici)일 수 있다.
본 발명의 일 실시예에서, 상기 페디오코커스 애시디락티시(Pediococcus acidilactici)는 페디오코커스 애시디락티시(Pediococcus acidilactici) KCTC 21,088일 수 있다.
본 발명의 다른 실시예에서, 상기 유산균 균주는 플란타리신을 생산하는 락토바실러스 플란타럼(Lactobacillus plantarum)일 수 있다.
상기 락토바실러스 플란타럼(Lactobacillus plantarum)은 돼지 내장에서 분리된 LP 177 일 수 있다. LP 177은 E. coli K99 에 대해 강력한 항균 작용을 나타낸다.
일반적으로 소화 불량성 음식 성분으로 정의되는 프리바이오틱스(prebiotics)는 위장관에서의 이로운 미생물의 성장 또는 활동을 유도하고, 숙주에 이로운 건강 효과를 제공한다. 본 발명에서는 프리바이오틱스로 다당류를 사용한다.
상기 다당류의 비제한적인 예로는 셀룰로오스(cellulose), 이눌린(inulin), 풀루란(pullulan), 전분(starch), 덱스트란(dextran), 펙틴(pectin) 등이 있다.
상기 덱스트란은 직쇄 포도당 분자 사이의 α(1→6) 글리코시드 연결과 가지 사이의 α(1→3) 연결로 구성된 복잡한 분지형 글루칸으로 인해 프리바이오틱스 소스로 점점 더 많이 사용되고 있다. 이 연결은 상부 위장관(GI)에서 췌장 효소에 의해 소화될 수 없으나, 장 미생물총에 의해 발효될 수 있다.
상기 풀루란은 풀루란(Pullulan)은 말토트리오스(maltotriose) 단위가 α-1,6 결합으로 연결된 것으로 진균류의 일종인 아우레오바시디움 풀루란스(Aureobasidium pullulans)가 생성하는 수용성 다당류이다. 이러한 풀루란은 락토바실러스 플란타럼(Lactobacillus plantarum)의 프리바이오틱스로 사용되어 락토바실러스 플란타럼(Lactobacillus plantarum)에 의해 부티레이트 및 프로피오네이트로 발효될 수 있다. 부티레이트는 장 장벽 기능을 조절할 수 있으며, 프로피오네이트는 DSS로 유발된 장 기능 장애를 치료할 수 있다.
본 발명의 일 실시예에 따르면, 상기 다당류는 소수성 잔기를 가지는 다당류인 것이 바람직하다.
다당류는 자연에서 얻은 것으로 소수성 잔기가 없는 구조이나, 본 발명의 일 예에 따른 방법에서 사용되는 다당류는 인위적으로 다당류(polysaccharide)의 1차 알코올기에 에스테르 결합(ester bond)으로 소수성 잔기(hydrophobic group)를 도입시킨 구조이다. 상기 소수성 잔기로는 아세테이트(acetate), 프로피오네이트(propionate), 부틸레이트(butyrate), 프탈레이트(phthalate), 콜레스테롤(cholesterol), 메르캅토숙신산(mercaptosuccinic acid), 메틸 글루타르산(methyl glutaric acid) 등일 수 있다.
이러한 소수성 잔기가 도입된 다당류는 친수성 용매에서 소수성 효과에 의해 자기 조립(self-assembly)되어 나노입자화될 수 있다. 이와 같이 소수성 잔기를 가지는 다당류는 미생물의 활성 및 자극을 증가시켜 항균성 단백질의 생합성을 증강시킬 수 있다.
본 발명의 일 실시예에 따르면, 상기 소수성 잔기는 아세테이트, 프로피오네이트, 부틸레이트, 프탈레이트, 콜레스테롤, 메르캅토숙신산 및 메틸 글루타르산으로 이루어진 군에서 선택되는 1종 이상이고, 상기 다당류는 셀룰로오스, 이눌린, 풀루란, 전분, 덱스트란 및 펙틴으로 이루어진 군에서 선택되는 1종 이상인 것이 바람직하다.
이러한 소수성 잔기를 가지는 다당류의 일 예는 아세틸 이눌린(acetyl inulin), 프탈릴 이눌린(phthalyl inulin), 프탈릴 덱스트란(phthalyl dextran), 프탈릴 스타치(phthalyl starch), 프탈릴 풀루란(phthalyl pullulan), 콜레스테릴 풀루란(cholesteryl pullulan), 프로필 이눌린(propyl inulin) 등일 수 있다.
일 례로, 상기 다당류 나노입자는 프탈릴 덱스트란 나노입자(phthalyl dextran nanoparticle, PDN)일 수 있다.
본 발명에서는 도 1의 (A)와 같이, 덱스트란 중의 히드록실기 및 프탈산 중의 카르복실산이 에스테르 결합하여 소수성 프탈릴기가 덱스트란에 도입된 프탈릴 덱스트란 나노입자(PDN)을 제조하였다.
다른 례로, 상기 다당류 나노입자는 프탈릴 풀루란 나노입자(phthalyl pullulan nanoparticle, PPN)일 수 있다.
본 발명에서는 도 7과 같이, 풀루란 중의 히드록실기와 프탈산 중의 카르복실산이 에스테르 결합을 하여 소수성 프탈릴기가 풀루란에 도입된 프탈릴 풀루란 나노입자(PPN)을 제조하였다.
상기 신바이오틱스 조성물은 상기 유산균 균주와 상기 다당류 나노입자가 배합된 제형일 수 있다.
본 발명의 일 실시예에 따르면, 상기 신바이오틱스 조성물은 페디오코커스 애시디락티시(Pediococcus acidilactici)와 프탈릴 덱스트란 나노입자(PDN)가 배합된 제형일 수 있다.
본 발명의 다른 실시예에 따르면, 상기 신바이오틱스 조성물은 락토바실러스 플란타럼(Lactobacillus plantarum)과 프탈릴 풀루란 나노입자(PPN)가 배합된 제형일 수 있다.
상기 다당류 나노입자는 유산균 세포 내로 도입되어 미생물의 활성 및 자극을 증가시켜 항균성 단백질의 생합성을 증강시킬 수 있다.
본 발명의 실험예에서, 유산균 세포 내로 다당류 나노입자가 도입되는 과정은 시간, 온도, 운반체 의존적인 과정인 것으로 확인되었다.
또한, 본 발명은 상기 장내 균총 개선용 신바이오틱스 조성물을 포함하는 사료 첨가제를 제공한다.
상기 사료 첨가제는 분말 또는 과립형태로 제조될 수 있고, 필요에 따라, 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성 피로인산염, 폴리인산염 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제 중 어느 하나 또는 하나 이상을 추가로 포함할 수 있다.
상기 사료 첨가제는 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩, 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조 성분 등을 더 포함할 수 있으며, 이외에도 영양 보충제, 소화 및 흡수 향상제, 성장 촉진제 등을 더 포함할 수 있다.
상기 사료 첨가제는 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료 첨가제와 조합하여 투여할 수도 있다. 또한, 상기 사료 첨가제는 탑 드레싱으로서 또는 이들을 사료에 직접 혼합하거나 또는 사료와 별도의 경구 제형으로 용이하게 동물에게 투여할 수 있다. 상기 사료 첨가제 조성물을 사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 약제학적으로 허용 가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 이러한 식용 담체는 고체 또는 액체, 예를 들어 옥수수 전분, 락토오스, 수크로오스, 콩 플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 사료 첨가제는 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체 담체가 사용될 경우, 사료 첨가제는 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다.
상기 사료 첨가제는, 예를 들어 보존제, 안정화제, 습윤제 또는 유화제, 용액 촉진제 등을 함유할 수 있다. 상기 사료 첨가제는 침주, 분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.
상기 사료 첨가제는 포유류, 및 가금 포함하는 다수의 동물 식이에 적용할 수 있다. 상기 포유류로서 돼지, 소, 양, 염소, 실험용 설치 동물, 및 실험용 설치 동물뿐만 아니라, 애완 동물(예: 개, 고양이) 등에게 사용할 수 있으며, 상기 가금류로서 닭, 칠면조, 오리, 거위, 꿩, 및 메추라기 등에도 사용할 수 있다.
또한, 본 발명은 상기 장내 균총 개선용 신바이오틱스 조성물을 포함하는 건강기능식품 첨가제를 제공한다.
상기 건강기능식품 첨가제는 상기 장내 균총 개선용 조성물을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 그의 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 본 발명의 신바이오틱스는 원료에 대하여 15 중량부 이하, 바람직하게는 10 중량부 이하의 양으로 첨가된다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 혼합양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 혼합양은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 건강기능식품의 종류에는 특별한 제한은 없다. 상기 신바이오틱스를 첨가할 수 있는 식품의 예로는 낙농제품, 각종 스프, 음료수, 차, 드링크제 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.
또한, 본 발명은 상기 장내 균총 개선용 신바이오틱스 조성물을 포함하는 장내 균총 개선용 약학적 조성물을 제공한다.
상기 약학적 조성물은 경구 또는 비경구 투여할 수 있으며, 비경구 투여시 피부 외용 또는 직장내주사방식을 선택하는 것이 바람직하다.
상기 약학적 조성물은 통상적으로 사용되는 부형제, 붕해제, 감미제, 활택제, 향미제 등을 추가로 포함할 수 있다. 또한, 상기 약학적 조성물은 약제학적으로 허용가능한 첨가제를 더 포함할 수 있으며, 이때 약제학적으로 허용가능한 첨가제로는 미결정셀룰로오스, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 아라비아고무, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바 납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 소르비톨, 탈크 등이 사용될 수 있다. 본 발명에 따른 약제학적으로 허용가능한 첨가제는 상기 약학적 조성물에 대해 0.1~90 중량부 포함되는 것이 바람직하다.
경구투여를 위한 고형제제에는 산제, 과립제, 정제, 캡슐제, 연질캅셀제, 환 등이 포함된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제, 에어로졸 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제로는 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 멸균된 수용액, 액제, 비수성용제, 현탁제, 에멀젼, 시럽, 좌제, 에어로졸 등의 외용제 및 멸균 주사제제의 형태로 제형화하여 사용될 수 있으며, 바람직하게는 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제의 피부 외용 약학적 조성물을 제조하여 사용할 수 있으나, 이에 한정하는 것은 아니다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
상기 약학적 조성물의 바람직한 투여량은 체내에서 활성성분의 흡수도, 불활성화율 및 배설속도, 환자의 연령, 성별 및 상태, 치료할 질병의 중증 정도에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 그러나 바람직한 효과를 위해서, 경구 투여제의 경우 일반적으로 성인에게 1일에 체중 1 kg당 본 발명의 조성물을 1일 0.0001 내지 100 ㎎/㎏으로, 바람직하게는 0.001 내지 100 ㎎/㎏으로 투여하는 것이 좋다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
이하, 본 발명의 실시예와 비교예를 통하여 더욱 상세하게 설명한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위해 예시적으로 제시한 것일 뿐, 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가지는 자에 있어서 자명할 것이다.
<실시예 1> PDN의 합성
본 발명에 사용된 모든 물질 및 화학 물질은 달리 언급되지 않는 한 Sigma-Aldrich (미국 미주리 주 세인트루이스)에서 구입하였다. 박테리아 배양을 위한 리소게니 브로스(LB), LB 한천, MRS 브로스, MacConkey 한천 배지 및 BHI(Brain Heart Infusion) 브로스는 BD Difco (Sparks, MD, USA)에서 구입했다.
도 1의 (A)와 같이, 덱스트란 중의 히드록실기 및 프탈산 중의 카르복실산이 에스테르 결합하여 소수성 프탈릴기가 덱스트란에 도입된 프탈릴 덱스트란 나노입자(PDN)을 제조하였다.
구체적으로, 덱스트란(1g, MW=4000 gmol-1)을 5 ml의 디메틸 포름아미드에 첨가한 후, 0.2 ml의 5% 소듐 아세테이트(w/v)를 반응용 촉매로서 첨가하였다. 이어서, 무수프탈산을 2:1 M비율로 덱스트란 용액에 첨가하였다. 반응을 24 시간 동안 40℃에서 질소와 함께 수행하여 PDN을 합성하고, PDN을 동결 건조하고 사용할 때까지 -20℃에서 저장하였다.
<실험예 1> PDN의 특성
실시예 1에서 제조된 PDN의 표면을 주사전자현미경(FE-SEM)(Carl Zeiss社, SUPRA 55VP-SEM)으로 측정하였다. 도 1의 (B)와 같이, PDN의 형태는 나노미터 스케일의 구형이었다.
또한, 입자 크기를 동적 광산란(DLS) 분광 광도계(Otsuka Electronics社, DLS-7000)로 측정하였다. 도 1의 (D)와 같이, PDN의 평균 크기는 0.220의 다분산 지수로 238.7 nm였다.
또한, PDN 중 프탈릴기의 양을 600 MHz 1H 핵자기 공명(NMR) 분광기(Bruker社, AVANCE 600)로 측정하였다. 도 1의 (C)와 같이, PDN 중 덱스트란 및 프탈산의 양성자는 각각 3.8 및 7.4-7.7 ppm인 것으로 확인되었다. 또한 PDN의 프탈릴기는 덱스트란기와 프탈릴기의 양성자의 총합을 기준으로 27.6mol%였다.
또한, 표면 전하(zeta potential)를 전기 영동 광산란 광도계(Otsuka Electronics社, ELS-8000)로 측정하였다. 도 1의 (D)와 같이, 표면 전하는 -27.32 Mv인 것으로 확인되었다. 이는 PDN의 프탈릴기 중의 카복실산에 기인한 것이다.
<실험예 2> PA에 PDN의 도입 특성 확인
실시예 1에서 제조된 PDN에 대하여, 페디오코커스 애시디락티시(Pediococcus acidilactici) KCTC 21,088 (PA) 도입 여부를 확인하였다.
(1) 배양 시간 별 도입 여부 확인
먼저, FITC(fluorescence isothiocyanate)가 표지된 PDN 및 덱스트란을 각각 준비하였다. FITC 5 mg과 DMSO 1 ml에 용해된 PDN 및 덱스트란을 각각 혼합한 후 어두운 곳, 상온에서 4시간 동안 교반하였다. 이후 반응물을 에탄올 10 ml에 떨어트려 미반응 FITC를 제거하고, FITC가 표지된 PDN(FITC-PDN) 및 덱스트란(FITC-덱스트란)을 각각 19,000 xg에서 10분 동안 원심분리하여 회수하였다. 이후 DAPI(4,6-diamidino-2-phenylindol, 2 ug/ml) 용액 200 ml를 처리하여 10분 동안 반응시켰다.
MRS 액상 배지 1 ml에서 배양된 상기 PA 2.0 x 105 CFU/ml에 0.5% (w/v) FITC-PDN 또는 FITC-덱스트란을 처리하고 37℃에서 3분, 5분 및 10분 배양하였다. PBS 1 ml로 3회 세척한 시료를 유세포분석기(flow cytometry)(BD Biosciences社, BD FACSCanto2) 및 공초점레이져현미경으로 측정하였고, 그 결과를 도 2에 나타내었다. FITC-PDN 또는 FITC-덱스트란은 녹색으로 표시되고, PA는 DAPI(4',6-디아미디노-2-페닐린돌)로 청색으로 염색되었다.
도 2의 (A)와 같이, FITC-PDN은 3분 이내에 PA에 도입되고 시간에 따라 도입 정도가 증가되는 것으로 확인되었다.
(2) 배양 온도 별 도입 여부 확인
PA에 FIIC-PDN 또는 FITC-덱스트란을 4℃, 25℃ 및 37℃에서 2시간 배양하는 것을 제외하고는, 실험예 2의 (1)과 동일한 방법으로 실험하였다,
도 2의 PDN의 도입은 25℃ 또는 4℃에서 배양 후보다 37℃에서 2 시간 동안 배양 후에 높은 것으로 확인되었다. 이로부터 PA에 PDN의 도입은 배양 온도의 증가에 따라 증가하는 에너지 의존적 메커니즘임을 알 수 있다.
(3) 운반체 별 도입 여부 확인
PDN을 세포내로 도입하는 운반체(transporter)를 확인하기 위해, PDN의 운반 차단제로 글루코스, 갈락토스 및 프럭토스를 사용하였다.
먼저, MRS 액상 배지 1 ml에서 배양된 상기 PA 2.0 x 105 CFU/ml에 37℃에서 10분 동안 10%(w/v)의 글루코스, 갈락토스 또는 프럭토스로 전배양한 후에, 0.5%(w/v) FITC-덱스트란 또는 FITC-PDN을 37℃에서 2 시간 동안 배양하였다. PBS 1 ml로 3회 세척한 시료를 유세포분석기(flow cytometry)(BD Biosciences社, BD FACSCanto2) 및 공초점레이져현미경으로 측정하였고, 그 결과를 도 2에 나타내었다.
도 2의 (A)와 같이, 글루코스 전배양은 PDN의 도입을 약 74.6%까지 방해하는 반면, 갈락토스 및 프럭토스 전배양은 PDN의 도입을 각각 약 55.1% 내지 46.8%까지 방해하는 것으로 확인되었다. 이로부터 PA로 PDN을 도입 시, 글루코스를 세포 내로 운반하는 운반체가 더 관여하는 것을 알 수 있었다.
<실험예 3> PA/PDN의 항균력
PDN의 도입에 따른 PA의 항균성이 변경되었는지 여부를 평가하기 위해, 살모넬라 갈리나륨(Salmonella Gallinarum), 에스체리치아 콜라이(Escherichia coli) K88, 에스체리치아 콜라이(Escherichia coli O157:H7) 등의 그람 음성 병원균 및 리스테리아 모노사이토제네스(Listeria monocytogenes) 등의 그람 양성 병원균에 대한 PA, 덱스트란으로 처리한 PA(PA/D) 및 PDN이 도입된 PA(PA/PDN)의 항균 활성 확인을 위한 공배양 시험 및 한천 확산 시험을 수행하였다.
이에 사용된 모든 박테리아 균주는 해당 배지에서 배양되었다: MRS 브로스 중 페디오코커스 애시디락시티(Pediococcus acidilactici)(PA), LB 브로스 중 그람 음성 살모넬라 갈리나륨(Salmonella Gallinarum), 에스체리치아 콜라이(Escherichia coli) K88, 및 에스체리치아 콜라이(Escherichia coli) O157:H7, 및 BHI 브로스 중 그람 양성 리스테리아 모노사이토제네스(Listeria monocytogenes).
그람 양성 및 그람 음성균을 진탕 배양기(255rpm)에서 37℃에서 배양하고 후속 실험에서 사용하거나 15% (v/v) 글리세롤에서 -70℃에서 저장하였다. 병원성 균주는 농업미생물은행(KACC)로부터 제공받았다.
공배양 시험을 위해, 1.0x106 CFU/ml의 상기 그람 음성 병원체를 진탕 배양기(255rpm)(호기 조건)에서 37℃에서 8 시간 동안 MRS 브로스에서 1.0x106 CFU/ml의 PA [0.5% (w/v) PDN 또는 덱스트란으로 또는 없이 처리]와 공 배양하였다. 그 다음 공배양 샘플을 MacConkey 한천 배지에 도말하였다.
한천 확산 시험을 위해, 상기 그람 음성 병원체(2.0x108 CFU/ml)의 120 μl를 LB 한천 플레이트 상에 도말하였다. 다음으로는, 종이 디스크를 병원체로 도말된 한천 상에 배치하고, 120 μl(2.0×108 CFU/㎖)의 PA [0.5% (w/v) PDN 또는 덱스트란으로 배양된]을 종이 디스크 상에 적하하였다. 37℃에서 20 시간 동안 배양한 후 억제 구역을 측정 하였다. 그람 양성 병원균의 경우, 1.0×105 CFU/ml의 PA 및 리스테리아 모노사이토제네스(Listeria monocytogenes)를 BHI 브로스로 지시한 후 공배양용 옥스포드 한천 상에 도말하였다. 한천 확산 시험에 BHI 한천을 사용하였다.
도 3의 (A) 내지 (D)와 같이, 공배양 시험에서, PA/PDN은 미처리 PA 또는 덱스트란 만으로 처리된 PA(PA/D)보다 그람 음성 및 양성 병원균 모두에 대해서 유의하게 높은 항균 활성을 나타내는 것으로 확인되었다.
또한, 한천 확산 시험에서, 성장 저해율을 억제 영역의 직경으로 산출하였다.
도 3의 (A) 내지 (D)와 같이, PA/PDN은 PA/D 또는 PA 단독보다 더 넓은 억제 영역을 나타내는 것으로 확인되었다.
이로부터 PA에 의한 PDN의 도입은 항균 활성을 유도하고 항균성 단백질의 생성에 영향을 미침을 알 수 있다.
<실험예 4> PA/PDN에 의한 페디오신 발현 및 정량 분석
(1) PA/PDN에 의한 페디오신 발현
PDN이 처리된 MRS 액상 배지에 PA를 투입한 후 37℃의 항온진탕기(255 rpm)에서 24시간 동안 배양하였다. 배양물을 4℃에서 3,000 xg로 30분 동안 원심분리하여 상층액을 분리한 후 상층액에 35 wt% 황산암모늄을 투입하여 30분 동안 교반시켰다. 단백질이 침전되면, 4℃에서 3,000 xg로 30분 동안 원심분리하였다. 상층액이 제거된 펠렛(pellet)에 PBS 완충액을 넣고 용해한 후 원심여과기(centrifugal filter)(Sigma-Aldrich社)로 정제하여 시료를 회수하였다. 시료를 PBS에서 하룻밤(o/n) 동안 투석하였다. 투석하여 얻은 단백질을 동결건조하여 4℃에서 보관하였다. 얻은 단백질을 시판중인 페디오신을 이용하여 SDS-PAGE로 확인한 결과 페디오신인 것으로 확인되었다.
(2) 페디오신 정량 분석
브래드포드법, 페디오신 활성 시험 및 정량적 실시간 PCR(qRT-PCR)으로 PA에 의한 페디오신의 생산을 정량 분석하였다.
1) 브래드포드 분석
PA에 아무것도 처리하지 않고 얻은 단백질(PA), PA에 덱스트란을 처리하여 얻은 단백질(PA/D), PA에 PDN을 처리하여 얻은 단백질(PA/PDN)의 양을 브래드포드법(Bradford assay)으로 정량화하여, 그 결과를 도 4에 나타내었다. 페디오신은 ASM 정제법을 사용하여 정제한 후 소혈청 알부민 표준 곡선을 사용하여 정량화하였다. 도 4의 (A)와 같이, PA/PDN에 의한 페디오신의 생산은 PA 및 PA/D보다 각각 2.2배 및 1.7배 높은 것이 확인되었다.
2) 페디오신 활성 분석
페디오신의 비활성을 측정하기 위해, 배양 상층액(pH 5.5)와 함께 인큐베이션한 후 리스테리아 모노사이토제네스(Listeria monocytogenes)의 억제 직경을 측정한 후 ml 당 임의단위(AU)로 표현하였다. 도 4의 (B)와 같이, PA/PDN은 PA 및 PA/D보다 각각 7.0배 및 5.8배 높은 페디오신 활성을 가지는 것으로 확인되었다.
3) 정량적 실시간 PCR
유전자 수준에서 PA에 의한 페디오신 생산을 검증하기 위해, 페디오신 생합성에 관여하는 유전자의 발현을 측정하기 위한 qRT-PCR을 수행하였다. 구체적으로, PA에 PDN 도입 후에 groEL, groES, dnaK 및 dnaJ 등 열충격 관련 유전자를 포함하는 스트레스 관련 유전자의 발현 수준을 측정하였다.
Thermo Fisher Scientific Inc.(Waltham, MA, USA)로부터 구입한 TRIzol® Max™ Bacterial RNA Isolation Kit를 사용하여 RNA 추출을 수행하였다. 전체 RNA 추출은 제조사의 지시에 따라 수행되었다.
RNA를 분리한 후, TOYOBO CO., LTD(Dojima, Osaka, Japan)로부터 구입한 ReverTra Ace® qPCR RT Master Mix와 gDNA 리무버를 사용하여 RNA 1 ㎍로부터 cDNA를 합성하였다.
원스텝 실시간 PCR 프로토콜을 사용하여 SYBR qPCR Mix로 RT-PCR을 수행하였다. 이때 사용한 프라이머 서열은 하기 표 1에 기재된 바와 같다.
유전자 프라이머 서열 (5’-3’) 크기(bp)
groEL F:GGTAACGGTCGCGTTTTAGAR:TTCAACGACTGCAACTAAGTCC 156
groES F:GGAAGACCTTGACGCAGAAGR:CGTTTTGAAGTGCTGAACGA 239
dnaK F:TTAACACGGGCACAATTTGAR:GCTTCGTCAGGGTTAATGGA 212
dnaJ F:GCCCAACTTGTGGTGGTACTR:CCAGTGCAGCTTGTACGAAA 240
16S F:GATGCGTAGCCG ACCTGAGAR:TCCATCAGACTTGCGTCCATT 113
상대적 정량화를 위해, 1 ng의 프라이머에 0.01 ng의 16S RNA Cdna의 발현량을 기준으로 각 유전자의 상대적 발현량을 ΔΔCt 방법을 사용하여 계산하였다.
표적 유전자 발현을 각 샘플에서 내부 대조군으로 사용된 16s rRNA 유전자의 상대적인 발현으로 정규화하였다. 데이터는 프로바이오틱스 대조군에 대한 상대적 배수 변화로 제시된다.
도 4의 (C)와 같이, 모든 4 개의 페디오신 생합성 유전자의 상대적 발현 수준은 PA 또는 PA/D보다 PA/PDN에서 더 높고, 특히 pedA 유전자의 발현은 미처리 PA보다 PA/PDN에서 유의하게 높은 것이 확인되었다(3.3배).
이로부터 PA에 의한 PDN의 도입은 페디오신 생산의 유도를 통해 PA의 항균 활성을 향상시켰음을 알 수 있다.
또한, 도 4의 (D)와 같이, PA/PDN에서의 groEL, groES, 및 dnaK 의 발현 수준은 PA 또는 PA/D에서보다 높은 것이 확인되었다. 특히, PA/PDN에서의 groEL 의 발현은 PA에서보다 유의하게 높았다(3.2배). 이로부터 PA에 의한 PDN의 도입은 PA의 스트레스 반응을 유도하였음을 알 수 있다.
<실험예 5> 동물 식이 실험
국제 윤리적 지침에 따라 5주령 BALB/C 수컷 마우스를 사용하여 동물 식이 실험을 수행하였다. 동물실험은 서울대학교 동물실험윤리위원회로부터 동물 실험(SNU-170,531-1-1) 승인을 받아 진행하였다.
마우스를 12 시간 명/암 주기로 제어 온도(22±2℃)에 수용시켰다. 동물에게 표준 생쥐 사료를 자유롭게 급여하고 항상 증류수를 제공하였다. 순응 7 일 후, 마우스를 4 개의 그룹(그룹당 10 BALB/C 마우스)으로 무작위로 할당하였다. 대조군은 이전과 같이 계속 먹이를 주었다. T1 그룹에는 식염수 용액 중 단일 용량의 108 CFU 페디오코커스 애시디락티시(Pediococcus acidilactici)(PA)를 경구 위관 영양법으로 투여하였다. T2 및 T3 그룹에는 각각 단일 용량의 덱스트란(0.5% w/v) 처리된 PA 또는 PDN (0.5% w/v) 처리된 PA가 투여되었다. 시험군에는 7 일 동안 시험 식을 지속적으로 투여하되, 시험 식이 6 일 후, E.coli O157 : H7 (109 CFU)를 3 일 동안 경구 위관 영양법을 통해 0.2 ml의 1% NaHCO3(E.coli O157 : H7을 투여하기 전에 30분간 처리)와 함께 투여하였다.
그룹 정의 동물
C E.coli O157:H7 10 BALB/C
T1 PA** + E.coli O157:H7 10 BALB/C
T2 PA/D*** + E.coli O157:H7 10 BALB/C
T3 PA/PDN**** + E.coli O157:H7 10 BALB/C
* E.coli O157:H7 : 0.1ml/BALB/C(마우스) (2 x 109 CFU)
**PA: 0.2ml/마우스(Pediococcus acidilactici 2 x 108 CFU)
***D: 0.5% w/v 덱스트란
****PDN: 0.5% w/v PDN
BALB/C: 마우스 품종
전체 실험 기간에 걸쳐 마우스의 체중 및 식품 섭취량을 매일 모니터링 하였다. PA 및 E.coli의 변화는 병원체 투여 1일로부터 시작하여, 매일 채취한 분변 시료(10 ㎎/㎖)을 이용하여 viable CFU를 측정함으로써 계수하였다. 구체적으로, 채취한 분변을 MRS 액상 배지 및 MacConkey 한천 배지에 도말한 후 37℃에서 20 시간 동안 배양한 후 CFU를 계수하였다. 실험 종료 시점에는 CO2를 이용하여 마우스를 안락사 시키고, 장 내 샘플 및 분변 시료를 수집하였다. 수집한 각 분변 시료는 생균수 측정 및 DNA 추출에 사용하였다.
<실험예 6> 생리적 변화
상기 실험예 5의 마우스 식이 실험 결과, 도 5의 (A)와 같이 PA/PDN 이 보충된 식이를 섭취한 T3 그룹은 7 일의 체중과 비교하여 13 일 후 체중이 증가했다. 특히, 7일과 비교하여 13일차에 대조군에서 체중이 감소한 반면, 체중은 T2 및 T3 그룹에서 증가하였다. 또한, 도 5의 (B)와 같이, PA/PDN 이 보충된 식이를 섭취한 T3 그룹의 동물 당 평균 사료 섭취량(feed intake)이 다른 그룹보다 높은 것으로 확인되었다.
시험 후 결장 길이(colon length)의 변화를 측정하였다. 결장 길이의 증가는 체중 증가와 양의 상관 관계가 있었다(상관비율: 0.408). 도 5의 (C)와 같이, PA/PDN 이 보충된 식이를 섭취한 T3 그룹은 다른 그룹에 비해 가장 긴 결장 길이를 가지는 것으로 확인되었다.
<실험예 7> 장내 미생물총에 대한 신바이오틱스 효과
실험예 5에서 얻은 각 분변 샘플을 분석하여 장내 미생물총의 변화를 확인하였다.
(1) 종 다양성 지표
각 분변 샘플의 종 다양성 지표(diversity index)로서 관찰된 OTU(observed OTU)를 확인하였다.
미생물총을 QIIME(Quantitative Insights Into Microbial Ecology) v1.9.1 소프트웨어를 사용하여 분석하였다. usearch61 방법(파라미터 설정: s 0.1)을 사용하여 OTU 피킹을 수행하였다. PyNAST를 사용하여 대표 서열을 정렬하였다. 대표 서열을 uclust 컨센서스 분류 체계 할당자를 사용하여 분류학적으로 할당하였다. OTU 테이블을 단일 희귀(single rarefaction)에 의해 샘플 당 16,660 개의 판독으로 표준화하고 추가 분석하였다.
알파 다양성 지수(OTU 관찰)를 10 회 반복의 희귀를 통해 샘플 당 16,660 개의 시퀀스 리드로부터 계산하였다. 주좌표 분석(PCoA)을 가중 UniFrac 거리에 기초하여 수행하고, 미생물총에 대한 치료 효과를 ANOSIM 통계 시험을 사용하여 평가하였다. 미생물 분류군의 풍부함을 총 16 개의 S rRNA 유전자 서열의 백분율로 표현하였다.
도 6의 (A)와 같이, 비가중 UniFrac 거리에 기초한 PCoA 는 마우스의 분변 미생물총이 처리 후 변경된 것으로 확인되었다. 특히, 대조군 및 T3 그룹은 서로 별개로 구별되었다.
또한, 도 6의 (B)와 같이, 관찰된 OTU의 수는 대조군, T1, T2 및 T3 그룹에 대해 각각 1692.0 (±171.8), 1798.0 (±155.3), 1866.0 (±229.5) 및 1946.0 (±163.4)이었다. 특히, PA/PDN 이 보충된 식이를 섭취한 T3 그룹은 대조군보다 유의적으로 가장 높은 미생물 다양성을 나타냈다.
(2) 분변 내 대장균 수
생균수 측정과 함께 특정 미생물에 특이적인 프라이머(primer)를 이용하여 정량적 PCR(qPCR)을 수행함으로써 분변 시료 내 특정 미생물의 양을 정량화하였다.
장내 집락 형성(colonization)을 추적하기 위해, E.coli 처리 시작일부터 매일 MacConkey 한천 배지 및 MRS 한천 배지 상에 분변 샘플을 플레이팅한 후 생균수 측정을 수행하여 그 결과를 도 6의 (C)에 나타내었다.
도 6의 (C)와 같이, E.coli O157:H7경구 투여 시작일에는, 4개의 마우스 그룹 모두의 분변에서 E. coli O157:H7에 의한 집락형성은 없었고, 하루 후 모든 처리구의 분변에서 평균적으로 대략 4 log10 (CFU/mg의 대변)의 E. coli 가 관찰되었다. 대조군의 경우 E. coli O157:H7를 경구 투여하는 5 일 동안, 분변 내 평균 E. coli 양은 유의하게 변경되지 않고 약 3.98 내지 3.69 log10 로 유지되었다. T1 및 T2 그룹에서도 E.coli O157:H7 세포수에 유의적 차이가 없었는데, T3 그룹에서는 2일째에, E. coli O157:H7의 생균수는 3.85에서 2.98 log10으로 감소한 것을 확인하였다.
실험 종료 시점에(5일차), E.coli O157:H7의 생균수는 대조군의 경우 3.69 log10, T1의 경우 3.00 log10, T2의 경우 2.80 log10, T3의 경우 1.57 log10로서, T3 그룹이 대조군과 유의하게 다른 것을 확인했다.
다음으로, E. coli O157:H7 특이적 마커인 인티민(intimin)을 이용한 Qpcr에 의한 생균수 측정 및 MRS 한천 배지를 이용하여 분변 내 유산균 함량을 검증하였다.
도 6의 (D)와 같이, 인티민 수준은 대조군(4.2배)에 비해 프로바이오틱스를 경구 투여한 3개의 그룹에서 유의하게 낮은 것으로 확인되었다(T1: 1.78배, T2: 2.05배, 및 T3: 0.95배), 즉, 프로바이오틱스의 급여가 장 내 병원균을 제거함을 알 수 있다. 매우 유의하지는 않지만, PA 공급 그룹(T1, T2, T3 그룹)의 페디오코커스 애시디락시티(Pediococcus acidilactici)의 양은 대조군(6.18 배)보다 약간 높았다(T1: 8.29배, T2: 6.20배, 및 T3: 7.24배).
(3) 병원성 미생물의 풍부도
AccuPrep® Stool DNA extraction kit(대한민국 대전시 바이오니아 제조)를 사용하여 각 분변 샘플 50 mg으로부터 제조사 프로토콜에 따라 DNA를 추출하고, 추가 분석까지 -20℃에서 저장하였다. 종 특이적 정량적 PCR을 위해, 사용된 프라이머는 하기 표 3에 기재된 바와 같고, qPCR은 전술한 방법으로 수행하였다.
유전자 프라이머 서열 (5'-3') 크기(bp)
ped A F: TGGCAAACATTCCTGCTCTGTR: CACCAGTAGCCCATGCCATAG 83
ped B F: ATTGCCAGCCAAGCGTTAGTR: GCCCCACCCTTTTTGAGAAT 102
ped C F: CCATATCGGTGAG TGCTGACAR: AGGAATAACGCCCCTGATGTT 104
ped D F: GGCCCATCTTCGACAGCTTR: GCACAGCTTCGGCATTTAAAT 101
16S F: GATGCGTAGCCG ACCTGAGAR: TCCATCAGACTTGCGTCCATT 113
dnaK F: TTAACACGGGCACAATTTGAR: GCTTCGTCAGGGTTAATGGA 212
dnaJ F: GCCCAACTTGTGGTGGTACTR:CCAGTGCAGCTTGTACGAAA 240
groEL F: GGTAACGGTCGCGTTTTAGAR: TTCAACGACTGCAACTAAGTCC 156
groES F: GGAAGACCTTGACGCAGAAGR: CGTTTTGAAGTGCTGAACGA 239
clpB F: CGGCAGCCAAGTTATCTAGCR: GCAGTGCCTTTAAGCGTTTC 219
Pediococcus acidilactici F: GTTCCGTCTTGCATTTGACCR: GGACTTGATAACGTACCCGC 449
Intimin F: CTCATGCGGAAATAGCCGTTA R: CATTGATCAGGATTTTTCTGGTGATA 102
Bifidobacterium spp F: GGTGTTCTTCCCGATATCTACAR: CTCCTGGAAACGGGTGG 549-563
Illumina MiSeq를 위해, 박테리아 16S rRNA유전자의 V4 영역을 Takara Ex Taq 폴리머라제(Takara Bio, Shiga, Japan) 및 515F-806 R 프라이머 페어를 사용하여 전체 추출 DNA로부터 증폭시켰다. 증폭 프로그램은 3분 동안 94℃에서 1 사이클, 45초 동안 94℃, 1분 동안 55℃, 및 1.5 분 동안 72℃에서 40 사이클, 그리고 마지막으로 10분 동안 72℃에서 1 사이클로 구성되었다.
DNA 라이브러리를 Illumina TruSeq DNA 샘플 준비 키트를 사용하여 구축하고, 앰플리콘의 페어드 엔드 시퀀싱(2x300 bp)을 Illumina MiSeq(대한민국 서울 마크로젠社 제조) 상에 완료시켰다. 확인된 16S rRNA유전자 서열을 NCBI Sequence Read Archive(SRA) 데이터베이스에 수납하였다.(accession number: SRR7867415).
16S rRNA 유전자 서열을 증폭한 뒤 Illumina Miseq 시퀀싱을 통해 대량 시퀀싱한 결과로부터 장내 미생물의 상대적 풍부도를 파악하였다.
그 중 병원성 미생물이 다수 속한 대표적인 문(phylum)인 프로박테리아(Proteobacteria)의 분변 균총 내 상대적 풍부도가, 도 6의 (E)와 같이, T3 그룹에서 가장 낮은 것으로 확인되었다. 이러한 결과로부터 PA/PDN의 공급은 덱스트란 자체 또는 PA 단독 공급보다 PA의 항균 활성을 개선하여 병원균을 억제하였음을 알 수 있다.
(4) 유익균의 함량
분변 내 대표적인 유익균인 유산균의 함량을 측정하기 위해 분변 내 유산균(LAB)의 양을 CFU기반으로 측정하였고, 또한 분자유전학적으로 비피도박테리움(Bifidobacterium spp.)에 특이적인 상기 표 3에 기재된 프라이머를 이용하여 정량화하였다,
도 6의 (G)와 같이, 비피도박테리움(Bifidobacterium spp.)의 함량은 대조군보다 T2 및 T3에서 더 높은 것으로 확인되었다.
또한, 도 6의 (F)와 같이, 유산균(LAB)의 CFU는 T1, T2, T3 그룹이 모두 대조군보다 높은 것으로 확인되었다. 이러한 결과로부터 PA/PDN의 공급은 덱스트란 자체 또는 PA 단독 공급보다 PA의 항균 활성을 더 개선하였음을 알 수 있다.
종합적으로, PA/PDN는 유해균인 프로박테리아(Proteobacteria)를 억제할 뿐만 아니라 미생물 다양성, 풍부성 및 일부 유익한 박테리아 수준의 증가와 같은 방식으로 장 미생물총을 조절함을 알 수 있다.
<실시예 2> PPN의 합성
본 발명에 사용된 풀루란은 산동 프레다 바이오테크놀로지(Shandong Freda Biotechnology Co., Ltd.) (중국 산둥 소재)로부터 구입하였고, 다른 화학 물질은 시그마-알드리치(Sigma-Aldrich) (미국 미주리주 세인트루이스 소재)에서 구입하였다. 박테리아 배양을 위한 리소게니 브로스(LB), LB 한천, MRS 브로스, MacConkey 한천 배지 및 뇌 심장 주입(BHI) 브로스는 BD Difco (Sparks, MD, 미국)에서 구입했다.
도 7과 같이, 풀루란 중의 히드록실기와 프탈산 중의 카르복실산이 에스테르 결합을 하여 소수성 프탈릴기가 풀루란에 도입된 프탈릴 풀루란 나노입자(PPN)을 제조하였다.
구체적으로, 풀루란 1g을 10ml의 디메틸포름아미드(DMF)에 용해시키고, 풀루란 당 잔류물 당 0.1mol% 디메틸 아미노피리딘을 촉매로서 용액에 첨가한 다음, 무수프탈산을 상이한 몰비로 상기 용액에 첨가하여 프탈릴기 치환도가 다른 PPN을 생산하였다: 6:1(무수프탈산:플루란)(PPN1로 명명), 9:1 (무수프탈산:플루란)(PPN2로 명명), 및 12:1(무수프탈산:플루란)(PPN3으로 명명)
상기 반응은 54℃에서 48 시간 동안 질소 하에서 수행하였다. 생산한 PPN은 DMF 중에서 먼저 투석하여 미반응 무수프탈산을 제거한 다음 24시간 동안 4℃에서 증류수에 두어 프탈릴 풀루란의 자기 조립 나노입자를 형성하였다. 제조한 PPN의 초원심분리 후에 미반응 풀루란은 제거되었다. 마지막으로, PPN을 동결건조하고 사용시까지 -20℃에서 보관하였다.
<실험예 8> PPN의 특성
실시예 2에서 제조된 PPN의 표면을 주사전자현미경(FE-SEM)(Carl Zeiss社, SUPRA 55VP-SEM)으로 측정하였다. 도 8의 (D)와 같이 PPN3는 나노미터 사이즈의 구형인 것으로 확인되었다.
또한, 입자 크기를 동적 광산란(DLS) 분광 광도계(Otsuka Electronics社, DLS-7000)로 측정하였다. 도 8의 (C)와 같이 DLS 측정 결과 나노입자의 사이즈는 PPN1, PPN2, 및 PPN3가 각각 140.0, 108.9 및 82.1 nm이었다. 이로부터 입자 크기가 풀루란 중의 결합된 프탈산기 수의 증가에 따라 감소함을 알 수 있다.
또한, PPN 중 프탈릴 부분의 치환도를 1H-NMR 분광기로 확인하고, 당 양성자(α-1,6 및 α-1,4 글리코시드 결합의 C1위치, 각각 4.68 및 5.00 ppm)에 대한 프탈산 양성자(7.4-77 ppm)의 비를 결정하여 계산하였다. 프탈산의 치환도에 따라, PPN을 다음과 같이 명명하였다: PPN1(DS: 30.90 mol%), PPN2(DS: 50.45 mol%) 및 PPN3(DS: 68.50 mol%).(도 8의 (A))
또한, 표면 전하(zeta potential)를 전기 영동 광산란 광도계(Otsuka Electronics社, ELS-8000)로 측정하였다. 도 8의 (B)와 같이, PPN1, PPN2, 및 PPN3의 표면 전하는 각각 -38.09, -38.45 및 -33.84 mV이었다. 프탈산기 중 미반응 카르복실기로 인해, PPN은 음의 제타 전위를 나타냈다.
<실험예 9> PPN의 LP 도입 특성 확인
실시예 2에서 제조된 PPN에 대하여, LP 177 도입 여부를 확인하였다.
(1) PPN의 LP 도입 여부 확인
먼저, FITC(fluorescence isothiocyanate)가 표지된 PPN(FITC-PPN) 및 풀루란(FITC-풀루란)을 각각 준비하였다.
먼저, 5 mg의 FITC를 100 ml PPN 또는 2 ml 디메틸 설폭사이드(DMSO)에 용해된 풀루란과 혼합하였다. 실온에서 불투명 튜브에서 4 시간 동안 교반한 후, 증류수로 24 시간 동안 4℃에서 투석하였다. 마지막으로, FITC 표지가 표지된 PPN(FITC-PPN) 및 풀루란을 동결건조하여 사용 시까지 -20℃에서 보관하였다.
MRS 액상 배지 1 ml에서 배양된 상기 LP 177 (2.0x106 CFU/ml)에 0.5 % (w/v) FITC-PPN 또는 FITC-풀루란을 처리하고, 2 시간 동안 37℃에서 배양하였다. PBS 1 ml로 3회 세척한 시료를 유세포분석기(flow cytometry)(BD Biosciences社, BD FACSCanto2) 및 공초점레이져현미경으로 측정하였고, 그 결과를 도 9에 나타내었다. 샘플을 PBS로 세척하고, 유세포분석기 및 공초점 레이저 주사 현미경(CLSM) (SP8X STED 라이카, Wetzlar, 독일)으로 분석하였다.
도 9와 같이, CLSM 결과 FITC-PPN 및 FITC-풀루란은 2시간 동안 37℃로 배양 후 LP로 도입된 것이 확인되었다.
PPN이 세포 표면에 위치하는지 또는 LP에 도입되었는지를 추가로 확인하기 위해, LP를 FITC-PPN3으로 처리하고 FITC-PPN3의 위치를 CLSM의 Z-섹션 모드로 확인하였다.
도 9와 같이, FITC 및 DAPI 의 형광 강도는 LP의 중심에서 가장 높았으며, 이로부터 LP에 PPN이 도입된 것이 확인되었다.
또한, 다당류 나노입자의 미생물 내 도입 위치를 파악하기 위한 또 다른 방법으로 네거티브 컨트롤(negative control)로서 막 결합 염료(FM4-64)를 이용하여 세포막을 염색한 뒤 FITC-PPN3의 FITC 형광 세기 및 위치를 확인하였다. 그 결과, 도 10과 같이 FITC 형광의 세기는 LP의 중심에서 최대이고, FITC 형광이 박테리아 내에 나타난 것을 확인하였다.
(2) 배양 온도 별 도입 여부 확인
LP에 PPN3의 도입이 온도 의존적인지를 결정하기 위해, LP의 세 개의 별도 배양물을 0.5% (w/v) FITC-PPN3로 처리한 후 4, 20 및 37℃에서 2 시간 동안 배양하였다. 또한 샘플을 PBS로 세척하고 유세포 분석기(FACS) 및 CLSM으로 분석하였다.
도 11의 (B)와 같이, LP에 PPN3의 도입은 37℃에서 가장 높았으며, 이로부터 PPN3의 도입이 에너지 의존적임을 알 수 있다.
(3) 운반체 별 도입 여부 확인
PPN을 세포내로 도입하는 운반체(transporter)를 확인하기 위해, PPN의 운반 차단제로 글루코스, 갈락토스, 프럭토스 및 PPN3를 사용하였다.
먼저, MRS 액상 배지 1 ml에서 배양된 상기 LP (2.0x106 CFU/ml)에 37℃에서 10분 동안 10%(w/v) 글루코스, 갈락토스, 프럭토스 또는 PPN3로 전배양한 후 0.5% (w/v) FITC-PPN3로 처리하였다. PBS 1 ml로 3회 세척한 시료를 유세포분석기(flow cytometry)(BD Biosciences社, BD FACSCanto2) 및 공초점레이져현미경으로 측정하였고, 그 결과를 도 9에 나타내었다.
도 9의 (B)와 같이, 갈락토스 전배양은 PPN의 도입을 약 40%까지 방해하는 것으로 확인되었다. 이로부터 LP로 PPN을 도입 시, 갈락토스를 세포 내로 운반하는 운반체가 더 관여하는 것을 알 수 있다.
<실험예 10> LP/PPN의 항균력
PPN의 도입에 의해 LP의 항균성이 변경되었는지 여부를 평가하기 위해, E. coli K99 및 리스테리아 모노사이토제네스(Listeria monocytogenes) (LM)을 대표적인 그람 음성 및 그람 양성 병원균에 대한 LP, 풀루란으로 처리한 LP(LP/풀루란) 및 PPN이 도입된 LP(LP/PPN)의 항균 활성 확인을 위한 공배양 시험 및 한천 확산 시험을 수행하였다. MRS 브로스에 LP177을 배양하고, LB 브로스에 E. coli K99을 배양하고, BHI 브로스에 LM을 배양하였다.
모든 박테리아 배양물을 진탕 배양기(250 rpm)에서 24시간 동안 37℃로 배양한 후 실험을 진행하거나 사용시까지 15% 글리세롤 중에서 -70℃에서 저장하였다.
E. coli 에 대한 LP의 항균 활성을 공배양 시험으로 비교하기 위해, 2.0x106 CFU/ml의 E. coli를 진탕 배양기(250 rpm)(호기 조건)에서 37℃에서 8시간 동안 MRS 브로스 중에서 0.5% (w/v) PPN 또는 풀루란으로 처리하거나 처리하지 않은 2.0x105 CFU/ml LP와 공배양하였다. 항균 활성을 E. coli의 생존률로 결정하였다. 공배양 시료를 MacConkey 한천 배지에 도말하고 37℃에서 24시간 동안 배양시키고, E. coli 콜로니의 수를 계수하였다.
또한, LM에 대한 LP의 항균 활성을 공배양 시험으로 측정하였다. LP 및 LM을 BHI 브로스 중에서 상기한 유사한 조건 하에 공배양하였다.
도 12의 (A) 및 (C)와 같이, E. coli 및 LM에 대한 미처리된 LP 또는 LP/P보다 LP/PPN 그룹의 항균 활성이 더 높았다. 또한, 나노입자의 크기가 작아질수록 LP의 항균력이 더 강해지는 것이 관찰되었다.
PPN 단독으로 항균 활성을 갖는지 여부를 결정하기 위해, 대장균 및 LM을 PPN으로 처리하였다. PPN 단독으로는 항균 활성이 나타나지 않았으며(데이터는 도시하지 않음), 이로부터 다당류 나노입자가 자체적으로 항균 활성의 기능이 있는 것이 아니라 프로바이오틱스인 LP에 도입됨으로써 프로바이오틱스의 항균 활성이 증대되도록 유도함을 알 수 있다.
한천 확산 시험으로 LP/PPN의 항균력을 확인하였다.
종이 디스크를 E. coli 스프레드 플레이트 상에 배치한 후 0.5% (w/v) PPN 및 풀루란으로 처리하거나 처리하지 않은 LP의 120 μl 8시간 배양된 LP 배지를 종이 디스크 상에 적하하였다. 실온에서 건조 후, 플레이트를 37℃에서 밤새 배양시켰다. E. coli 성장의 억제 영역을 항균 활성을 직접적인 측정치로 사용하였다. 동일한 방식으로 BHI 한천 플레이트 상의 LM 성장에 대한 0.5% (w/v) PPN 또는 풀루란으로 처리하거나 처리하지 않은 LP의 억제 효과를 시험하였다. 마지막으로, 공배양된 샘플을 옥스포드 한전 상에 도말하고, LM 콜로니의 수를 계수하였다.
도 12의 (B) 및 (D)와 같이, 나노입자의 사이즈가 82.1 nm로 가장 작은 PPN3으로 처리할 때 억제 영역이 상대적으로 가장 큰 것으로 확인되었다.
이로부터 LP에 의한 PPN의 도입은 항균성 단백질의 생성에 영향을 미쳐 항균 활성을 유도함을 알 수 있다.
LP가 단백질인 플란타리신을 통해 항균 활성을 발휘하는지를 확인하기 위해, 배양 배지를 1 mg/ml 프로테이나제 K로 처리하고 37℃에서 2시간 동안 배양한 후, E. coli 및 LM에 대한 LP의 한천 확산 시험을 상기한 프로토콜과 동일하게 수행한 다음, 각각의 배양 상층액을 30 분 동안 100℃에서 가열하였다. 도 13의 (C) 및 (D)과 같이, 프로테이나제 K 처리 그룹의 항균 활성은 미처리 그룹과 비교하여 유의하게 감소한 것으로 확인되었다. 이로부터 프로테이나제 K에 의해 플란타리신이 분해되었음을 알 수 있다.
<실험예 11> LP/PPN에 의한 플란타리신 발현 및 정량 분석
(1) LP의 생장 및 젖산 생산에 대한 PPN의 효과
PPN 또는 풀루란으로 처리한 후 LP의 성장을 시험하기 위해, 상이한 시점에서 세포 콜로니를 계수하였다. 도 13의 (A)와 같이, PPN 또는 풀루란 처리의 유무에 따른 LP 성장 차이는 없는 것으로 확인되었다.
PPN 또는 풀루란으로 처리한 후 LP 의 배양 배지의 pH를 또한 측정하여 젖산 생성을 평가하였다. 도 13의 (B)와 같이, PPN 또는 풀루란으로 처리하거나 처리하지 않거나 LP의 pH 곡선은 그룹 간에 유의한 변화를 나타내지 않는 것으로 확인되었다. 따라서 LP에 PPN의 도입은 LP의 성장에 부정적인 영향을 미치지 않음을 알 수 있다.
(2) LP/PPN에 의한 플란타리신 발현
PPN이 처리된 MRS 액상 배지에 LP를 투입한 후 37℃의 항온진탕기(255 rpm)에서 24시간 동안 배양하였다. 공배양된 배지로부터의 상층액을 실온에서 2 시간 동안 황산암모늄 설페이트(80% 포화)와 함께 교반하였다. 원심 분리에 의해 회수된, 침전 단백질을 시트르산 포스페이트 완충액(50 mM)에 용해시키고 투석(1 kDa 컷오프 멤브레인, 스펙트럼 랩, 미국)으로 탈염시켰다. 단백질을 동결 건조하고 추가 분석을 위해 4℃에서 보관하였다. 얻은 단백질을 시판중인 플란타리신과 함께 SDS-PAGE로 확인한 결과, 분자량은 2.5 내지 6.5 kDa의 플란타리신이었다.
도 13의 (F)와 같이, LP/PPN 그룹에서 동일한 단리 조건 하의 LP 및 LP/P 그룹에 비해 플란타리신 생산이 증가되었음이 확인되었다.
<실험예 12> 정량적 실시간 PCR
mRNA 수준에서 PPN 처리된 LP에 의한 플란타리신의 생산을 평가하기 위해, PPN 처리된 LP에서의 플란타리신 mRNA 의 발현 수준을 qRT-PCR을 사용하여 미처리된 LP의 발현 수준과 비교하였다.
Thermo Fisher Scientific Inc.(Waltham, MA, USA)로부터 구입한 TRIzol® Max™ Bacterial RNA Isolation Kit를 사용하여 RNA 추출을 수행하였다. 전체 RNA 추출은 제조사의 지시에 따라 수행되었다.
RNA를 분리한 후, TOYOBO CO., LTD(Dojima, Osaka, Japan)로부터 구입한 ReverTra Ace® qPCR RT Master Mix와 gDNA 리무버를 사용하여 RNA 1 ㎍로부터 cDNA를 합성하였다.
원스텝 실시간 PCR 프로토콜을 사용하여 SYBR qPCR Mix로 RT-PCR을 수행하였다. 프라이머 서열은 하기 표 4에 기재된 바와 같다.
유전자 프라이머 서열 (5’-3’) 크기(bp)
planS F:GCCTTACCAGCGTAATGCCCR:CTGGTGATGCAATCGTTAGTTT 450
dnaK F:ATTAACGGACATTCCAGCGGR:TTGGCCTTTTTGTTCTGCCG 600
dnaJ F:GGAACGAATGGTGGCCCTTA R:CTAGACGCACCCACCACAAA 474
상대적 정량화를 위해, 1 ng의 프라이머에 0.01 ng의 16S RNA cDNA를 사용하였다.
상대적 유전자 발현은 -2ΔΔCt 방법을 사용하여 계산되었다.
플란타리신 유전자 planS를 선택하고, 16S rRNA을 정규화에 사용하였다. 도 13의 (E)와 같이, 8시간 동안 PPN 또는 풀루란으로 처리 후, planS의 발현 수준은 미처리 또는 풀루란 처리된 LP보다 PPN처리된 LP에서 더 높아 planS의 발현은 PPN 처리된 LP의 항균 활성을 향상시켰음이 확인되었다.
이전의 연구에서, PA에 도입된 이눌린 나노 입자는 PA에서 스트레스 반응을 유도하는 것으로 밝혀졌다(Cui et al., 2018 ; Kim et al., 2018). LP에서 유사한 거동이 발생하는지 확인하기 위해, 열충격 단백질 dnaK 및 dnaJ 등 스트레스와 관련된 유전자의 발현 수준을 측정했다. 도 14의 (A) 및 (B)와 같이, PPN 또는 풀루란으로 8시간 동안 처리 후, dnaK 및 dnaJ의 발현 수준은 미처리된 LP에서 보다 PPN 처리된 LP에서 유의하게 높은 것으로 확인되었다. 이로부터 LP에 PPN의 도입이 스트레스 반응을 유도했음을 알 수 있다.
<실험예 13> 동물 식이 실험
국제 윤리적 지침에 따라 5주령 BALB/C 수컷 마우스를 사용하여 동물 식이 실험을 수행하였다. 동물실험은 서울대학교 동물실험윤리위원회로부터 동물 실험(SNU-170,531-1-1) 승인을 받아 진행하였다.
마우스를 12 시간 명/암 주기로 제어 온도(22±2℃)에 수용시켰다. 동물에게 표준 생쥐 사료를 자유롭게 급여하고 항상 증류수를 제공하였다. 순응 7 일 후, 마우스를 5 개의 그룹으로 무작위로 할당하였다. 시험군 T1 내지 T5에는 시험 식이 5일 경과 전 3일 동안 항생제를 처리하여 장내 불균형(Dysbiosis)를 유도하여 병원균 감염에 취약한 상태에서 병원균 E. coli K99로 감염시켰다. 항생제로 암피실린, 젠타마이신, 네오마이신 및 반코마이신암의 혼합물(암피실린:젠타마이신:네오마이신:반코마이신=2:2:2:1 (20mg/마우스))을 사용하였다. 대조군은 이전과 같이 계속 먹이를 주었다. T2 그룹에는 식염수 용액 중 단일 용량의 108 CFU 락토바실러스 플랜타럼(Lactobacillus plantarum) (LP)를 경구 위관 영양법으로 투여하였다. T3 및 T4 그룹에는 각각 단일 용량의 플루란(0.5% w/v)과 LP 혼합 제형 또는 PPN (0.5% w.v)과 LP 혼합 제형이 투여되었다. 또한 T5 그룹에는 단일 용량의 풀루란(0.5% w/v) 및 PPN(0.5% w/v) 처리된 LP가 투여되었다. 시험군에는 7 일 동안 시험 식을 지속적으로 투여하되, 시험 식이 6 일 후, E.coli K99: 0.2ml/마우스 (1x109 CFU)를 3 일 동안 경구 위관 영양법을 통해 0.2 ml의 1% NaHCO3(E. coli K99을 투여하기 전에 30분간 처리)와 함께 투여하였다.
그룹 정의 동물
C 미처리 6 BALB/C
T1 항생제-E.coli K99* 6 BALB/C
T2 항생제-E.coli K99―LP** 6 BALB/C
T3 항생제-E.coli K99 LP/P*** 6 BALB/C
T4 항생제-E.coli K99 LP/PPN**** 5 BALB/C
T5 항생제-E.coli K99 LP/P/PPN 5 BALB/C
* E.coli K99: 0.2ml/마우스 (1x109 CFU)
**LP: 0.2ml/마우스 (Lactobacillus plantarum 1x108 CFU)
***P: 0.5% w/v 풀루란
****PPN: 0.5% w/v PPN
항생제: 암피실린, 젠타마이신, 네오마이신 및 반코마이신암의 혼합물
(암피실린:젠타마이신:네오마이신:반코마이신=2:2:2:1 (20mg/마우스))
전체 실험 기간에 걸쳐 마우스의 체중 및 식품 섭취량을 매일 모니터링하였다. 병원체 투여 1일로부터 시작하여, 일일 분변 시료(10 ㎎/㎖)로부터 viable CFU로서 LP 및 E.coli를 계수하였다. 분변을 MRS 한천 및 MacConkey 한천 배지 모두에 도말한 후 37℃에서 20 시간 동안 배양하였다. 실험 종료 시점에는 마우스를 CO2로 안락사 시켰다.
장으로부터 장내 샘플 및 분변을 수집하여 생균수 측정 및 미생물총 분석에 사용하였다.
<실험예 14> 생리적 변화
마우스 식이 실험 결과, 도 15의 (A)와 같이, LP/풀루란/PPN 조합으로 보충된 T5 그룹의 경우 체중이 가장 많이 증가한 반면, 프로바이오틱스만을 처리한 T2 그룹의 경우 14일째 체중이 12일과 비교하여 감소되었다.
또한, 도 15의 (B)와 같이, 신바이오틱스가 보충된 T4 및 T5 그룹의 동물 당 평균 식이 섭취량이 가장 높은 것으로 확인되었다.
시험 후 결장 길이의 변화를 측정하였다. 결장 길이의 증가는 체중 증가와 양의 상관 관계가 있었다(상관비율: 0.408). 도 15의 (C)와 같이, LP/PPN 조합으로 보충된 T4 그룹은 다른 그룹에 비해 가장 긴 결장 길이를 가졌고, 프로바이오틱스 또는 신바이오틱스가 보충된 T2, T3, T4 및 T5 그룹은 프로바이오틱스 또는 신바이오틱스가 보충되지 않은 T1 그룹과 비교하여 더 긴 결장 길이를 갖는 것으로 확인되었다.
맹장 무게도 측정하였다. 도 16과 같이, E. coli K99만 투여하고 프로바이오틱스 또는 신바이오틱스가 보충되지 않은 T1 그룹은 가장 큰 맹장 무게를 갖는 반면, 프로바이오틱스 또는 신바이오틱스가 보충된 T2 내지 T5 그룹은 맹장 무게가 C 그룹에 더 가까운 수준으로 낮았다.
장 장벽 기능은 장 박테리아, 독소 및 그람 음성 박테리아 LPS와 같은 유해 물질이 다른 조직 또는 전신 순환계로 유입되는 것을 방지함으로써 정상적인 장 기능을 유지하는데 중요한 역할을 한다.
도 17과 같이, 프로바이오틱스 또는 신바이오틱스가 보충되지 않은 T1 그룹의 혈중 내독소 수준(serum LPS level)이 가장 높았고, 프로바이오틱스 또는 신바이오틱스가 보충된 그룹들, 특히 LP/PPN 및 LP/P/PPN을 각각 투여한 T4 그룹 및 T5 그룹의 혈중 내독소 수준이 낮은 것으로 확인되었다.
<실험예 15> 장내 미생물총에 대한 신바이오틱스 효과
실험예 13에서 얻은 각 분변 샘플을 분석하여 장내 미생물총의 변화를 확인하였다.
(1) 종 다양성 확인
상기 실험예 7에 기재된 방법과 동일하게 각 분변 샘플의 종 다양성 지표(diversity index)로서 관찰된 OTU를 확인하였다.
특히, 장 미생물총의 다양성에 대한 PPN 및 프로바이오틱스의 효과를 조사하기 위해, PPN 처리(C, T1, T2, T3 대 T4, T5) 또는 프로바이오틱스 처리(C, T1 대 T2, T3, T4, T5)로 그룹을 재조직한 뒤, 종 다양성 지표에 차이가 있는지 확인하였다. 흥미롭게도, PPN 처리 시 또는 프로바이오틱스 처리 시 관찰된 OTU가 더 높았다. 또한, 도 20의 (A)와 같이, 관찰된 OTU는 T1, C, T2, T3, T4 및 T5의 순서로 높아지는 것으로 확인되었다.
비가중 및 가중 UniFrac 거리에 기초한 주좌표 분석(PCoA) 결과 장 미생물총이 병원균 감염 및 프로바이오틱스 혹은 신바이오틱스 처리에 따라 그룹화가 되는 것을 확인하였고, Adonis 시험(비가중: R2 = 0.2798, P <0.001; 가중: R2 = 0.8418, P <0.001)에 의해 유의한 영향임이 확인되었다(도 18 및 19).
(2) 분변 내 대장균 수의 확인
생균수 측정 및 정량적 PCR(qPCR)을 사용하여 분변 시료로부터 특이적 미생물의 양을 정량화하였다.
처리해준 E. coli와 유산균의 장내 정착을 추적하기 위해서 E. coli 및 유산균(LAB)의 생균수를 각각 MacConkey 한천 배지 및 MRS 한천 배지 상에 대변 샘플을 플레이팅하여 평가하였다. 도 20의 (B)와 같이, E.coli 세포의 생균수는 대략 3 내지 4 log10(대변의 CFU/mg)인 프로바이오틱스 또는 신바이오틱스로 처리된 다른 그룹과 비교하여 T1 그룹에서 대략 7 log10 (대변의 CFU/mg)로 더 높고, T4 및 T5 그룹은 T2 및 T3에 비해 E. coli 생균수가 가장 낮은 것이 확인되었다. 이로부터 T4 및 T5 그룹에 급여된 PPN은 E. coli의 항균 능력을 유도함을 알 수 있다.
LAB의 생균수를 MRS 한천 플레이트상에서 평가하였다. 도 20의 (D)와 같이, C 그룹에서 LAB의 생균수는 대략 3-4 log10(대변의 CFU/mg)인 반면, 프로바이오틱스 또는 신바이오틱스 처리된 그룹(T2, T3, T4 및 T5)에서 LAB의 생균수는 대략 5-6 log10(대변의 CFU/mg)인 것으로 확인되었다. T1 그룹은 단지 2~3 log10(대변의 CFU/mg) 만이 존재하였으며, 이로부터 항생제 치료에 의해 장 미생물총이 확실히 파괴되고, 프로바이오틱스 및 신바이오틱스 처리에 의해 회복됨을 알 수 있다.
(3) 병원성 미생물의 풍부도
병원체의 공격, 프로바이오틱스 및 신바이오틱스 처리에 의한 장 미생물총의 변화에 주요하게 반응한 미생물 분류군을 확인하기 위해, 일원 분산 분석(one-way ANOVA)을 수행하여, 몇 개의 문과 속을 확인하였다. 특히, 도 20의 (C)와 같이, 문 수준에서 프로테오박테리아(Proteobacteria)는 C 그룹보다 T1 그룹이 더 풍부했으며 T2, T3, T4 및 T5 그룹에서는 유의하게 감소한 것으로 확인되었다. 이러한 결과로부터 병원균 감염에 의해 증가한 프로박테리아(Proteobacteria) 수준을 프로바이오틱스 및 신바이오틱스 처리로써 정상적인 상태로 되돌릴 수 있음을 알 수 있다.
(4) 유익균의 함량
분변 내 대표적인 유익균인 유산균(LAB)을 CFU 계수로 확인하고 비피도박테리움(Bifidobacterium spp.) 특이적 마아커(marker)를 이용해 측정하였다,
도 20의 (F)와 같이, 비피도박테리움(Bifidobacterium spp.)은 LP/PPN을 공급한 T4 및 T5에서 유의하게 더 풍부한 것으로 확인되었다.
또한, 도 20의 (E)와 같이, 유산균(LAB)의 함량은 다른 그룹보다 T4 및 T5에서 더 풍부하였다.
종합적으로, LP/PPN는 프로박테리아(Proteobacteria)를 억제하는 등 병원체 감염의 영향을 억제할 뿐만 아니라 미생물 다양성, 풍부성 및 일부 유익한 박테리아 수준의 증가와 같은 방식으로 장 미생물총을 조절함을 알 수 있다.

Claims (13)

  1. 프로바이오틱스로서 유산균 균주 및 프리바이오틱스로서 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물.
  2. 제1항에 있어서,
    상기 유산균은 페디오코커스 펜토사세우스(Pediococcus pentosaceus), 또는 페디오코커스 애시디락티시(Pediococcus acidilactici), 락토바실러스 락티스 속(Lactobacillus lactis subsp.) 또는 락토코커스 락티스(Lactococcus lactis), 및 락토바실럭스 플란타럼(Lactobacillis plantarum)으로 이루어진 군으로부터 선택되는 1종 이상의 유산균인 것인 장내 균총 개선용 신바이오틱스 조성물.
  3. 제1항에 있어서,
    상기 유산균은 항균성 단백질을 생산하는 것인 장내 균총 개선용 신바이오틱스 조성물
  4. 제3항에 있어서,
    상기 항균성 단백질은 페디오신(pediocin), 니신(nisin), 플란타리신(plantaricin) 및 플란타신(plantacin)으로 이루어진 군으로부터 선택되는 1종 이상의 항균성 단백질인 것인 장내 균총 개선용 신바이오틱스 조성물.
  5. 제1항에 있어서,
    상기 다당류는 소수성 잔기를 가짐으로써 친수성 용매에서 소수성 효과에 의해 자기 조립(self-assembly)되어 나노입자화되는 것인 장내 균총 개선용 신바이오틱스 조성물.
  6. 제5항에 있어서,
    상기 소수성 잔기는 아세테이트, 프로피오네이트, 부틸레이트, 프탈레이트, 콜레스테롤, 메르캅토숙신산 및 메틸 글루타르산으로 이루어진 군에서 선택되는 1종 이상의 소수성 잔기이고,
    상기 다당류는 셀룰로오스, 이눌린, 풀루란, 전분, 덱스트란 및 펙틴으로 이루어진 군에서 선택되는 1종 이상의 다당류인 것인 장내 균총 개선용 신바이오틱스 조성물.
  7. 제1항에 있어서,
    상기 유산균 균주와 상기 다당류 나노입자가 배합된 제형인 것인, 장내 균총 개선용 신바이오틱스 조성물.
  8. 제1항 또는 제7항에 있어서,
    상기 유산균은 페디오코커스 애시디락티시(Pediococcus acidilactici)이고, 상기 다당류 나노입자는 프탈릴 덱스트란 나노입자(PDN)인 것인 장내 균총 개선용 신바이오틱스 조성물.
  9. 제1항 또는 제7항에 있어서,
    상기 유산균은 락토바실럭스 플란타럼(Lactobacillis plantarum)이고, 상기 다당류 나노입자는 프탈릴 풀루란 나노입자(PPN)인 것인 장내 균총 개선용 신바이오틱스 조성물.
  10. 제1항 내지 제7항 중 어느 한 항의 장내 균총 개선용 신바이오틱스 조성물을 포함하는 사료 첨가제.
  11. 제1항 내지 제7항 중 어느 한 항의 장내 균총 개선용 신바이오틱스 조성물을 포함하는 건강기능식품 첨가제.
  12. 제1항 내지 제7항 중 어느 한 항의 장내 균총 개선용 신바이오틱스 조성물을 포함하는 건강기능식품 첨가제.
  13. 제1항 내지 제7항 중 어느 한 항의 장내 균총 개선용 신바이오틱스 조성물을 포함하는 장내 균총 개선용 약학적 조성물.
PCT/KR2020/008303 2020-06-25 2020-06-25 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물 WO2021261626A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200077942A KR102632441B1 (ko) 2020-06-25 2020-06-25 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물
KR10-2020-0077942 2020-06-25

Publications (1)

Publication Number Publication Date
WO2021261626A1 true WO2021261626A1 (ko) 2021-12-30

Family

ID=79281446

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/008303 WO2021261626A1 (ko) 2020-06-25 2020-06-25 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물

Country Status (2)

Country Link
KR (1) KR102632441B1 (ko)
WO (1) WO2021261626A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070020250A1 (en) * 2004-02-23 2007-01-25 Ajinomoto Co., Inc. Lactic acid bacteria producing Nisin at high concentration and method for selecting the same
US20130336931A1 (en) * 2011-02-09 2013-12-19 Lavivo Ab Synbiotic compositions for restoration and reconstitution of gut microbiota
KR20190000763A (ko) * 2017-06-23 2019-01-03 서울대학교산학협력단 항균능력을 가지고 있는 박테리오신의 생산을 유산균에서 증진시키기 위한 방법

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009537547A (ja) * 2006-05-18 2009-10-29 バイオバランス エルエルシー 生物学的治療組成物およびその使用
KR101047948B1 (ko) * 2008-04-01 2011-07-12 (주)오비티 박테리오신을 생산하는 유산균 및 이를 함유하는 생균제 조성물
KR101381794B1 (ko) 2012-04-10 2014-04-07 씨제이제일제당 (주) 타가토스 및 프로바이오틱 유산균을 함유하는 신바이오틱 식품 조성물
KR101591879B1 (ko) * 2014-01-14 2016-02-04 주식회사 이지바이오 가축들의 장내 미생물 변화와 생산성에 영향을 주는 신바이오틱스 가축사료 첨가제
US11439172B2 (en) * 2017-07-03 2022-09-13 Oakbio, Inc. Microbial biomass based feed products

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070020250A1 (en) * 2004-02-23 2007-01-25 Ajinomoto Co., Inc. Lactic acid bacteria producing Nisin at high concentration and method for selecting the same
US20130336931A1 (en) * 2011-02-09 2013-12-19 Lavivo Ab Synbiotic compositions for restoration and reconstitution of gut microbiota
KR20190000763A (ko) * 2017-06-23 2019-01-03 서울대학교산학협력단 항균능력을 가지고 있는 박테리오신의 생산을 유산균에서 증진시키기 위한 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CUI LIAN-HUA, YAN CHANG-GUO, LI HUI-SHAN, KIM WHEE-SOO, HONG LIANG, KANG SANG-KEE, CHOI YUN-JAIE, CHO CHONG-SU: "A New Method of Producing a Natural Antibacterial Peptide by Encapsulated Probiotics Internalized with Inulin Nanoparticles as Prebiotics", JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 28, no. 4, 28 April 2018 (2018-04-28), pages 510 - 519, XP055884495, ISSN: 1017-7825, DOI: 10.4014/jmb.1712.12008 *
HONG LIANG, KIM WHEE-SOO, LEE SANG-MOK, KANG SANG-KEE, CHOI YUN-JAIE, CHO CHONG-SU: "Pullulan Nanoparticles as Prebiotics Enhance the Antibacterial Properties of Lactobacillus plantarum Through the Induction of Mild Stress in Probiotics", FRONTIERS IN MICROBIOLOGY, vol. 10, 6 February 2019 (2019-02-06), pages 1 - 12, XP055884488, DOI: 10.3389/fmicb.2019.00142 *
HONG, L. Research on synbiotic combination for enhancing protective functions of intestinal barrier. 2019[28 June 2019]. 한국축산학회 동물생명공학 구두 발표 (Animal Biotechnology Verbal Announcement of Korean Society of Animal Science and Technology). *
KIM WHEE-SOO; HAN GEON GOO; HONG LIANG; KANG SANG-KEE; SHOKOUHIMEHR MOHAMMADREZA; CHOI YUN-JAIE; CHO CHONG-SU: "Novel production of natural bacteriocin via internalization of dextran nanoparticles into probiotics", BIOMATERIALS, ELSEVIER, AMSTERDAM, NL, vol. 218, 15 July 2019 (2019-07-15), AMSTERDAM, NL , XP085747195, ISSN: 0142-9612, DOI: 10.1016/j.biomaterials.2019.119360 *

Also Published As

Publication number Publication date
KR102632441B1 (ko) 2024-02-05
KR20220000236A (ko) 2022-01-03

Similar Documents

Publication Publication Date Title
WO2019216662A1 (ko) 락토바실러스 파라카제이 균주 및 그 용도
WO2018143678A1 (ko) 신규 유산균 및 이의 용도
AU2020336649B2 (en) Akkermansia muciniphila EB-AMDK19 strainand use thereof
WO2015115790A1 (ko) 발효 대두박 생산능이 향상된 바실러스 속 균주 및 이를 이용하여 발효 대두박을 제조하는 방법
WO2020075949A1 (ko) 신규한 락토바실러스 플란타룸 균주 atg-k2, atg-k6 또는 atg-k8, 이를 포함하는 질염의 예방 또는 치료용 조성물
WO2021182829A1 (ko) 장관 면역조절 기능과 염증성 장 질환의 예방 또는 치료 활성을 갖는 락토바실러스 람노서스 균주
WO2018186700A1 (ko) 실크 피브로인으로 코팅되어 장내 정착성이 향상된 유산균을 포함하는 조성물
WO2012060579A2 (ko) 항균용 유산균 사균체 및 이의 제조방법
AU2020339348B2 (en) Akkermansia muciniphila EB-AMDK27 strain and use thereof
WO2013151362A1 (ko) 신규 바실러스 서브틸리스
WO2021221398A1 (ko) 우수한 면역기능 증진 효과를 갖는 신규한 유산균 및 이를 포함하는 식품조성물, 건강기능성 식품 조성물 및 프로바이오틱스
WO2019226002A1 (ko) 락토바실러스 크리스파투스 kbl693 균주 및 그 용도
WO2021066549A1 (ko) 락토바실러스 애시도필러스 kbl409 균주 및 그 용도
WO2019045493A1 (en) NOVEL BACILLUS AMYLOLIC FACTOR STRAIN AND PROCESS FOR PREPARING A FERMENTED SOY PRODUCT USING THE SAME
WO2023055188A1 (ko) 신규 프로바이오틱스 및 이의 용도
EP3676371A1 (en) Novel bacillus amyloliquefaciens strain and method for preparing fermented soy product using the same
WO2018230960A2 (ko) 신규한 비피도박테리움 비피덤 균주 및 균주 유래 다당체
WO2022039561A1 (ko) 클로스트리디움 디피실리 감염의 치료 또는 예방용 조성물
WO2017196140A2 (ko) 면역 조절 t 세포를 유도하는 락토코커스 락티스 bfe920 균주를 포함하는 수산양식 기능성 사료 첨가제
WO2021261626A1 (ko) 다당류 나노입자를 포함하는 장내 균총 개선용 신바이오틱스 조성물
WO2019132600A1 (ko) 바실러스 서브틸리스 균주, 바실러스 푸밀러스 균주 및 바실러스 리체니포미스 균주를 유효성분으로 포함하는 급성 췌장염 괴사증 또는 흰반점 증후군의 예방 또는 치료용 사료 조성물
WO2020013672A1 (ko) 락토바실러스 플란타럼 cjlp475 균주 및 락토바실러스 플란타럼 cjlp243 균주를 포함하는 조성물 및 이의 용도
WO2019132605A1 (ko) 바실러스 서브틸리스 균주를 유효성분으로 포함하는 급성 췌장염 괴사증 또는 흰반점 증후군의 예방 또는 치료용 사료 조성물
WO2022231178A1 (ko) 신규한 락토바실러스 퍼멘텀 atg-v5 균주 또는 이를 포함하는 면역증강용 조성물
WO2022039514A1 (ko) 락토바실러스 사케이 또는 이로부터 유래된 세포밖 소포체를 유효성분으로 포함하는 뇌질환의 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20941965

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20941965

Country of ref document: EP

Kind code of ref document: A1