WO2021256706A1 - Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 - Google Patents

Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 Download PDF

Info

Publication number
WO2021256706A1
WO2021256706A1 PCT/KR2021/006059 KR2021006059W WO2021256706A1 WO 2021256706 A1 WO2021256706 A1 WO 2021256706A1 KR 2021006059 W KR2021006059 W KR 2021006059W WO 2021256706 A1 WO2021256706 A1 WO 2021256706A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nos
nucleotide sequences
polynucleotide
primer pair
Prior art date
Application number
PCT/KR2021/006059
Other languages
English (en)
French (fr)
Inventor
천상영
이정석
주시연
이성근
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2021256706A1 publication Critical patent/WO2021256706A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Definitions

  • the present application relates to a marker, a composition, a kit, a chip for diagnosing root rot, and a method of using the same.
  • Root rot (basal stem rot) is a disease of plants mainly showing a disease in which young roots are infringed and the vitality of the plant is reduced. Plants infected with root rot show atrophy, and the growth is sluggish, resulting in small fruits and reduced yield. If the disease progresses severely, the leaves deteriorate, slowly wither, and then die.
  • the pathogen of root rot is known to be a microorganism of the genus Ganoderma, and it is known that the pathogen is caused by invading the root of a plant.
  • microorganisms of the genus Ganoderma which are the main pathogens of root rot
  • a sequence specific to the microorganism Ganoderma boninense was discovered, and a novel marker was developed to detect the microorganism Ganoderma boninense therefrom.
  • One object of the present application is to provide a composition for diagnosing root rot.
  • Another object of the present application is to provide a kit for diagnosing root rot disease comprising the composition.
  • Another object of the present application is to provide a chip for diagnosing root rot disease comprising the composition.
  • Another object of the present application is to provide a method for diagnosing root rot.
  • Another object of the present application is to provide a composition for detecting Ganoderma boninense microorganisms.
  • Another object of the present application is to provide a method for detecting Ganoderma boninense microorganisms.
  • Another object of the present application is to provide a use for diagnosing root rot.
  • Another object of the present application is to provide a use for detecting Ganoderma boninense microorganisms.
  • the marker capable of specifically detecting Ganoderma boninense bacteria of the present application can directly detect Ganoderma boninense microorganisms in soil. Through this, it can be used to prevent and treat root rot caused by contamination of the microorganisms, and industrial application in oil palm farms can be expected.
  • FIG. 1 is a diagram showing the result of detecting Ganoderma boninense bacteria as a marker of the present application in Malaysian soil.
  • One aspect of the present application for achieving the above object provides a composition for diagnosing root rot.
  • the composition comprises a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, It may be a composition for diagnosing root rot disease comprising an agent capable of detecting a complementary polynucleotide thereof, or a fragment thereof, but is not limited thereto.
  • a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, and a complementary polynucleotide thereof , or a fragment thereof may be a polynucleotide specifically possessed by a Ganoderma boninense microorganism, a complementary polynucleotide thereof, or a fragment thereof, and may be mixed with a marker for detecting the Ganoderma boninense microorganism.
  • a marker capable of detecting a Ganoderma boninense microorganism or “marker” is a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, the nucleotide sequence of any one of SEQ ID NOs: 1 to 7 It refers to a polynucleotide having at least 80% homology with a polynucleotide, a complementary polynucleotide, or a fragment thereof , which is a sequence specific to Ganoderma boninense microorganisms only. By determining the presence of the sequence, Ganoderma boninense in the sample It refers to a sequence capable of discriminating whether microorganisms exist.
  • the markers provided in the present application may have a certain level of homology with each other or may share a specific core sequence of the Ganoderma boninense microorganism, but is not limited thereto.
  • a polynucleotide represented by any one of nucleotide sequences of SEQ ID NOs: 1 to 7 is one of polynucleotides having a sequence specifically found in Ganoderma boninense microorganisms, and depending on the presence of the polynucleotide, Ganoderma It can be confirmed whether boninense microorganisms are present in the sample (soil).
  • a polynucleotide having at least 80% homology with any one of SEQ ID NOs: 1 to 7 is a polynucleotide having 80% or more homology or identity with any one of SEQ ID NOs: 1 to 7 as, similar to the polynucleotides represented by any one of the nucleotide sequence of SEQ ID NO: 1 to 7, having a sequence that is specifically found in Ganoderma boninense microorganism is a Ganoderma boninense microbial samples (soil) is based on the presence of the polynucleotide You can check whether it exists in Specifically, the polynucleotide having at least 80% homology with the base sequence of any one of SEQ ID NOs: 1 to 7 may be one having at least 80%, 85%, 90%, or 95% homology, but is limited thereto doesn't happen
  • a polynucleotide, gene or protein is described as having a nucleotide sequence or amino acid sequence of a specific SEQ ID NO: identical to or corresponding to the polynucleotide, gene or protein consisting of the nucleotide sequence or amino acid sequence of the SEQ ID NO: If it has activity , as long as it is specifically present in the desired Ganoderma boninense microorganism, a polynucleotide, gene or protein having a sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added may also be used in the present application. It is self-evident that it can
  • sequences having identity may also be included in the scope of the present application, but is not limited thereto.
  • the term 'homology' or 'identity' refers to the degree to which two given amino acid sequences or base sequences are related to each other and may be expressed as a percentage.
  • Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially, homologous or identical sequences are generally at least about 50%, 60%, 70%, 80% of the entire or full-length sequence under moderate or high stringent conditions. or more than 90% hybrid. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
  • GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • the term "homology” or "identity” refers to a relevance between sequences.
  • the term "complementary" is used to describe a relationship between nucleotide bases capable of hybridizing with each other.
  • adenosine is complementary to thymine and cytosine is complementary to guanine.
  • the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
  • fragment refers to a partial sequence of a polynucleotide having a specific sequence, specifically, a polynucleotide represented by any one of SEQ ID NOs: 1 to 7, among SEQ ID NOs: 1 to 7 of any one of the nucleotide sequence and yet part of having a homology of at least 80% of the polynucleotide, or a complementary polynucleotide sequence, by including Ganoderma boninense microbe-specific sequences, some of which may be used in Ganoderma boninense microorganism detection zone means sequence.
  • the sequence or its length is not limited, and a sequence in which a meaningless sequence is added to both ends of the fragment or a sequence in which a part of the sequence is substituted is also included in the scope of the present application.
  • the fragment may include any one of the nucleotide sequences of SEQ ID NOs: 8 to 14, but is not limited thereto.
  • the marker of the present application may include any one sequence of SEQ ID NOs: 1 to 14, and more specifically, the marker of the present application may be composed of any one sequence of SEQ ID NOs: 1 to 14 , but not limited thereto.
  • detectable agent includes any agent generally used in the art for detecting polynucleotides, and includes not only an agent that detects the entire sequence of the marker, but also an agent that detects a part of the marker It means an agent that can confirm the presence.
  • the detectable agent may refer to an agent capable of amplifying and detecting the marker of the present application, and specifically, a probe, a primer pair, an antibody, an aptamer, and It may be any one selected from the group consisting of oligonucleotides, but is not limited thereto.
  • primer refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be detected, and may serve as a starting point for synthesis of a primer extension product.
  • the primer may be prepared to be used for detection of a marker through a PCR reaction, and the specific length and sequence of the primer may depend on the required complexity of the DNA or RNA target, as well as usage conditions such as temperature and ionic strength. According to it, it can be synthesized by a method known in the art.
  • the primer pair is a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 15 and 16; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 17 and 18; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 19 and 20; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 21 and 22; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 23 and 24; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 25 and 26; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 27 and 28; Alternatively, it may be a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 29 and 30, but is not limited thereto.
  • the "probe” of the present application is a probe that can be prepared from a specific polynucleotide sequence by a known method, for example, if it can hybridize with a complementary sequence to all or part of the base sequence under stringent conditions.
  • the scope of the present application may be included without limitation.
  • the "stringent condition” means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., supra).
  • genes having high homology or identity 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more
  • the conditions in which genes having 99% or more homology or identity hybridize with each other and genes with lower homology or identity do not hybridize, or at 60° C., which is a washing condition for normal Southern hybridization 1 X SSC, 0.1% SDS, specifically 60° C. 0.1 X SSC, 0.1% SDS, more specifically 68° C. 0.1 X SSC, 0.1% SDS at a salt concentration and temperature equivalent to one time, specifically 2 Conditions for washing three to three times can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is as described above.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • diagnosis refers to the process of determining whether root rot has occurred due to contamination by Ganoderma boninense microorganisms.
  • composition of the present invention it can be confirmed whether the Ganoderma boninense microorganism-specific sequence is present in the sample.
  • the composition for diagnosing root rot of the present application is a specific marker possessed by the Ganoderma boninense microorganism, that is, a polynucleotide represented by any one of SEQ ID NOs: 1 to 7, a base sequence of any one of SEQ ID NOs: 1 to 7 and a minimum
  • a polynucleotide having 80% or more homology, its complementary polynucleotide, or a fragment thereof is present in the collected sample, it is possible to diagnose whether the sample is contaminated by Ganoderma boninense microorganisms, or whether the sample is infected with root rot. It may be a composition that allows it, but is not limited thereto.
  • the root rot disease may be caused by Ganoderma boninense microorganisms in an oil palm tree, and the plant in which the root rot disease occurs may be Elaeis guineensis, Elaeis oleifera, Attalea maripa, etc., but is not limited thereto.
  • Ganoderma boninense microorganism is a microorganism belonging to a fungus, and the microorganism of the genus Ganoderma has been traditionally used as a medicine in Asia.
  • the present application provides a marker capable of specifically detecting the microorganisms of the genus Ganoderma, particularly, the microorganisms of the genus Ganoderma, paying attention to the fact that the microorganisms Ganoderma boninense may be the causative bacteria of root rot.
  • the Ganoderma boninense is Ganoderma orbiforme, Ganoderma orbiformum, Ganoderma miniatocinctum, Ganoderma lucidum var. orbiformis, Polyporus cupreus, or Fomes orbiformis may also be named, and all microorganisms having the same characteristics as Ganoderma boninense microorganisms are included, and the name is not limited.
  • Another aspect of the present application provides a kit for diagnosing root rot.
  • the kit is a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, and its complementary It may include an agent capable of detecting a polynucleotide or a fragment thereof, and the kit for diagnosing root rot of the present application may be used to determine whether Ganoderma boninense microorganisms are present in a soil sample collected from the field.
  • the kit may be selected from the group consisting of an RT-PCR kit, an immune strip, a DNA chip kit, a protein chip kit, a rapid kit or a multiple reaction monitoring (MRM) kit, and an ELISA diagnostic kit, As long as it can be determined whether the Ganoderma boninense microorganism is present, it is not limited to the principle or form of its operation.
  • kit of the present application may include one or more other components composition, solution or device suitable for diagnosing root rot disease, but is not limited thereto.
  • the other components include, but are not limited to, suitable carriers, labeling substances capable of generating a detectable signal, chromophores, solubilizers, detergents, buffers, stabilizers, and the like.
  • the labeling material is an enzyme, it may include a substrate capable of measuring enzyme activity and a reaction terminator.
  • the carrier includes a soluble carrier and an insoluble carrier
  • an example of the soluble carrier is a physiologically acceptable buffer known in the art, for example, PBS
  • an example of the insoluble carrier is polystyrene, polyethylene, polypropylene, polyester, poly It may be acrylonitrile, fluororesin, crosslinked dextran, polysaccharide, polymer such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof, but is not limited thereto.
  • the kit of the present application may include a primer pair for detection of a marker, and a reagent for performing a detection reaction, but is not limited thereto.
  • the kit of the present application may further include reagents necessary for the amplification reaction performed for detecting the marker, and the reagents for performing the amplification reaction may include DNA polymerase, dNTPs, and a buffer, and also , may further include reagents necessary for performing and analyzing a real-time PCR reaction.
  • kit of the present application may further include a user guide that describes the conditions for performing the optimal reaction.
  • Handbooks are printed out instructions explaining how to use the kit, eg, how to prepare PCR buffers, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit.
  • the guide includes information published or provided through electronic media such as the Internet.
  • Another aspect of the present application provides a chip for diagnosing root rot.
  • a chip for diagnosing root rot disease comprising the composition.
  • the chip is a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a complementary polynucleotide thereof, Or it may include an agent capable of detecting a fragment thereof, and specifically, the chip may be a DNA chip or a protein chip.
  • the DNA chip may include a substrate to which cDNA or oligonucleotide corresponding to a marker polynucleotide or a fragment thereof for detecting a Ganoderma boninense microorganism is attached, and reagents, agents, It may further include enzymes and the like.
  • the substrate may include cDNA or oligonucleotide corresponding to a control polynucleotide or a fragment thereof, but is not limited thereto.
  • the protein chip is a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7 of the present application, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, and its complement It may include an antibody that specifically recognizes a specific polynucleotide, or a fragment thereof, but is not limited thereto.
  • Another aspect of the present application provides a method for diagnosing root rot.
  • taking a sample taking a sample; And a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7 in the collected sample, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a polynucleotide complementary thereto It provides a method for diagnosing root rot, comprising the step of detecting a nucleotide, or a fragment thereof.
  • the fragment may include any one of the nucleotide sequences of SEQ ID NOs: 8 to 14, but is not limited thereto.
  • the sample may be used without limitation as long as it can determine contamination by Ganoderma boninense microorganisms, but may be soil, a plant, etc.
  • the sampling depth of the sample, the collection method, etc. are not limited.
  • the detection is reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time polymerase reaction (real time RT-PCR), real time reverse transcriptase polymerase reaction (real time) It may be performed by a method selected from the group consisting of quantitative RT-PCR), RNase protection method, Northern blotting, gene chip, and combinations thereof, but is not limited thereto.
  • the diagnostic method of the present application further comprises the step of (d) detecting the marker of the present application in the control sample, or (e) the marker of the present application detected in the control sample and in step (c) It may further include the step of comparing the detection result of the marker in the identified sample, but is not limited thereto.
  • the marker detection method of the present application may be to detect the amplified marker after amplifying the marker, but is not limited to a specific method as long as it is a marker detection method known in the art.
  • the detection result may be the amount of the amplified polynucleotide or fragment thereof, but is not limited thereto.
  • the control sample may be a sample in which Ganoderma boninense microorganisms do not exist, or a sample in which root rot disease does not develop, but is not limited thereto.
  • the diagnostic method of the present application compares the amount of the amplified polynucleotide or fragment thereof in the control sample and the sample, and when the amount of polynucleotide or fragment thereof specifically possessed by the Ganoderma boninense microorganism increases, It may further include, but is not limited to, diagnosing as having a root rot disease.
  • a method for isolating genomic DNA from a sample or a microorganism included in the sample may use a method known in the art, for example, the CTAB method may be used, or a wizard prep kit (Promega) may be used.
  • the target sequence may be amplified by using the isolated genomic DNA as a template and performing an amplification reaction using primers.
  • Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There is strand displacement amplification or amplification via Q ⁇ replicase or any other suitable method for amplifying nucleic acid molecules known in the art.
  • PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase.
  • PCR methods are well known in the art, and commercially available kits may be used.
  • Real-time PCR is a method of real-time monitoring of the PCR progress at each period in order to compare each PCR within an exponentially increasing range.
  • the real-time PCR method which is a DNA quantification technique, is a method for quantifying the amount of target DNA present in the original sample by observing the production process of the PCR amplification product in real time using a device in which a thermal cycler and a spectrofluorophotometer are integrated. .
  • Real-time PCR replaces the existing microbial qualitative and quantitative methods that had to be based on microbial culture, enabling the qualitative and quantitative determination of microorganisms without performing isolation and culture of microorganisms.
  • the real-time PCR method is divided into absolute quantification and relative quantification analysis.
  • preparation of a calibration curve (standard curve) of a standard sample is an essential element.
  • Quantitative real-time PCR is simultaneously performed on the standard sample and the unknown sample to derive a calibration curve from the standard sample, and then the amount of target DNA in the unknown sample is quantified from the calibration curve.
  • the calibration curve from the standard sample x-axis: concentration of standard sample, y-axis: number of threshold cycles (CT)
  • CT threshold cycles
  • “Quantitative PCR” refers to PCR for quantifying the amount of template DNA at the start of an amplification reaction, and means PCR capable of confirming amplification of a molecule to be amplified at any time during the reaction.
  • PCR is generally combined with a calibration curve correlating the number of template DNA molecules at the start of the reaction and a signal serving as an index of the amplification.
  • This calibration curve can be prepared using standard samples with known molecular numbers.
  • the calibration curve uses the polynucleotide or marker of the Ganoderma boninense microorganism to be quantified as a standard sample, and performs quantitative real-time PCR using a primer to specifically amplify it. Based on the calibration curve created from the amplification of the standard sample, It may be to identify the threshold cycle number (CT) of the target polynucleotide or marker present.
  • CT threshold cycle number
  • the amplified target sequence may be labeled with a detectable labeling material.
  • the labeling material may preferably be a fluorescence-emitting material, but is not limited thereto.
  • the detection chemistry currently used in real-time PCR is generally divided into a non-specific method using Sybr Green I and a specific method using a hybridization probe. Sybr Green I non-specifically binds to double-stranded DNA and emits fluorescence, and the real-time PCR device measures the amount of fluorescence to confirm the amount of DNA.
  • the hybridization probe specifically hybridizes to a complementary nucleotide sequence and emits fluorescence during the PCR reaction.
  • a taqman probe (dual labeled fluorogenic probe) has a fluorescent reporter attached to the 5'-end and a quencher to the 3'-end.
  • the fluorescent reporter of the TaqMan probe is present in close proximity to the quencher, the fluorescence is canceled and is not detected.
  • the TaqMan probe is hybridized to a specific target nucleotide sequence and PCR amplification proceeds, the Taq DNA polymerase 5'-3' exonuclease activity decomposes the TaqMan probe and the fluorescent reporter is freely released, thereby As it moves away from the quencher, it emits fluorescence. By measuring this, the production amount of the target DNA fragment is monitored in real time.
  • the primer pair used in the method of the present application includes a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 15 and 16; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 17 and 18; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 19 and 20; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 21 and 22; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 23 and 24; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 25 and 26; a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 27 and 28; Alternatively, it may be a primer pair consisting of the nucleotide sequences of SEQ ID NOs: 29 and 30, and the step of detecting the polynucleotide or fragment thereof of the method of the present application includes a primer pair
  • Another aspect of the present application provides a composition for detecting Ganoderma boninense microorganisms.
  • a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7, its complementary It provides a composition for detecting a Ganoderma boninense microorganism, comprising an agent capable of detecting a polynucleotide, or a fragment thereof.
  • Ganoderma boninense microorganism detection composition of the present application is the sample may be used to determine whether or not (e.g., soil) is contaminated by Ganoderma boninense microorganisms, specifically, may be used to detect the marker of the present application .
  • Another aspect of the present application provides a method for detecting a Ganoderma boninense microorganism.
  • a polynucleotide represented by any one of the nucleotide sequences of SEQ ID NOs: 1 to 7 in the collected sample, and a polynucleotide having at least 80% homology with any one of the nucleotide sequences of SEQ ID NOs: 1 to 7 It provides a method for detecting a Ganoderma boninense microorganism, comprising the step of detecting its complementary polynucleotide, or a fragment thereof.
  • the method for detecting Ganoderma boninense microorganisms of the present application may be to detect whether Ganoderma boninense microorganisms are present in a sample using the marker or composition of the present application, but is not limited thereto.
  • Another aspect of the present application provides a use for diagnosing root rot.
  • Another aspect of the present application provides a use for detecting a Ganoderma boninense microorganism.
  • Example 1 Ganoderma boninense Extraction of bacterial sequences and discovery of specific markers
  • the present inventors tried to discover a marker capable of specifically detecting the Ganoderma boninense microorganism, which is known as the main cause of root rot.
  • Ganoderma boninense directly secured the DNA sequence of the microorganism, and found and developed a specific marker for detecting the Ganoderma boninense microorganism from the secured sequence.
  • NGS Next Generation Sequencing
  • the DNA sequence of microorganisms of the genus Ganoderma known in the database (178,448,606,127bp) and the DNA sequence of fungi strains (2,391 strains, 80,288,864,015bp) not of the genus Ganoderma were obtained.
  • the gDNA sequence of the soil confirmed that the microorganisms of the genus Ganoderma did not exist as a result of metagenome analysis was obtained through NGS (7,724,586,454bp).
  • the Ganoderma boninense microorganism specific marker of Ganoderma boninense sequence of SEQ ID NO: 1 to 7 of dig was derived by comparing the sequence obtained from the NCBI database, the microorganism within Ganoderma soil microorganisms and Malaysia DNA that is not part of the boninense.
  • Example 2 Ganoderma boninense Diagnosis of root rot using fungal-specific markers
  • primers for detecting any one marker of SEQ ID NOs: 1 to 7 of the present application were prepared, and the regions in the Ganoderma boninense microorganism-specific sequence to which the primers bind are the same as the sequences of SEQ ID NOs: 8 to 14, respectively.
  • the PCR product was analyzed by electrophoresis by keeping it at 4°C, loading all 20uL on 1% agrose gel. The presence of Ganoderma boninense microorganisms was confirmed from the obtained PCR product, and the degree of soil contamination by the Ganoderma boninense bacteria was confirmed from the band intensity of the PCR product.
  • primers of SEQ ID NOs: 17 and 18 in the same manner as the primers of SEQ ID NOs: 15 and 16; primers of SEQ ID NOs: 19 and 20; primers of SEQ ID NOs: 21 and 22; primers of SEQ ID NOs: 23 and 24; and primers of SEQ ID NOs: 25 and 26; primers of SEQ ID NOs: 27 and 28; And PCR was performed using the primers of the nucleotide sequences of SEQ ID NOs: 29 and 30, and the degree of contamination was confirmed (FIG. 1).
  • Lane 8 represents a DNA ladder
  • lanes 1 to 7 and 9 represent PCR products using soil DNA in which root rot has occurred
  • lane 1 is PCR using primers of SEQ ID NOs: 15 and 16 to detect the region of SEQ ID NO: 1 or 8 product
  • Lane 2 is a PCR product using primers of SEQ ID NOs: 17 and 18 to detect regions of SEQ ID NO: 2 or 9
  • Lane 3 is a PCR product using primers of SEQ ID NOs: 19 and 20 to detect regions of SEQ ID NO: 3 or 10
  • Lane 4 is a PCR product using primers of SEQ ID NOs: 21 and 22 to detect regions of SEQ ID NO: 3 or 10
  • Lane 5 is a PCR product using the primers of SEQ ID NOs: 23 and 24 to detect the region of SEQ ID NO: 4 or 11
  • Lane 6 is a PCR product using primers of SEQ ID NOs: 25 and 26 to detect regions of SEQ ID NO: 5 or 12
  • Lane 7 is
  • the present inventors not only discovered novel markers specifically possessed by Ganoderma boninense microorganisms, but also confirmed that it is possible to diagnose root rot infection by Ganoderma boninense bacteria in soil.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 출원은 Ganoderma boninense 미생물을 특이적으로 검출할 수 있는 마커, 조성물, 및 상기 마커 또는 상기 조성물을 이용하여 Ganoderma boninense 속 미생물을 검출하는 방법 및 뿌리 썩음병 진단 방법, Ganoderma boninense 속 미생물을 검출하는 용도, 및 뿌리 썩음병 진단 용도에 관한 것이다.

Description

GANODERMA 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
본 출원은 뿌리 썩음병 진단을 위한 마커, 조성물, 키트, 칩 및 이를 이용하는 방법에 관한 것이다.
뿌리 썩음병(basal stem rot)은 주로 어린 뿌리가 침해되어 식물체의 활력이 떨어지는 병증을 나타내는 식물체의 병이다. 뿌리 썩음병에 감염된 식물체는 위축을 나타내고, 생육은 부진하여 과실은 작고, 수량이 감소될 뿐만 아니라, 병이 심하게 진전되면 잎은 퇴록되고, 서서히 시들다가 후에 말라 죽는다. 뿌리 썩음병의 병원균은 Ganoderma 속 미생물인 것으로 알려져 있으며, 병원균이 식물체의 뿌리를 침범함으로써 발생하는 것으로 알려져 있다.
오일팜 산업이 활발한 말레이시아에서는 Ganoderma 속 미생물에 의한 뿌리 썩음병에 의한 경제적 손실이 매우 크며 그 규모가 연간 4,600만 달러에 달하는 것으로 알려져 있다. 이에, 산업 현장에서 이용할 수 있는 뿌리 썩음병 진단이 가능한 마커 개발의 필요성이 대두되고 있다.
이와 관련하여, 종래에 인삼 뿌리 썩음병 진단을 위한 기술은 알려져 있으나(한국 등록특허 10-1570792호), 이는 인삼 뿌리 썩음 병원균인 Cylindrocarpon destructans을 검출하기 위한 방법으로, Ganoderma boninense 미생물에 의한 뿌리 썩음병 진단을 위한 마커는 아직 개발되지 않은 실정이다.
뿌리 썩음병의 주된 병원균인 Ganoderma 속 미생물 중에서도 Ganoderma boninense 미생물이 특이적으로 갖는 서열을 발굴하고, 이로부터 Ganoderma boninense 미생물을 검출할 수 있는 신규한 마커를 개발하였다.
본 출원의 하나의 목적은 뿌리 썩음병 진단용 조성물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 조성물을 포함하는 뿌리 썩음병 진단용 키트를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 조성물을 포함하는 뿌리 썩음병 진단용 칩을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 뿌리 썩음병 진단 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 Ganoderma boninense 미생물 검출용 조성물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 Ganoderma boninense 미생물 검출 방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 뿌리 썩음병 진단 용도를 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 Ganoderma boninense 미생물 검출 용도를 제공하는 것이다.
본 출원의 Ganoderma boninense 균을 특이적으로 검출할 수 있는 마커는 토양에서 직접 Ganoderma boninense 미생물을 검출할 수 있다. 이를 통해 상기 미생물의 오염으로 인한 뿌리 썩음병을 예방 및 치료하는데 이용될 수 있고, 오일팜 농장에서의 산업적 활용을 기대할 수 있다.
도 1은 말레이시아 토양에서 본 출원의 마커로 Ganoderma boninense 균을 검출한 결과를 나타낸 도이다.
이하, 본 출원 내용에 대하여 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시한 일 양태의 설명 및 실시형태는 공통된 사항에 대하여 다른 양태의 설명 및 실시 형태에도 적용될 수 있다. 또한, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 더불어, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
상술한 목적을 달성하기 위한 본 출원의 일 양태는 뿌리 썩음병 진단용 조성물을 제공한다.
하나의 구체예에서, 상기 조성물은 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출할 수 있는 제제를 포함하는 뿌리 썩음병 진단용 조성물일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편은 Ganoderma boninense 미생물이 특이적으로 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 그의 단편일 수 있으며, Ganoderma boninense 미생물을 검출하기 위한 마커와 혼용될 수 있다.
본 출원에서, "Ganoderma boninense 미생물을 검출할 수 있는 마커" 또는 "마커"는 상기 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 의미하는 것으로서, Ganoderma boninense 미생물에만 특이적으로 존재하는 서열로서 상기 서열의 존재 여부를 판별함으로써, 시료 내에 Ganoderma boninense 미생물이 존재하는지 여부를 판별할 수 있는 서열을 의미한다. 본 출원의 마커를 이용할 경우, 채취된 시료가 Ganoderma boninense 미생물에 의해 오염되었는지 여부를 빠르고 정확하게 판별할 수 있다. 본 출원에서 제공하는 마커는 서로 일정 수준 이상의 상동성을 갖거나, Ganoderma boninense 미생물이 갖는 특이적 코어 서열을 공유하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드"는 Ganoderma boninense 미생물에서 특이적으로 발견되는 서열을 갖는 폴리뉴클레오티드의 하나로서, 상기 폴리뉴클레오티드의 존재 여부에 따라 Ganoderma boninense 미생물이 시료(토양) 내에 존재하는지 여부를 확인할 수 있다. 또한, "서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드"는 서열번호 1 내지 7 중 어느 하나의 염기서열과 80% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드로서, 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드와 마찬가지로, Ganoderma boninense 미생물에서 특이적으로 발견되는 서열을 갖고, 상기 폴리뉴클레오티드의 존재 여부에 따라 Ganoderma boninense 미생물이 시료(토양) 내에 존재하는지 여부를 확인할 수 있다. 구체적으로, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드는 80%, 85%, 90%, 또는 95% 이상의 상동성을 갖는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, 폴리뉴클레오티드, 유전자 또는 단백질이 특정 서열번호의 염기서열 또는 아미노산 서열을 갖는 것으로 기재되어 있다 하더라도, 해당 서열번호의 염기서열 또는 아미노산 서열로 이루어진 폴리뉴클레오티드, 유전자 또는 단백질과 동일 혹은 상응하는 활성을 가지는 경우라면, 목적하는 Ganoderma boninense 미생물에 특이적으로 존재하는 것인 한, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 서열을 갖는 폴리뉴클레오티드, 유전자 또는 단백질도 본 출원에서 사용될 수 있음은 자명하다.
또한, 특정 서열번호로 표현되는 염기서열 또는 아미노산 서열의 폴리뉴클레오티드, 유전자 또는 단백질과 동일 또는 상응하는 활성을 갖는 이상, 특정 서열번호로 표현되는 염기서열 또는 아미노산 서열과 80% 이상의 상동성(homology) 또는 동일성(identity)을 갖는 서열도 본 출원의 범주에 포함될 수 있으나, 이에 제한되는 것은 아니다. 구체적으로, 특정 서열번호의 염기서열 또는 아미노산 서열과 적어도 80%, 85%, 90%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가질 수 있으며, 상응하는 효능 또는 활성을 나타내는 것으로, 목적하는 Ganoderma boninense 미생물에 특이적으로 존재하는 것인 한, 일부 서열이 결실, 변형, 치환 또는 부가된 서열 역시 본 출원의 범주에 포함됨은 자명하다.
본 출원에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 서로 관련된 정도를 의미하며 백분율로 표시될 수 있다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된 (conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나 (homologous) 또는 동일한 (identical) 서열은 중간 또는 높은 엄격한 조건(stringent conditions)에서 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90% 이상으로 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 코돈 대신 축퇴 코돈을 함유하는 폴리뉴클레오티드 또한 고려된다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48: 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본 출원에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
본 출원에서 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데노신은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
본 출원에서, "단편"은 특정 서열을 갖는 폴리뉴클레오티드의 일부 서열을 의미하는 것으로, 구체적으로는, 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 또는 이의 상보적인 폴리뉴클레오티드의 일부 서열이면서, Ganoderma boninense 미생물 특이적인 서열을 포함함으로써, Ganoderma boninense 미생물 검출에 이용될 수 있는 일부 영역의 서열을 의미한다. 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 또는 이의 상보적인 폴리뉴클레오티드의 일부 서열이면서 Ganoderma boninense 미생물을 검출할 수 있는 한, 서열이나 그 길이는 제한되지 않고, 상기 단편의 양 말단에 무의미한 서열이 부가되거나, 일부 서열이 치환된 서열 역시 본 출원의 범주에 포함됨은 자명하다. 구체적으로, 상기 단편은 서열번호 8 내지 14 중 어느 하나의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
구체적으로, 본 출원의 마커는 서열번호 1 내지 14 중 어느 하나의 서열을 포함하는 것일 수 있고, 보다 구체적으로, 본 출원의 마커는 서열번호 1 내지 14 중 어느 하나의 서열로 구성되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "검출할 수 있는 제제"는 당업계에서 일반적으로 폴리뉴클레오티드를 검출하는데 이용하는 임의의 제제를 모두 포함하며, 상기 마커의 서열 전체를 검출하는 제제뿐 아니라, 그 일부를 검출하여 마커의 존재를 확인할 수 있는 제제를 의미한다. 본 출원에서, 상기 검출할 수 있는 제제는, 이에 제한되는 것은 아니나, 본 출원의 마커를 증폭하고 검출할 수 있는 제제를 의미할 수 있고, 구체적으로는 프로브, 프라이머 쌍, 항체, 앱타머, 및 올리고뉴클레오티드로 이루어진 군에서 선택되는 어느 하나인 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서, "프라이머"는 검출하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 본 출원에서 프라이머는 PCR 반응을 통한 마커의 검출에 이용되기 위해 제작될 수 있으며, 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 이용 조건에 따라 당업계에 알려진 방법으로 합성될 수 있다. 구체적으로, 상기 프라이머 쌍은 서열번호 15 및 16의 염기서열로 이루어진 프라이머 쌍; 서열번호 17 및 18의 염기서열로 이루어진 프라이머 쌍; 서열번호 19 및 20의 염기서열로 이루어진 프라이머 쌍; 서열번호 21 및 22의 염기서열로 이루어진 프라이머 쌍; 서열번호 23 및 24의 염기서열로 이루어진 프라이머 쌍; 서열번호 25 및 26의 염기서열로 이루어진 프라이머 쌍; 서열번호 27 및 28의 염기서열로 이루어진 프라이머 쌍; 또는 서열번호 29 및 30의 염기서열로 이루어진 프라이머 쌍일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 "프로브"는 공지의 방법으로 특정 폴리뉴클레오티드 서열로부터 조제될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화 될 수 있는 것이라면 본 출원의 범주에 제한 없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌 (예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성(homology) 또는 동일성(identity)이 높은 유전자끼리, 80% 이상, 85% 이상, 구체적으로는 90% 이상, 보다 구체적으로는 95% 이상, 더욱 구체적으로는 97% 이상, 특히 구체적으로는 99% 이상의 상동성 또는 동일성을 갖는 유전자끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 유전자끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃ 1 X SSC, 0.1% SDS, 구체적으로는 60℃ 0.1 X SSC, 0.1% SDS, 보다 구체적으로는 68℃ 0.1 X SSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로는 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치 (mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 전술한 바와 같다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
본 출원에서, "진단"은 Ganoderma boninense 미생물에 의해 오염되어 뿌리 썩음병이 발병되었는지 여부를 판단하는 과정을 의미한다. 본 발명의 조성물을 이용하면 시료에 Ganoderma boninense 미생물 특이적인 서열이 존재하는지 여부를 확인할 수 있다.
본 출원의 뿌리 썩음병 진단용 조성물은 Ganoderma boninense 미생물이 갖는 특이적인 마커, 즉, 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편이 채취된 시료에 존재하는지 여부를 판별하여 시료가 Ganoderma boninense 미생물에 의해 오염되었는지 여부, 또는 뿌리 썩음병에 걸렸는지를 진단할 수 있도록 하는 조성물일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 뿌리 썩음병은 오일팜나무에서 Ganoderma boninense 미생물에 의해 발병하는 것일 수 있고, 상기 뿌리 썩음병이 발병하는 식물체는 Elaeis guineensis, Elaeis oleifera, Attalea maripa 등일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서, "Ganoderma boninense 미생물"은 진균류(fungi)에 속하는 미생물로서, Ganoderma 속 미생물은 아시아에서 전통적으로 의약품으로 사용되어 왔다. 본 출원에서는 상기 Ganoderma 속 미생물, 그 중에서도 Ganoderma boninense 미생물이 뿌리 썩음병의 원인균일 수 있다는 점에 착안하여, 상기 미생물을 특이적으로 검출할 수 있는 마커를 제공한다. 구체적으로, 상기 Ganoderma boninense는 Ganoderma orbiforme, Ganoderma orbiformum, Ganoderma miniatocinctum, Ganoderma lucidum var. orbiformis, Polyporus cupreus, 또는 Fomes orbiformis 등으로도 명명될 수 있고, Ganoderma boninense 미생물과 동일한 특성을 갖는 미생물이면 모두 포함되며, 명칭에 제한되지 않는다.
본 출원의 다른 하나의 양태는 뿌리 썩음병 진단용 키트를 제공한다.
하나의 구체예에서, 상기 조성물을 포함하는 뿌리 썩음병 진단용 키트를 제공한다. 구체적으로, 상기 키트는 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출 할 수 있는 제제를 포함할 수 있으며, 본 출원의 뿌리 썩음병 진단용 키트는 현장에서 채취한 토양 시료에 Ganoderma boninense 미생물이 존재하는지 여부를 확인하는 데 이용될 수 있다.
구체적으로, 상기 키트는 RT-PCR　키트, 면역 스트립, DNA 칩 키트, 단백질　칩　키트, 래피드(rapid)　키트　또는 MRM(Multiple reaction monitoring)　키트, 및 ELISA　진단　키트로 이루어진 군으로부터 선택되는 것일 수 있으나, Ganoderma boninense 미생물이 존재하는지 여부를 확인할 수 있다면 그 작동 원리나 형태에 제한되지 않는다.
또한, 본 출원의 키트는 뿌리 썩음병 진단을 위해 적합한 한 종류 또는 그 이상의 다른 구성성분　조성물, 용액 또는 장치를 포함할 수 있으나, 이에 제한되지 않는다. 상기 다른 구성 성분의 일 예로, 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등이 포함되나 이에 제한되지 않는다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체, 불용성 담체가 있고, 가용성 담체의 일 예로 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 키트는 마커의 검출을 위한 프라이머 쌍, 및 검출 반응을 수행하기 위한 시약을 포함할 수 있으나, 이에 제한되지 않는다. 또한, 본 출원의 키트는 마커 검출을 위해 수행되는 증폭 반응에 필요한 시약을 추가로 포함할 수 있고, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs 및 버퍼 등을 포함할 수 있고, 또한, 실시간 PCR 반응 수행 및 분석을 위해 필요한 시약을 추가로 포함할 수 있다.
또한, 본 출원의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 버퍼 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.
본 출원의 또 다른 하나의 양태는 뿌리 썩음병 진단용 칩을 제공한다.
하나의 구체예에서, 상기 조성물을 포함하는 뿌리 썩음병 진단용 칩을 제공한다. 상기 칩은 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출 할 수 있는 제제를 포함할 수 있으며, 구체적으로, 상기 칩은 DNA　칩, 또는 단백질　칩일 수 있다.
상기 DNA　칩은 Ganoderma boninense 미생물을 검출하기 위한 마커 폴리뉴클레오티드 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드(oligonucleotide)가 부착되어 있는 기판을 포함하는 것일 수 있고, 형광표식 프로브를 제작하기 위한 시약, 제제, 효소 등을 추가적으로 포함할 수 있다. 또한, 상기 기판은 대조군 폴리뉴클레오티드 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드를 포함할 수 있으나, 이에 제한되지 않는다.
상기 단백질 칩은 본 출원의 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 특이적으로 인식하는 항체를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 뿌리 썩음병 진단 방법을 제공한다.
하나의 구체예에서, 시료를 채취하는 단계; 및 채취된 시료에서 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출하는 단계를 포함하는, 뿌리 썩음병 진단 방법을 제공한다. 상기 단편은 서열번호 8 내지 14 중 어느 하나의 염기서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
상기 시료는 Ganoderma boninense 미생물에 의한 오염을 판단할 수 있는 한, 제한없이 이용될 수 있으나, 토양, 식물체 등이 될 수 있고, 토양 시료의 경우, 시료의 채취 깊이, 채취 방법 등은 제한되지 않는다.
또한, 상기 검출은 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 중합효소반응(real time RT-PCR), 실시간 역전사효소 중합효소반응(real time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting), 유전자　칩, 및 이들의 조합으로 이루어진 군에서 선택된 방법으로 수행될 수 있으나, 이에 제한되지 않는다.
본 출원의 진단 방법의 한 예로서,
(a) 시료를 채취하는 단계;
(b) 시료에서 게놈 DNA를 분리하는 단계; 및
(c) 상기 분리된 게놈 DNA를 주형으로 하여, 본 출원의 마커를 검출하기 위한 프라이머 세트를 이용하는 실시간 PCR을 수행하여 마커를 검출하는 단계를 포함하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 진단 방법은, (d) 대조군 시료에서 본 출원의 마커를 검출하는 단계를 추가로 포함하거나, 또는, (e) 상기 대조군 시료에서 검출된 본 출원의 마커와 (c) 단계에서 확인된 시료 내 마커의 검출 결과와 비교하는 단계를 추가로 포함하는 것일 수 있으나, 이에 제한되지 않는다. 본 출원의 마커 검출 방법은 마커를 증폭한 후 증폭된 마커를 검출하는 것일 수 있으나, 당업계에 알려진 마커 검출 방법이라면 특정 방법에 제한되지 않는다. 상기 검출 결과는 증폭된 폴리뉴클레오티드 또는 이의 단편의 양일 수 있으나, 이에 제한되지 않는다. 상기 대조군 시료는 Ganoderma boninense 미생물이 존재하지 않는 시료, 또는 뿌리 썩음병이 발병하지 않은 시료 등이 될 수 있으나, 이에 제한되지 않는다.
더 나아가, 본 출원의 진단 방법은 (f) 대조군 시료와 시료 내 증폭된 폴리뉴클레오티드 또는 그의 단편의 양을 비교하여, Ganoderma boninense 미생물이 특이적으로 갖는 폴리뉴클레오티드 또는 그의 단편의 양이 증가할 경우, 뿌리 썩음병에 걸린 것으로 진단하는 단계를 추가로 포함할 수 있으나, 이에 제한되지 않는다.
본 출원에서, 시료 또는 시료 내 포함된 미생물에서 게놈 DNA를　분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, wizard prep 키트 (Promega)를 이용할 수도 있다. 상기　분리된 게놈 DNA를 주형으로 하고, 프라이머를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응 (PCR), 리가아제 연쇄반응 (ligase chain reaction), 핵산 서열 기재 증폭 (nucleic acid sequence-based amplification), 전사 기재 증폭 시스템 (transcription-based amplification system), 가닥 치환 증폭 (strand displacement amplification) 또는 Qβ 복제효소 (replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.
실시간 PCR은 각 PCR을 지수함수적으로 증가하는 범위 내에서 비교하기 위해 매 시기의 PCR 진행 상황을 실시간으로 모니터링하는 방법이다. DNA 정량기법인 실시간 PCR 방법은 열순환기 (thermal cycler)와 분광 형광광도계가 일체화된 장치를 이용하여 실시간으로 PCR 증폭 산물의 생성 과정을 관찰함으로써 최초의　시료에 존재하는 표적 DNA 양을 정량하는 방법이다. 실시간 PCR은 미생물　배양에 기초할 수밖에 없었던 기존의 미생물　정성 및 정량 방법을 대체하여 미생물의　분리　및 배양을 수행하지 않고서도 미생물의 정성 및 정량을 가능하게 한다.
실시간 PCR 방법은 절대 정량 (absolute quantification)과 상대 정량 (relative quantification) 분석으로 구분되는데,　시료　내의 표적 DNA를 정량하기 위해서는 표준시료의 검량선 (표준곡선; standard curve) 작성이 필수적인 요소이다. 표준시료와 미지시료를 대상으로 동시에 정량적 실시간 PCR을 실시하여 표준시료로부터 검량선을 도출한 후, 이 검량선으로부터 미지시료　내 표적 DNA의 양을 정량한다. 이때 표준시료로부터의 검량선 (x축: 표준시료의 농도, y축: 역치 주기 수 (CT; threshold cycle))은 상관지수 (R2)가 1에 가까울수록, 기울기가 -3.33에 가까울수록 이상적이다. "정량적 PCR"이란 증폭반응 개시 시의 주형 DNA 양을 정량하기 위한 PCR로서, 반응 중 임의의 시점에서 증폭대상의 분자에 대해 증폭을 확인할 수 있는 PCR을 의미한다. 정량을 위해서는 일반적으로 그와 같은 PCR과 반응 개시 시의 주형 DNA 분자 수와 그 증폭의 지표가 되는 신호를 관련짓는 검량선이 조합된다. 이 검량선은 분자 수가 알려진 표준시료를 이용하여 제작할 수 있다. 상기 검량선은 정량하고자 하는 Ganoderma boninense 미생물의 폴리뉴클레오티드 또는 마커를 표준시료로 하고, 이를 특이적으로 증폭하기 위한 프라이머를 이용하여 정량적 실시간 PCR을 수행함으로써, 표준시료의 증폭으로부터 작성된 검량선을 기준으로　시료　내 존재하는 표적 폴리뉴클레오티드 또는 마커의 역치 주기 수 (CT)를 확인하는 것일 수 있다.
또한, 상기 증폭된 표적 서열은 검출 가능한 표지　물질로 표지될 수 있다. 상기 표지　물질은 바람직하게는 형광을 발하는　물질일 수 있으나, 이에 제한되지 않는다. 현재 실시간 PCR에 사용되는 검출 방법 (detection chemistry)은 일반적으로 Sybr Green I을 이용하는 비특이적 방법과 혼성화 프로브 (hybridization probe)를 이용하는 특이적 방법으로 나뉜다. Sybr Green I은 이중나선 DNA에 비특이적으로 결합하여 형광을 방출하며 실시간 PCR 기기는 이 형광의 양을 측정하여 DNA의 양을 확인할 수 있다. 혼성화 프로브는 특이적으로 상보적인 염기서열에 혼성화되어 PCR 반응 중에 형광을 방출한다. 예를 들어, 대표적인 혼성화 프로브로서 택맨 프로브 (taqman probe, dual labeled fluorogenic probe)는 5'-말단에는 형광 리포터가, 3'-말단에는 소광제 (quencher)가 결합되어 있다. 택맨 프로브의 형광 리포터는 소광제와 근접하여 존재하는 경우, 형광이 상쇄되어 검출되지 않는다. 택맨 프로브가 특이적 표적 염기서열에 혼성화되어 PCR 증폭이 진행되면 Taq DNA 폴리머라제의 5'-3' 엑소뉴클레아제 (exonuclease) 활성에 의해 택맨 프로브가 분해되면서 형광 리포터가 자유롭게 방출되고, 그로 인해 소광제와 멀어지면서 형광을 발산하게 된다. 이를 측정하여 실시간으로 표적 DNA 조각의 생성량을 모니터링하는 것이다.
구체적으로, 본 출원의 방법에서 이용하는 프라이머 쌍은 서열번호 15 및 16의 염기서열로 이루어진 프라이머 쌍; 서열번호 17 및 18의 염기서열로 이루어진 프라이머 쌍; 서열번호 19 및 20의 염기서열로 이루어진 프라이머 쌍; 서열번호 21 및 22의 염기서열로 이루어진 프라이머 쌍; 서열번호 23 및 24의 염기서열로 이루어진 프라이머 쌍; 서열번호 25 및 26의 염기서열로 이루어진 프라이머 쌍; 서열번호 27 및 28의 염기서열로 이루어진 프라이머 쌍; 또는 서열번호 29 및 30의 염기서열로 이루어진 프라이머 쌍일 수 있고, 본 출원의 방법의 폴리뉴클레오티드 또는 이의 단편을 검출하는 단계는 서열번호 15 및 16의 염기서열로 이루어진 프라이머 쌍; 서열번호 17 및 18의 염기서열로 이루어진 프라이머 쌍; 서열번호 19 및 20의 염기서열로 이루어진 프라이머 쌍; 서열번호 21 및 22의 염기서열로 이루어진 프라이머 쌍; 서열번호 23 및 24의 염기서열로 이루어진 프라이머 쌍; 서열번호 25 및 26의 염기서열로 이루어진 프라이머 쌍; 서열번호 27 및 28의 염기서열로 이루어진 프라이머 쌍; 또는 서열번호 29 및 30의 염기서열로 이루어진 프라이머 쌍을 이용한 PCR(Polymerase chain reaction)을 통해 수행되는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 Ganoderma boninense 미생물 검출용 조성물을 제공한다.
하나의 구체예에서, 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출할 수 있는 제제를 포함하는, Ganoderma boninense 미생물 검출용 조성물을 제공한다.
본 출원의 Ganoderma boninense 미생물 검출용 조성물은 시료(예를 들어, 토양)가 Ganoderma boninense 미생물에 의해 오염되었는지 여부를 판별하는 데 이용될 수 있으며, 구체적으로는 본 출원의 마커를 검출하는데 이용될 수 있다.
본 출원의 또 다른 하나의 양태는 Ganoderma boninense 미생물 검출 방법을 제공한다.
하나의 구체예에서, 채취된 시료에서 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출하는 단계를 포함하는, Ganoderma boninense 미생물 검출 방법을 제공한다.
본 출원의 Ganoderma boninense 미생물 검출 방법은 본 출원의 마커, 또는 조성물을 이용하여 시료 내 Ganoderma boninense 미생물이 존재하는지 여부를 검출하는 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 뿌리 썩음병 진단 용도를 제공한다.
하나의 구체예에서, (i) 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편의 뿌리 썩음병 진단 용도; 또는 (ii) 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출할 수 있는 제제의 뿌리 썩음병 진단 용도를 제공한다.
본 출원의 또 다른 하나의 양태는 Ganoderma boninense 미생물 검출 용도를 제공한다.
하나의 구체예에서, (i) 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편의 Ganoderma boninense 미생물 검출 용도; 또는 (ii) 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출할 수 있는 제제의 Ganoderma boninense 미생물 검출 용도를 제공한다.
이하, 본 출원을 실시예를 들어 상세히 설명하고자 하나, 이는 본 출원의 이해를 돕기 위한 것일 뿐, 본 출원의 범위가 이에 한정되는 것은 아니다.
실시예 1: Ganoderma boninense 균의 서열 추출 및 특이적 마커 발굴
본 발명자들은 뿌리 썩음병의 주원인으로 알려져 있는 Ganoderma boninense 미생물을 특이적으로 검출할 수 있는 마커를 발굴하고자 하였다.
이에, Ganoderma boninense은 직접 미생물의 DNA 서열을 확보하여, 확보된 서열로부터 Ganoderma boninense 미생물을 검출하기 위한 특이적 마커를 발굴 및 개발하였다.
구체적으로, NGS (Next Generation Sequencing) 시퀀싱을 통해 본 발명자들이 확보한 Ganoderma boninense 균주의 DNA 서열(2,544contig, 95,911,849bp), NCBI(https://www.ncbi.nlm.nih.gov/)의 nt database (178,448,606,127bp)에 공지된 Ganoderma 속 미생물의 DNA 서열, 및 Ganoderma 속이 아닌 fungi 균주의 DNA 서열(2,391개 strain, 80,288,864,015bp) 정보를 확보하였다.
이후, 본 발명자들이 확보한 토양 샘플 중, metagenome 분석 결과 Ganoderma 속 미생물이 존재하지 않는 것으로 확인된 토양의 gDNA서열을 NGS를 통해 확보하였다(7,724,586,454bp).
이후, NCBI 데이터베이스 내 Ganoderma boninense에 속하지 않는 미생물과 말레이시아 토양 DNA에서 확보한 미생물 서열을 비교하여 Ganoderma boninense 미생물 특이적인 마커인 Ganoderma boninense 유래의 서열번호 1 내지 7의 서열을 발굴하였다.
실시예 2: Ganoderma boninense 균 특이적 마커를 이용한 뿌리 썩음병의 진단
상기 실시예 1에서 확보한 마커를 이용하여 토양에서 직접 Ganoderma boninense 미생물을 검출할 수 있는지 확인하였다.
이를 위해, 본 출원의 서열번호 1 내지 7 중 어느 하나의 마커를 검출하기 위한 프라이머를 제작하였으며, 상기 프라이머가 결합하는 Ganoderma boninense 미생물 특이적 서열 내 영역은 각각 서열번호 8 내지 14의 서열과 같다.
상기 서열번호 1 내지 14의 영역을 검출하기 위한 프라이머 정보는 다음의 표 1과 같다.
마커 및 단편 정보 프라이머 정보
마커 서열번호 단편 서열번호 서열번호 서열
1 8 15 Forward ATACGCTATATGCAATTTCGAACCG
16 Reverse CGTATTCGAATACTCTCAATCTGCG
2 9 17 Forward GAGGAGATCGAGGACAATCTTTGTA
18 Reverse TACCTTTGAAGCGATATCAGCACTA
3 10 19 Forward GGGTGAGTCTTGACATTGTACAAAT
20 Reverse CGTGTTACCCTCCTCTTTCACTTAT
21 Forward GGGTGAGTCTTGACATTGTACAAATT
22 Reverse CGTGTTACCCTCCTCTTTCACTTAT
4 11 23 Forward ATACTCACGTTGGTTTACGCCTAAA
24 Reverse CCTCACAATGAGCATCTTAGACCTA
5 12 25 Forward TCTCGACATGTGCGATATTCCATAT
26 Reverse CAAAAAGTGGATCCTAGAGAAACGG
6 13 27 Forward GCATAAGAACCAATCTCGACTACAG
28 Reverse ACGGTAAATCATGCCAACATTTTCT
7 14 29 Forward CCCAAAGCCTTTTATACCGGGTATA
30 Reverse AGCCTCTCAACCTAGTGGAAATTAG
상기 서열번호 15 및 16의 염기서열로 이루어진 프라이머 쌍; 서열번호 17 및 18의 염기서열로 이루어진 프라이머 쌍; 서열번호 19 및 20의 염기서열로 이루어진 프라이머 쌍; 서열번호 21 및 22의 염기서열로 이루어진 프라이머 쌍; 서열번호 23 및 24의 염기서열로 이루어진 프라이머 쌍; 서열번호 25 및 26의 염기서열로 이루어진 프라이머 쌍의 염기서열로 이루어진 프라이머 쌍; 서열번호 27 및 28의 염기서열로 이루어진 프라이머 쌍; 또는 서열번호 29 및 30의 염기서열로 이루어진 프라이머 쌍을 이용하여, 토양에서 Ganoderma boninense 균에 의한 감염 여부를 진단할 수 있는지 확인하였다.
구체적으로, 말레이시아에서 채취한 Ganoderma boninense에 오염된 토양 샘플에서 얻어진 토양 DNA 300~500ng 또는 genomic DNA (G.boninense 또는 Ganoderma 속 미생물이 아닌 다른 fungi) 1~20ng을 AccuPowr® PriFi Taq PCR PreMix 튜브에 넣고, 10 pmol/uL의 서열번호 15 및 16의 프라이머를 1uL 첨가하였다. 이후, 증류수를 넣어 전체 volume이 20uL이 되도록 하고, Blue pellet을 잘 녹인 다음에 spin down하였다. 이후, Thermocycler에 setting한후 다음과 같은 조건에서 PCR을 진행하였다.
95℃에서 5분후 95℃에서 20초, 60℃에서 30초, 68℃에서 1분간 30~50cycle을 돌린다. 이후 68℃에서 5분간 두었다.
온도 시간 Cycles
95°C 5분 1cylces
95°C 20초 30~50cylces
60°C 30초
68°C 1분
68°C 5분 1cylces
PCR 반응이 끝난 후, 4℃에서 유지시키고, 1% agrose gel에 20uL를 모두 로딩하여 전기영동으로 PCR 산물을 분석하였다. 얻어진 PCR 산물로부터 Ganoderma boninense 미생물의 존재 여부를 확인하고, PCR 산물의 밴드 강도 (band intensity)로부터 상기 Ganoderma boninense 균에 의한 토양의 오염정도를 확인하였다.
또한, 상기 서열번호 15 및 16의 프라이머와 동일한 방법으로 서열번호 17 및 18의 프라이머; 서열번호 19 및 20의 프라이머; 서열번호 21 및 22의 프라이머; 서열번호 23 및 24의 프라이머; 및 서열번호 25 및 26의 프라이머; 서열번호 27 및 28의 프라이머; 및 서열번호 29 및 30의 염기서열의 프라이머를 이용하여 PCR을 진행하고 오염 정도를 확인하였다(도 1).
도 1의 각 레인이 나타내는 바는 다음과 같다. 레인 8은 DNA ladder를, 레인 1 내지 7 및 9는 뿌리썩음병이 발생한 토양 DNA를 이용한 PCR 산물을 나타내며, 레인 1은 서열번호 1 또는 8 영역을 검출하기 위하여 서열번호 15 및 16의 프라이머를 이용한 PCR 산물; 레인 2는 서열번호 2 또는 9 영역을 검출하기 위하여 서열번호 17 및 18의 프라이머를 이용한 PCR 산물; 레인 3은 서열번호 3 또는 10 영역을 검출하기 위하여 서열번호 19 및 20의 프라이머를 이용한 PCR 산물; 레인 4는 서열번호 3 또는 10 영역을 검출하기 위하여 서열번호 21 및 22의 프라이머를 이용한 PCR 산물; 레인 5는 서열번호 4 또는 11 영역을 검출하기 위하여 서열번호 23 및 24의 프라이머를 이용한 PCR 산물; 레인 6은 서열번호 5 또는 12 영역을 검출하기 위하여 서열번호 25 및 26의 프라이머를 이용한 PCR 산물; 레인 7은 서열번호 6 또는 13 영역을 검출하기 위하여 서열번호 27 및 28의 프라이머를 이용한 PCR 산물; 레인 9는 서열번호 7 또는 14 영역을 검출하기 위하여 서열번호 29 및 30의 프라이머를 이용한 PCR 산물을 나타낸다.
도 1의 결과로부터, 본 출원의 마커를 이용하여 Ganoderma boninense 균에 의한 뿌리썩음병을 검출할 수 있음을 확인하였다.
상술한 실시예로부터, 본 발명자들은 Ganoderma boninense 미생물이 특이적으로 갖는 신규 마커를 발굴하였을 뿐만 아니라, 토양에서 Ganoderma boninense 균에 의한 뿌리 썩음병 감염 여부를 진단할 수 있음을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.

Claims (16)

  1. 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴틀레오티드, 이의 상보적인 폴리뉴틀레오티드, 또는 이의 단편을 검출할 수 있는 제제를 포함하는, 뿌리 썩음병 진단용 조성물.
  2. 제1항에 있어서, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편은 Ganoderma boninense 미생물이 특이적으로 갖는 것인, 조성물.
  3. 제1항에 있어서, 상기 제제는 프로브, 프라이머 쌍, 항체, 앱타머, 및 올리고뉴클레오티드로 이루어진 군에서 선택되는 어느 하나인 것인, 조성물.
  4. 제1항에 있어서, 상기 단편은 서열번호 8 내지 14 중 어느 하나의 염기서열을 포함하는 것인, 조성물.
  5. 제3항에 있어서, 상기 프라이머 쌍은 서열번호 15 및 16의 염기서열로 이루어진 프라이머 쌍; 서열번호 17 및 18의 염기서열로 이루어진 프라이머 쌍; 서열번호 19 및 20의 염기서열로 이루어진 프라이머 쌍; 서열번호 21 및 22의 염기서열로 이루어진 프라이머 쌍; 서열번호 23 및 24의 염기서열로 이루어진 프라이머 쌍; 서열번호 25 및 26의 염기서열로 이루어진 프라이머 쌍; 서열번호 27 및 28의 염기서열로 이루어진 프라이머 쌍; 또는 서열번호 29 및 30의 염기서열로 이루어진 프라이머 쌍인 것인, 조성물.
  6. 제1항에 있어서, 상기 뿌리 썩음병은 Ganoderma boninense 미생물에 의해 발병하는 것인, 조성물.
  7. 제1항 내지 제6항 중 어느 한 항의 조성물을 포함하는 뿌리 썩음병 진단용 키트.
  8. 제1항 내지 제6항 중 어느 한 항의 조성물을 포함하는 뿌리 썩음병 진단용 칩.
  9. 시료를 채취하는 단계; 및 채취된 시료에서 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴틀레오티드, 또는 이의 단편을 검출하는 단계를 포함하는, 뿌리 썩음병 진단 방법.
  10. 제9항에 있어서, 상기 단편은 서열번호 8 내지 14 중 어느 하나의 염기서열을 포함하는 것인, 방법.
  11. 제9항에 있어서, 상기 폴리뉴클레오티드 또는 이의 단편을 검출하는 단계는 서열번호 15 및 16의 염기서열로 이루어진 프라이머 쌍; 서열번호 17 및 18의 염기서열로 이루어진 프라이머 쌍; 서열번호 19 및 20의 염기서열로 이루어진 프라이머 쌍; 서열번호 21 및 22의 염기서열로 이루어진 프라이머 쌍; 서열번호 23 및 24의 염기서열로 이루어진 프라이머 쌍; 서열번호 25 및 26의 염기서열로 이루어진 프라이머 쌍; 서열번호 27 및 28의 염기서열로 이루어진 프라이머 쌍; 또는 서열번호 29 및 30의 염기서열로 이루어진 프라이머 쌍을 이용한 PCR(Polymerase chain reaction)을 통해 수행되는 것인, 방법.
  12. 제9항에 있어서, 상기 채취된 시료에서 증폭된 폴리뉴클레오티드 또는 이의 단편의 양을 측정하는 단계를 추가로 포함하는 것인, 방법.
  13. 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출할 수 있는 제제를 포함하는, Ganoderma boninense 미생물 검출용 조성물.
  14. 채취된 시료에서 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴클레오티드, 이의 상보적인 폴리뉴클레오티드, 또는 이의 단편을 검출하는 단계를 포함하는, Ganoderma boninense 미생물 검출 방법.
  15. 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴틀레오티드, 이의 상보적인 폴리뉴틀레오티드, 또는 이의 단편의 뿌리 썩음병 진단 용도.
  16. 서열번호 1 내지 7 중 어느 하나의 염기서열로 표현되는 폴리뉴클레오티드, 상기 서열번호 1 내지 7 중 어느 하나의 염기서열과 최소 80% 이상의 상동성을 갖는 폴리뉴틀레오티드, 이의 상보적인 폴리뉴틀레오티드, 또는 이의 단편의 Ganoderma boninense 미생물 검출 용도.
PCT/KR2021/006059 2020-06-18 2021-05-14 Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법 WO2021256706A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200074515A KR20220000426A (ko) 2020-06-18 2020-06-18 Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
KR10-2020-0074515 2020-06-18

Publications (1)

Publication Number Publication Date
WO2021256706A1 true WO2021256706A1 (ko) 2021-12-23

Family

ID=79268121

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006059 WO2021256706A1 (ko) 2020-06-18 2021-05-14 Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법

Country Status (2)

Country Link
KR (2) KR20220000426A (ko)
WO (1) WO2021256706A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2000217581A (ja) * 1999-02-02 2000-08-08 Agency Of Ind Science & Technol アブラヤシ土壌病害ガノデルマ属菌を検出するためのオリゴヌクレオチド及び方法
WO2010115162A2 (en) * 2009-04-03 2010-10-07 Synthetic Genomics, Inc. Compositions of volatile organic compounds and methods of use thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001314199A (ja) 2000-05-09 2001-11-13 Mitsubishi Chemicals Corp オイルパーム病害菌ガノデルマ・ボニネンセの検出法及び検出用プライマー
KR102147340B1 (ko) 2019-02-20 2020-08-25 씨제이제일제당 주식회사 Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2000217581A (ja) * 1999-02-02 2000-08-08 Agency Of Ind Science & Technol アブラヤシ土壌病害ガノデルマ属菌を検出するためのオリゴヌクレオチド及び方法
WO2010115162A2 (en) * 2009-04-03 2010-10-07 Synthetic Genomics, Inc. Compositions of volatile organic compounds and methods of use thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
C. UTOMO: "Development of diagnostic methods for detecting Ganoderma- infected oil palms", JOURNAL OF PHYTOPATHOLOGY, vol. 148, 1 January 2000 (2000-01-01), pages 507 - 514, XP055734972, DOI: 10.1046/j.1439-0434.2000.00478.x *
MUTHUSAMY KARTHIKEYAN, KRISHNAN RADHIKA , RAMANUJAM BHASKARAN , SUBRAMANIAN MATHIYAZHAGAN, RAMASAMY SAMIYAPPAN AND RETHINASAMY VE: "Rapid Detection of Ganoderma Disease of Coconut and Assessment of Inhibition Effect of Various Control Measures by Immunoassay and PCR", PLANT PROTECT. SCI, 1 January 2006 (2006-01-01), pages 49 - 57, XP055732427, Retrieved from the Internet <URL:https://www.agriculturejournals.cz/publicFiles/15519.pdf> DOI: 10.17221/2771-PPS *
RA AKUL YUSHAHFI, KUMAR VIJAY, CHONG KHIM PHIN: "Designing primers for loop-mediated isothermal amplifi cation (LAMP) for detection of Ganoderma boninense", BULGARIAN JOURNAL OF AGRICULTURAL SCIENCE, vol. 24, no. 5, 1 January 2018 (2018-01-01), pages 854 - 859, XP055881972 *

Also Published As

Publication number Publication date
KR20220047550A (ko) 2022-04-18
KR20220000426A (ko) 2022-01-04
KR102492587B1 (ko) 2023-01-27

Similar Documents

Publication Publication Date Title
Kong et al. secA1 gene sequence polymorphisms for species identification of Nocardia species and recognition of intraspecies genetic diversity
WO2011025262A2 (ko) 결핵균군 및 마이코박테리아 속 구분 검출용 조성물 및 이를 이용한 실시간 다중 중합효소 연쇄반응에 의한 결핵균 및 마이코박테리아 속의 동시 분석 방법
Bertaccini et al. Standard detection protocol: PCR and RFLP analyses based on 16S rRNA gene
WO2014157176A1 (ja) アシネトバクター属菌の遺伝型タイピング法及びこれに用いるプライマーセット
Ciantar et al. Molecular identification of Capnocytophaga spp. via 16S rRNA PCR-restriction fragment length polymorphism analysis
WO2020171596A1 (ko) 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2021177773A2 (ko) Sars-cov-2 진단용 조성물, 키트 및 이를 이용한 sars-cov-2의 진단방법
Couzinet et al. High-density DNA probe arrays for identification of staphylococci to the species level
WO2021256706A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2020171595A1 (ko) 가노더마 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2020171604A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2020171603A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
WO2020171598A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
KR20210046887A (ko) 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트
EP2421969B1 (en) Selective detection of bordetella species
JP4648023B2 (ja) ジャガイモそうか病原因菌種の１６ＳｒＲＮＡ遺伝子若しくは１６ＳｒＲＮＡ遺伝子からＩＴＳ領域間を増幅するための新規プライマー対、及びそれらを用いたジャガイモそうか病原因菌種の検出・識別方法
JP6873903B2 (ja) 強毒型クロストリジウムディフィシル株の存在を検出するための方法
KR101967735B1 (ko) 제한효소 절편길이 다형성을 이용한 종특이적 김 붉은갯병균 결정방법
KR102461769B1 (ko) 레몬 품종 선별용 마커 및 이의 용도
Bretagne Molecular detection and characterization of fungal pathogens
JP2013146244A (ja) 緑膿菌の遺伝子型別分類法およびこれに用いるプライマーセット
JP2019004811A (ja) Ｃｌｏｓｔｒｉｄｉｕｍ ｄｉｆｆｉｃｉｌｅの遺伝子型タイピング法及びこれに用いるプライマーセット
WO2020257987A1 (en) Snp markers of drug reduced susceptibility related evolutionary branches of clostridium difficile, method for identifying strain category, and use thereof
CN105400877A (zh) 一种基于免疫酶联反应的基因组snp位点检测方法
KR20240086777A (ko) 박과 감염 황화 바이러스의 다중 진단용 프라이머 세트 및 이를 이용한 진단 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21824857

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21824857

Country of ref document: EP

Kind code of ref document: A1