WO2021215617A1 - 폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물. - Google Patents

폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물. Download PDF

Info

Publication number
WO2021215617A1
WO2021215617A1 PCT/KR2020/018989 KR2020018989W WO2021215617A1 WO 2021215617 A1 WO2021215617 A1 WO 2021215617A1 KR 2020018989 W KR2020018989 W KR 2020018989W WO 2021215617 A1 WO2021215617 A1 WO 2021215617A1
Authority
WO
WIPO (PCT)
Prior art keywords
coronavirus
bat
virus
polyphosphate
hcov
Prior art date
Application number
PCT/KR2020/018989
Other languages
English (en)
French (fr)
Inventor
김홍렬
졸로마시모
윤경섭
공대영
페루시베로니카
정재호
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2021215617A1 publication Critical patent/WO2021215617A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/42—Phosphorus; Compounds thereof
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N59/00—Biocides, pest repellants or attractants, or plant growth regulators containing elements or inorganic compounds
    • A01N59/26—Phosphorus; Compounds thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/20—Inorganic substances, e.g. oligoelements
    • A23K20/26—Compounds containing phosphorus
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/16—Inorganic salts, minerals or trace elements
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/19—Cosmetics or similar toiletry preparations characterised by the composition containing inorganic ingredients
    • A61K8/24—Phosphorous; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2/00—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor
    • A61L2/16—Methods or apparatus for disinfecting or sterilising materials or objects other than foodstuffs or contact lenses; Accessories therefor using chemical substances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/10—Washing or bathing preparations
    • C—CHEMISTRY; METALLURGY
    • C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
    • C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
    • C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
    • C11D3/48—Medical, disinfecting agents, disinfecting, antibacterial, germicidal or antimicrobial compositions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system

Definitions

  • the present invention relates to a composition capable of effectively preventing a coronavirus infection or a disease caused by the infection, and to a composition for disinfection or cleaning in addition.
  • Coronavirus is a representative virus that causes lethal infectious diseases in modern civilization. Middle East Respiratory Syndrome (MERS), also known as MERS, spread from the Middle East to the world, resulting in a death rate of about 36%.
  • MERS Middle East Respiratory Syndrome
  • Coronavirus disease 19 COVID-19
  • SARS Severe acute respiratory syndrome coronavirus 2
  • -CoV-2 Severe acute respiratory syndrome coronavirus 2
  • Coronavirus Infectious Disease-19 is transmitted when droplets (saliva) of an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, and mouth. After infection, after an incubation period of about 2 to 14 days (estimated), the main symptoms are fever (37.5 degrees), respiratory symptoms such as cough or shortness of breath, and pneumonia. reach
  • One object of the present invention is to provide a composition for various uses that can prevent infection by coronavirus or various diseases caused by the infection.
  • Another object of the present invention is to provide a disinfecting or cleaning composition having inhibitory activity against coronavirus.
  • One embodiment of the present invention relates to a composition for preventing viral infection or infectious disease, comprising polyphosphate as an active ingredient.
  • the polyphosphate (polyphosphate); Or it relates to a method for preventing a viral infection or an infectious disease, comprising administering a pharmaceutically acceptable salt thereof.
  • polyphosphate (PolyP) of the present invention is a linear polymer of orthophosphate linked by phosphate anhydride bonds. Localized in the lysosomes, granules, mitochondria, and nucleus of mammalian cells. At physiological pH, each internal unit has a monovalent negative charge, so the polymer is highly anionic.
  • the anionicity led to the discovery that polyphosphate can provide a physiological anionic surface for factor XII, particularly through activation of coagulation cascades such as prekallikrein and HMW kininogen. It has been found to accelerate thrombin-mediated activation to induce coagulation and enhance fibrin polymerization.
  • the polyphosphate may have a phosphate unit of 2 or more and 200 or less, preferably 2 or more and 9 or less, or 100 or more and 200 or less, More preferably 100 or more and less than 125, 125 It may be 130 or more, 130 or more and less than 140, 140 or more and 150 or less, 160 or more and 170 or less, or 180 or more and 190 or less, and more preferably 8, 120, 126, 137, 145, 162 or 189, and most preferably may be 8, 120 or 126, but is not limited thereto.
  • the polyphosphate may be included in the composition at a concentration of 5 ⁇ M or more and 100 ⁇ M or less, preferably 10 ⁇ M or more and 50 ⁇ M or less.
  • concentration of the polyphosphate is less than 5 ⁇ M, the effect of addition of the polyphosphate may be insignificant, and when the concentration exceeds 100 ⁇ M, it is difficult to expect any more synergistic effect according to the addition, and the efficiency of the addition may be reduced.
  • the pharmaceutically acceptable salts are salts generally considered by those skilled in the art to be suitable for medical applications (eg, since such salts are not harmful to the subject to be treated with the salts), or each salts that cause acceptable side effects within the treatment of
  • the pharmaceutically acceptable salts are salts considered acceptable by regulatory authorities such as the United States Food and Drug Administration (FDA), European Medicines Agency (EMA), or the Pharmaceutical and Medical Devices Agency (PMDA) of the Ministry of Health, Labor and Welfare of Japan.
  • FDA United States Food and Drug Administration
  • EMA European Medicines Agency
  • PMDA Pharmaceutical and Medical Devices Agency
  • the present invention in principle provides an intermediate, for example in the preparation of a compound according to the invention or a physiologically functional derivative thereof, or a pharmaceutically acceptable salt of a compound according to the invention or a physiologically functional derivative thereof.
  • salts of the compounds according to the invention which are not themselves pharmaceutically acceptable.
  • Said salts include water-insoluble salts, in particular water-soluble salts.
  • a particular compound according to the invention or a physiologically functional derivative thereof is capable of forming a salt, ie whether said compound according to the invention or a physiologically functional derivative thereof is, for example
  • Exemplary salts of the compounds of the present invention are acid addition salts or salts with bases, particularly pharmaceutically acceptable inorganic and organic acid addition salts and salts with bases commonly used in pharmaceuticals, which are water-insoluble or particularly water-soluble acid addition salts. is salt Depending on the substituents of the compounds of the present invention, salts with bases may also be suitable. Acid addition salts are prepared, for example, by combining a solution of a compound of the present invention with a solution of a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, citric acid, tartaric acid, carbonic acid or phosphoric acid. It can be formed by mixing.
  • a pharmaceutically acceptable acid such as hydrochloric acid, sulfuric acid, fumaric acid, maleic acid, succinic acid, acetic acid, benzoic acid, citric acid, tartaric acid, carbonic acid or phosphoric acid. It can be formed by mixing.
  • pharmaceutically acceptable base addition salts include alkali metal salts (eg, sodium or potassium salts); alkaline earth metal salts (eg, calcium or magnesium salts); and salts formed with suitable organic ligands (e.g., ammonium, quaternary ammonium and amines formed with counter anions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl sulfonates and aryl sulfonates) cations) may be included.
  • suitable organic ligands e.g., ammonium, quaternary ammonium and amines formed with counter anions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl sulfonates and aryl sulfonates
  • Illustrative examples of pharmaceutically acceptable salts include acetate, adipate, alginate, arginate, ascorbate, aspartate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, butyrate, calcium edetate, camphorate, camphorsulfonate, camsylate, carbonate, chloride, citrate, digluconate, dihydrochloride, dodecylsulfate, edetate, edisylate, ethanesulfonate, Formate, fumarate, galactate, galacturonate, gluconate, glutamate, glycerophosphate, hemisulphate, heptanoate, hexanoate, hexylresorcinate, hydrobromide, hydrochloride, hydroiodide , 2-hydroxy-ethanesulfonate, hydroxynaphthoate
  • Salts which are not pharmaceutically acceptable in the present invention and which, for example, can be obtained as process products during the preparation of the compounds according to the invention on an industrial scale, are also included in the invention and, if desired, are known to the person skilled in the art. It can be converted into a pharmaceutically acceptable salt by a method.
  • the virus may be an RNA virus.
  • the "RNA virus” refers to any virus using RNA as a genetic material.
  • the RNA virus is Coronaviridae, Amalgaviridae, Birnaviridae, Chrysoviridae, Cystoviridae, Endornaviridae ( Endornaviridae), Hypoviridae, Megabirnaviridae, Partitiviridae, Picobirnaviridae, Reoviridae, Totiviridae, Quadriviridae, Arteriviridae, Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Marnaviridae Marnaviridae, Picornaviridae, Secoviridae, Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae ), Bornaviridae, Filoviridae, Paramyx
  • the "coronavirus (Coronavirus)” has four genera (alpha, beta, gamma, delta) in the coronavirus subfamily (Coronavirinae) of the Coronaviridae, and a gene size of 27 to 32kb as an RNA virus. It is known to cause respiratory and digestive system infections in humans and animals. It is easily infected mainly through mucosal transmission and droplet transmission. Humans generally cause mild respiratory infections, but rarely fatal infections. Diarrhea in cattle and pigs, and respiratory diseases in chickens. Among coronaviruses, coronaviruses that host humans are divided into the classifications in Table 1 below (Centers for Disease Control and Prevention, 2020). Among the four genera, alpha and beta infect humans and animals, and gamma and delta are reported to infect only animals.
  • coronaviruses infecting humans in Table 2 below, and types that cause colds (229E, OC43, NL63, HKU1) and types that cause severe pneumonia (SARS-CoV, SARS-CoV2, MERS) -CoV).
  • Virus name Genus host Symptom HCoV-229E Alpha Human mild respiratory symptoms HCoV-NL63 Alpha Human mild respiratory symptoms SARS-CoV Beta Human severe respiratory symptoms MERS-CoV Beta Human severe respiratory symptoms HCoV-OC43 Beta Human mild respiratory symptoms HCoV-HKU1 Beta Human Pneumonia symptoms SARS-CoV-2 Beta Human Mild respiratory symptoms Severe cases can cause shortness of breath
  • beta coronavirus corresponds to a zoonotic infection as one of the four genus coronaviruses of the subfamily Coronavirus.
  • beta coronaviruses include Severe Acute Respiratory Syndrome virus (SARS; SARS-CoV), Severe Acute Respiratory Syndrome virus-2 (SARS-CoV-2), Middle East Respiratory Middle East Respiratory Syndrome virus (MERS; MERS-CoV), human coronavirus OC43 (HCoV-OC43), or human coronavirus HKU1 (HCoV-HKU1) are known to exist.
  • the "Severe Acute Respiratory Syndrome virus-2 (SARS-CoV-2)" is an enveloped, positive-polar single-stranded RNA beta coronavirus belonging to the Coronaviridae family. .
  • the coronaviruses that historically infect humans are severe common cold viruses, including hCoV-OC43, HKU and 229E5.
  • nucleocapsid protein includes N1, N2 and N3 fragments.
  • the coronavirus includes naturally or artificially mutated variants.
  • the infectious disease caused by the coronavirus is coronavirus enteritis, coronavirus diarrhea, severe acute respiratory syndrome coronavirus (SARS), Middle East respiratory syndrome (MERS), or these It may be a combination of, but may be included without limitation if it is a disease that can be caused by the coronavirus infection.
  • coronavirus enteritis coronavirus diarrhea
  • severe acute respiratory syndrome coronavirus SARS
  • MERS Middle East respiratory syndrome
  • the infectious disease may be a respiratory disease, hepatitis, gastroenteritis or encephalitis caused by the viral infection.
  • the respiratory disease may be one that causes Severe Acute Respiratory Syndrome (SARS).
  • SARS Severe Acute Respiratory Syndrome
  • the Severe Acute Respiratory Syndrome is a disease that can cause upper or lower respiratory tract infections, which can cause sudden fever, cough, and shortness of breath, and can progress to pneumonia and even lead to death.
  • composition of the present invention may be used alone or in combination with conventional antiviral agents, or may be used in combination with biological agents such as antiserum.
  • the polyphosphate or pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is for humans. .
  • the pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • the route of administration of the compound or pharmaceutical composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal , topical, sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
  • the compound or pharmaceutical composition of the present invention may be determined by several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, degree of disease, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and from 0.0001 to 0.0001 per day 50 mg/kg or 0.001 to 50 mg/kg may be administered. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • the term "individual” refers to a subject who has or is suspected of having a virus infection and needs to prevent viral infection or a disease caused by the infection by suppressing virus activity, etc. means all animals, including humans.
  • administration of the present invention refers to the process of introducing the active ingredient of the present invention to an individual by any suitable method, and the administration method in the treatment method of the present invention is through various routes such as oral or parenteral. may be administered.
  • a specific pharmaceutically effective amount for a target subject includes the type and extent of the reaction to be achieved, the specific composition comprising the active ingredient, including whether other agents are used in some cases, the age of the patient, Body weight, general health status, sex and diet, administration time, administration route and secretion rate of a composition containing the active ingredient, treatment period, various factors including drugs used or used together with a specific composition and well-known in the pharmaceutical field It is preferable to apply differently depending on similar factors.
  • the food composition may be prepared in the form of various foods, for example, beverages, gum, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like.
  • it may be used as a food additive composition necessary for the preparation of the food composition.
  • the amount may be added in a proportion of 0.1 to 50% of the total weight.
  • the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and polysaccharides such as sucrose, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do.
  • flavoring agent examples include natural flavoring agents (taumartin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • the food composition or food composition additive of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • These components may be used independently or in combination.
  • the proportion of these additives is not so important, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention.
  • the composition may be 20 to 90% highly concentrated or may be prepared in powder or granular form.
  • the feed additives include organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid, phosphates such as sodium phosphate, potassium phosphate, and acid pyrophosphate, polyphenols, catechins, alpha-tocopherol, rosemary extract, vitamin C, green tea extract , licorice extract, chitosan, tannic acid, any one or more of natural antioxidants such as phytic acid may be further included.
  • organic acids such as citric acid, humic acid, adipic acid, lactic acid, and malic acid
  • phosphates such as sodium phosphate, potassium phosphate, and acid pyrophosphate
  • polyphenols catechins
  • alpha-tocopherol rosemary extract
  • vitamin C vitamin C
  • green tea extract licorice extract
  • chitosan tannic acid
  • the composition when used as a feed, the composition may be formulated in a conventional feed form, and may include common feed ingredients together.
  • the feed additive and feed include grains such as milled or crushed wheat, oats, barley, corn and rice; plant protein feeds, such as feeds based on rape, soybean and sunflower; animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Sugar and dairy products, for example, may further include dry ingredients made of various powdered milk and whey powder, and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.
  • the polyphosphate when used as the feed additive, it may be administered to an animal alone or in combination with other feed additives in an edible carrier.
  • the feed additives can be easily administered to the animal as a top dressing, directly mixing them into the animal feed, or in an oral formulation separate from the feed.
  • a pharmaceutically acceptable edible carrier as is well known in the art to prepare an immediate release or sustained release formulation.
  • Such edible carriers may be solid or liquid, for example corn starch, lactose, sucrose, soy flakes, peanut oil, olive oil, sesame oil and propylene glycol.
  • the feed additive may be a tablet, capsule, powder, troche or sugar-containing tablet or top dressing in microdispersed form.
  • the feed additive may be in the form of a gelatin soft capsule, or a syrup or suspension, emulsion, or solution.
  • the feed may include any protein-containing organic flour commonly used to meet the dietary needs of animals. Such protein-containing flour typically consists of corn, soy flour, or corn/soy flour mix.
  • the feed composition or feed additive composition may contain, for example, a preservative, a stabilizer, a wetting or emulsifying agent, a solution accelerator, and the like.
  • the feed additive composition may be used by immersion, spraying, or mixing to add to animal feed.
  • polyphosphate (polyphosphate); Or a pharmaceutically acceptable salt thereof as an active ingredient, relates to a composition for disinfection or cleaning having inhibitory activity against viruses.
  • the polyphosphate to the subject relates to a disinfection or cleaning method for a virus, comprising the step of contacting a pharmaceutically acceptable salt thereof.
  • the polyphosphate may have a phosphate unit of 2 or more and 200 or less, preferably 2 or more and 9 or less, or 100 or more and 200 or less, More preferably 100 or more and less than 125, 125 It may be 130 or more, 130 or more and less than 140, 140 or more and 150 or less, 160 or more and 170 or less, or 180 or more and 190 or less, and more preferably 8, 120, 126, 137, 145, 162 or 189, and most preferably may be 8, 120 or 126, but is not limited thereto.
  • the polyphosphate may be included in the composition at a concentration of 5 ⁇ M or more and 100 ⁇ M or less, preferably 10 ⁇ M or more and 50 ⁇ M or less.
  • concentration of the polyphosphate is less than 5 ⁇ M, the effect of addition of the polyphosphate may be insignificant, and when the concentration exceeds 100 ⁇ M, it is difficult to expect any more synergistic effect according to the addition, and the efficiency of the addition may be reduced.
  • the definitions of the virus and pharmaceutically acceptable salts overlap with those described above and are omitted below in order to avoid excessive complexity of the specification.
  • the "disinfection” means to lose or kill the activity of a pathogenic microorganism or a pathogenic virus. Loss of activity includes inhibiting infection, survival, proliferation, transmission, or a combination thereof of a pathogenic microorganism or pathogenic virus.
  • cleaning refers to a method used to facilitate or assist in removing contaminants, bleaching, reducing microbial or viral populations, rinsing, and any combination thereof.
  • the "subject” includes all living or non-living objects (instruments, devices, clothing, tableware, etc.) or hard surfaces thereof that are required to prevent virus infection.
  • the disinfecting composition or cleaning composition comprising the compound in the present invention is useful as a disinfectant and cleaning agent for hospitals and public health to prevent hospital infection. It can be used and can be used for disinfection and cleaning of various items such as general household disinfectants and cleaners, tableware, food cooking equipment, inside buildings, drinking water, vehicles, aircraft, and ships.
  • composition of the present invention when used as a disinfecting composition or a cleaning composition, a pharmacologically, veterinarily or agriculturally acceptable carrier or diluent may be included together.
  • the compound or composition of the present invention may be prepared in any phase of liquid, solid, and gaseous phases.
  • the compound or composition of the present invention may be applied to the human body itself or to various instruments or devices used by humans, and when applied to the human body, it may be administered in any manner, such as orally or parenterally.
  • the compound or composition may be formulated in various forms that can be effectively applied to the human body itself or various instruments or devices, for example, pharmaceutical formulations for oral administration such as tablets, pills, capsules, powder formulations, or sprays ,
  • pharmaceutical formulations for oral administration such as tablets, pills, capsules, powder formulations, or sprays
  • the detergent L gel, liquid, cream, ointment, etc. may include formulations applicable to external preparations or devices and devices, and may preferably be a spray, but is not limited thereto.
  • the "contact" as a method of applying the compound or composition to a subject is a known disinfection or cleaning agent application method is appropriately selected according to the nature of the subject, the surrounding environment, etc., but wiping, dipping, immersion (immersing) or may include the form of spraying, preferably in the form of spraying, but is not limited thereto.
  • composition provided in the present invention has a coronavirus inhibitory activity, not only has a disinfecting or cleaning effect on coronavirus, but also can effectively prevent infection by coronavirus or disease caused by the infection.
  • Figure 2 shows a photograph taken by magnifying the primary cells obtained from the nasal cavity of a healthy person in Preparation Example 2 under a microscope.
  • 5 is a graph showing the results of confirming the change in the expression level of the N1 gene when the cells of the patient infected with Sars-CoV-2 in Experimental Example 3 were treated with the monomer 120 polyphosphate (P120 PolyP).
  • FIG. 6 is a graph showing the results of confirming the change in the expression level of the N2 gene when the cells of the patient infected with Sars-CoV-2 in Experimental Example 3 were treated with the monomer 120 polyphosphate (P120 PolyP).
  • FIG. 7 is a graph showing the results of confirming the change in the expression level of the N3 gene when the cells of the patient infected with Sars-CoV-2 in Experimental Example 3 were treated with the monomer 120 polyphosphate (P120 PolyP).
  • FIG 9 is a graph showing the results of confirming the change in the expression level of the RdRp and E genes when the cells of the patient infected with Sars-CoV-2 in Experimental Example 5 were treated with the monomer 120 polyphosphate (P120 PolyP).
  • FIG. 13 is a graph showing changes in N1, N2 and N3 gene expression levels when primary cells were infected with Sars-CoV-2 MOI of 0.001 in Experimental Example 6 and then treated with a polyphosphate of unit 120 (P120 PolyP). will be.
  • Figure 20 shows the results of immunoblotting analysis (Immunoblotting analyzes) to confirm the expression level of ACE2 when polyphosphate and cycloheximide (CHX) are used together in Experimental Example 11.
  • One object of the present invention is to provide a composition for various uses that can prevent infection by coronavirus or various diseases caused by the infection.
  • Linear polyphosphate was polymerized with sodium phosphate units (NaH 2 PO 4 ⁇ 9.0%; Sigma Aldrich) at 700° C. for 1 hour in an electric furnace (HQ-DMF3; Coretech, Korea). Then, molten sodium polyphosphate was poured into a copper plate and rapidly cooled to pulverize.
  • the process can be represented by the following formula (1).
  • polyphosphates as shown in the chemical formula of FIG. 1 were synthesized.
  • nNaH 2 PO 4 (NaPO 3 ) n + nH 2 O
  • the resulting polymer known as Graham's salt, contains polyphosphate (PolyP) of three mixed molecular structures: linear, cyclic and branched.
  • Polyphosphate PolyP
  • Branched polyphosphates are very unstable, and when dissolved in water, the branching point of these polyphosphates is hydrolyzed regardless of pH, even at room temperature.
  • linear polyphosphates and cyclic polyphosphates (cyclo PolyP) hydrolyze very slowly at neutral pH and room temperature.
  • the hydrolysis half-life for P-O-P bonds of linear polyphosphates at pH 7 at room temperature reaches several years.
  • Synthesized polyphosphates may generally contain very small amounts of cyclic polyphosphates, but cyclic polyphosphates mainly have short chain lengths, so they were not synthesized in this example.
  • the obtained polymers had a wide range of chain lengths to perform fractional precipitation.
  • Sodium polyphosphate powder was dissolved in distilled water (1:10 w/v), the pH was adjusted to 7, and left at 25° C. for 12 hours. Then, acetone was added to the solution for polyphosphate precipitation. The precipitated polyphosphate was partitioned by centrifugation at 4200 rpm for 5 minutes. The fractional precipitation was repeated 25 times, and the obtained polyphosphate fraction was dried for 48 hours.
  • the polyphosphate was fractionated by HPLC system (LC-20AD; Shimadzu, Japan) and multi-angle light scattering detector (miniDawn Treos II; Wyatt Technology, USA).
  • HPLC system was gel permeation chromatography (PL aquagel-OH; 7.5 ⁇ 50 mm; 8 ⁇ m; Agilent Technology, USA) guard column (PL aquagel-OH Mixed-M; 7.5 ⁇ 300 mm; 8 ⁇ m; Agilent Technology, USA).
  • the concentration of the injected polyphosphate sample is 25 mg/mL
  • the injection volume is 50 ⁇ L.
  • the temperature of the column was maintained at 30°C.
  • the chain length (n) of the polyphosphate separated by the above process was determined according to the following formula (2).
  • Mn (average molar mass number) Na n+2 P n O 3n+1
  • human primary cells were obtained through nasal brushing of 3 healthy people, and the results of observing the cells 40 times are shown in FIG. 2 .
  • the primers used for each target gene are shown in Table 3 below.
  • Vero E6 cells infected with SARS-CoV-2 particles obtained from a Korean patient were treated with polyphosphate (P120 PolyP) of monomer 120 at different concentrations (ranging from 9.375 to 37.5 ⁇ M). The results are shown in FIG. 4 .
  • RT-real-time PCR analysis was performed.
  • samples of 8 patients with COVID-19 were treated with 30 ⁇ M of polyphosphate as a monomer 120 (phosphate with a phosphate monomer of 120, P120 PolyP), and vehicle-treated cells were used as a negative control.
  • "CLONIT quanty COVID-19" [Ref. RT-25] (IVD approved) kit and BioRad CFX96 instrument at 25° C., 2 min; 50° C., 15 minutes; 95°C, 2 min; 95°C, 3 seconds; 45 cycles were performed under the conditions of 55° C. and 30 seconds.
  • the cycle threshold (Ct) and fold values of the targets (N1, N2, N3) derived as a result of RT-real-time PCR analysis are shown in FIGS. 5 to 7 and Table 4 .
  • RT-25] (IVD approved) kit and BioRad CFX96 instrument at 25° C., 2 min; 50° C., 15 minutes; 95°C, 2 min; 95°C, 3 seconds; 45 cycles were performed under the conditions of 55° C. and 30 seconds.
  • the results of RT-real-time PCR analysis are shown in FIG. 8 and Table 5.
  • RT-real time PCR analysis was performed.
  • samples of two COVID-19 patients were treated with 30 ⁇ M of polyphosphate of unit 120 (P120 PolyP) and polyphosphate of unit 8 (P8 PolyP), respectively, and vehicle-treated cells were negative. It was used as a control.
  • RNA extraction from the sample using a kit capable of detecting RdRp and E genes (“Ab Analitica”; approved by IVD) and a BioRad CFX96 instrument at 25° C.
  • RT-real-time PCR analysis was performed. Specifically, in the BSL3 laboratory, 6.0 X 10 5 cells of primary cells were treated with 37.5 ⁇ M each of polyphosphate of unit 120 (P120 PolyP) or polyphosphate of unit 126 (phosphate unit of 126, P126 PolyP), and vehicle-treated Cells were used as negative controls. Twenty minutes after treatment, Sars-CoV-2 particles obtained from frozen swabs used in Sars-CoV-2 positive patients were treated with 0.16 MOI (DCA), 0.01 MOI (CM), and 0.001 MOI (DLL) into primary cells (DLL). primary cells). Uninfected cells were used as negative controls for infection.
  • DCA 0.16 MOI
  • CM 0.01 MOI
  • DLL 0.001 MOI
  • the Cq values of the targets (N1, N2, N3) through RT-real-time PCR analysis are shown in Table 7 below. The Cq value was normalized to derive the Ct value, and the multiple of the quantitative value for the vehicle-treated control group was calculated, and the results are shown in FIGS. 11 to 13 .
  • Immunofluorescence analysis was performed in order to confirm the effect of the unit 120 polyphosphate (P120 PolyP) in preventing coronavirus infection.
  • P120 PolyP unit 120 polyphosphate
  • IF Immunofluorescence analysis
  • ACE2 angiotensin-converting enzyme 2
  • PolyP polyphosphate
  • PolyP polyphosphate
  • PolyP polyphosphate
  • RT-real-time PCR analysis was performed in human colorectal carcinoma cell lines. Specifically, when the human colorectal carcinoma cell line Caco2 cells were treated with 37.5 ⁇ M of the monomer 120 polyphosphate (P120 PolyP), Sars obtained from frozen swabs used in Sars-CoV-2 positive patients 8 hours have elapsed. -CoV-2 particles were infected into cells at an MOI of 0.022. At 36 hours after infection, RNA was extracted from Caco2 cells.
  • N2 and N3 fragments derived from the nucleocapsid (N) gene which play an important role in the proliferation of Sars-CoV-2, were quantitatively detected and shown as shown in FIG. 21 , and RdRp, nucleocapsid (N) ACE2 expression levels of gene-derived N1 and Caco2 cells were measured, and the results are shown in FIG. 22 .
  • a case in which the vehicle was treated with Sars-CoV-2 infected cells was used as a control.
  • the polyphosphate has a remarkably excellent preventive effect on the coronavirus.
  • polyphosphate (PolyP) was effective in preventing coronavirus infection even when sprayed in the form of an aerosol. Specifically, after dispensing Vero cells, 37.5 ⁇ M of polyphosphate (P120 PolyP) of the unit 120 was sprayed with a nebulizer. One hour later, cells were infected with Sars-CoV-2 particles (0.1 MOI), uninfected cells were used as negative controls for infection, and vehicle-treated cells were used as negative controls. After 48 hours of treatment, Vero cells were lysed and RNA was extracted. Afterwards, the results were shown as shown in FIG.
  • the present invention relates to a pharmaceutical composition, disinfecting or cleaning composition that can effectively prevent infection with coronavirus.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Inorganic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Birds (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Dermatology (AREA)
  • Environmental Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Nutrition Science (AREA)
  • Animal Husbandry (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 폴리포스페이트를 이용하여, 이들 화합물의 코로나바이러스 억제 활성을 통해, 코로나바이러스에 대한 소독 또는 세정뿐만 아니라, 코로나바이러스에 의한 감염 또는 상기 감염에 의한 질환을 효과적으로 예방할 수 있다.

Description

폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물.
본 발명은 코로나바이러스 감염 또는 상기 감염에 의한 질환을 효과적으로 예방할 수 있는 조성물과, 그 외에 소독용 또는 세정용 조성물에 관한 것이다.
코로나바이러스는 현대 문명에서 치명적인 감염병을 일으키는 대표적인 바이러스로 2003년 4월에는 중증급성호흡기증후군(Severe Acute Respiratory Syndrome; SARS), 일명 사스가 유행해 사망률 9.6%를 기록하며 많은 사람이 사망했으며, 2015년에는 중동 호흡기 증후군(Middle East Respiratory Syndrome; MERS), 일명 메르스가 중동에서 전 세계로 퍼지면서 사망률 약 36%로써 사망자가 다수 발생한 바 있다. 또한, 코로나바이러스감염증-19(Coronavirus disease 19; COVID-19)는 2019년 12월 처음 발생하여 전세계로 확산된 새로운 유형의 코로나바이러스인 중증급성호흡기증후군 코로나바이러스 2(Severe acute respiratory syndrome coronavirus 2; SARS-CoV-2)에 의한 호흡기 감염질환이다. 코로나바이러스감염증-19는 감염자의 비말(침방울)이 호흡기나 눈·코·입의 점막으로 침투될 때 전염된다. 감염되면 약 2~14일(추정)의 잠복기를 거친 뒤 발열(37.5도) 및 기침이나 호흡곤란 등 호흡기 증상, 폐렴이 주증상으로 나타나고 치사율도 2020년 3월까지 집계된 자료에 따르면 5.6%에 달한다.
신변종 바이러스의 유행은 인류에게 크나큰 문제를 야기하고 있으나, 지금까지 코로나바이러스에 대한 치료제 개발이 추진되고 있음에도, 마땅한 감염이 우려되는 의료진 및 접촉자의 소독을 위한 조성물은 완성되지 않은 상황이다. 따라서 코로나바이러스 감염 또는 감염을 효과적으로 예방하고, 소독 또는 세정할 수 있는 조성물이 요구된다.
본 발명의 일 목적은 코로나바이러스에 의한 감염 또는 상기 감염에 의해 유발된 다양한 질환을 예방할 수 있는 다양한 용도의 조성물을 제공하자 한다.
본 발명의 다른 목적은 코로나바이러스에 대한 억제 활성을 갖는 소독용 또는 세정용 조성물을 제공하자 한다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.
본 발명 내 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.
본 발명의 일 구현 예는, 폴리포스페이트(polyphosphate)를 유효성분으로 포함하는, 바이러스 감염 또는 감염 질환의 예방용 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 개체에게 상기 폴리포스페이트(polyphosphate); 또는 이의 약학적으로 허용 가능한 염을 투여하는 단계를 포함하는, 바이러스 감염 또는 감염 질환의 예방 방법에 관한 것이다.
본 발명의 상기 "폴리포스페이트(polyphosphate; PolyP)"는 인산염 무수물 결합에 의해 연결된 정인산염(오르토포스페이트, orthophosphate)의 선형 중합체이다. 포유류 세포의 리소좀, 조밀과립, 미토콘드리아 및 핵에 국한되어 있다. 생리적 pH에서, 각각의 내부 단위는 1가 음전하를 가지며, 따라서 중합체는 높은 음이온성(anion)이다. 상기 음이온성은 폴리포스페이트가 XII 인자(factor XII)의 생리학적 음이온 표면을 제공할 수 있다는 발견으로 이어졌고, 특히 프리칼리크레인(prekallikrein) 및 고분자 키니노겐(HMW kininogen) 등의 응고 케스케이드의 활성화를 통해 트롬빈 매개 활성화를 가속화시켜 응고를 유발하고 피브린 중합을 향상시키는 것으로 밝혀졌다.
본 발명에서, 상기 폴리포스페이트는 인산염 단위체(phosphate unit)가 2 이상 200 이하인 것일 수 있고, 바람직하게는 2 이상 9 이하, 또는 100 이상 200 이하인 것일 수 있고, 보다 바람직하게는 100 이상 125 미만, 125 이상 130 미만, 130 이상 140 미만, 140 이상 150 이하, 160 이상 170 이하 또는 180 이상 190 이하인 것일 수 있으며, 더욱 바람직하게는 8, 120, 126, 137, 145, 162 또는 189일 수 있고, 가장 바람직하게는 8, 120 또는 126일 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 폴리포스페이트는 상기 조성물 내에 5μM 이상 100μM 이하의 농도로 포함될 수 있고, 바람직하게는 10μM 이상 50μM 이하의 농도로 포함될 수 있다. 상기 폴리포스페이트의 농도가 5μM 미만인 경우 상기 폴리포스페이트의 첨가 효과가 미미할 수 있고, 상기 농도가 100μM을 초과하는 경우 첨가에 따른 더 이상의 상승 효과를 기대하기 어려워 첨가의 효율성이 저하될 수 있다.
본 발명에서 상기 약학적으로 허용되는 염은, 의학적 적용에 적합한 것으로 당업자에 의해 일반적으로 간주되는 염(예를 들어 이러한 염이 상기 염으로 치료될 수 있는 대상체에게 유해하지 않기 때문임), 또는 각각의 치료 내에서 허용 가능한 부작용을 야기하는 염이다. 일반적으로, 상기 약학적으로 허용되는 염은 미국 식품 의약국(FDA), 유럽 의약청(EMA), 또는 일본 후생성의 의약품 의료기기 종합기구(PMDA)와 같은 규제 당국에 의해 허용되는 것으로 간주되는 염이다. 그러나, 본 발명은 원칙적으로, 예를 들어 본 발명에 따른 화합물 또는 그의 생리학적으로 작용성인 유도체의 제조에서의 중간체, 또는 본 발명에 따른 화합물의 약학적으로 허용되는 염 또는 그의 생리학적으로 작용성인 유도체의 제조에서의 중간체로서, 그 자체로는 약학적으로 허용되지 않는 본 발명에 따른 화합물의 염을 또한 포함한다. 상기 염은 수불용성 염을 포함하고, 특히, 수용성 염을 포함한다.
각각의 경우에, 당업자는 본 발명에 따른 특정 화합물 또는 그의 생리학적으로 작용성인 유도체가 염을 형성할 수 있는지 여부, 즉, 상기 본 발명에 따른 화합물 또는 그의 생리학적으로 작용성인 유도체가, 예를 들어 아미노기, 카르복실산기 등과 같은 전하를 띨 수 있는 기를 가지는지 여부를 쉽게 결정할 수 있다.
본 발명의 화합물의 예시적인 염은 산 부가 염 또는 염기와의 염, 특히 약학적으로 허용되는 무기산 및 유기산 부가 염 및 약학에서 통상적으로 사용되는 염기와의 염이며, 이는 수불용성 또는 특히 수용성 산 부가 염이다. 본 발명의 화합물의 치환기에 따라 염기와의 염이 또한 적합할 수 있다. 산 부가 염은, 예를 들어, 본 발명의 화합물의 용액을 염산, 황산, 푸마르산, 말레산, 석신산, 아세트산, 벤조산, 시트르산, 타르타르산, 탄산 또는 인산과 같은 약학적으로 허용되는 산의 용액과 혼합함으로써 형성될 수 있다. 마찬가지로, 약학적으로 허용되는 염기 부가 염은 알칼리 금속염(예를 들어, 나트륨 또는 칼륨 염); 알칼리 토금속 염(예를 들어, 칼슘 또는 마그네슘 염); 및 적합한 유기 리간드로 형성된 염(예를 들어, 할라이드, 하이드록사이드, 카복실레이트, 설페이트, 포스페이트, 니트레이트, 알킬 설포네이트 및 아릴 설포네이트와 같은 반대 음이온을 사용하여 형성된 암모늄, 4차 암모늄 및 아민 양이온)을 포함할 수 있다. 약학적으로 허용되는 염의 예시적인 예로는 아세테이트, 아디페이트, 알기네이트, 아르기네이트, 아스코르베이트, 아스파테이트, 벤젠설포네이트, 벤조에이트, 바이카르보네이트, 바이설페이트, 바이타르트레이트, 보레이트, 브로마이드, 부티레이트, 칼슘 에데테이트, 캄포레이트, 캄포설포네이트, 캄실레이트, 카르보네이트, 클로라이드, 시트레이트, 디글루코네이트, 디하이드로클로라이드, 도데실설페이트, 에데테이트, 에디실레이트, 에탄설포네이트, 포르메이트, 푸마레이트, 갈락테이트, 갈락투로네이트, 글루코네이트, 글루타메이트, 글리세로포스페이트, 헤미설페이트, 헵타노에이트, 헥사노에이트, 헥실레소르시네이트, 하이드로브로마이드, 하이드로클로라이드, 하이드로요오다이드, 2-하이드록시-에탄설포네이트, 하이드록시나프토에이트, 요오다이드, 이소부티레이트, 이소티오네이트, 락테이트, 라우레이트, 라우릴 설페이트, 말레이트, 말레에이트, 말로네이트, 만델레이트, 메탄설포네이트(메실레이트), 메틸설페이트, 2-나프탈렌설포네이트, 니코티네이트, 니트레이트, 올레에이트, 옥살레이트, 팔미테이트, 판토테네이트, 펙티네이트, 퍼설페이트, 3-페닐프로피오네이트, 포스페이트/디포스페이트, 프탈레이트, 피크레이트, 피발레이트, 폴리갈락투로네이트, 프로피오네이트, 살리실레이트, 스테아레이트, 설페이트, 수베레이트, 석시네이트, 탄네이트, 타르트레이트, 토실레이트, 운데카노에이트, 발레레이트 등이 포함되지만 이로 한정되지 않는다.
본 발명에서 약학적으로 허용되지 않으며, 예를 들어, 산업적 규모로 본 발명에 따른 화합물을 제조하는 동안 공정 생성물로서 수득될 수 있는 염이 또한 본 발명에 포함되고, 요망되는 경우, 이는 당업자에게 알려진 방법에 의해 약학적으로 허용되는 염으로 전환될 수 있다.
본 발명에서 상기 바이러스는 RNA 바이러스일 수 있다. 본 발명에서, 상기 “RNA 바이러스”는 RNA를 유전물질로 사용하는 모든 바이러스를 의미한다. 예를 들어, 상기 RNA 바이러스는 코로나비리대 (Coronaviridae), 아말가비리대 (Amalgaviridae), 비르나비리대 (Birnaviridae), 크리소비리대 (Chrysoviridae), 시스토비리대 (Cystoviridae), 엔도르나비리대 (Endornaviridae), 하이포비리대 (Hypoviridae), 메가비르나비리대 (Megabirnaviridae), 파르티티비리대 (Partitiviridae), 피코비르나비리대 (Picobirnaviridae), 레오비리대 (Reoviridae), 토티비리대 (Totiviridae), 콰드리비리대 (Quadriviridae), 아르테리비리대 (Arteriviridae), 메소니비리대 (Mesoniviridae), 로니비리대 (Roniviridae), 디시스트로비리대 (Dicistroviridae), 이플라비리대 (Iflaviridae), 마르나비리대 (Marnaviridae), 피코르나비리대 (Picornaviridae), 세코비리대 (Secoviridae), 알파플렉시비리대 (Alphaflexiviridae), 베타플렉시비리대 (Betaflexiviridae), 감마플렉시비리대 (Gammaflexiviridae), 티모비리대 (Tymoviridae), 보르나비리대 (Bornaviridae), 필로비리대 (Filoviridae), 파라믹소비리대 (Paramyxoviridae), 랍도비리대 (Rhabdoviridae), 니아미비리대 (Nyamiviridae), 칼리시비리대 (Caliciviridae), 플라비비리대 (Flaviviridae), 루테오비리대 (Luteoviridae), 토가비리대 (Togaviridae), 뉴모바라대 (Pneumoviridae), 아레나비리대 (Arenaviridae), 델타비리대 (Deltavirus), 또는 오르토믹스비리대 (Orthomyxoviridae) 바이러스일 수 있으나, 바람직하게는 코로나비리대일 수 있으며, 보다 바람직하게는 코로나비리대에 속하는 코로나바이러스일 수 있다.
본 발명에서 상기 "코로나바이러스(Coronavirus)"는 코로나비리대(Coronaviridae)의 코로나바이러스아과(Coronavirinae)에 4개의 속(알파, 베타, 감마, 델타)이 있으며, 유전자 크기 27 내지 32kb의 RNA 바이러스로 사람과 동물의 호흡기와 소화기계 감염을 유발하는 것으로 알려져 있다. 주로 점막 전염, 비말 전파로 쉽게 감염되며, 사람은 일반적으로 경미한 호흡기 감염을 일으키지만 드물게 치명적인 감염을 일으키기도 하며, 소와 돼지는 설사, 닭은 호흡기 질환이 발생하기도 한다. 코로나바이러스 중에서 사람을 숙주로 하는 코로나바이러스는 하기 표 1의 분류로 나뉜다(질병관리본부, 2020). 4개의 속 중에서 알파와 베타는 사람과 동물에게 감염이 되며, 감마와 델타는 동물에게만 감염되는 것으로 보고되고 있다.
속(genus) 사람-코로나바이러스 사람 외 감염 코로나바이러스
알파 코로나바이러스 229, NL63 돼지 유행성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), (돼지)전염성 위장염 바이러스 (transmissible gastroenteritis virus; TGEV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus;FCoV), Miniopterus bat(박쥐) coronavirus1, Miniopterus bat(박쥐) coronavirus HKU8, Rhinolophus bat(박쥐) coronavirus HKU2, Scotophilus bat(박쥐) coronavirus 512
베타 코로나바이러스 OC43, HKU1, SARS-CoV, SARS-CoV2, MERS-CoV 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우코로나바이러스(bovine coronavirus; BCoV), 말코로나바이러스(equine coronavirus; EqCoV), 쥐코로나바이러스(murine coronavirus; MuCoV), Tylonycteris bat(박쥐) coronavirus HKU4, Pipistrellus bat(박쥐) coronavirus HKU5, Rousettus bat(박쥐) coronavirus HKU9
감마 코로나바이러스 - 새코로나바이러스(Avian coronavirus), 흰색 돌고래(Beluga whale)-코로나바이러스 SW1
델타 코로나바이러스 - 제주직박구리(Bulbul)-코로나바이러스 HKU11, 개똥지빠귀(Thrush)-코로나바이러스 HKU12, 킨바라(Munia)-코로나바이러스 HKU13
특히, 현재 사람에 감염력이 있는 코로나바이러스로는 하기 표 2의 7종이 존재하며, 감기를 일으키는 유형(229E, OC43, NL63, HKU1)과 중증 폐렴을 일으키는 유형(SARS-CoV, SARS-CoV2, MERS-CoV)으로 나뉜다.
바이러스명 속(Genus) 숙주(host) 증상
HCoV-229E Alpha Human 가벼운 호흡기 증상
HCoV-NL63 Alpha Human 가벼운 호흡기 증상
SARS-CoV Beta Human 심각한 호흡기 증상
MERS-CoV Beta Human 심각한 호흡기 증상
HCoV-OC43 Beta Human 가벼운 호흡기 증상
HCoV-HKU1 Beta Human 폐렴 증상
SARS-CoV-2 Beta Human 가벼운 호흡기 증상 심한 경우 호흡곤란 유발
본 발명에서 상기 "베타 코로나바이러스(Beta coronavirus)"는 코로나바이러스아과의 네 속의 코로나바이러스 중 하나로 인수공통 감염증에 해당한다. 베타 코로나바이러스의 예로는 중증 급성 호흡기 증후군 바이러스(Severe Acute Respiratory Syndrome virus; SARS; SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 바이러스(Middle East Respiratory Syndrome virus; MERS; MERS-CoV), 인간 코로나바이러스 OC43(HCoV-OC43) 또는 인간 코로나바이러스 HKU1(HCoV-HKU1) 등이 존재하는 것으로 알려져 있다.
본 발명에서 상기 "중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2)"는 코로나비리대 패밀리에 속하는 외피로 둘러싸인, 양성-극성 외가닥 RNA 베타 코로나바이러스에 해당한다. 역사적으로 인간을 감염시키는 코로나바이러스는 중증 공통의 감기 바이러스로, hCoV-OC43, HKU 및 229E5 등을 포함한다. SARS-CoV-2 분리체의 서열을 분석하면, 30-kb 게놈은 14개의 오픈 리딩 프레임(open-reading frames; ORFs)을 코딩하는 것으로 알려져 있고, 바이러스 게놈의 3’말단에서 13개의 ORF는 9개의 예측되는 서브-게놈 RNA로부터 발현되며, 이들은 4개의 구조 단백질인, 스파이크(spike; S), 외피(envelope; E), 막(membrane; M) 및 뉴클레오캡시드(nucleocapsid; N)와, 9개의 추정적 부가 요소로부터 발현된다. 여기서, 상기 뉴클레오캡시드 단백질은 N1, N2 및 N3 절편을 포함한다.
본 발명에서, 상기 코로나바이러스는 자연적으로 또는 인공적으로 돌연변이가 발생한 변이체를 포함한다.
본 발명에서, 상기 코로나바이러스에 의한 감염 질환은 코로나바이러스성 장염, 코로나바이러스성 설사, 중증 급성 호흡기 증후군(severe acute respiratory syndrome coronavirus; SARS), 중동 호흡기 증후군(Middle East respiratory syndrome; MERS), 또는 이들의 조합일 수 있으나, 상기 코로나바이러스 감염에 의해 유발될 수 있는 질환이라면 제한없이 포함될 수 있다.
본 발명에서, 상기 감염 질환은 상기 바이러스 감염에 기인한 호흡기 질환, 간염, 위장염 또는 뇌염일 수 있다.
본 발명에서, 상기 호흡기 질환은 중증급성호흡기증후군(Severe Acute Respiratory Syndrome; SARS)을 유발하는 것일 수 있다. 상기 중증급성호흡증후군은 상기도 또는 하기도 감염을 유발하여 갑작스러운 발열, 기침, 호흡곤란을 일으킬 수 있고, 폐렴으로 진행돼 죽음에 이를 수도 있는 질환이다.
본 발명의 조성물은 단독으로, 혹은 종전의 항바이러스제를 혼합하여 사용할 수 있고, 혹은 항혈청과 같은 생물학적 제제와 병용하여 사용할 수 있다.
본 발명의 조성물은 약학적 조성물, 식품 조성물, 식품 첨가제 조성물, 사료 조성물 또는 사료 첨가제 조성물의 용도로 사용될 수 있으나, 특별히 제한되지는 않는다.
본 발명에서 "예방"은 본 발명의 조성물의 투여로 바이러스의 감염 또는 증식을 진행을 지연시키는 모든 행위를 의미한다.
본 발명에 있어서, 상기 폴리포스페이트 또는 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 화합물 또는 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명의 화합물 또는 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.
본 발명에서 상기 "개체"란 바이러스 감염 증상이 있거나 의심되어, 바이러스 활성을 억제하는 등으로 바이러스 감염 또는 상기 감염에 기인하여 유발된 질환을 예방이 필요한 대상체로, 상기 바이러스에 이미 감염되었거나 감염될 수 있는 인간을 포함한 모든 동물을 의미한다.
본 발명의 상기 "투여"란, 임의의 적절한 방법으로 개체에게 본 발명의 유효성분을 도입하는 과정을 의미하는 것으로서, 본 발명의 상기 치료 방법에서 투여 방법은 경구 또는 비경구 등의 다양한 경로를 통해 투여될 수 있다.
본 발명의 목적상, 목적하는 개체에 대한 구체적인 약학적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 상기 유효성분을 포함하는 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 상기 유효성분을 포함하는 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다.
본 발명에서 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다. 또한 상기 식품 조성물의 제조에 필요한 식품 첨가제 조성물로도 이용될 수 있다.
본 발명에서 유효 성분으로 포함되는 상기 폴리포스페이트가 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 50%의 비율로 첨가할 수 있다. 여기서, 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 즉, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등을 들 수 있다.
그 외 본 발명의 식품 조성물 또는 식품 조성물 첨가제는 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.
이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 식품 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명의 상기 폴리포스페이트가 사료 조성물 또는 사료 첨가제 조성물에 함유되어 이용될 경우, 상기 조성물은 20 내지 90% 고농축액이거나 분말 또는 과립형태로 제조될 수 있다. 상기 사료 첨가제는 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성 피로인산염 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제 중 어느 하나 또는 하나 이상을 추가로 포함할 수 있다.
본 발명에서, 상기 폴리포스페이트가 사료로 이용될 경우, 상기 조성물은 통상의 사료 형태로 제제화될 수 있으며, 통상의 사료 성분을 함께 포함할 수 있다. 상기 사료 첨가제 및 사료는 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조 성분 등을 더 포함할 수 있으며, 이외에도 영양 보충제, 소화 및 흡수 향상제, 성장 촉진제 등을 더 포함할 수 있다.
본 발명에서, 상기 폴리포스페이트가 상기 사료 첨가제로 사용될 경우에는 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료 첨가제와 조합하여 투여할 수도 있다. 또한, 상기 사료 첨가제는 탑 드레싱으로서 또는 이들을 동물 사료에 직접 혼합하거나 또는 사료와 별도의 경구 제형으로 용이하게 동물에게 투여할 수 있다. 상기 사료 첨가제를 동물 사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 약제학적으로 허용 가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 이러한 식용 담체는 고체 또는 액체, 예를 들어 옥수수 전분, 락토오스, 수크로오스, 콩 플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 사료 첨가제는 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체 담체가 사용될 경우, 사료 첨가제는 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다. 상기 사료는 동물의 식이 욕구를 충족시키는데 통상적으로 사용되는 임의의 단백질-함유 유기 곡분을 포함할 수 있다. 이러한 단백질-함유 곡분은 통상적으로 옥수수, 콩 곡분, 또는 옥수수/콩 곡분 믹스로 구성되어 있다. 또한 사료 조성물 또는 사료 첨가제 조성물은 예를 들어 보존제, 안정화제, 습윤제 또는 유화제, 용액 촉진제 등을 함유할 수 있다. 또한 사료 첨가제 조성물은 침지, 분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.
본 발명의 또 다른 구현 예에 따르면, 폴리포스페이트(polyphosphate); 또는 이의 약학적으로 허용 가능한 염을 유효 성분으로 포함하는, 바이러스에 대한 억제 활성을 갖는 소독용 또는 세정용 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 대상체에 상기 폴리포스페이트; 또는 이의 약학적으로 허용 가능한 염을 접촉시키는 단계를 포함하는, 바이러스에 대한 소독 또는 세정 방법에 관한 것이다.
본 발명에서, 상기 폴리포스페이트는 인산염 단위체(phosphate unit)가 2 이상 200 이하인 것일 수 있고, 바람직하게는 2 이상 9 이하, 또는 100 이상 200 이하인 것일 수 있고, 보다 바람직하게는 100 이상 125 미만, 125 이상 130 미만, 130 이상 140 미만, 140 이상 150 이하, 160 이상 170 이하 또는 180 이상 190 이하인 것일 수 있으며, 더욱 바람직하게는 8, 120, 126, 137, 145, 162 또는 189일 수 있고, 가장 바람직하게는 8, 120 또는 126일 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 폴리포스페이트는 상기 조성물 내에 5μM 이상 100μM 이하의 농도로 포함될 수 있고, 바람직하게는 10μM 이상 50μM 이하의 농도로 포함될 수 있다. 상기 폴리포스페이트의 농도가 5μM 미만인 경우 상기 폴리포스페이트의 첨가 효과가 미미할 수 있고, 상기 농도가 100μM을 초과하는 경우 첨가에 따른 더 이상의 상승 효과를 기대하기 어려워 첨가의 효율성이 저하될 수 있다.
본 발명에서 상기 바이러스 및 약학적으로 허용 가능한 염에 대한 정의는 앞서 기재된 바와 중복되어 명세서의 과도한 복잡을 방지하기 위하여 이하 생략한다.
본 발명에서 상기 "소독(disinfection)"은 병원 미생물 또는 병원 바이러스의 활성을 잃게 하거나 죽이는 것을 의미한다. 활성을 잃게 하는 것은 병원 미생물 또는 병원 바이러스의 감염, 생존, 증식, 전파, 또는 이들의 조합을 저해하는 것을 포함한다.
본 발명에서 상기 "세정"은 오염물 제거, 표백, 미생물 또는 바이러스 집단 감소, 헹굼 및 임의의 이들의 조합을 용이하게 하거나 돕는 데 사용되는 방법을 지칭한다.
본 발명에서 상기 "대상체"는 바이러스의 감염을 저지하여야 하는 생물체 또는 비생물체(기구, 장치, 의류， 식기 등) 또는 이들의 경질 표면을 모두 포함한다.
본 발명의 상기 폴리포스페이트는 바이러스에 특이적 사멸능을 가지므로, 본 발명에서의 상기 화합물을 포함하는 소독용 조성물 또는 세정용 조성물은 병원 감염을 막기 위한 병원 및 보건용의 소독제 및 세정제로 유용하게 사용될 수 있고 일반 생활 소독제 및 세정제, 식기, 식품 조리 설비, 건물 내부, 음수, 차량, 항공기 및 선박 등의 각종 용품의 소독 및 세정 등에 사용될 수 있다.
본 발명의 조성물을 소독용 조성물 또는 세정용 조성물로 사용되는 경우, 약리학적, 수의학적 또는 농학적으로 허용 가능한 담체 또는 희석제를 함께 포함할 수 있음은 물론이다.
또한, 본 발명의 화합물 또는 조성물은 액체상， 고체상 및 기체상 증 임의의 상으로 제조될 수 있다.
본 발명의 상기 화합물 또는 조성물은 인체 자체 또는 인간이 사용하는 각종 기구나 장치에 적용될 수 있으며， 인체에 적용되는 경우 경구, 비경구 등 임의의 방식으로 투여될 수 있다. 또한, 상기 화합물 또는 조성물은 인체 자체 또는 각종 기구나 장치에 효과적으로 적용될 수 있는 다양한 형태로 제형화 될 수 있으며， 예로서, 정제, 환제， 캡술제, 분체제제 등과 같은 경구 투여용 약학 제형, 또는 분무제， 세정거 L 겔제, 액제， 크림제， 연고제 등과 같은 외용제 또는 기구 및 장치에 적용 가능한 제형을 들 수 있으며, 바람직하게는 분무제일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 화합물 또는 조성물을 대상체에 적용하는 방법으로 상기 "접촉"은 공지의 소독 또는 세정제 적용 방법을 대상체의 성질， 주변 환경 등에 따라 적절히 선택하되, 닦음질(wiping), 침액(dipping), 침지(immersing) 또는 분무의 형태를 포함할 수 있으며, 바람직하게는 분무의 형태일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 제공하는 조성물은 코로나바이러스 억제 활성을 가져, 코로나바이러스에 대한 소독 또는 세정 효과를 가질 뿐만 아니라, 코로나바이러스에 의한 감염 또는 상기 감염에 의한 질환을 효과적으로 예방할 수도 있다.
도 1은 준비예 1에서 본 발명의 일 실시예에 따른 폴리포스페이트의 화학식을 나타낸 것이다.
도 2는 준비예 2에서 건강한 사람의 비강으로부터 수득한 일차 세포를 현미경으로 확대하여 촬영한 사진을 나타낸 것이다.
도 3은 실험예 1에서 폴리포스페이트의 처리시 독성을 나타내는 농도를 측정한 결과를 그래프로 나타낸 것이다.
도 4는 실험예 2에서 폴리포스페이트의 처리 농도 별 코로나바이러스의 감염 억제 효과를 그래프로 나타낸 것이다.
도 5는 실험예 3에서 Sars-CoV-2에 감염된 환자의 세포가 단위체 120의 폴리포스페이트(P120 PolyP)로 처리된 경우 N1 유전자의 발현 수준의 변화를 확인한 결과를 그래프로 나타낸 것이다.
도 6은 실험예 3에서 Sars-CoV-2에 감염된 환자의 세포가 단위체 120의 폴리포스페이트(P120 PolyP)로 처리된 경우 N2 유전자의 발현 수준의 변화를 확인한 결과를 그래프로 나타낸 것이다.
도 7은 실험예 3에서 Sars-CoV-2에 감염된 환자의 세포가 단위체 120의 폴리포스페이트(P120 PolyP)로 처리된 경우 N3 유전자의 발현 수준의 변화를 확인한 결과를 그래프로 나타낸 것이다.
도 8은 실험예 4에서 Sars-CoV-2에 감염된 환자의 세포가 단위체 120의 폴리포스페이트(P120 PolyP) 또는 단위체 8의 폴리포스페이트(P8 PolyP)로 처리된 경우 N1, N2 및 N3 유전자의 발현 수준의 변화를 확인한 결과를 그래프로 나타낸 것이다.
도 9는 실험예 5에서 Sars-CoV-2에 감염된 환자의 세포가 단위체 120의 폴리포스페이트(P120 PolyP)로 처리된 경우 RdRp 및 E 유전자의 발현 수준의 변화를 확인한 결과를 그래프로 나타낸 것이다.
도 10은 실험예 5에서 Sars-CoV-2에 감염된 환자의 세포가 단위체 120의 폴리포스페이트(P120 PolyP) 또는 단위체 8의 폴리포스페이트(P8 PolyP)로 처리된 경우 RdRp 및 E 유전자의 발현 수준의 변화를 확인한 결과를 그래프로 나타낸 것이다.
도 11은 실험예 6에서 일차 세포를 Sars-CoV-2 0.16 MOI로 감염시킨 후, 폴리포스페이트(PolyP)를 처리한 경우, 단위체에 따른 N1, N2 및 N3 유전자 발현 수준의 변화를 그래프로 나타낸 것이다.
도 12는 실험예 6에서 일차 세포를 Sars-CoV-2 0.01 MOI로 감염시킨 후, 단위체 120의 폴리포스페이트(P120 PolyP)로 처리한 경우, N1, N2 및 N3 유전자 발현 수준의 변화를 그래프로 나타낸 것이다.
도 13은 실험예 6에서 일차 세포를 Sars-CoV-2 0.001 MOI로 감염시킨 후, 단위체 120의 폴리포스페이트(P120 PolyP)로 처리한 경우, N1, N2 및 N3 유전자 발현 수준의 변화를 그래프로 나타낸 것이다.
도 14는 실험예 7에서 폴리포스페이트의 코로나바이러스 억제 효과를 면역 형광 분석(immunofluorescence; IF)으로 확인한 결과를 나타낸 것이다.
도 15는 실험예 7에서 폴리포스페이트의 코로나바이러스 억제 효과를 면역 형광 분석(immunofluorescence; IF)으로 확인하여 정량 분석한 결과를 나타낸 것이다.
도 16은 실험예 8에서 ACE2와 폴리포스페이트의 관계를 확인하기 위하여 면역 형광 분석(immunofluorescence; IF)을 수행한 결과를 나타낸 것이다.
도 17은 실험예 9에서 폴리포스페이트의 처리 농도에 따른 ACE2 발현량을 인하기 위하여 면역 블로팅 분석(Immunoblotting analyses)을 수행한 결과를 나타낸 것이다.
도 18은 실험예 10에서 폴리포스페이트의 처리 시간에 따른 ACE2 발현량을 확인하기 위하여 면역 블로팅 분석(Immunoblotting analyses)을 수행한 결과를 나타낸 것이다.
도 19는 실험예 11에서 폴리포스페이트와 프로테아좀 억제제를 병용 처리할 경우 ACE2 발현량을 확인하기 위하여, 면역 블로팅 분석(Immunoblotting analyses)을 수행한 결과를 나타낸 것이다.
도 20은 실험예 11에서 폴리포스페이트와 사이클로헥사미드(Cycloheximide; CHX)를 병용할 경우 ACE2 발현량을 확인하기 위하여, 면역 블로팅 분석(Immunoblotting analyses)을 수행한 결과를 나타낸 것이다.
도 21은 실험예 12에서 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 N2 및 N3 유전자 절편의 발현 수준을 확인한 결과를 나타낸 것이다.
도 22는 실험예 12에서 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 RdRp 및 ACE2 발현 수준을 확인한 결과를 나타낸 것이다.
도 23은 실험예 13에서 폴리포스페이트(PolyP)를 분무한 후 베로 세포에 Sars-CoV-2를 감염시킨 경우 유전자의 발현 수준을 확인한 결과를 나타낸 것이다.
본 발명의 일 목적은 코로나바이러스에 의한 감염 또는 상기 감염에 의해 유발된 다양한 질환을 예방할 수 있는 다양한 용도의 조성물을 제공하는 것이다.
이하, 본 발명을 하기의 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
실시예
[준비예 1] 폴리포스페이트 합성 및 세포 준비
선형 폴리포스페이트를 인산나트륨 단위체(NaH2PO4≥9.0%; Sigma Aldrich)를 700℃에서 1시간 동안 전기로(HQ-DMF3; Coretech, Korea)에서 중합시켰다. 이어서, 용융 된 폴리포스페이트 나트륨을 구리판에 부어 급속 냉각시키켜 분쇄하였다. 상기 과정은 하기 화학식 1로 나타낼 수 있다. 그 결과 도 1의 화학식과 같은 폴리포스페이트를 합성하였다.
[화학식 1]
nNaH2PO4 = (NaPO3)n + nH2O
얻어진 중합체는 Graham의 염으로 알려져 있으며, 선형, 고리형 및 분지형의 3 가지 혼합 분자 구조의 폴리포스페이트(PolyP)를 함유하고 있다. 분지형 폴리포스페이트는 매우 불안정하고, 물에 용해될 때, 이들 폴리포스페이트의 분지점은 pH에 상관없이, 심지어 실온에서도 가수 분해된다. 대조적으로, 선형 폴리포스페이트 및 고리형 폴리포스페이트(cyclo PolyP)는 중성 pH 및 실온에서 매우 느리게 가수 분해된다. 상온에서 pH 7의 선형 폴리포스페이트의 P-O-P 결합에 대한 가수분해 반감기는 몇 년에 달한다. 합성된 폴리포스페이트는 일반적으로 매우 소량의 고리형 폴리포스페이트를 함유할 수 있으나, 고리형 폴리포스페이트는 주로 짧은 사슬 길이를 가져, 본 실시예에서는 합성되지 않았다.
또한 얻어진 중합체는 광범위한 사슬 길이를 가져 분별 침전을 수행하였다. 소듐 폴리포스페이트 분말을 증류수(1:10 w/v)에 용해시키고, pH를 7로 조정하고 25℃에서 12시간 동안 방치하였다. 이어서, 폴리포스페이트 침전을 위하여 아세톤을 용액 추가하였다. 침전된 폴리포스페이트를 4200rpm에서 5분 동안 원심 분리를 통하여 나누었다. 상기 분획 침전을 25회 반복하고, 수득된 폴리포스페이트 분획을 48시간 동안 건조시켰다.
상기 폴리포스페이트는 HPLC 시스템(LC-20AD; Shimadzu, Japan) 및 다중 각도 광 산란 검출기(miniDawn Treos II; Wyatt Technology, USA)에 의해 분별되었다. 상기 HPLC 시스템은 겔 투과 크로마토그래피(PL aquagel-OH; 7.5 Х 50 mm; 8 μm; Agilent Technology, USA) 가드 칼럼(PL aquagel-OH Mixed-M; 7.5 Х 300 mm; 8 μm; Agilent Technology, USA)을 포함하고, 주입된 폴리포스페이트 샘플의 농도는 25 mg/mL이며, 주입 부피는 50μL이다. 칼럼의 온도는 30℃로 유지되었다. 상기 과정에 의해 분리된 폴리포스페이트의 사슬 길이(n)를 하기 화학식 2에 따라 결정하였다.
[화학식 2]
Mn(평균 몰 질량 수) = Nan+2PnO3n+1
이어서, Astra 소프트웨어, 버전 6.1(Wyatt Technology, USA)을 사용하여, 다 분산 지수(중량 평균 몰 질량/평균 몰 질량 수; Mw/Mn)를 통해 각 분획의 사슬 길이의 범위를 수득 하였다.
한편 3 명의 건강한 사람의 비강 브러싱을 통하여 인간 일차 세포(Primary cell)를 수득하였고, 상기 세포를 40배로 관찰한 결과를 도 2와 같이 나타내었다.
[준비예 2] 세포의 준비
이하의 실험을 위하여, 3 명의 건강한 사람의 비강 브러싱을 통하여 인간 일차 세포(Primary cell)를 수득하였고, 상기 세포를 40배로 관찰한 결과를 도 2와 같이 나타내었다.
[준비예 3] 유전자 증폭을 위한 프라이머 준비
유전자 증폭을 위하여, 타겟 유전자 별로 사용된 프라이머는 하기 표 3과 같다.
타겟 유전자 프라이머 종류 프라이머 서열 서열번호
ACE2 포워드 프라이머 GAAATTCCCAAAGACCAGTGGA 서열번호 1
ACE2 리버스 프라이머 CCCCAACTATCTCTCTCGCTTCAT 서열번호 2
RdRp 포워드 프라이머 GTGAAATGGTCATGTGTGGCGG 서열번호 3
RdRp 리버스 프라이머 CAAATGTTAAAAACACTATTAGCATA 서열번호 4
N1 포워드 프라이머 GACCCCAAAATCAGCGAAAT 서열번호 5
N1 리버스 프라이머 TCTGGTTACTGCCAGTTGAATCTG 서열번호 6
스파이크 포워드 프라이머 ATTGCCACTAGTCTCTAGT 서열번호 7
스파이크 리버스 프라이머 AGGATCTGAAAACTTTGTCA 서열번호 8
외피 포워드 프라이머 ACAGGTACGTTAATAGTTAATAGCGT 서열번호 9
외피 리버스 프라이머 ATATTGCAGCAGTACGCACACA 서열번호 10
sg 포워드 프라이머 CAAACCAACCAACTTTCGATCTCTTGTA 서열번호 11
sgS 리버스 프라이머 TGAAAGAATTAGTGTATGCA 서열번호 12
sgE 리버스 프라이머 AGAAGTACGCTATTAACTATT 서열번호 13
sgM 리버스 프라이머 TATTACTAGGTTCCATTGTTCAA 서열번호 14
sgN 리버스 프라이머 TCTGGTTACTGCCAGTTGAATC 서열번호 15
[실험예 1] 폴리포스페이트의 독성 확인
폴리포스페이트의 농도에 따른 세포 독성 효과를 알아보기 위하여, 세포 지수 접근법(Cell Index approach)을 통한 실시간 세포 증식 분석(Real-Time cell proliferation analyses)을 실시하였다. 인간 일차 세포 8,000개를 도말한 후, 4.16uM, 12.5uM, 37.5uM 및 112uM의 상이한 농도의 단위체 120의 폴리포스페이트(P120 PolyP)로 각각 처리하였고, 음성 대조군으로는 비히클(Vehicle) 처리된 세포를 사용하였다. 이후 36분 동안 2분마다 임피던스를 측정하여, 세포 지수를 도출하였고, 그 결과를 도 3과 같이 나타내었다.
그 결과, 도 3에서 보는 바와 같이, 112uM P120으로 처리된 세포에서는 세포 독성 효과를 나타낸 것을 확인할 수 있었다.
[실험예 2] 폴리포스페이트의 코로나바이러스 억제 효과 확인(1)
폴리포스페이트의 항 바이러스 효과를 알아보기 위하여, 한국인 환자로부터 얻은 SARS-CoV-2 입자로 감염된 베로 E6 세포를 상이한 농도(9.375 내지 37.5μM 범위)의 단위체 120의 폴리포스페이트(P120 PolyP)로 처리하여 그 결과를 도 4와 같이 나타내었다.
도 4와 같이, 낮은 농도의 폴리포스페이트로 처리된 경우를 포함하여 단위체 120의 폴리포스페이트(P120 PolyP)로 처리된 베로 E6 세포에서 N, RdRp 및 E 유전자에 대한 증가된 Ct값을 보여, 항 바이러스 효과를 확인할 수 있었다.
[실험예 3] 폴리포스페이트의 코로나바이러스 억제 효과 확인(2)
폴리포스페이트(PolyP)의 항 바이러스 효과를 확인하기 위하여, RT-실시간 PCR 분석을 실시하였다. 시험관 내(in vitro) 실험을 위하여, COVID-19 환자 8명의 시료에 단위체 120의 폴리포스페이트(인산염 단위체가 120인 포스페이트, P120 PolyP) 30μM를 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 상기 시료로부터 RNA를 추출한 후 "CLONIT quanty COVID-19" [Ref. RT-25](IVD 승인) 키트 및 BioRad CFX96 기기를 사용하여 25℃, 2분; 50℃, 15분; 95℃, 2분; 95℃, 3초; 55℃, 30초의 조건으로 45회 사이클을 수행하였다. RT-실시간 PCR 분석 결과 도출된 타겟(N1, N2, N3)의 주기 임계값(cycle threshold; Ct) 및 폴드값을 도 5 내지 7 및 표 4에 나타내었다.
샘플 타겟유전자 비히클 P120 PolyP 폴드값
#S1 N1 20.68 24.46 3.79
#S1 N2 20.16 n.a. n.a.
#S1 N3 21.66 23.23 1.58
#S1 int ctr 26.75 n.a. -
#D N1 32.01 34.57 0.26
#D N2 32.09 n.a. n.a.
#D N3 23.28 33.68 1.4
#D int ctr 28.5 n.a. -
#E1 N1 32.07 34.57 2.5
#E1 N2 32.5 n.a. 0
#E1 N3 31.61 35.49 3.88
#E1 int ctr 26.91 n.a. -
#F N1 32.18 34.21 2.03
#F N2 32.41 n.a. n.a.
#F N3 33.01 33.27 0.26
#F int ctr 24.87 34.97 -
#F1 N1 30.32 32.97 2.65
#F1 N2 30.54 n.a. n.a.
#F1 N3 30.26 34.63 4.37
#F1 int ctr 24.5 n.a. -
#H N1 32.6 33.77 1.17
#H N2 33.43 n.a. n.a.
#H N3 33.15 35.08 1.93
#H int ctr 25.15 n.a. -
#I N1 31.77 33.04 1.28
#I N2 32.21 n.a. n.a.
#I N3 32.08 33.87 1.79
#I int ctr 24.15 33.98 -
#V N1 32.11 36.36 4.25
#V N2 33.02 n.a. n.a.
#V N3 32.24 35.83 3.58
#V int ctr 27.57 n.a. -
도 5에서 보는 바와 같이, 대조군(Vechicle CTR)과 비교하여, 모든 환자에서 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 N1 유전자 단편의 Cq(즉, Ct)가 증가되었다(폴드값: 2.24; P = 0.002).
또한, 도 6에서 보는 바와 같이, 대조군(Vechicle CTR)과 비교하여 모든 환자에서 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 N2 유전자 단편의 Cq가 45 이상이거나, 증폭되지 않아 완전히 억제된 것을 알 수 있었다(P = 0.001).
또한, 도 7에서 보는 바와 같이, 대조군(Vechicle CTR)과 비교하여 모든 환자에서 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우 N3 유전자 단편의 Cq 값이 대조군에 비해 증가하였는 바, N3 유전자의 발현이 억제된 것을 알 수 있었다(폴드값: 2.34; P = 0.002).
따라서, 폴리포스페이트의 항 바이러스 효과가 현저히 뛰어남을 알 수 있었다.
[실험예 4] 폴리포스페이트의 코로나바이러스 억제 효과 확인(3)
단위체 120의 폴리포스페이트(P120 PolyP)와 단위체 8의 폴리포스페이트(P8 PolyP)의 항 바이러스 효과를 확인하기 위하여, RT-실시간 PCR 분석을 실시하였다. 시험관 내(in vitro) 실험을 위하여, COVID-19 환자 2명의 시료에 단위체 120의 폴리포스페이트(P120 PolyP) 및 단위체 8의 폴리포스페이트(인산염 단위체가 8인 포스페이트, P8 PolyP)를 각각 30μM 씩 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 상기 샘플로부터 RNA를 추출한 후 "CLONIT quanty COVID-19" [Ref. RT-25](IVD 승인) 키트 및 BioRad CFX96 기기를 사용하여 25℃, 2분; 50℃, 15분; 95℃, 2분; 95℃, 3초; 55℃, 30초의 조건으로 45회 사이클을 수행하였다. RT-실시간 PCR 분석 결과를 도 8 및 표 5에 나타내었다.
샘플 타겟유전자 비히클 P120 PolyP P8 PolyP P120 PolyP 폴드값
#S1 N1 20.68 24.46 20.63 3.79
#S1 N2 20.16 n.a. 20.02 n.a.
#S1 N3 21.66 23.23 22 1.58
#S1 int ctr 26.75 n.a. 26.66 -
도 8 및 표 5에서와 같이, 비히클 처리한 대조군에 비하여 단위체 120 및단위체 8의 폴리포스페이트(P120 PolyP; P8 PolyP)를 처리한 경우, SARS-CoV-2의 N1, N2 및 N3 유전자에 대한 억제 효과를 확인할 수 있었는 바, 상기 결과로 폴리포스페이트의 항 바이러스 효과가 현저히 뛰어남을 알 수 있었다.
[실험예 5] 폴리포스페이트의 코로나바이러스 억제 효과 확인(4)
단위체 120의 폴리포스페이트(P120 PolyP) 및 단위체 8의 폴리포스페이트(P8 PolyP)의 항 바이러스 효과를 확인하기 위하여 RT-실시간 PCR 분석을 실시하였다. 시험관 내(in vitro) 실험을 위하여, COVID-19 환자 2명의 시료에 단위체 120의 폴리포스페이트(P120 PolyP) 및 단위체 8의 폴리포스페이트(P8 PolyP)를 각각 30μM 씩 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 상기 샘플로부터 RNA를 추출한 후 RdRp 및 E 유전자를 검출할 수 있는 키트("Ab Analitica"; IVD 승인) 및 BioRad CFX96 기기를 사용하여 25℃, 2분; 50℃, 15분; 95℃, 2분; 95℃, 3초; 55℃, 30초의 조건으로 45회 사이클을 수행하였다. RT-실시간 PCR 분석 결과 도출된 타겟(RdRp 및 E 유전자)의 발현량을 9, 도 10 및 표 6에 나타내었다.
샘플 타겟유전자 비히클 P120 PolyP P8 PolyP P120 PolyP 폴드값
#6 RdRp 37.3 38.27 - 0.97
#6 E 37.23 38.03 - 0.8
#6 int ctr 30.6 31.19 - -
#8 RdRp 32.5 33.18 32.83 0.68
#8 E 31.53 32.65 31.73 1.12
#8 int ctr 30.3 31.41 29.7 -
그 결과, 도 9, 도 10 및 표 6에서 나타난 것처럼, 대조군(Vechicle CTR)과 비교하여 단위체 120의 폴리포스페이트(P120 PolyP) 및 단위체 8의 폴리포스페이트(P8 PolyP)를 처리한 경우 SARS-CoV-2의 RdRP(P = 0.11) 및 E 유전자(P = 0.1)의 발현량이 현저히 감소하였는 바, 이로부터 폴리포스페이트의 항 바이러스 효과가 뛰어남을 알 수 있었다.
[실험예 6] 폴리포스페이트의 코로나바이러스 감염 예방 효과 확인(1)
폴리포스페이트(PolyP)의 코로나바이러스의 감염 예방 효과를 확인하기 위해, RT-실시간 PCR 분석을 실시하였다. 구체적으로는 BSL3 실험실에서 일차 세포 6.0 X 105 세포에 단위체 120의 폴리포스페이트(P120 PolyP) 또는 단위체 126의 폴리포스페이트(인산염 단위체가 126인 포스페이트, P126 PolyP) 각 37.5μM를 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 후 20분이 경과하였을 때 Sars-CoV-2 양성 환자에 사용된 동결된 스왑으로부터 얻어진 Sars-CoV-2 입자를 0.16 MOI(DCA), 0.01 MOI(CM) 및 0.001 MOI(DLL)로 일차 세포(Primary cell)에 감염시켰다. 감염되지 않은 세포는 감염의 음성 대조군으로 사용하였다. 감염 후 12시간이 경과하였을 때, 상기 일차 세포에서 RNA를 추출하였다. 이후 "CLONIT quanty COVID-19" [Ref. RT-25](IVD 승인) 키트 및 BioRad CFX96 기기를 사용하여 25℃, 2분; 50℃, 15분; 95℃, 2분; 95℃, 3초; 55℃, 30초의 조건으로 45회 사이클을 수행하였다. RT-실시간 PCR 분석을 통하여 타겟(N1, N2, N3)의 Cq값을 하기 표 7에 나타내었다. 상기 Cq값을 정규화 하여 Ct값으로 도출하고 비히클 처리된 대조군에 대한 상기 정량값의 배수를 계산하여 그 결과를 도 11 내지 13에 나타내었다.
시료 타겟 1차 Cq 2차 Cq
비히클 CTR 처리된 Sars-CoV-2 감염 DCA(0.16 MOI) N1 23.97 23.93
N2 23.30 23.34
N3 23.84 23.79
INT CTR 26.17 26.24
P120 PolyP 처리된 Sars-CoV-2 감염 DCA(0.16 MOI) N1 31.14 30.79
N2 31.07 31.04
N3 30.86 30.59
INT CTR 26.65 26.63
P126 PolyP 처리된 Sars-CoV-2 감염 DCA(0.16 MOI) N1 27.99 27.68
N2 27.62 27.28
N3 28.15 28.12
INT CTR 24.39 24.59
비히클 CTR 처리된 Sars-CoV-2 감염 CM(0.01 MOI) N1 27.27 27.37
N2 26.86 26.85
N3 27.31 27.38
INT CTR 24.69 23.80
P120 PolyP 처리된 Sars-CoV-2 감염 CM(0.01 MOI) N1 30.10 30.13
N2 29.85 29.87
N3 29.76 30.07
INT CTR 25.25 25.27
P126 PolyP 처리된 Sars-CoV-2 감염 CM(0.01 MOI) N1 29.46 29.56
N2 29.38 29.14
N3 29.29 29.64
INT CTR 25.48 25.54
P120 PolyP 처리된 Sars-CoV-2 감염 DLL(0.001 MOI) N1 31.04 30.96
N2 30.68 30.50
N3 30.90 31.06
INT CTR 27.15 27.23
P126 PolyP 처리된 Sars-CoV-2 감염 DLL(0.001 MOI) N1 29.58 29.70
N2 29.35 29.33
N3 29.66 29.44
INT CTR 24.64 24.68
도 11 내지 13 및 표 7에서 보는 바와 같이, 단위체 120의 폴리포스페이트(P120 PolyP) 및 단위체 126의 폴리포스페이트(P126 PolyP)로 표시되는 화합물로 전처리된 일차 세포에 Sars-CoV-2를 감염시킨 결과, 대조군에 비하여 N1, N2 및 N3 유전자 절편의 발현 수준이 현저히 감소하였는 바, 폴리포스페이트의 코로나바이러스 예방 효과가 현저히 뛰어남을 알 수 있었다.
[실험예 7] 폴리포스페이트의 코로나바이러스 감염 예방 효과 확인(2)
단위체 120의 폴리포스페이트(P120 PolyP)의 코로나바이러스의 감염 예방 효과를 확인하기 위하여 면역 형광 분석(immunofluorescence; IF)을 수행하였다. 먼저 앞서 실험 과정과 같이, 일차 세포에 단위체 120의 폴리포스페이트(P120 PolyP) 37.5μM를 처리한 뒤 30분이 경과하였을 때, Sars-CoV-2 양성 환자에 사용된 동결된 스왑으로부터 얻어진 Sars-CoV-2 입자를 0.01 MOI로 세포에 감염시켰다. 12시간 후 배율 40 배. Leica TCS SP8 MP 다 광자 현미경을 사용하여 세포를 관찰한 결과를 도 14에 나타내었고, MANTRA 정량적 병리학 워크 스테이션을 사용하여 정량 분석한 결과를 도 15에 나타내었다.
도 14 및 도 15에서 보는 바와 같이, 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우, Sars-CoV-2의 외피 단백질, 스파이크 단백질, N 단백질 및 RdRp 단백질의 발현이 감소하였는 바, 폴리포스페이트의 코로나바이러스 억제 효과가 현저히 뛰어남을 알 수 있었다.
[실험예 8] ACE2와 폴리포스페이트 간 상호작용 확인
안지오텐신 전환효소 2(Angiotensin-converting enzyme 2; ACE2)와 폴리포스페이트(PolyP)의 관계를 확인하기 위하여 면역 형광 분석(immunofluorescence; IF)을 수행하였다. 실험예 7과 같이 처리한 후, DAPI(358/546 nm의 레이저)를 조사하여 항-ACE2 단백질 및 폴리포스페이트(PolyP)를 검출한 결과를 도 16과 같이 나타내었다.
도 16에서 보는 바와 같이, ACE2와 폴리포스페이트(PolyP)가 같이 분포함을 확인할 수 있어, 양자간 상호작용이 있을 수 있음을 확인할 수 있었다.
[실험예 9] 폴리포스페이트의 처리 농도에 따른 ACE2 발현량 확인
폴리포스페이트(PolyP)의 처리 농도에 따른 ACE2 발현량을 확인하기 위하여 면역 블로팅 분석(Immunoblotting analyses)을 수행하였다. 먼저 인간 일차 세포(500.000)를 도말하고 4.16uM, 12.5uM, 37.5uM 및 112uM의 상이한 농도의 단위체 120의 폴리포스페이트(P120 PolyP)로 24시간 동안 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하여 그 결과를 도 17과 같이 나타내었다.
도 17과 같이, 폴리포스페이트(PolyP)가 24시간 동안 처리된 세포에서 ACE2의 용량 의존적 감소를 나타낸 것을 확인하였다.
[실험예 10] 폴리포스페이트의 처리 시간에 따른 ACE2 발현량 확인
폴리포스페이트(PolyP)의 처리 시간에 따른 ACE2 발현량을 확인하기 위하여 면역 블로팅 분석(Immunoblotting analyses)을 수행하였다. 먼저 베로 E6 세포(500,000)를 도말하고 단위체 120의 폴리포스페이트(P120 PolyP)로 12, 24, 48시간 동안 각각 처리하였고, 비히클 처리된 세포를 음성 대조군으로 사용하여 그 결과를 도 18과 같이 나타내었다
도 18과 같이, 폴리포스페이트(PolyP)에 노출된 시간이 증가할수록 ACE2 발현이 감소하여, ACE2의 시간 의존적 감소를 나타낸 것을 확인하였다.
[실험예 11] 폴리포스페이트의 ACE2 억제 기전 확인
폴리포스페이트(PolyP)의 ACE2 억제 기전을 확인하기 위하여, 이하의 실험을 수행하였다. 먼저 베로 E6 세포(500,000)를 도말하고 10uM MG132(프로테아좀 억제제) 또는 50ug 사이클로헥사미드(Cycloheximide; CHX)와, 단위체 120의 폴리포스페이트(P120 PolyP)를 24시간 동안 병용 처리한 후, 면역 블로팅 분석(Immunoblotting analyses)을 통해 ACE2 발현량을 측정하여 도 19 및 20에 나타내었다.
도 19에서 보는 바와 같이, 폴리포스페이트(PolyP) 및 10uM MG132(프로테아좀 억제제)를 병용한 경우, 비히클 처리된 세포 및 10uM MG132(프로테아좀 억제제)를 단독 투여한 대조군에 비하여 ACE2 발현량이 오히려 증가한 것을 확인하였다.
또한, 도 20에서 보는 바와 같이, 단위체 120의 폴리포스페이트(120 PolyP) 및 50ug 사이클로헥사미드(Cycloheximide; CHX)를 병용 투여한 경우, 비히클 처리된 세포 및 50ug 사이클로헥사미드(Cycloheximide; CHX)를 단독 처리한 대조군에 비하여 ACE2 발현량이 감소한 것을 확인하였다.
이를 통해 폴리포스페이트(PolyP)는 프로테아좀 경로를 통하여 ACE2 발현을 차단하는 것을 알 수 있었다.
[실험예 12] 폴리포스페이트의 코로나바이러스 감염예방 효과 확인(3)
폴리포스페이트(P120 PolyP)의 코로나바이러스 감염의 예방 효과를 확인하기 위하여 인간 직장 결장 암종 세포주에서 RT-실시간 PCR 분석을 실시하였다. 구체적으로는 인간 직장 결장 암종 세포주인 Caco2 세포에 단위체 120의 폴리포스페이트(P120 PolyP) 37.5μM을 처리한 뒤 8시간이 경과하였을 때, Sars-CoV-2 양성 환자에 사용된 동결된 스왑으로부터 얻어진 Sars-CoV-2 입자를 0.022 MOI로 세포에 감염시켰다. 감염 후 36시간이 경과하였을 때, Caco2 세포에서 RNA를 추출하였다. 이후 RT-실시간 PCR 분석을 통해 Sars-CoV-2의 증식에 중요한 역할을 하는 뉴클레오캡시드(N) 유전자 유래의 N2 및 N3 절편을 정량적으로 검출하여 도 21과 같이 나타내었고, RdRp, 뉴클레오캡시드(N) 유전자 유래의 N1 및 Caco2 세포의 ACE2 발현량을 측정하여 그 결과를 도 22에 나타내었다. 단, Sars-CoV-2에 감염된 세포에 비히클을 처리한 경우를 대조군으로 사용하였다.
도 21에서 보는 바와 같이, 인간 직장 결장 암종 세포주에 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우, 처리 후 감염시킨 Sars-CoV-2의 N2 및 N3 유전자 절편의 발현 수준이 현저히 감소하였다.
또한, 도 22에서 보는 바와 같이, 인간 직장 결장 암종 세포주에 단위체 120의 폴리포스페이트(P120 PolyP)를 처리한 경우, RdRp 및 ACE2 발현 수준이 현저히 감소하였다.
이를 통해, 폴리포스페이트는 코로나바이러스 예방 효과가 현저히 뛰어남을 알 수 있었다.
[실험예 13] 폴리포스페이트의 코로나바이러스 감염 예방 효과 확인(4)
폴리포스페이트(PolyP)를 에어로졸 형태로 분무할 경우에도 코로나바이러스 감염 예방 효과가 있는 지 확인하였다. 구체적으로는 베로 세포를 분주한 후, 네뷸라이저로 단위체 120의 폴리포스페이트(P120 PolyP) 37.5μM를 분무하였다. 1시간 후 Sars-CoV-2 입자를 세포에 감염시켰고(0.1 MOI), 감염되지 않은 세포는 감염의 음성 대조군으로 사용하였으며, 비히클 처리된 세포를 음성 대조군으로 사용하였다. 처리 48시간 후 베로 세포를 용해시키고 RNA를 추출하였다. 이후 실시간 PCR 분석을 통해 그 결과를 도 23과 같이 나타내었으며, 이때 그래프 상 왼쪽부터 ACE2 및 Sars-CoV-2의 N1 절편, 외피(E), 스파이크(Spike) 및 주요 구조 sgRNA들(sgM, sgE, sgN, sgS)의 결과값에 해당한다.
도 23에서 보는 바와 같이, 베로 세포에 네뷸라이저로 단위체 120의 폴리포스페이트(P120 PolyP)를 분무한 경우, Sars-CoV-2의 ACE2, N1 절편, 외피(E), 스파이크(Spike), sgM, sgE, sgN 및 sgS 억제 효과를 나타내어, 에어로졸 제형으로 전달된 단위체 120의 폴리포스페이트(P120 PolyP)는 코로나바이러스 감염에 대한 억제 작용을 유지했음을 알 수 있었다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 코로나바이러스에 대한 감염을 효과적으로 예방할 수 있는 약학적 조성물, 소독용 또는 세정용 조성물에 관한 것이다.

Claims (26)

  1. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효 성분으로 포함하는, 바이러스 감염 또는 감염 질환의 예방용 약학적 조성물.
  2. 제 1항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 2 이상 200 이하인 것인, 약학적 조성물.
  3. 제 2항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 100 이상 200 이하인 것인, 약학적 조성물.
  4. 제 2항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 2 이상 9 이하, 100 이상 125 미만 또는 125 이상 130 미만인 것인, 약학적 조성물.
  5. 제 4항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 8, 120 또는 126인 것인, 약학적 조성물.
  6. 제 1항에 있어서,
    상기 바이러스는 코로나바이러스(coronavirus)인, 약학적 조성물.
  7. 제 6항에 있어서,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 약학적 조성물.
  8. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 바이러스 감염 또는 감염 질환의 예방용 식품 또는 식품 첨가제 조성물.
  9. 제 8항에 있어서,
    상기 바이러스는 코로나바이러스(coronavirus)인, 식품 또는 식품 첨가제 조성물.
  10. 제 9항에 있어서,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 식품 또는 식품 첨가제 조성물.
  11. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 바이러스 감염 또는 감염 질환의 예방용 사료 또는 사료 첨가제 조성물.
  12. 제 11항에 있어서,
    상기 바이러스는 코로나바이러스(coronavirus)인, 사료 또는 사료 첨가제 조성물.
  13. 제 12항에 있어서,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 사료 또는 사료 첨가제 조성물.
  14. 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 바이러스 억제 활성을 갖는 소독용 또는 세정용 조성물.
  15. 제 14항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 2 이상 200 이하인 것인, 소독용 또는 세정용 조성물.
  16. 제 15항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 100 이상 200 이하인 것인, 소독용 또는 세정용 조성물.
  17. 제 15항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 2 이상 9 이하, 100 이상 125 미만 또는 125 이상 130 미만인 것인, 소독용 또는 세정용 조성물.
  18. 제 17항에 있어서,
    상기 폴리포스페이트는 인산염 단위체가 8, 120 또는 126인 것인, 소독용 또는 세정용 조성물.
  19. 제 14항에 있어서,
    상기 바이러스는 코로나바이러스(coronavirus)인, 소독용 또는 세정용 조성물.
  20. 제 19항에 있어서,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 소독용 또는 세정용 조성물.
  21. 대상체에 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 접촉시키는 단계를 포함하는, 바이러스의 소독 또는 세정 방법.
  22. 제 21항에 있어서,
    상기 바이러스는 코로나바이러스(coronavirus)인, 바이러스의 소독 또는 세정 방법.
  23. 제 22항에 있어서,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 바이러스의 소독 또는 세정 방법.
  24. 개체에게 폴리포스페이트(polyphosphate) 또는 이의 약학적으로 허용 가능한 염을 투여하는 단계를 포함하는, 바이러스 감염 또는 감염 질환의 예방 방법.
  25. 제 24항에 있어서,
    상기 바이러스는 코로나바이러스(coronavirus)인, 바이러스 감염 또는 감염 질환의 예방 방법.
  26. 제 24항에 있어서,
    상기 코로나바이러스는 인간 코로나바이러스 229E(HCoV-229E), 인간 코로나바이러스 OC43(HCoV-OC43), 인간 코로나바이러스 HKU1(HCoV-HKU1), 인간 코로나바이러스 NL63(HCoV-NL63), 중증 급성 호흡기 증후군 코로나바이러스(SARS-CoV), 중증 급성 호흡기 증후군-2 바이러스(Severe Acute Respiratory Syndrome virus-2; SARS-CoV-2), 중동 호흡기 증후군 코로나바이러스(MERS-CoV), 돼지 전염성 설사 바이러스(porcine epidemic diarrhea virus; PEDV), 전염성 위장염 바이러스(transmissible gastroenteritis virus; TGEV), 돼지 혈구 응집성뇌척수염 바이러스(porcine hemagglutinating encephalomyelitis virus; PHEV), 우 코로나바이러스(bovine coronavirus; BCoV), 말 코로나바이러스(equine coronavirus; EqCoV), 쥐 코로나바이러스(murine coronavirus; MuCoV), 개코로나바이러스(canine coronavirus; CCoV), 고양이 코로나바이러스 (feline coronavirus; FCoV), 박쥐 코로나바이러스-1(Miniopterus bat coronavirus1), 박쥐 코로나바이러스 HKU8(Miniopterus bat coronavirus HKU8), 박쥐 코로나바이러스 HKU2(Rhinolophus bat coronavirus HKU2), 박쥐 코로나바이러스 512(Scotophilus bat coronavirus 512), 박쥐 코로나바이러스 HKU4(Tylonycteris bat coronavirus HKU4), 박쥐 코로나바이러스 HKU5(Pipistrellus bat coronavirus HKU5), 박쥐 코로나바이러스 HKU9(Rousettus bat coronavirus HKU9), 새 코로나바이러스(Avian coronavirus), 흰색 돌고래 코로나바이러스 SW1(Beluga whale coronavirus SW1), 제주직박구리 코로나바이러스 HKU11(Bulbul coronavirus HKU11), 개똥지빠귀 코로나바이러스 HKU12(Thrush coronavirus HKU12) 및 킨바라 코로나바이러스 HKU13(Munia coronavirus HKU13)로 이루어진 군에서 선택된 1종 이상인, 바이러스 감염 또는 감염 질환의 예방 방법.
PCT/KR2020/018989 2020-04-24 2020-12-23 폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물. WO2021215617A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200050184 2020-04-24
KR10-2020-0050184 2020-04-24

Publications (1)

Publication Number Publication Date
WO2021215617A1 true WO2021215617A1 (ko) 2021-10-28

Family

ID=78269418

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/018989 WO2021215617A1 (ko) 2020-04-24 2020-12-23 폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물.

Country Status (2)

Country Link
KR (2) KR20210132567A (ko)
WO (1) WO2021215617A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4320597A1 (de) * 1993-06-22 1995-01-05 Heinz C Prof Dr Dr Schroeder Verwendung von Polyphosphaten zur antiviralen Therapie und als Immunmodulatoren
KR20130071032A (ko) * 2011-12-20 2013-06-28 한국생명공학연구원 단삼 추출물을 포함하는 코로나 바이러스 감염의 예방 또는 치료용 조성물
KR20190070629A (ko) * 2017-12-13 2019-06-21 전북대학교산학협력단 HBD2(human beta-defensin 2) 또는 상기 유전자와 융합된 메르스 코르나 바이러스의 에피토프 단백질을 포함하는 메르스 코로나바이러스의 예방 또는 치료용 조성물
KR20190092776A (ko) * 2018-01-31 2019-08-08 국민대학교산학협력단 메르스 코로나바이러스 헬리케이즈 nsP13의 활성을 억제하는 화합물 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4320597A1 (de) * 1993-06-22 1995-01-05 Heinz C Prof Dr Dr Schroeder Verwendung von Polyphosphaten zur antiviralen Therapie und als Immunmodulatoren
KR20130071032A (ko) * 2011-12-20 2013-06-28 한국생명공학연구원 단삼 추출물을 포함하는 코로나 바이러스 감염의 예방 또는 치료용 조성물
KR20190070629A (ko) * 2017-12-13 2019-06-21 전북대학교산학협력단 HBD2(human beta-defensin 2) 또는 상기 유전자와 융합된 메르스 코르나 바이러스의 에피토프 단백질을 포함하는 메르스 코로나바이러스의 예방 또는 치료용 조성물
KR20190092776A (ko) * 2018-01-31 2019-08-08 국민대학교산학협력단 메르스 코로나바이러스 헬리케이즈 nsP13의 활성을 억제하는 화합물 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LORENZ B, LEUCK J, KÖHL D, MÜLLER W., SCHRÖDER H. C: "Anti-HIV-1 activity of inorganic polyphosphates", JOURNAL OF ACQUIRED IMMUNE DEFICIENCY SYNDROMES AND HUMAN RETROVIROLOGY, vol. 14, no. 2, 1 February 1997 (1997-02-01), US , pages 110 - 118, XP009531387, ISSN: 1077-9450, DOI: 10.1097/00042560-199702010-00003 *

Also Published As

Publication number Publication date
KR20210132567A (ko) 2021-11-04
KR20210132581A (ko) 2021-11-04

Similar Documents

Publication Publication Date Title
WO2021235616A1 (ko) 제2형 중증급성호흡기증후군 코로나바이러스 감염 질환의 예방 또는 치료용 조성물
WO2022050516A1 (ko) 담팔수 추출물을 유효성분으로 포함하는 코로나 바이러스 치료제
WO2021206309A1 (en) Pharmaceutical composition for prevention or treatment of diseases caused by sars-cov-2
WO2009148279A9 (ko) 바이러스 억제제로서 유용한 트리테르페노이드계 화합물
WO2021015437A1 (ko) 활성산소 생성억제제 및 활성산소 소거제 복합물을 유효성분으로 포함하는 바이러스 감염 질환의 예방, 치료, 또는 개선용 조성물
WO2019231220A1 (ko) 2,3,5-치환된 싸이오펜 화합물의 유방암 예방, 개선 또는 치료 용도
WO2015199456A1 (ko) 포스파티딜콜린 합성경로 관여 물질을 포함하는 항바이러스용 조성물
WO2019225953A2 (ko) 잣나무 부산물 추출물을 함유하는 헬리코박터파일로리균 제균 효과를 갖는 조성물
WO2021215617A1 (ko) 폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물.
WO2024090747A1 (ko) 칸나비디올 및 타우린을 포함하는 치주염 예방 또는 치료용 조성물
WO2022031151A1 (ko) 고사리 추출물 또는 이의 분획물을 포함하는 항바이러스용 조성물
WO2021215616A1 (ko) 폴리포스페이트를 포함하는 코로나바이러스 감염 또는 감염 질환의 치료용 조성물
WO2022045520A1 (ko) 페난트로인돌리지딘 및 페난트로퀴놀리지딘 알칼로이드 유도체, 이의 광학이성질체, 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 코로나바이러스감염증-19 치료용 조성물
WO2021080388A1 (ko) 커큐미노이드계 화합물, 및 감초 추출물 또는 이의 분획물을 포함하는 복합체를 포함하는 돼지 유행성 설사 바이러스 감염의 예방 또는 치료용 조성물
WO2022080577A1 (ko) Pmca 억제제를 포함하는 코로나바이러스 감염 또는 감염 질환의 예방 또는 소독용 조성물
WO2022149929A1 (ko) 스테로이드 설파타제 억제제를 포함하는 항바이러스성 약학적 조성물
WO2012173392A2 (ko) 인플루엔자 바이러스 감염의 예방 또는 치료용 커큐미노이드계 화합물/스테비오사이드 함유 복합체
WO2024076172A1 (ko) 천연물을 이용한 코로나바이러스 또는 인플루엔자에 바이러스에 대한 항-바이러스 조성물 및 이의 용도
WO2019022357A1 (ko) 중동호흡기 증후군의 예방 또는 치료용 약학조성물
WO2021206498A1 (ko) 항코로나바이러스능을 가지는 플라보노이드 배당체
WO2022080576A1 (ko) Pmca 억제제를 포함하는 코로나바이러스 감염 또는 감염 질환의 치료용 조성물
KR20210116152A (ko) 리코린 클로라이드를 포함하는 코로나바이러스 감염 예방 또는 치료용 조성물
WO2018128510A1 (ko) 전이성 난소암, 자궁내막암 또는 유방암의 예방 또는 치료용 조성물
WO2021241873A1 (ko) 제2형 중증급성호흡기증후군 코로나바이러스 감염 질환의 예방 또는 치료용 조성물
WO2023171998A1 (ko) 동맥경화를 포함하는 노화성 혈관질환 치료 또는 예방용 조성물로서의 사이코사포닌 c

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20932339

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20932339

Country of ref document: EP

Kind code of ref document: A1