WO2021194179A1 - Virus oncolytique comprenant une séquence d'acide nucléique ciblant stat3 et mtor de manière bispécifique - Google Patents

Virus oncolytique comprenant une séquence d'acide nucléique ciblant stat3 et mtor de manière bispécifique Download PDF

Info

Publication number
WO2021194179A1
WO2021194179A1 PCT/KR2021/003487 KR2021003487W WO2021194179A1 WO 2021194179 A1 WO2021194179 A1 WO 2021194179A1 KR 2021003487 W KR2021003487 W KR 2021003487W WO 2021194179 A1 WO2021194179 A1 WO 2021194179A1
Authority
WO
WIPO (PCT)
Prior art keywords
adenovirus
tumor
mtor
sequence
nucleotide sequence
Prior art date
Application number
PCT/KR2021/003487
Other languages
English (en)
Korean (ko)
Inventor
최진우
박성훈
찰스고흐너 피터
유중기
최청갑
엄기환
이의진
이형빈
Original Assignee
㈜큐리진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ㈜큐리진 filed Critical ㈜큐리진
Publication of WO2021194179A1 publication Critical patent/WO2021194179A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10033—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory

Definitions

  • the present invention relates to an antitumor adenovirus and an anticancer composition comprising the same.
  • Cancer is one of the diseases that cause the highest number of deaths worldwide, and the development of innovative cancer treatments can reduce medical costs and create high added value at the same time.
  • molecular therapeutics that can overcome existing anticancer drug resistance accounted for $17.5 billion in 7 major countries (US, Japan, France, Germany, Italy, Spain, UK), and in 2018, about It is expected to show a growth rate of 9.5% compared to 2008, occupying a market size of about $45 billion.
  • Cancer treatment is divided into surgery, radiation therapy, chemotherapy, and biological therapy.
  • chemotherapy is a treatment that suppresses or kills cancer cell proliferation as a chemical substance.
  • RNA interference (hereinafter referred to as RNAi) has been found to act on sequence-specific mRNA in various types of mammalian cells since its role was discovered (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773).
  • RNAi is a small interfering ribonucleic acid short interfering RNA (small interfering RNA, hereinafter referred to as siRNA) having a double helix structure of 21-25 nucleotides in size is specifically bound to an mRNA transcript having a complementary sequence. It is a phenomenon in which the expression of a specific protein is suppressed by decomposing the transcriptome.
  • RNA double-stranded is processed by an endonuclease called Dicer and converted into 21 to 23 double-stranded (base pair, bp) siRNA, which binds to RISC (RNA-induced silencing complex).
  • RISC RNA-induced silencing complex
  • the guide (antisense) strand recognizes and degrades the target mRNA to sequence-specifically inhibit the expression of the target gene (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503 -514).
  • siRNA for the same target gene has a superior inhibitory effect on mRNA expression in vitro and in vivo compared to antisense oligonucleotide (ASO), and the effect lasts for a long time.
  • ASO antisense oligonucleotide
  • the market for RNAi technology-based therapeutics, including siRNA, has been analyzed to form a total of more than 12 trillion won in the future world market size around 2020. It is being evaluated as a next-generation gene therapy technology that can treat difficult-to-treat diseases.
  • siRNA binds to the target mRNA and regulates the expression of the target gene in a sequence-specific manner. Compared to the development period and development cost of (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13(4):664-670).
  • this ribonucleic acid-mediated interference phenomenon proposes a solution to the problem that occurs in the development of conventional chemical synthesis drugs, while selectively inhibiting the expression of specific proteins at the transcript level, and a study to use them in the development of therapeutic agents for various diseases, especially tumor therapeutics is in progress
  • siRNA therapeutics have the advantage that side effects can be predicted because the target is clear, but this target specificity is a disease caused by problems with various genes. may be the cause
  • the present invention provides an antitumor adenovirus comprising a nucleotide sequence having STAT3 as a target sequence and a nucleotide sequence having mTOR as a target sequence.
  • the present invention provides a composition for treating cancer comprising the anti-tumor adenovirus.
  • an adenovirus comprising an expression cassette encoding an shRNA expressing a double-stranded siRNA that simultaneously inhibits the expression of STAT3 and mTOR of the present invention and an hTERT promoter is specifically delivered to cancer cells by avoiding an in vivo immune response It has a systemic therapeutic effect, can be delivered locally, has excellent selectivity, and exhibits a remarkable anticancer effect even with minimally invasive treatment, so it can be usefully used as an anticancer composition or an anticancer adjuvant for various cancer types.
  • FIG. 1 is a diagram illustrating a map of a vector for intracellular expression of shRNA including a dual target siRNA set of the present invention.
  • FIG. 2 is a diagram confirming the effect of inhibiting the expression of mTOR and STAT3 genes by double-stranded siRNA of the double target of sets 1 to 9 of the present invention, respectively.
  • FIG. 3 is a diagram confirming the expression levels of mTOR and STAT3 by a vector comprising a sequence encoding a TTGGATCCAA loop shRNA sequence of SEQ ID NO: 20 or a sequence encoding a TTCAAGAGAG loop shRNA sequence of SEQ ID NO: 29 according to the amount of shRNA DNA. .
  • FIG. 4 is a diagram comparing the gene expression inhibition effect of two single target siRNAs connected in series with the dual target shRNA of the present invention.
  • FIG. 5 is a diagram showing a vector map of the adenovirus vector of the present invention.
  • FIG. 6 is a diagram schematically illustrating the structure of the adenovirus of the present invention.
  • FIG. 7 is a diagram confirming the effect of inhibiting the expression of mTOR and STAT3 genes by the recombinant adenovirus CA102 of the present invention, which encodes and expresses the hTERT promoter and dual target shRNA, in bladder cancer cell lines T24 and 253JBV.
  • FIG. 8 is a diagram confirming the effect of inhibiting the expression of mTOR and STAT3 genes by the recombinant adenovirus CA102 of the present invention, which encodes and expresses the hTERT promoter and dual target shRNA, in the head and neck cancer cell lines FaDu and HSC-2.
  • FIG. 9 is a diagram confirming the effect of inhibiting the expression of mTOR and STAT3 genes by the recombinant adenovirus CA102 of the present invention, which encodes and expresses the hTERT promoter and dual target shRNA, in skin squamous cell carcinoma cell lines A431 and HSC-5.
  • FIG. 10 is a diagram confirming the effect of inhibiting the expression of mTOR and STAT3 genes by the recombinant adenovirus CA102 of the present invention at the protein level in bladder cancer cell lines T24 and 253J-BV.
  • FIG. 11 is a diagram confirming the killing effect of bladder cancer cell lines RT4, T24 and 253J-BV by the recombinant adenovirus CA102 of the present invention.
  • FIG. 12 is a diagram confirming the killing effect of the head and neck cancer cell lines FaDu and HSC-2 by the recombinant adenovirus CA102 of the present invention.
  • FIG. 13 is a diagram confirming the killing effect of the skin squamous cell carcinoma cell lines A431 and HSC-5 by the recombinant adenovirus CA102 of the present invention.
  • FIG. 14 is a view confirming the anticancer effect of the recombinant adenovirus CA102 of the present invention on bladder cancer cells (253J-BV) in vivo.
  • FIG. 15 is a diagram confirming the anticancer effect of the recombinant adenovirus CA102 of the present invention on head and neck cancer cells (FaDu) in vivo.
  • 16 is a view confirming the anticancer effect of the recombinant adenovirus CA102 of the present invention on tumors (bladder cancer) formed in vivo.
  • 17 is a diagram confirming the anticancer effect of CA102 according to the number of administrations on tumors (bladder cancer) formed in vivo.
  • FIG. 18 is a diagram confirming the effect of treating glioblastoma according to the dose of recombinant adenovirus CA102 of the present invention in vivo.
  • 19 is a view confirming the bladder cancer treatment effect of the recombinant adenovirus CA102 of the present invention and the combined treatment with cisplatin in vivo.
  • nucleic acids are written in a 5' ⁇ 3' direction from left to right.
  • Numerical ranges recited within the specification are inclusive of the numbers defining the range, including each integer or any non-integer fraction within the defined range.
  • the present invention provides a human telomere promoter (hTERT); And it relates to an antitumor adenovirus comprising an expression cassette comprising a nucleotide sequence having STAT3 as a target sequence and a nucleotide sequence having mTOR as a target sequence.
  • hTERT human telomere promoter
  • the nucleotide sequence having STAT3 as the target sequence and the nucleotide sequence having mTOR as the target sequence may partially or 100% complementarily bind to form a double strand during gene expression.
  • the human telomere promoter may be operably linked with an endogenous gene of an adenovirus.
  • operably linked refers to a functional linkage between a gene expression control sequence (eg, an array of promoter, signal sequence, or transcriptional regulatory factor binding sites) and another gene sequence, whereby the Regulatory sequences will control the transcription and/or translation of the other gene sequences.
  • a gene expression control sequence eg, an array of promoter, signal sequence, or transcriptional regulatory factor binding sites
  • the hTERT promoter may include the nucleotide sequence of SEQ ID NO: 38.
  • the endogenous gene of adenovirus has the structure of 5'ITR-C1-C2-C3-C4-C5 3'ITR; wherein C1 comprises E1A (SEQ ID NO: 39), E1B (SEQ ID NO: 41) or E1A-E1B; wherein C2 includes E2B-L1-L2-L3-E2A-L4; wherein C3 does not include E3 or includes E3; wherein C4 includes L5; and C5 may not include E4 or may include E4, and may include the nucleotide sequence of SEQ ID NO: 42.
  • the adenovirus may have a partial deletion of the E3 region, and the deleted nucleotide sequence may include the nucleotide sequence of SEQ ID NO: 43.
  • the expression cassette may be located at the C3 region of the endogenous gene of the adenovirus.
  • the hTERT promoter may be operably linked with E1A and E1B of endogenous genes of adenovirus.
  • an IRES sequence (SEQ ID NO: 40) may be further included between E1A and E1B of the endogenous gene of adenovirus.
  • the expression cassette is capable of encoding and expressing shRNA.
  • the shRNA may simultaneously inhibit the expression of STAT3 and mTOR.
  • the antitumor adenovirus of the present invention can inhibit expression by degrading mRNA of a nucleic acid or inhibiting translation by RNA interference.
  • the expression cassette of the present invention can simultaneously inhibit STAT3 and mTOR by expressing a double-stranded siRNA in which a STAT3-specific sense strand and an mTOR-specific anti-sense strand are partially complementary.
  • the term “repression of expression” means to cause a decrease in expression or translation of a target gene, and preferably means that the expression of the target gene becomes undetectable or exists at an insignificant level.
  • siRNA small interfering RNA
  • siRNA refers to a short double-stranded RNA capable of inducing an RNA interference (RNAi) phenomenon through cleavage of a specific mRNA.
  • RNAi RNA interference
  • siRNA is composed of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. antisense strand), and since the antisense RNA strand is an siRNA specific for mTOR (antisense strand for mTOR), the double-stranded siRNA can simultaneously inhibit the expression of STAT3 and mTOR, respectively.
  • RNA short hairpin RNA
  • shRNA short hairpin RNA
  • RNA refers to a single-stranded RNA that partially includes a palindromic nucleotide sequence, has a double-stranded structure in the 3' region, forms a hairpin-like structure, and is expressed in cells It means RNA that can be converted into siRNA after being cut by dicer, a type of RNase present in the cell, and the length of the double-stranded structure is not particularly limited, but is preferably 10 nucleotides or more, more preferably is 20 nucleotides or more.
  • the shRNA can be encoded and expressed by an expression cassette, and the shRNA is siRNA for each gene in a set sequence consisting of an antisense strand and a sense strand, after converting U to T, 3' of the sense strand It can be produced by linking TTGGATCCAA (TTGGATCCAA loop) or TTCAAGAGAG (TTCAAGAGAG loop), antisense strand and TT to construct an expression cassette encoding shRNA and expressing it in a cell.
  • TTGGATCCAA TTGGATCCAA loop
  • TTCAAGAGAG TTCAAGAGAG loop
  • the expression cassette is SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16, or a nucleic acid in which U is converted to T in the nucleotide sequences of SEQ ID NOs: 17 and 18.
  • the siRNAs of SEQ ID NOs: 1 and 2 are 17mers in 21mers
  • siRNAs of SEQ ID NOs: 3 and 4 are 16mers in 20mers
  • siRNAs of SEQ ID NOs: 5 and 6 are 15mers in 19mers
  • siRNAs of SEQ ID NOs: 7 and 8 are 14mer in 18mer
  • siRNA of SEQ ID NOs: 9 and 10 is 16mer in 17mer
  • siRNA of SEQ ID NO: 11 and 12 is 17mer in 20mer
  • siRNA of SEQ ID NO: 13 and 14 is 16mer in 19mer
  • siRNA of SEQ ID NOs: 17 and 18, 14mer of 17mer can complementarily bind.
  • the DNA encoding the shRNA included in the expression cassette may include any one of the nucleic acids represented by the nucleotide sequences of SEQ ID NOs: 20 to 37.
  • the nucleotide sequence targeting STAT3 as the target sequence may include a nucleotide sequence having at least 60% complementarity with the reverse complementary sequence of the nucleotide sequence targeting mTOR, and the nucleotide sequence targeting mTOR as the target sequence is It may include a nucleotide sequence having a complementarity of 60% or more with a reverse complementary sequence of a nucleotide sequence using STAT3 as a target sequence.
  • the nucleotide sequence targeting STAT3 as the target sequence is 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% of the reverse complementary sequence of the nucleotide sequence targeting mTOR. Or it may include a nucleotide sequence having a complementarity of 99% or more, and the nucleotide sequence targeting mTOR as the target sequence is 70%, 80%, 85%, 90%, 95% of the reverse complementary sequence of the nucleotide sequence targeting STAT3. %, 96%, 97%, 98%, or may include a nucleotide sequence having a complementarity of 99% or more.
  • variants of the nucleotide sequence having STAT3 as the target sequence or mTOR as the target sequence included in the expression cassette are included within the scope of the present invention.
  • the expression cassette of the present invention is a functional equivalent of a nucleic acid molecule constituting it, for example, some nucleotide sequence of a nucleic acid molecule has been modified by deletion, substitution or insertion, but a nucleotide sequence molecule and It is a concept that includes variants capable of performing the same functionally.
  • the "% of sequence homology" for a nucleic acid molecule is determined by comparing two optimally aligned sequences to a comparison region, wherein a portion of the nucleic acid molecule sequence in the comparison region is a reference sequence (additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to (not including).
  • the shRNA may include a nucleotide sequence sequentially encoding a nucleotide sequence having STAT3 as a target sequence, a loop sequence capable of forming a hairpin structure, and a nucleotide sequence having mTOR as a target sequence.
  • expression of the expression cassette may be regulated by a U6 promoter, and the U6 promoter may include the nucleotide sequence of SEQ ID NO: 19.
  • the adenovirus may be an adenovirus with a serotype 5 of group C.
  • the anti-tumor virus of the present invention may have high oncolytic activity compared to wild-type adenovirus, and may have high oncolytic activity compared to adenovirus in which the hTERT promoter is introduced into wild-type adenovirus.
  • the present invention relates to a composition for treating cancer comprising the anti-tumor virus of the present invention.
  • the composition of the present invention may further include an anticancer agent, for example, acibacin, aclarubicin, acodazole, acronisin, adozelesin, alanosine, aldesleukin, allo Purinol Sodium, Altretamine, Aminoglutethimide, Amonafide, Ampligen, Amsacrine, Androgens, Anguidin, Apidicoline Glycinate, Asaray, Asparaginase, 5-Azacytidine , Azathioprine, Bacillus Calmete-Guerin (BCG), Bakers Antipol, Beta-2-deoxythioguanosine, Bisantrene HCl, Bleomycin Sulfate, Bulsupan, Butionine Sulfoximine, BWA 773U82 , BW 502U83/HCl, BW 7U85 mesylate, cerasemid, carvetimer, carboplatin, carmustine, chloram
  • the cancer is colon cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, stomach cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer, esophageal cancer, small intestine cancer , perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma , intraocular melanoma, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, glioblastoma multiforme and pituitary gland
  • promoter refers to an untranslated nucleic acid upstream of a coding region that includes a binding site for RNA polymerase and has transcription initiation activity into mRNA of a gene downstream of the promoter. say sequence.
  • the promoter may be any promoter capable of initiating the expression of shRNA.
  • a promoter constitutive promoter
  • a promoter inducible promoter
  • Examples include U6 promoter, H1 promoter, CMV (cytomegalovirus) promoter, SV40 promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108:193-199, 1991), CaMV 35S promoter (Odell et al., Nature 313: 810-812, 1985), the Rsyn7 promoter (US Patent Application No.
  • the promoter of the present invention may be a U6 promoter, a HI promoter, or a CMV promoter, and according to a preferred embodiment of the present invention, the U6 promoter may be used.
  • composition of the present invention may further include an adjuvant.
  • the adjuvant may be used without limitation as long as it is known in the art, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the effect.
  • composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field.
  • Pharmaceutically acceptable carriers that can be used in the composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin. It can be prepared by mixing and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • compositions for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used.
  • base of the suppository witepsol, tween 61, cacao butter, laurin, glycerogelatin, etc. may be used.
  • the holy material according to the present invention may be administered to an individual by various routes. Any mode of administration can be envisaged, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.
  • the dosage of the pharmaceutical composition according to the present invention is selected in consideration of the individual's age, weight, sex, physical condition, and the like. It is self-evident that the concentration of the single domain antibody included in the pharmaceutical composition can be variously selected depending on the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 ⁇ g/ml. If the concentration is less than 0.01 ⁇ g/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 ⁇ g/ml, it may be toxic to the human body.
  • composition of the present invention can be used for the prevention or treatment of cancer and its complications, and can also be used as an anticancer adjuvant.
  • the present invention also provides a method for preventing and treating cancer comprising administering a pharmaceutically effective amount of the composition of the present invention to a subject.
  • composition of the present invention is administered in a therapeutically effective amount or a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the subject type and severity, age, sex, activity of the drug, and the drug. It can be determined according to factors including sensitivity, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field.
  • the present invention relates to the use of the anti-tumor adenovirus of the present invention for preventing or treating tumors.
  • the present invention relates to a method of treating a tumor using the anti-tumor adenovirus of the present invention.
  • a double-target siRNA (double strand) capable of simultaneously inhibiting STAT3 (signal transducer and activator of transcription 3) and mTOR (mammalian target of rapamycin) was prepared with the sequence shown in Table 1 below (Bioneer, Daejeon, Korea).
  • siRNAs of SEQ ID NOs: 1 and 2 of Set 1 have a 17mer in 21mer
  • siRNAs of SEQ ID NOs: 3 and 4 of Set 2 have a 16mer of 20mer
  • siRNAs of SEQ ID NOs: 5 and 6 of Set 3 have a 15mer of 19mer
  • siRNAs of SEQ ID NOs: 7 and 8 of set 4 bind to 14mers in 18mer
  • siRNAs of SEQ ID NOs: 9 and 10 of set 5 bind to 16mers in 17mers.
  • siRNA of SEQ ID NOs: 11 and 12 of set 6 has a 17mer in 20mer
  • the siRNA of SEQ ID NOs: 13 and 14 of set 7 has a 16mer of 19mer
  • the siRNA of SEQ ID NOs: 15 and 16 of set 8 has a 15mer of 18mer
  • siRNAs of SEQ ID NOs: 17 and 18 of set 9 are complementary to 14mers in 17mers.
  • each set of antisense_mTOR was converted into mTOR mRNA (gi
  • mTOR mRNA gi
  • MTOR mechanistic target of rapamycin (serine/threon
  • si-MS1 gacuguggcauccaccugcau One augcagguaggcgccucaguc 2 21 17 2 si-MS2 gacuguggcauccaccugca 3 ugcagguaggcgccucaguc 4 20 16 3 si-MS3 gacuguggcauccaccugc 5 gcagguaggcgccucaguc 6 19 15 4 si-MS4 gacuguggcauccaccug 7 cagguaggcgccucaguc 8 18 14 5 si-MS5 ucagccacagcuug 9 caagcugcuguagcuga 10 17 16 6 si-MS6 gcagcgcaugcggcccagca 11 ugcugggccgcaguggcugc 12 20 17 7 si-MS7 gcagcgcaugcgggg
  • TTGGATCCAA TTGGATCCAA loop
  • TTCAAGAGAG TTCAAGAGAG loop
  • antisense strand and TT are linked to 3' of the sense strand of the siRNA set of Table 1 in the 5' to 3' direction to construct a DNA sequence encoding the shRNA did.
  • shRNA expression cassettes TTGGATCCAA loop shRNA and TTCAAGAGAG loop shRNA containing the double-target siRNA (SEQ ID NOs: 1 and 2) siRNA double-stranded sequence and loop sequence of Set 1 are shown in Table 2 (siRNA is a lowercase letter) Additional sequences are indicated by capital letters) and the remaining shRNA sequences are listed in the Sequence Listing (SEQ ID NOs: 20 to 37).
  • U6 promoter SEQ ID NO: 19
  • PstI and EcoRV of the pE3.1 vector FIG. 1
  • mTOR and STAT3 dual target shRNA sequence (5' ⁇ 3') SEQ ID NO: TTGGATCCAA loop shRNA gactgtggcatccacctgcatTTGGATCCAAatgcaggtaggcgcctcagtcTT 20 TTCAAGAGAG loop shRNA gactgtggcatccacctgcatTTCAAGAGAGatgcaggtaggcgcctcagtcTT 29
  • the cells were cultured at 37° C. and 5% CO 2 in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) until the cell density reached 50%. Thereafter, the cells were transfected with lipofectamine3000 (Invitrogen, Carlsbad, CA, USA) with the dual target siRNAs of sets 1 to 9 prepared in Example 1, respectively, to knock down mTOR and STAT3 simultaneously. 48 hours after transfection, cells were lysed and total RNA was extracted with GeneJET RNA Purification Kit (Invitrogen). Reverse transcription reaction was performed with RevoScriptTM RT PreMix (iNtRON BIOTECHNOLOGY) using the extracted total RNA as a template.
  • U-87 (U87MG) was transfected with 0, 1 and 2 ⁇ g, respectively. 48 hours after transfection, the degree of decrease in gene expression of mTOR and STAT3 was confirmed using the Real-time PCR analysis method described in Experimental Example 1.
  • the expression of mTOR and STAT3 was decreased in both types of shRNA including the dual target siRNA of the present invention, and showed a tendency to decrease by about 20% in proportion to the amount of DNA of the shRNA ( FIG. 3 ).
  • siRNA for mTOR and siRNA for STAT3 were serially linked in the sequence of mTOR-STAT3 or STAT3-mTOR, and the gene expression inhibitory effect on mTOR and STAT3 was compared with the mTOR/STAT3 dual target shRNA of the present invention.
  • hTERT promoter (SEQ ID NO: 38)-E1A (SEQ ID NO: 39)-IRES (SEQ ID NO: 40)-E1B sequence (SEQ ID NO: 41) (hTERT-E1A-IRES-E1B full sequence: SEQ ID NO: 42) was transferred to SpeI of the adenoviral vector After insertion between and ScaI, the U6 promoter and the STAT3 and mTOR dual target shRNA coding sequence prepared in the above Example (U6 promoter + STAT3 and mTOR dual target shRNA coding sequence: SEQ ID NO: 44) were inserted into the E3 region, respectively.
  • the hTERT promoter and dual target shRNA were expressed by insertion between SpeI, and an infectious recombinant adenovirus was constructed (mTOR and STAT3 dual target shRNA coding (expressing) adenovirus: CA102) (see FIGS. 5 and 6).
  • mTOR and STAT3 dual target shRNA coding (expressing) adenovirus: CA102 infectious recombinant adenovirus
  • CA10G a recombinant adenovirus into which only hTERT was inserted as a control was prepared.
  • the sequence of the prepared adenovirus vector was analyzed, and if there was no abnormality, the virus genome was linearized using PacI restriction enzyme, and each virus was produced by transducing the 293A cells using the CaCl 2 method.
  • RNA prep was performed using an RNA prep kit (Takara, 9767A).
  • a PCR mixture (total volume, 20 ul) corresponding to the experimental group was prepared (template 2 ul, forward primer 0.5 ul (10 pmole/ul), reverse primer 0.5 ul (10 pmole/ul) ), 10 ul 2X master mix (Bioline, BIO-94005) and 7 ul DW).
  • the PCR mixture was vortexed, mixed well, and centrifuged, followed by 40 cycles of 5 minutes at 95°C, 10 seconds at 95°C, and 30 seconds at 60°C in a qPCR device (Applied Biosystems, QS3). The results were analyzed using the program in the qPCR instrument.
  • the recombinant adenovirus CA102 of the present invention which encodes and expresses the hTERT promoter and mTOR and STAT3 dual target shRNA, is significantly more mTOR and STAT3 genes than the recombinant adenovirus CA10G containing only the hTERT promoter. was shown to inhibit the expression of (Fig. 7).
  • the effect of inhibiting the expression of the recombinant adenovirus CA102 prepared in Example 4 on the target genes mTOR and STAT3 was confirmed in the skin squamous cell carcinoma cell lines A431 and HSC-5 by the method of Example 5-1-1, both cell lines
  • the recombinant adenovirus CA102 of the present invention encoding and expressing the hTERT promoter and mTOR and STAT3 dual target shRNA significantly repressed the expression of mTOR and STAT3 genes compared to the recombinant adenovirus CA10G containing only the hTERT promoter ( Fig. 9).
  • the bladder cancer cell killing effect of the recombinant adenovirus CA10G and CA102 prepared in Example 4 was compared. Specifically, T24 cells (2.5X10 3 /well), 253J-BV cells (5X10 3 /well), and human bladder epithelial cell line RT4 cells (5X10 3 /well) were spread in 96-well plates, respectively, and after 1 hour, CA10G and CA102 was treated to 1, 2, 5, 10, 20, or 50 MOI in each well, and 72 hours later, MTT reagent was added and incubated at 37° C. for 3 hours. After 3 hours, the medium was removed from each well, 100 ul of DMSO was added, and then the absorbance was measured at a wavelength of 540 nm using a microplate reader, and MTT analysis was performed.
  • CA102 of the present invention significantly killed cancer cells compared to CA10G (FIG. 11).
  • the recombinant adenovirus CA10G and CA102 prepared in Example 4 were treated with HSC-2 and Fadu, the head and neck cancer cell lines, and the apoptosis effect was analyzed by MTT analysis. were compared.
  • CA10G treatment resulted in about 40% of cell death, whereas CA102 encoding and expressing mTOR and STAT3 dual target shRNA induced more than 70% of cell death (FIG. 12).
  • the recombinant adenoviruses CA10G and CA102 prepared in Example 4 were treated with skin squamous cell lines A431 and HSC-5, followed by MTT analysis. The apoptosis effect was compared. As a result, it was found that the apoptosis effect of CA102 was significantly higher than that of CA10G on the basis of 10 MOI treatment ( FIG. 13 ).
  • 1.0 x 10 7 bladder cancer cell line 253J-BV and head and neck cancer cell line FaDu were cultured on a 100 mm 3 plate, respectively, and then the recombinant adenovirus CA10G of the present invention was cultured. and CA102 at 2 MOI and 5 MOI, respectively, for 1 hour (control group treated with PBS), replaced with fresh medium and cultured for 2 hours. Thereafter, cells were harvested, mixed with Matrigel at a ratio of 1:1 (v/v), and transplanted (Xenograft) into 6-week-old male Balb/c nu-nu mice, followed by observation for 32 days.
  • the size of cancer cells in the group treated with CA10G 2 MOI was significantly reduced in the group treated with CA10G 2 MOI, and cancer cells were terminated in the group treated with CA102 2 MOI ( FIG. 14 ).
  • the size of cancer cells in the group treated with CA10G 5 MOI did not show a significant difference compared to the control group, but cancer cells were terminated in the group treated with CA102 5 MOI ( FIG. 15 ).
  • Example 8 Confirmation of the effect of combination treatment with an anticancer agent of a dual target shRNA-encoding adenovirus
  • a bladder cancer cell line (253J-BV) was subcutaneously transplanted into balb c nu/nu mice to construct a bladder cancer mouse model, and then, the recombinant adenoviruses CA10G and CA102 prepared in Example 4 were administered directly into the tumor to grow the tumor.
  • the tumor volume and weight were significantly reduced in the CA102-treated group compared to the untreated control group (buffer-treated group) and the vector control group (CA10G-treated group). It was confirmed that the anticancer effect synergistically increased (FIG. 19).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un adénovirus antitumoral et une composition oncolytique comprenant celui-ci. L'adénovirus selon la présente invention, qui comprend un promoteur de hTERT et une cassette d'expression codant pour un ARN court en épingle à cheveux (ARNsh) exprimant un ARN interférent court (ARNsi) double brin qui inhibe simultanément l'expression de STAT3 et de mTOR, évite la réponse immunitaire dans le corps et est administré spécifiquement à des cellules cancéreuses de sorte à avoir un effet thérapeutique systémique, peut être administré localement, présente une excellente sélectivité et présente un effet oncolytique remarquable même au moyen d'un traitement minimalement invasif, et peut donc être utile en tant que composition oncolytique ou adjuvant oncolytique pour divers carcinomes.
PCT/KR2021/003487 2020-03-23 2021-03-22 Virus oncolytique comprenant une séquence d'acide nucléique ciblant stat3 et mtor de manière bispécifique WO2021194179A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200035176 2020-03-23
KR10-2020-0035176 2020-03-23

Publications (1)

Publication Number Publication Date
WO2021194179A1 true WO2021194179A1 (fr) 2021-09-30

Family

ID=77890438

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003487 WO2021194179A1 (fr) 2020-03-23 2021-03-22 Virus oncolytique comprenant une séquence d'acide nucléique ciblant stat3 et mtor de manière bispécifique

Country Status (2)

Country Link
KR (1) KR20210118757A (fr)
WO (1) WO2021194179A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20230093859A (ko) * 2021-12-20 2023-06-27 (주)큐리진 mTOR 유전자 및 STAT3 유전자의 발현을 동시에 억제하는 핵산

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040002322A (ko) * 2002-06-27 2004-01-07 송준석 텔로머라제 프로모터를 갖는 아데노바이러스 및 이를항암치료에 사용하는 용도
KR20160067184A (ko) * 2013-10-25 2016-06-13 싸이오서스 테라퓨틱스 엘티디. 이종 유전자로 무장된 종양살상 아데노바이러스
WO2018143626A1 (fr) * 2017-01-31 2018-08-09 ㈜큐리진 Acide nucléique inhibant simultanément l'expression du gène mtor et du gène stat3

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040002322A (ko) * 2002-06-27 2004-01-07 송준석 텔로머라제 프로모터를 갖는 아데노바이러스 및 이를항암치료에 사용하는 용도
KR20160067184A (ko) * 2013-10-25 2016-06-13 싸이오서스 테라퓨틱스 엘티디. 이종 유전자로 무장된 종양살상 아데노바이러스
WO2018143626A1 (fr) * 2017-01-31 2018-08-09 ㈜큐리진 Acide nucléique inhibant simultanément l'expression du gène mtor et du gène stat3

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"Government Project Final Report", 1 January 2003, YONSEI UNIVERSITY COLLEGE OF MEDICINE, Korea, article YOON CHAEOK: "Development of cancer cell specific replication competent adenovirus and validation of adenoviral safety in vitro and in vivo", pages: 1 - 43, XP009531106 *
XIA PU, GUO QING-XI, LONG HAN-AN, YANG CHENG-WAN: "Effects of mTOR-STAT3 on the migra=tion and invasion abilities of hepatoma cell and mTOR-STAT3 expression in liver cancer", ASIAN PACIFIC JOURNAL OF TROPICAL MEDICINE, vol. 7, no. 5, 1 May 2014 (2014-05-01), Singapore, pages 368 - 372, XP055529511, ISSN: 1995-7645, DOI: 10.1016/S1995-7645(14)60057-2 *
YI ZHANG, ZHANG JUN-WEI, LV GUO-YUE, XIE SHU-LI, WANG GUANG-YI: "Effects of STAT3 Gene Silencing and Rapamycin on Apoptosis in Hepatocarcinoma Cells", INTERNATIONAL JOURNAL OF MEDICAL SCIENCE, vol. 9, no. 3, 1 January 2012 (2012-01-01), AU, pages 216 - 224, XP055529508, ISSN: 1449-1907, DOI: 10.7150/ijms.4004 *

Also Published As

Publication number Publication date
KR20210118757A (ko) 2021-10-01

Similar Documents

Publication Publication Date Title
WO2012053741A9 (fr) Molécules d'acides nucléiques induisant une interférence arn, et leurs utilisations
ES2485848T3 (es) ARN de interferencia para el tratamiento de trastornos relacionados con la ganancia de función
WO2021194180A1 (fr) Structure de virus oncolytique comprenant une molécule d'acide nucléique bispécifique
JP2018500027A (ja) リガンド修飾二本鎖核酸
WO2018143626A1 (fr) Acide nucléique inhibant simultanément l'expression du gène mtor et du gène stat3
WO2021194179A1 (fr) Virus oncolytique comprenant une séquence d'acide nucléique ciblant stat3 et mtor de manière bispécifique
WO2021194181A1 (fr) Virus anticancéreux comprenant une molécule d'acide nucléique ciblant ar et mtor de manière bispécifique
KR101993377B1 (ko) Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
JP2007104971A (ja) ミオスタチンのスプライシング制御アンチセンスオリゴヌクレオチド
WO2018231034A2 (fr) Composition pharmaceutique pour prévenir ou traiter le cancer
KR101420564B1 (ko) ＴＧＦ－β２ 발현을 억제하는 ｓｈＲＮＡ
WO2023121178A1 (fr) Acides nucléiques inhibant l'expression des gènes mtor et stat3
WO2022191661A1 (fr) Acides nucléiques inhibant simultanément l'expression du gène c-met et du gène pd-l1
US20200399642A1 (en) Methods and compositions for treating and preventing metastatic tumors
CN114829599A (zh) Scamp3抑制剂用于治疗乙型肝炎病毒感染的用途
CN114901821A (zh) Sept9抑制剂用于治疗乙型肝炎病毒感染的用途
EP3680334A1 (fr) Molécule d'arn double brin ciblant ckip-1 et son utilisation
WO2023043220A1 (fr) Composé antisens régulant l'expression de wfdc2
WO2013115579A1 (fr) Arnsh destiné à supprimer l'expression de tgf-b2
WO2020235936A1 (fr) Arnsi asymétrique pour inhiber l'expression de pd-1
CN111615558A (zh) 用于调节erc1表达的寡核苷酸
WO2020122534A1 (fr) Arnsi asymétrique pour inhiber l'expression de snai1
KR100627377B1 (ko) 뇌하수체 종양-형질전환 유전자 1 단백질의 합성을 차단할수 있는 작은 간섭 ｒｎａ 및 이를 발현하는 벡터를 이용한 암의 유전자 치료
JP2021511022A (ja) Ｐｉａｓ４発現を調節するためのオリゴヌクレオチド
CN114867856A (zh) Saraf抑制剂用于治疗乙型肝炎病毒感染的用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21774153

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21774153

Country of ref document: EP

Kind code of ref document: A1