WO2021194181A1 - Virus anticancéreux comprenant une molécule d'acide nucléique ciblant ar et mtor de manière bispécifique - Google Patents

Virus anticancéreux comprenant une molécule d'acide nucléique ciblant ar et mtor de manière bispécifique Download PDF

Info

Publication number
WO2021194181A1
WO2021194181A1 PCT/KR2021/003489 KR2021003489W WO2021194181A1 WO 2021194181 A1 WO2021194181 A1 WO 2021194181A1 KR 2021003489 W KR2021003489 W KR 2021003489W WO 2021194181 A1 WO2021194181 A1 WO 2021194181A1
Authority
WO
WIPO (PCT)
Prior art keywords
adenovirus
sequence
tumor
mtor
nucleotide sequence
Prior art date
Application number
PCT/KR2021/003489
Other languages
English (en)
Korean (ko)
Inventor
최진우
박성훈
찰스고흐너 피터
유중기
최청갑
엄기환
이의진
이형빈
Original Assignee
㈜큐리진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ㈜큐리진 filed Critical ㈜큐리진
Publication of WO2021194181A1 publication Critical patent/WO2021194181A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10032—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent

Definitions

  • the present invention relates to an antitumor adenovirus and an anticancer composition comprising the same.
  • Cancer is one of the diseases that cause the highest number of deaths worldwide, and the development of innovative cancer treatments can reduce medical costs and create high added value at the same time.
  • molecular therapeutics that can overcome existing anticancer drug resistance accounted for $17.5 billion in 7 major countries (US, Japan, France, Germany, Italy, Spain, UK), and in 2018, about It is expected to show a growth rate of 9.5% compared to 2008, occupying a market size of about $45 billion.
  • Cancer treatment is divided into surgery, radiation therapy, chemotherapy, and biological therapy.
  • chemotherapy is a treatment that suppresses or kills cancer cell proliferation as a chemical substance.
  • RNA interference (hereinafter referred to as RNAi) has been found to act on sequence-specific mRNA in various types of mammalian cells since its role was discovered (Silence of the transcripts: RNA interference in medicine. J Mol Med (2005) 83: 764773).
  • RNAi is a small interfering ribonucleic acid short interfering RNA (small interfering RNA, hereinafter referred to as siRNA) having a double helix structure of 21-25 nucleotides in size is specifically bound to an mRNA transcript having a complementary sequence. It is a phenomenon in which the expression of a specific protein is suppressed by decomposing the transcriptome.
  • RNA double-stranded is processed by an endonuclease called Dicer and converted into 21 to 23 double-stranded (base pair, bp) siRNA, which binds to RISC (RNA-induced silencing complex).
  • RISC RNA-induced silencing complex
  • the guide (antisense) strand recognizes and degrades the target mRNA to sequence-specifically inhibit the expression of the target gene (NUCLEIC-ACID THERAPEUTICS: BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503 -514).
  • siRNA for the same target gene has a superior inhibitory effect on mRNA expression in vitro and in vivo compared to antisense oligonucleotide (ASO), and the effect lasts for a long time.
  • ASO antisense oligonucleotide
  • the market for RNAi technology-based therapeutics, including siRNA, has been analyzed to form a total of more than 12 trillion won in the future world market size around 2020. It is being evaluated as a next-generation gene therapy technology that can treat difficult-to-treat diseases.
  • siRNA binds to the target mRNA and regulates the expression of the target gene in a sequence-specific manner. Compared to the development period and development cost of (Progress Towards in Vivo Use of siRNAs. MOLECULAR THERAPY. 2006 13(4):664-670).
  • this ribonucleic acid-mediated interference phenomenon proposes a solution to the problem that occurs in the development of conventional chemical synthesis drugs, while selectively inhibiting the expression of specific proteins at the transcript level, and a study to use them in the development of therapeutic agents for various diseases, especially tumor therapeutics is in progress
  • siRNA therapeutics have the advantage that side effects can be predicted because the target is clear, but this target specificity is a disease caused by problems with various genes. may be the cause
  • the present invention provides an anti-tumor adenovirus comprising a nucleotide sequence having AR as a target sequence and a nucleotide sequence having mTOR as a target sequence.
  • the present invention provides a composition for treating cancer comprising the anti-tumor adenovirus.
  • the adenovirus containing an expression cassette encoding an shRNA containing a double-stranded siRNA that simultaneously inhibits the expression of AR and mTOR of the present invention and an adenovirus containing an hTERT promoter is specifically delivered to cancer cells by avoiding an in vivo immune response. It has a systemic therapeutic effect, can be delivered locally, has excellent selectivity, and exhibits a remarkable anticancer effect even with minimally invasive treatment, so it can be usefully used as an anticancer composition or an anticancer adjuvant for various cancer types.
  • FIG. 1 is a diagram illustrating a map of a vector for intracellular expression of shRNA including a dual target siRNA set of the present invention.
  • FIG. 2 is a diagram confirming the effect of inhibiting the expression of AR gene and mTOR gene by the dual target siRNA set 1 of the present invention in a cancer cell line:
  • siAR siRNA for AR
  • simTOR siRNA for mTOR
  • si-AT1 AR and mTOR dual target siRNA set of the present invention 1.
  • FIG. 3 shows A549 by dual target siRNA sets 1-13 of the present invention. It is a diagram confirming the effect of suppressing the expression of AR gene and mTOR gene in cell lines:
  • si-AT1 to si-AT13 siRNA sets 1 to 13 of the present invention.
  • FIG. 4 is a diagram schematically illustrating the structure of the adenovirus of the present invention.
  • FIG. 5 is a diagram showing a vector map of the adenovirus vector of the present invention.
  • FIG. 6 is a diagram confirming the effect of inhibiting the expression of AR and mTOR genes by the recombinant adenovirus CA103 of the present invention including the hTERT promoter and the dual target shRNA expression cassette in the prostate cancer cell line LNcap.
  • FIG. 7 is a diagram confirming in vitro the effect of inhibiting the expression of AR and mTOR genes by the recombinant adenovirus CA103 of the present invention including the hTERT promoter and the dual target shRNA expression cassette in prostate cancer cell lines C42B and 22Rv1.
  • FIG. 8 is a diagram confirming in vivo the effect of inhibiting the expression of AR and mTOR genes by the recombinant adenovirus CA103 of the present invention including the hTERT promoter and the dual target shRNA expression cassette.
  • FIG. 9 is a diagram confirming the killing effect of the cancer cell line LNcap by the recombinant adenovirus CA103 of the present invention including the hTERT promoter and the dual target shRNA expression cassette.
  • FIG. 10 is a diagram confirming the killing effect of the cancer cell lines C42B and 22Rv1 cell lines by the recombinant adenovirus CA103 of the present invention containing the hTERT promoter and the dual target shRNA expression cassette.
  • FIG. 11 is a diagram confirming in vivo the therapeutic effect of prostate cancer by the recombinant adenovirus CA103 of the present invention comprising the hTERT promoter and the dual target shRNA expression cassette.
  • nucleic acids are written in a 5' ⁇ 3' direction from left to right.
  • Numerical ranges recited within the specification are inclusive of the numbers defining the range, including each integer or any non-integer fraction within the defined range.
  • the present invention provides a human telomere promoter (hTERT); And it relates to an antitumor adenovirus comprising an expression cassette comprising a nucleotide sequence having AR as a target sequence and a nucleotide sequence having mTOR as a target sequence.
  • hTERT human telomere promoter
  • the nucleotide sequence having AR as the target sequence and the nucleotide sequence having mTOR as the target sequence may partially or 100% complementarily bind to form a double strand during gene expression.
  • the human telomere promoter may be operably linked with an endogenous gene of an adenovirus.
  • operably linked refers to a functional linkage between a gene expression control sequence (eg, an array of promoter, signal sequence, or transcriptional regulatory factor binding sites) and another gene sequence, whereby the Regulatory sequences will control the transcription and/or translation of the other gene sequences.
  • a gene expression control sequence eg, an array of promoter, signal sequence, or transcriptional regulatory factor binding sites
  • the hTERT promoter may include the nucleotide sequence of SEQ ID NO: 54.
  • the endogenous gene of adenovirus has the structure of 5'ITR-C1-C2-C3-C4-C5 3'ITR; wherein C1 comprises E1A (SEQ ID NO: 55), E1B (SEQ ID NO: 57) or E1A-E1B; wherein C2 includes E2B-L1-L2-L3-E2A-L4; wherein C3 does not include E3 or includes E3; wherein C4 includes L5; and C5 may not include E4 or may include E4, and may include the nucleotide sequence of SEQ ID NO: 58.
  • the adenovirus may have a partial deletion of the E3 region, and the deleted nucleotide sequence may include the nucleotide sequence of SEQ ID NO: 60.
  • the expression cassette may be located at the C3 region of the endogenous gene of the adenovirus.
  • the hTERT promoter may be operably linked with E1A and E1B of endogenous genes of adenovirus.
  • an IRES sequence (SEQ ID NO: 56) may be further included between E1A and E1B of the endogenous gene of adenovirus.
  • the expression cassette is capable of encoding and expressing shRNA.
  • the shRNA may simultaneously inhibit the expression of AR and mTOR.
  • the antitumor adenovirus of the present invention can inhibit expression by degrading mRNA of a nucleic acid or inhibiting translation by RNA interference.
  • the expression cassette of the present invention can simultaneously inhibit AR and mTOR by expressing a double-stranded siRNA in which the AR-specific sense strand and the mTOR-specific anti-sense strand are partially complementary.
  • the term “repression of expression” means to cause a decrease in expression or translation of a target gene, and preferably means that the expression of the target gene becomes undetectable or exists at an insignificant level.
  • siRNA small interfering RNA
  • siRNA refers to a short double-stranded RNA capable of inducing an RNA interference (RNAi) phenomenon through cleavage of a specific mRNA.
  • RNAi RNA interference
  • siRNA is composed of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. antisense strand), and since the antisense RNA strand is an siRNA specific for mTOR (antisense strand for mTOR), the double-stranded siRNA can simultaneously inhibit the expression of AR and mTOR, respectively.
  • RNA short hairpin RNA
  • shRNA short hairpin RNA
  • RNA refers to a single-stranded RNA that partially includes a palindromic nucleotide sequence, has a double-stranded structure in the 3' region, forms a hairpin-like structure, and is expressed in cells It means RNA that can be converted into siRNA after being cut by dicer, a type of RNase present in the cell, and the length of the double-stranded structure is not particularly limited, but is preferably 10 nucleotides or more, more preferably is 20 nucleotides or more.
  • the shRNA may be included in an expression cassette, and the shRNA is TTGGATCCAA (TTGGATCCAA) 3' of the sense strand after converting U to T in the set sequence consisting of the siRNA antisense strand and the sense strand for each gene. loop) or TTCAAGAGAG (TTCAAGAGAG loop), antisense strand and TT are sequentially linked to construct an expression cassette encoding shRNA, and it can be produced by expressing it in a cell.
  • TTGGATCCAA TTGGATCCAA
  • TTCAAGAGAG loop antisense strand and TT are sequentially linked to construct an expression cassette encoding shRNA, and it can be produced by expressing it in a cell.
  • the expression cassette is SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16, SEQ ID NOs: 17 and 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: 21 and 22, SEQ ID NOs: 23 and 24, or SEQ ID NOs: 25 and 26 may include nucleic acids in which U is converted to T .
  • siRNA (Antisense AR) of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25 complementarily binds to the mRNA of AR
  • SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 siRNA (Antisense mTOR) can complementarily bind to mRNA of mTOR.
  • the DNA encoding the shRNA included in the expression cassette may include any one of the nucleic acids represented by the nucleotide sequences of SEQ ID NOs: 28 to 53.
  • the nucleotide sequence having AR as the target sequence may include a nucleotide sequence having at least 60% complementarity with the reverse complementary sequence of the nucleotide sequence having mTOR as the target sequence, and the nucleotide sequence having mTOR as the target sequence is It may include a nucleotide sequence having a complementarity of 60% or more with a reverse complementary sequence of a nucleotide sequence using AR as a target sequence.
  • the nucleotide sequence having AR as the target sequence is 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% of the reverse complementary sequence of the nucleotide sequence targeting mTOR as the target sequence.
  • it may include a nucleotide sequence having at least 99% complementarity
  • the nucleotide sequence targeting mTOR as the target sequence is 70%, 80%, 85%, 90%, 95% of the reverse complementary sequence of the nucleotide sequence targeting AR.
  • %, 96%, 97%, 98% or may include a nucleotide sequence having a complementarity of 99% or more.
  • variants of the nucleotide sequence having AR as the target sequence or mTOR as the target sequence included in the expression cassette are included within the scope of the present invention.
  • the expression cassette of the present invention is a functional equivalent of a nucleic acid molecule constituting it, for example, some nucleotide sequence of a nucleic acid molecule has been modified by deletion, substitution or insertion, but a nucleotide sequence molecule and It is a concept that includes variants capable of performing the same functionally.
  • the "% of sequence homology" for a nucleic acid molecule is determined by comparing two optimally aligned sequences to a comparison region, wherein a portion of the nucleic acid molecule sequence in the comparison region is a reference sequence (additions or deletions) to the optimal alignment of the two sequences. may include additions or deletions (ie, gaps) compared to (not including).
  • the expression cassette may include a nucleotide sequence sequentially encoding a nucleotide sequence having AR as a target sequence, a loop sequence capable of forming a hairpin structure, and a nucleotide sequence having mTOR as a target sequence.
  • expression of the expression cassette may be regulated by a U6 promoter, and the U6 promoter may include the nucleotide sequence of SEQ ID NO: 27.
  • the adenovirus may be an adenovirus with a serotype 5 of group C.
  • the anti-tumor virus of the present invention may have high oncolytic activity compared to wild-type adenovirus, and may have high oncolytic activity compared to adenovirus in which the hTERT promoter is introduced into wild-type adenovirus.
  • the present invention relates to a composition for treating cancer comprising the anti-tumor virus of the present invention.
  • the composition of the present invention may further include an anticancer agent, for example, acibacin, aclarubicin, acodazole, acronisin, adozelesin, alanosine, aldesleukin, allo Purinol Sodium, Altretamine, Aminoglutethimide, Amonafide, Ampligen, Amsacrine, Androgens, Anguidin, Apidicoline Glycinate, Asaray, Asparaginase, 5-Azacytidine , Azathioprine, Bacillus Calmete-Guerin (BCG), Bakers Antipol, Beta-2-deoxythioguanosine, Bisantrene HCl, Bleomycin Sulfate, Bulsupan, Butionine Sulfoximine, BWA 773U82 , BW 502U83/HCl, BW 7U85 mesylate, cerasemid, carvetimer, carboplatin, carmustine, chloram
  • the cancer is colon cancer, breast cancer, uterine cancer, cervical cancer, ovarian cancer, prostate cancer, brain tumor, head and neck carcinoma, melanoma, myeloma, leukemia, lymphoma, stomach cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer, esophageal cancer, small intestine cancer , perianal cancer, fallopian tube carcinoma, endometrial carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, bladder cancer, kidney cancer, ureter cancer, renal cell carcinoma, renal pelvic carcinoma, bone cancer, skin cancer, head cancer, cervical cancer, skin melanoma , intraocular melanoma, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, glioblastoma multiforme and pituitary gland
  • promoter refers to an untranslated nucleic acid upstream of a coding region that includes a binding site for RNA polymerase and has transcription initiation activity into mRNA of a gene downstream of the promoter. say sequence.
  • the promoter may be any promoter capable of initiating the expression of shRNA.
  • a promoter constitutive promoter
  • a promoter inducible promoter
  • Examples include U6 promoter, H1 promoter, CMV (cytomegalovirus) promoter, SV40 promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108:193-199, 1991), CaMV 35S promoter (Odell et al., Nature 313: 810-812, 1985), the Rsyn7 promoter (US Patent Application No.
  • the promoter of the present invention may be a U6 promoter, a HI promoter, or a CMV promoter, and according to a preferred embodiment of the present invention, the U6 promoter may be used.
  • composition of the present invention may further include an adjuvant.
  • the adjuvant may be used without limitation as long as it is known in the art, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the effect.
  • composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field.
  • Pharmaceutically acceptable carriers that can be used in the composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin. It can be prepared by mixing and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • compositions for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used.
  • base of the suppository witepsol, tween 61, cacao butter, laurin, glycerogelatin, etc. may be used.
  • the holy material according to the present invention may be administered to an individual by various routes. Any mode of administration can be envisaged, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.
  • the dosage of the pharmaceutical composition according to the present invention is selected in consideration of the individual's age, weight, sex, physical condition, and the like. It is self-evident that the concentration of the single domain antibody included in the pharmaceutical composition can be variously selected depending on the subject, and is preferably included in the pharmaceutical composition at a concentration of 0.01 to 5,000 ⁇ g/ml. If the concentration is less than 0.01 ⁇ g/ml, pharmaceutical activity may not appear, and if it exceeds 5,000 ⁇ g/ml, it may be toxic to the human body.
  • composition of the present invention can be used for the prevention or treatment of cancer and its complications, and can also be used as an anticancer adjuvant.
  • the present invention also provides a method for preventing and treating cancer comprising administering a pharmaceutically effective amount of the composition of the present invention to a subject.
  • composition of the present invention is administered in a therapeutically effective amount or a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the subject type and severity, age, sex, activity of the drug, and the drug. It can be determined according to factors including sensitivity, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field.
  • the present invention relates to the use of the anti-tumor adenovirus of the present invention for preventing or treating tumors.
  • the present invention relates to a method of treating a tumor using the anti-tumor adenovirus of the present invention.
  • a double-target siRNA (double strand) set capable of simultaneously inhibiting AR (androgen receptor) and mTOR (mammalian target of rapamycin) was prepared with the sequence shown in Table 1 below (Bioneer, Daejeon, Korea).
  • siRNA set 1 consisting of SEQ ID NOs: 1 and 2
  • 18mers are complementary to each other
  • the 19mer siRNA set 2 consisting of SEQ ID NOs: 3 and 4
  • the 17mers are complementary to each other
  • the 18mers consisting of SEQ ID NOs: 5 and 6 siRNA set 3 of siRNA set 3 is 16mer complementary to each other
  • 17mer siRNA set 4 consisting of SEQ ID NOs: 7 and 8
  • 19mer siRNA set 5 consisting of SEQ ID NOs: 9 and 10 is 15mer complementary to each other
  • 18mer siRNA set 6 consisting of SEQ ID NOs: 11 and 12 is 14mer complementary to each other
  • 17mer siRNA set 7 consisting of SEQ ID NOs: 13 and 14 is 13mer complementary to each other
  • 23mer siRNA consisting of SEQ ID NOs: 15 and 16 Set 8 has 19mers complementary to each other
  • 22mer siRNA set 9 consisting of SEQ ID NOs: 17 and 18 is 18mer complementary to each other
  • 22mer siRNA set 9 consisting
  • siRNA (Antisense AR) of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25 of Table 1 is complementary to the mRNA of AR, SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 siRNA (Antisense mTOR) complementarily binds to the mRNA of mTOR. Therefore, siRNA sets 1 to 13 of the present invention simultaneously decrease the expression of AR and mTOR genes.
  • One si-AT1 GCUGCUGCUGCUGCCUGGGG One CCCCAUGCAGCUGCAGCAGC 2 20 18 2 si-AT2 CUGCUGCUGCUGCCUGGGG 3 CCCCAUGCAGCUGCAGGCAG 4 19 17 3 si-AT3 UGCUGCUGCUGCCUGGGG 5 CCCCAUGCAGCUGCAGCA 6 18 16 4 si-AT4 GCUGCUGCUGCCUGGGG 7 CCCCAUGCAGCUGCAGGC 8 17 15 5 si-AT5 CCACCCCCACCACCACCACCACCACCAC 9 GUGGUGGCAGCGGUGGUGG 10 19 15 6 si-AT6 CCACCCCCACCACCACCACCACCACCA 11 UGGUGGCAGCGGUGGUGG 12 18 14 7 si-AT7 CCACCCCCACCACCACCACCACCACCACCA 11 UGGUGGCAGCGGUGGUGG 12
  • an expression cassette expressing shRNA was prepared. Specifically, TTGGATCCAA (TTGGATCCAA loop) or TTCAAGAGAG (TTCAAGAGAG loop), antisense strand and TT are linked to 3' of the sense strand of the siRNA set of Table 1 in the 5' to 3' direction to construct a DNA sequence encoding the shRNA did.
  • shRNA expression cassettes TTGGATCCAA loop shRNA and TTCAAGAGAG loop shRNA containing the double-target siRNA (SEQ ID NOs: 1 and 2) siRNA double-stranded sequence and loop sequence of Set 1 are shown in Table 2 (siRNA is uppercase letter) Additional sequences are indicated in lowercase letters) and the remaining shRNAs are listed in the sequence listing (SEQ ID NOs: 28 to 53).
  • U6 promoter SEQ ID NO: 27
  • PstI and EcoRV of the pE3.1 vector
  • AR and mTOR dual target shRNA sequence (5' ⁇ 3') SEQ ID NO: TTGGATCCAA loop shRNA GCTGCTGCTGCTGCCTGGGGttggatccaaCCCCATGCAGCTGCAGCAGCtt 28 TTCAAGAGAG loop shRNA GCTGCTGCTGCTGCCTGGGGttcaagagagCCCCATGCAGCTGCAGCAGCtt 41
  • h460 and A549 cell lines in a 12-well plate, respectively, in RPMI medium (Hyclone) supplemented with 10% FBS (Hyclone) until the cell density reached 50% at 37°C, 5% CO 2 cultured under conditions. Thereafter, the double target siRNA sets 1 to 13 prepared in Example 1 were transferred to the cell-cultured wells with 80 pmol/well of 3 ⁇ l of lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). Speciation knocked down AR and mTOR simultaneously (set 1 in PC3 cell line and h460, set 2-13 in A549 cell line).
  • siRNA for AR and siRNA for mTOR which are commercially available in Table 3 below, were transfected, respectively. 48 hours after transfection, cells were lysed and total RNA was extracted with GeneJET RNA Purification Kit (Invitrogen). Using the extracted total RNA as a template, reverse transcribed into cDNA through RT-PCR reaction, and then each siRNA and mRNA of AR and mTOR by dual target siRNA set 1 (si-AT1) of the present invention through q-PCR reaction The expression level was confirmed.
  • primer set and reaction mixture for AR or mTOR [10X reaction Buffer 2 ⁇ l, HQ Buffer 2 ⁇ l, dNTP 1.6 ⁇ l, Primer (F, R, 10 pmole/ul) 1 ⁇ l, Template (500 ng) 2 ⁇ l, Taq 0.2 ⁇ l, DW 10.2 ⁇ l, Total vol. 20 ⁇ l] was used.
  • mRNA of AR and mTOR in cell lysates knocked down by PCR conditions [2 min at 95°C, 30 cycles at 95°C for 20 sec, 10 sec at 60°C and 30-60 sec at 72°C, 5 min at 72°C] was converted to cDNA.
  • the reaction mixture was subjected to [Template (RT-PCR product) 6 ⁇ l, Taqman probe 3 ⁇ l, 10X reaction Buffer 6 ⁇ l, HQ Buffer 6 ⁇ l, dNTP 4.8 ⁇ l, Taq 0.6 ⁇ l, DW 10.2 ⁇ l, Total vol. 60 ⁇ l] and qPCR was performed [10 min at 95° C., 15 sec at 95° C. and 40 cycles per minute at 60° C. by furnace].
  • the probes used were AR (Thermo, Hs00171172_m1), mTOR (Thermo, Hs00234508_m1), and GAPDH (Thermo, Hs02786624_g1), and it was performed using QS3 equipment. All reactions were repeated three times and their average value was taken. The results obtained in this way were normalized to the mRNA value of GAPDH, a housekeeping gene.
  • both the expression of AR and mTOR were decreased by the dual target siRNA sets 1 and 2 to 13 of the present invention in both PC3 cells and h460 cell lines ( FIGS. 2 and 3 ), and the degree of decrease was determined by the effect of each siRNA and similar or superior.
  • the dual target siRNA of the present invention can effectively inhibit the expression of both genes at the same time.
  • hTERT promoter (SEQ ID NO: 54)-E1A (SEQ ID NO: 55)-IRES (SEQ ID NO: 56)-E1B sequence (SEQ ID NO: 57) (hTERT-E1A-IRES-E1B full sequence: SEQ ID NO: 58) was transferred to SpeI of the adenoviral vector After insertion between and ScaI, the U6 promoter and the AR and mTOR dual target shRNA coding sequence prepared in the above Example (U6 promoter + AR and mTOR dual target shRNA coding sequence: SEQ ID NO: 59) were inserted into the E3 region, respectively.
  • the hTERT promoter and dual target shRNA were expressed by insertion between SpeI, and an infectious recombinant adenovirus was constructed (AR and mTOR dual target shRNA coding (expressing) adenovirus: CA103) (see Fig. 5).
  • AR and mTOR dual target shRNA coding (expressing) adenovirus: CA103) see Fig. 5
  • a recombinant adenovirus into which only hTERT was inserted as a control was prepared (CA10G). Thereafter, the sequence of the prepared adenovirus vector was analyzed, and if there was no abnormality, the virus genome was linearized using PacI restriction enzyme, and 293A cells were transduced using the CaCl 2 method to produce each virus.
  • RNA prep was performed using a prep kit (Takara, 9767A). After that, RNA was quantified using Nanodirp, and 400 ng/20 ul per tube was added using RT premix (intron, 25081), mixed well with the premix contents, and then using a PCR device at 45° C.
  • the recombinant adenovirus CA103 of the present invention encoding and expressing the hTERT promoter and the AR and mTOR dual target shRNA significantly suppressed the expression of AR and mTOR genes compared to the recombinant adenovirus CA10G containing only the hTERT promoter. was found to be (Fig. 6).
  • the recombinant adenovirus CA103 of the present invention significantly suppressed the expression of AR and mTOR genes compared to CA10G ( FIG. 7 ).
  • the recombinant adenoviruses CA10G and CA103 prepared in Example 4 were administered directly intratumorally once ( 2 ⁇ 10 8 pfu/spot, 3 times), the tumor was excised 21 days later, and the expression level of AR and mTOR genes in the tumor was confirmed by Western blot analysis and IHC analysis. As a result of Western blot analysis, it was found that the expression of mTOR and AR was decreased in the CA103-administered group compared to the control group and the CA10G-administered group.
  • the cancer cell killing effects of the recombinant adenoviruses CA10G and CA103 prepared in Example 4 were compared. Specifically, after each dispensing of LNcap, C42B and 22Rv1 cell lines in a 96-well plate at 5X10 3 /well, 1, 2, 5, 10, 20, 40 or 50 MOI of CA10G and CA103 into each well after 1 hour After 72 hours of treatment as much as possible, MTT reagent was added and incubated at 37° C. for 3 hours. After 3 hours, the medium was removed from each well, 100 ul of DMSO was added, and then the absorbance was measured at a wavelength of 540 nm using a microplate reader, followed by MTT analysis.
  • CA103 of the present invention significantly killed cancer cells compared to CA10G in the case of LNcap cell line ( FIG. 9 ), and it was confirmed that CA103 of the present invention significantly killed cancer cells even in the case of C42B and 22Rv1 cell lines. could (Fig. 10).
  • the recombinant adenoviruses CA10G and CA103 prepared in Example 4 were administered directly intratumorally (2 ⁇ 10 8 pfu/spot, 3 times) to observe the growth, the tumor volume and weight were significantly reduced in the CA103-treated group compared to the untreated control group (buffer-treated group) and the vector control group (CA10G-treated group). was confirmed (FIG. 11).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne : un adénovirus antitumoral ; et une composition anticancéreuse comprenant celui-ci. Un adénovirus comprenant une cassette d'expression, qui code pour un ARN court en épingle à cheveux (ARNsh) double brin inhibant simultanément l'expression d'AR et de mTOR, et un promoteur de hTERT selon la présente invention évite les réponses immunitaires dans le corps et est ainsi administré spécifiquement à des cellules cancéreuses, et présente ainsi un effet thérapeutique systémique. De plus, l'adénovirus peut être administré localement, présente une excellente sélectivité et présente un effet anticancéreux remarquable même par l'intermédiaire d'un traitement minimalement invasif. Ainsi, l'adénovirus peut être utilisé efficacement en tant que composition anticancéreuse ou adjuvant anticancéreux pour divers carcinomes.
PCT/KR2021/003489 2020-03-23 2021-03-22 Virus anticancéreux comprenant une molécule d'acide nucléique ciblant ar et mtor de manière bispécifique WO2021194181A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0035175 2020-03-23
KR20200035175 2020-03-23

Publications (1)

Publication Number Publication Date
WO2021194181A1 true WO2021194181A1 (fr) 2021-09-30

Family

ID=77892426

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/003489 WO2021194181A1 (fr) 2020-03-23 2021-03-22 Virus anticancéreux comprenant une molécule d'acide nucléique ciblant ar et mtor de manière bispécifique

Country Status (2)

Country Link
KR (1) KR20210118760A (fr)
WO (1) WO2021194181A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040002322A (ko) * 2002-06-27 2004-01-07 송준석 텔로머라제 프로모터를 갖는 아데노바이러스 및 이를항암치료에 사용하는 용도
KR20160067184A (ko) * 2013-10-25 2016-06-13 싸이오서스 테라퓨틱스 엘티디. 이종 유전자로 무장된 종양살상 아데노바이러스
KR20190009947A (ko) * 2017-07-20 2019-01-30 (주)큐리진 AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040002322A (ko) * 2002-06-27 2004-01-07 송준석 텔로머라제 프로모터를 갖는 아데노바이러스 및 이를항암치료에 사용하는 용도
KR20160067184A (ko) * 2013-10-25 2016-06-13 싸이오서스 테라퓨틱스 엘티디. 이종 유전자로 무장된 종양살상 아데노바이러스
KR20190009947A (ko) * 2017-07-20 2019-01-30 (주)큐리진 AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BRACHTLOVA TEREZA, VAN BEUSECHEM VICTOR: "Unleashing the Full Potential of Oncolytic Adenoviruses against Cancer by Applying RNA Interference: The Force Awakens", CELLS, vol. 7, no. 12, 228, 23 November 2018 (2018-11-23), pages 1 - 21, XP055852578, DOI: 10.3390/cells7120228 *
GRITSINA GALINA, GAO WEI-QIANG, YU JINDAN: "Transcriptional repression by androgen receptor: roles in castration-resistant prostate cancer", ASIAN JOURNAL OF ANDROLOGY, vol. 21, no. 3, 1 May 2019 (2019-05-01), US, pages 215 - 223, XP055852556, ISSN: 1008-682X, DOI: 10.4103/aja.aja_19_19 *

Also Published As

Publication number Publication date
KR20210118760A (ko) 2021-10-01

Similar Documents

Publication Publication Date Title
ES2485848T3 (es) ARN de interferencia para el tratamiento de trastornos relacionados con la ganancia de función
WO2012053741A9 (fr) Molécules d'acides nucléiques induisant une interférence arn, et leurs utilisations
JP2018500027A (ja) リガンド修飾二本鎖核酸
WO2008109447A1 (fr) Composés d'acides nucléiques conçus pour inhiber l'expression du gène met et utilisations de ceux-ci
KR20210118759A (ko) 이중 특이적 핵산분자를 포함한 항암 바이러스의 구조
WO2018143626A1 (fr) Acide nucléique inhibant simultanément l'expression du gène mtor et du gène stat3
EP2121923A1 (fr) Composes d'acide nucleique permettant d'inhiber l'expression de gene de la famille erbb et utilisations de ceux-ci
WO2021194179A1 (fr) Virus oncolytique comprenant une séquence d'acide nucléique ciblant stat3 et mtor de manière bispécifique
EP2361305A2 (fr) Composés d acide nucléique pour inhiber l expression du gène birc5 et utilisations de ceux-ci
WO2021194181A1 (fr) Virus anticancéreux comprenant une molécule d'acide nucléique ciblant ar et mtor de manière bispécifique
WO2008109449A1 (fr) Composés d'acide nucléique pour inhiber l'expression du gène bcl2 et utilisations de ceux-ci
KR101993377B1 (ko) Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
KR20200009286A (ko) AR 유전자 및 mTOR 유전자의 발현을 동시에 억제하는 핵산
WO2008109556A1 (fr) Composés d'acide nucléique pour inhiber l'expression du gène de télomérase et utilisation de ceux-ci
WO2023121178A1 (fr) Acides nucléiques inhibant l'expression des gènes mtor et stat3
WO2022191661A1 (fr) Acides nucléiques inhibant simultanément l'expression du gène c-met et du gène pd-l1
WO2008109548A2 (fr) Composés d'acides nucléiques conçus pour inhiber l'expression du gène tgfb et utilisations de ceux-ci
WO2008109558A2 (fr) Composés d'acide nucléique pour inhiber l'expression du gène tlr et utilisation de ceux-ci
WO2008109366A2 (fr) Composés d'acide nucléique permettant d'inhiber l'expression de gène ccnd1 et utilisations de ceux-ci
WO2010064851A2 (fr) Arn interférant court à réaction croisée interspécifique, vecteur de recombinaison contenant ce dernier et composition pharmaceutique contenant ce dernier
TWI353254B (en) Treatment of a disease or a condition associated w
KR20200009498A (ko) Bcl2 유전자 및 bi-1 유전자의 발현을 동시에 억제하는 핵산
WO2019017713A2 (fr) Acide nucléique inhibant simultanément l'expression du gène ar et du gène mtor
WO2008109359A1 (fr) Composés d'acide nucléique permettant d'inhiber l'expression de gène de la famille pdgfr et utilisations de ceux-ci
WO2019103578A1 (fr) Oligonucléotide et composition pharmaceutique le comprenant pour la prévention ou le traitement du cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21775332

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21775332

Country of ref document: EP

Kind code of ref document: A1