WO2021182712A1 - 뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법 - Google Patents

뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법 Download PDF

Info

Publication number
WO2021182712A1
WO2021182712A1 PCT/KR2020/015709 KR2020015709W WO2021182712A1 WO 2021182712 A1 WO2021182712 A1 WO 2021182712A1 KR 2020015709 W KR2020015709 W KR 2020015709W WO 2021182712 A1 WO2021182712 A1 WO 2021182712A1
Authority
WO
WIPO (PCT)
Prior art keywords
microglia
cells
mature
neuroepithelial
confirmed
Prior art date
Application number
PCT/KR2020/015709
Other languages
English (en)
French (fr)
Inventor
권민수
임종섭
공태호
유민정
원지혜
Original Assignee
의료법인 성광의료재단
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 의료법인 성광의료재단, 차의과학대학교 산학협력단 filed Critical 의료법인 성광의료재단
Priority to US17/906,165 priority Critical patent/US20230113221A1/en
Publication of WO2021182712A1 publication Critical patent/WO2021182712A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0622—Glial cells, e.g. astrocytes, oligodendrocytes; Schwann cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/02—Atmosphere, e.g. low oxygen conditions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/15—Transforming growth factor beta (TGF-β)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2334—Interleukin-34 (IL-34)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C12N2501/33—Insulin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/08—Coculture with; Conditioned medium produced by cells of the nervous system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/08—Coculture with; Conditioned medium produced by cells of the nervous system
    • C12N2502/081—Coculture with; Conditioned medium produced by cells of the nervous system neurons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2509/00—Methods for the dissociation of cells, e.g. specific use of enzymes
    • C12N2509/10—Mechanical dissociation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/30—Synthetic polymers
    • C12N2533/32—Polylysine, polyornithine

Definitions

  • It relates to a method for producing mature microglia capable of banking and subculture.
  • Microglia are glial cells present in the cerebrospinal cord, also called Hortega cells. It is derived from mesoderm, is activated by invasion of foreign substances such as viruses into the brain and trauma, and is known to be responsible for various physiological functions, such as sterilization and tissue repair, as well as anti-tumor action. In addition, microglia remove wastes such as dead cells and amyloid ⁇ due to apoptosis or damage by phagocytosis.
  • chronic neurodegenerative diseases following neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Lou Gehrig's disease, those involved in brain diseases such as cerebral infarction associated with acute and subacute brain injury, and amyloid ⁇ in the brain It is known that the reactivity is changed by the accumulated waste material.
  • microglia or mature microglia for the development and evaluation of therapeutic agents for diseases related to microglia, and various methods have been tried for this purpose.
  • a conventional method for obtaining microglia is i) culturing a microglia cell line. In this case, subculture and storage are possible, but it is an immortalized cell line transformed from a virus, and there is a disadvantage in that the characteristics of mature microglia are not reflected. ii) Second, there is a method using primary cultured microglia. This shows a little more characteristics of mature microglia than the cell line, but it is impossible to subculture and difficult to store, and it does not completely have the genetic characteristics of mature microglia. Furthermore, in order to secure the number of cells for the experiment, there is a disadvantage that an individual immediately after birth must be dissected for every experiment.
  • One aspect comprises the steps of culturing a mixture containing neuroepithelial cells and microglia precursors; And to provide a method for producing mature microglia comprising the step of isolating microglia from the mixture.
  • Another aspect is to provide a mature microglia prepared according to the manufacturing method.
  • One aspect comprises the steps of culturing a mixture containing neuroepithelial cells and microglia precursors; And it relates to a method for producing mature microglia comprising the step of isolating microglia from the mixture.
  • neuroepithelial cell refers to an epithelial cell differentiated to fit a sensory organ, and refers to an ectoderm part to be a nervous system. Neuroepithelial cells are formed during the development of the neural tube or neural plate during the development of the fetal brain and are the earliest neural stem cells and have multidifferentiation capable of differentiating into neurons and glia cells. .
  • microglia are cells involved in the immune function in the brain, and secrete nutrients to help nerve survival or to secrete substances that induce inflammation to protect nerve cells from invasion of foreign substances.
  • the mixture containing the neuroepithelial cell (NEC) and the microglia precursor is not limited as long as it contains the neuroepithelial cell and the microglia precursor, but specifically the neuroepithelial layer (neuroepithelial layer) of the individual. ) or may be separated or separated from the cerebral cortex, and more specifically, separated or separated from the neuroepithelial layer of the individual.
  • the method may further include separating the mixture from the neuroepithelial layer of the subject.
  • the "individual” means all living organisms, such as rats, mice, and livestock, except for humans, that can have neuroepithelial cells and microglia precursors. As a specific example, it may be a mammal including a rat, a mouse, and the like, and more specifically, a rat, a mouse, and the like.
  • the subject may be a fetus separated from the uterus of a pregnant parent.
  • the fetus is not limited as long as the parent is a pregnant fetus, but specifically, when the subject is a mouse, the subject's parent may be a fetus 11.5 to 15.5 days after sexual intercourse, and the subject is another animal, particularly a mammal In the case of , when the subject is a mouse, the subject's parent may be a fetus corresponding to a fetus 11.5 to 15.5 days after intercourse.
  • the fetus may be a fetus 12.5 to 14.5 days after sexual intercourse of the parent of the subject when the subject is a mouse more specifically, and when the subject is another animal, particularly a mammal, the subject is a mouse
  • the parent of the subject may be a fetus corresponding to a fetus 12.5 to 14.5 days after intercourse.
  • “correspondence” includes those having the same number of days, and includes those in the same stage of development based on the adult according to the gestation period of each individual or the development of the fetus.
  • the separation from the uterus of the parent of the pregnant individual may be separated according to a known separation method.
  • the neuroepithelial layer is a neuroepithelial layer
  • the head, brain, retina, etc. are not limited, but for example, may be a neuroepithelial layer on the head or brain side.
  • the culture may be a conventional culture or subculture.
  • the culture may differentiate or change the precursors of microglia contained in the mixture into mature microglia as the period or number of passages increases. Specifically, when the culture is subculture, when the number of passages is 2 to 6, more specifically 3 to 5, and then the microglia are separated from the mixture, the separated microglia may be mature microglia.
  • the method for preparing the mature microglia comprises the steps of: freezing the mixture prior to isolating the microglia; and
  • the method may further include thawing the mixture.
  • Proliferation and subculture are possible even when the mixture is stored frozen, and the microglia in the mixture maintain phagocytosis and migration ability, and maturity can also be maintained. Therefore, according to the method according to one aspect, it is possible to isolate and use only mature microglia at any time, anywhere, so that the number of subjects required for the experiment can be drastically reduced.
  • the separation may be made using at least one method selected from the group consisting of a MACS (Magnetic-activated cell sorting) system or a FACS (Fluorescent-activated cell sorting) system and a shaking method. And, specifically, it may be made using a MACS system.
  • MACS Magnetic-activated cell sorting
  • FACS Fluorescent-activated cell sorting
  • the microglia may express CD11b, a marker of microglia.
  • the microglia are at least selected from the group consisting of IBA-1, PU1, TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta, MERTK, C1QA, GPR34, and TGFBR1 markers of mature microglia. It may express one gene, specifically, it may express at least one gene selected from the group consisting of IBA-1 and TMEM119.
  • the microglia may be capable of phagocytosis.
  • One function of microglia, phagocytosis, may appear equivalent to or similar to that of mature microglia.
  • the microglia may be in the form of ramified (Ramified). This is a cellular form of mature microglia, which can be observed through a microscope.
  • Another aspect provides a mature microglia prepared according to the method for producing a mature microglia.
  • the preparation method is the same as described above, and the mature microglia are CD11b, IBA-1, Nestin, PU1, TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta, MERTK, It may be to express at least one gene selected from the group consisting of C1QA, GPR34 and TGFBR1.
  • the mature microglia may be capable of phagocytosis, and may be in a ramified form.
  • microglia According to the manufacturing method according to one aspect, subculture and banking are possible, and since freezing storage and thawing are possible, only mature microglia can be simply separated and used whenever necessary. In addition, it is possible to dramatically reduce the number of individuals required for the experiment, and it can contribute economically to all research or industrial fields related to microglia.
  • 1A to 1D are diagrams illustrating the separation and culture of neuroepithelial cells from the neuroepithelial layer and confirming the presence of microglia among mixed cells separated from the neuroepithelial layer.
  • Figures 2a and 2b are diagrams showing the comparison of the neuroepithelial layer and the cerebral cortex as the origin of microglia and the separation of pure microglia using the MACS system.
  • FIG. 3 is a diagram confirming the expression of major markers of purely isolated microglia through immunofluorescence staining.
  • 4A and 4B are diagrams confirming the subculture of neuroepithelial cells including microglia and the phagocytic function of purely isolated microglia.
  • 5 is a diagram confirming the unique characteristics of purely isolated microglia through immunofluorescence staining.
  • FIG. 6 is a diagram confirming the unique characteristics of purely isolated microglia through qPCR.
  • 8a to 8c are diagrams confirming the change according to the culture period of purely isolated microglia.
  • FIG. 9 is a diagram confirming the highest number of microglia in neuroepithelial cells isolated at the age of 13.5 days through immunochemical staining.
  • 10 shows the age of 13.5 days. It is a diagram confirming the proliferation and maturation of microglia when the neuroepithelial cell layer is separated and cultured for 21 days.
  • FIG. 11 is a diagram confirming through flow cytometry that the percentage of microglia (CD11b) is increased when the fetal neuroepithelial cell layer is separated and cultured for 21 days.
  • FIG. 12 is a diagram confirming that the neuroepithelial layer of the mouse E13.5 day is separated and cultured for 21 days, and subculture is possible.
  • FIG. 13 is a diagram confirming that microglia have proliferative ability when sub-cultured after culturing neuroepithelial cells for 21 days.
  • FIG. 14 is a diagram confirming that microglia (NEC-MG) obtained by separating only microglia using the MACS system after culturing the neuroepithelial cell layer for 21 days express microglia markers (IBA-1, CX3CR1, TMEM119) .
  • 15 is a view confirming the maturity of microglia isolated from the neuroepithelial layer.
  • 16 is a diagram confirming that the maturity of microglia is maintained even in subculture and continuous culture.
  • 17 is a diagram confirming the microglia markers and phagocytosis ability according to subculture and continuous culture.
  • 18A to 18C are diagrams confirming the phagocytosis ability of microglia.
  • 19 is a view confirming the migrating ability of microglia.
  • 20 is a diagram confirming the cytokine secretion ability of microglia during LPS treatment.
  • 21 is a diagram confirming the ability to secrete inflammatory and anti-inflammatory cytokines after LPS treatment.
  • 22A and 22B are diagrams confirming microglia isolated from the cryopreserved and thawed neuroepithelial layer.
  • FIG. 23 is a diagram confirming the maturity level of microglia isolated from the neuroepithelial layer that has been frozen and thawed.
  • HBBS Hanks' Balanced Salt Solution
  • DMEM fresh culture medium
  • fetal bovine serum gibco, cat. # 11995-065
  • heat-inactivated fetal bovine serum gibco, cat
  • 0.1x GlutaMAXTM gibco, cat. #35050-061
  • penicillin/streptomycin gibco, cat # 15140122
  • Poly-D-lysine hydrobromide (SIGMA, cat# P7280) coated 75T-flasks were incubated in 3 sets at 37°C, 5% CO 2 in an incubator (one set means 10 to 12 pups, only one set For culture, use 25T-flask).
  • CD11b is a microglia marker expressed only in microglia among neuroepithelial cells
  • flow cytometry analysis was performed using an anti-CD11b antibody (BD, cat. # 553311).
  • CD11b monoclonal antibodies conjugated with a fluorescent dye specific to mouse CD11b (cat. # 553311; BD Biosciences, San Jose, CA) were used.
  • Cells were washed with calcium-magnesium-free phosphate-buffered saline (PBS; cat. #14190-144, gibco), and in cell staining buffer (cat. #420201; BioLegend) at 4°C for 5 minutes. Liver cultured.
  • Antibodies were incubated with cell suspension at 4°C for 30 min, washed with PBS, resuspended, and fixed with 1% paraformaldehyde (Wako, Osaka, Japan) in PBS.
  • the expression rate of CD11b was calculated as the fluorescence intensity of each fluorochrome. All data were collected on a CytoFLEX flow cytometer (Beckman) and analyzed with CyExpert software (Beckman).
  • markers of microglia were identified through immunofluorescence staining.
  • primary cultured microglia were seeded on glass coverslips in 24-well plates. Cells were washed with PBS, fixed with 4% formaldehyde, and permeabilized with 0.5% Triton X-100 for 5 minutes. ProLongTM Gold Antifade Mountant with DAPI (Invitrogen, cat. # P36931) reagent was used for fixing cells, long-term storage, and maintaining fluorescent staining, and indirect immunofluorescence was performed using the following antibodies as primary antibodies: rabbit Anti-GFAP antibody (abcam, cat. # ab7260), goat anti-IBA-1 antibody (abcam, cat. # ab48004), rabbit anti-IBA-1 antibody (wakko, cat.
  • the MACS system was used to isolate pure CD11b-positive cells from NEC.
  • the number of cells was first measured, and when the total number of cells was 1 x 10 7 cells, 10 ⁇ l of CD11b and 90 ⁇ l of PBS and 0.5% BSA buffer were incubated at 4° C. for 15 minutes. 1 to 2 ml of PBS and 0.5% BSA buffer were added, and centrifuged at 300 g for 10 minutes. The supernatant was removed, and when the number of cells was 1 x 10 7 cells, 500 ⁇ l of PBS and 0.5% BSA buffer were added.
  • CD11b MACS beads MS Columns (Miltenyi, cat. # 130-042-201), CD11b (Miltenyi, cat. # 130-093-636)) were used for positive selection (130-093-636; Miltenyi) (LS). can also be separated by columns).
  • RNA was immediately extracted and analyzed for purity.
  • a shaking method may be used in addition to the MACS system, and the specific method is as follows.
  • Shaking incubator (JEIOTECH, KOREA) was incubated for 45 minutes at 50 rpm. Then, 14 ml of the media was removed and 14 ml of new media was added so that the final volume was 21 ml, and incubated at 37° C. and 5% CO 2 in an incubator for 3 hours. In addition, it was shaken at 160 rpm for 2 hours, put in a 50 ml conical tube, and centrifuged at 1200 rpm for 8 minutes. After that, the amount of pellet (microglia) was counted, and it was confirmed that the shaking separation method was also possible (Table 1).
  • microglia markers PU1, IBA-1, and TMEM119 were confirmed by performing the same immunofluorescence staining as in Example 1 (rabbit anti-TMEM119 antibody (abcam, cat. # ab209064) and murine anti-Pu.1 antibody (abcam, cat. # ab88082)).
  • CD11b-positive cells (microglia) from NEC cultured for more than 15 days (NECp0) were isolated using the MACS system, and microglia isolated using the MACS system after passage 6 times in NECs ( IBA-1 and TMEM119 markers were identified in NECp6), and in particular, the expression of TMEM119 in NECp6-MG was confirmed through DAPI staining. As a result, it was confirmed that the expression levels of IBA-1 and TMEM119 were increased in NECp6 than in NECp0 (FIG. 4a).
  • red beads SIGMA, cat. # L3030-1ML were inoculated to confirm yellow beads in the cells (FIG. 4b).
  • microglia signature genes TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta
  • qPCR Quantitative Reverse Transcriptase Polymerase Chain Reaction
  • TREM2 (Table 1), Olfml3 (Table 1), P2RY12 (Qiagen, Germany, PPM04913C), TMEM119 (PPM28876A), CSF1R (PPM03625F), MAFB (PPM05266A) ), HEXB (PPM27125A) and TGFB (PPM02991B) genes were analyzed.
  • cDNA was prepared using the Applied QuantStudio1 system (thermo) at 95 ° C. for 10 minutes, and 40 cycles were performed at 95 ° C. for 15 seconds and 60 ° C. for 1 minute. Together, they were amplified using Power SYBR Green PCR Master Mix. Melting curves were generated to test the specificity of the amplification. Relative quantity (RQ) levels were calculated by the 2- ⁇ Ct method using GAPDH (Table 1 below) as an internal standard control. Results were performed in 3 independent experiments on independent cell batches.
  • mice primer order SEQ ID NO: One GAPDH GAPDH-F CATGGCCTTCCGTGTTCCTA One GAPDH-R GCGGCACGTCAGATCCA 2 2 olfml3 olfml3-F CTGCTGCTCCTCTTCTTTTTG 3 olfml3-R CTACTCTGATCCTGGCATTG 4 3 trem2 trem2-F TGGGACCTCTCCACCAGTT 5 trem2-R GTGGTGTTGAGGGCTTGG 6
  • TMEM119 a marker of mature microglia, was isolated at NEC passage 4 (NECp4-MG), and isolated at passage 6 (NECp6-MG). ), it was confirmed that the expression level was partially decreased (FIG. 7a).
  • NECp0-MG and NECp4-MG were transformed into fetal microglia, BV2 (microglia cell line), mature microglia, and genes representing the characteristics of major microglia (microglia signature gene: TMEM119). , MERTK, C1QA, GPR34 and TGFBR1) were compared, and it was found that the expression of major genes (especially TMEM119) from at least NECp4-MG was similar to adult microglia (Fig. 7b).
  • TMEM119 and IBA-1 were mixed with insulin culture medium (DMEM (gibco, cat. # 11995-065), 10% heat-inactivated fetal bovine serum (gibco, cat. #16000-044), 0.1x GlutaMAXTM ( gibco, cat. #35050-061), 5 ⁇ g/ml Insulin solution human (sigma, cat. # 19278-5ML) and 1% penicillin/streptomycin (Gibco, cat # 15140122)) and microglia culture medium (Microglia (MG) ) culture medium: DMEM (gibco, cat.
  • Example 2 The materials and methods of the experiments in Example 2 are the same as in Example 1 above.
  • Neuroepithelial cells were isolated in the same manner as in Example 1, but were separated from 10.5-day-old mouse embryos, 13.5-day-old mouse embryos, and 17.5-day-old mouse embryos.
  • the method according to one aspect is a microglia culture technology capable of subculture.
  • microglia obtained by separating only microglia using the MACS system expressed microglia markers (IBA-1, CX3CR1, TMEM119) (FIG. 14). .
  • NEC-MG showed higher levels of expression of mature microglia genes than conventional microglia models, microglia cell lines (BV2, SIM-A9) and primary cultured microglia (immature microglia fetal microglia). It was confirmed that Pros1, C1qa, Gas6, Trem2, Csf1r, and Tgfb1 were expressed at a level similar to that of adult microglia (FIG. 15).
  • microglia markers IBA-1, CX3CR1 were not only expressed in microglia isolated after subculture, but also TMEM119 expressed in mature microglia showed a higher expression pattern with subculture. It was confirmed, and it was confirmed that phagocytosis, which is a characteristic of microglia, was also made in this cell (FIG. 17).
  • Fluorescent beads (FIG. 18a), Amyloid-beta (FIG. 18b), and Synaptosome (FIG. 18c) were treated to confirm the phagocytosis ability of NEC-MG, and phagocytosis was confirmed (FIG. 18).
  • NEC-MG can secrete various cytokines when 100ng/ml of LPS was treated for 24 hours (FIG. 20).
  • FIG. 22a When cultured for 21 days, it changed to a ramified form (FIG. 22a), and microglia (NEC-MG) isolated by MACS system on days 7 and 14 after thawing well expressed TMEM119 and CX3CR1 and showed phagocytosis of microglia. was confirmed (FIG. 22b).

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법에 관한 것으로, 일 양상에 따른 방법에 의하면, 계대배양 및 저장(stock)이 가능하고, 냉동 보관 및 해동도 가능하므로, 필요할 때마다 간단하게 성숙한 미세아교세포만 분리하여 사용할 수 있다. 또한, 실험에 필요한 개체의 수를 획기적으로 줄일 수 있어, 미세아교세포와 관련된 모든 연구 또는 산업 분야에 경제적으로도 이바지할 수 있다.

Description

뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법
뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법에 관한 것이다.
미세아교세포(microglia)란 뇌척수 중에 존재하는 신경교세포로, Hortega 세포라고도 불린다. 중배엽 유래이고, 뇌 내로의 바이러스 등 이물의 침입 및 외상에 의해 활성화되고, 살균, 조직의 수복 이외에, 항종양 작용 등, 여러 가지 생리기능을 담당하는 것이 알려져 있다. 또한, 미세아교세포는 아포토시스나 손상에 의한 사세포나 아밀로이드β 등의 노폐물을 탐식작용에 의해 제거한다.
질환과의 관계에서는 알츠하이머병, 파킨슨병과, 루게릭병 같은 신경변성을 따르는 만성 신경변성질환이나, 급성 및 아급성 뇌손상과 관련된 뇌경색 등의 뇌 질환에 관여하는 것 및 아밀로이드 β로 대표되는 뇌 내에서 축적하는 노폐물에 의해 반응성이 변화되는 것 등이 알려져 있다.
한편, 미세아교세포에 관련되는 질환의 치료약 개발과 평가를 위해서 미세아교세포 또는 성숙한 미세아교세포를 사용하는 것이 필요하며, 이를 위해 다양한 방법이 시도되고 있다.
미세아교세포를 얻기 위한 기존의 방법으로 i) 미세아교세포주를 배양하는 방법이 있다. 이러한 경우, 계대배양 및 저장이 가능하나, 바이러스로부터 형질전환된 불멸화 세포주이며, 성숙한 미세아교세포의 특징이 반영되지 않는 단점이 있다. ii) 두 번째로, 1차 배양한 미세아교세포를 이용하는 방법이 있다. 이는 상기 세포주보다는 성숙한 미세아교세포의 특성이 조금 더 나타내나, 계대배양이 불가능하고, 저장이 어려울 뿐만 아니라, 성숙한 미세아교세포의 유전적 특징을 완전하게 가지지 못 한다. 나아가, 실험을 위한 세포 수를 확보하기 위해서는 출생 직후의 개체를 실험 때마다 해부해야 하는 단점이 있다. iii) 세 번째로, 개체의 뇌로부터 미세아교세포를 직접 분리하는 방법도 있다. 이 경우, 성숙한 미세아교세포를 얻을 수 있으나, 분리 후 세포의 특성이 변화되어 분리 후 세포의 특성을 유지하며 장기간 배양하기 어려우며, 계대배양 및 저장이 불가능하며, 이 역시 실험을 위해서는 많은 실험 개체를 요한다는 단점이 있다.
이에, 계대배양이 및 저장이 가능하며, 성숙한 미세아교세포를 제조할 수 있는 방법이 절실히 요구되는 실정이다.
일 양상은 신경상피세포 및 미세아교세포 전구체가 포함된 혼합물을 배양하는 단계; 및 상기 혼합물로부터 미세아교세포를 분리하는 단계를 포함하는 성숙한 미세아교세포의 제조 방법을 제공하는 것이다.
다른 양상은 상기 제조 방법에 따라 제조된 성숙한 미세아교세포를 제공하는 것이다.
일 양상은 신경상피세포 및 미세아교세포 전구체가 포함된 혼합물을 배양하는 단계; 및 상기 혼합물로부터 미세아교세포를 분리하는 단계를 포함하는 성숙한 미세아교세포의 제조 방법에 관한 것이다.
상기 "신경상피세포"는 감각기관에 맞도록 분화된 상피세포를 말하며, 신경계가 될 외배엽 부분을 의미한다. 신경상피세포는 태아 뇌 발달과정 중에 신경관 또는 신경판 발달 과정 중에 형성되며 가장 초기의 신경줄기세포(primitive neural stem cell)로 뉴런(neuron)과 글리아(glia)세포로 분화가 가능한 다분화성을 갖고 있다.
상기 "미세아교세포(microglia)"는 뇌에서 면역작용에 관여하는 세포로서 영양물질을 분비하여 신경의 생존을 돕거나 염증을 유도하는 물질을 분비하여 외부물질의 침입으로부터 신경세포를 보호한다.
상기 신경상피세포(Neuroepithelial cell: NEC) 및 미세아교세포(Microglia) 전구체가 포함된 혼합물은 상기 신경상피세포 및 미세아교세포 전구체를 포함하고 있다면 제한되지는 않으나, 구체적으로 개체의 신경상피층(neuroepithelial layer) 또는 대뇌 피질(cortex)로부터 분리 또는 박리된 것일 수 있고, 보다 구체적으로 개체의 신경상피층으로부터 분리 또는 박리된 것일 수 있다.
일 양상에 따르면, 개체의 신경상피층(neuroepithelial layer)으로부터 상기 혼합물을 분리하는 단계를 더 포함할 수 있다.
상기 "개체"란 신경상피세포 및 미세아교세포 전구체를 보유할 수 있는 인간을 제외한 쥐, 생쥐, 가축 등의 모든 생물을 의미한다. 구체적인 예로, 쥐, 생쥐 등을 포함한 포유동물일 수 있고, 보다 구체적으로는 쥐, 생쥐 등일 수 있다.
또한, 일 양상에 따르면, 상기 개체는 임신 중인 부모의 자궁으로부터 분리된 태아일 수 있다.
상기 태아는 부모가 임신 중인 태아라면 제한되지는 않으나, 구체적으로 상기 개체가 생쥐인 경우에는 상기 개체의 부모가 성교 후 11.5일 내지 15.5일이 된 태아일 수 있고, 상기 개체가 다른 동물 특히 포유동물인 경우, 상기 개체가 생쥐인 경우 상기 개체의 부모가 성교 후 11.5일 내지 15.5일이 된 태아에 대응되는 태아일 수 있다. 또한, 상기 태아는 보다 구체적으로 상기 개체가 생쥐인 경우에는 상기 개체의 부모가 성교 후 12.5일 내지 14.5일이 된 태아일 수 있고, 상기 개체가 다른 동물 특히 포유동물인 경우, 상기 개체가 생쥐인 경우 상기 개체의 부모가 성교 후 12.5일 내지 14.5일이 된 태아에 대응되는 태아일 수 있다. 이 때, "대응"은 일 수가 동일한 것도 포함하며, 각 개체의 임신 기간 또는 태아의 발달과정에 따라 성체를 기준으로 발달 과정이 동일한 단계에 있는 것을 포함한다.
상기 임신 중인 개체의 부모의 자궁으로부터 분리는 기존에 공지된 분리 방법에 따라 분리될 수 있다.
상기 신경상피층은 신경상피층이라면 머리 또는 뇌, 망막 등 제한되지는 않으나, 예를 들어, 머리 또는 뇌 측의 신경상피층일 수 있다.
일 양상에 따르면, 상기 배양은 통상적인 배양 또는 계대배양일 수 있다.
상기 배양은 기간 또는 계대 수가 증가함에 따라 상기 혼합물에 포함된 미세아교세포의 전구체를 성숙한 미세아교세포로 분화 또는 변화시킬 수 있다. 구체적으로 상기 배양이 계대배양인 경우, 계대 수가 2 내지 6회, 보다 구체적으로 3 내지 5회 이루어진 후 혼합물로부터 미세아교세포가 분리되면, 분리된 미세아교세포는 성숙한 미세아교세포일 수 있다.
일 양상에 있어서, 상기 성숙한 미세아교세포의 제조 방법은 상기 미세아교세포를 분리하기 이전에 상기 혼합물을 냉동 보관하는 단계; 및
상기 혼합물을 해동하는 단계를 더 포함할 수 있다.
상기 혼합물을 냉동 보관하여도 증식 및 계대배양이 가능하며, 상기 혼합물 내 미세아교세포는 식균 작용, 이동 능력도 유지되며, 성숙도도 유지될 수 있다. 따라서, 일 양상에 따른 방법에 의하면 언제 어디서든 성숙한 미세아교세포만 분리하여 사용할 수 있어, 실험에 필요한 개체의 수를 획기적으로 줄일 수 있다.
일 양상에 있어서, 상기 분리는 MACS(Magnetic-activated cell sorting) 시스템 또는 FACS(Fluorescent-activated cell sorting) 시스템 및 진탕 분리법(shaking method)으로 이루어진 군에서 선택되는 적어도 하나의 방법을 이용하여 이루어지는 것일 수 있고, 구체적으로 MACS 시스템을 이용하여 이루어지는 것일 수 있다.
일 양상에 있어서, 상기 미세아교세포는 미세아교세포의 마커인 CD11b를 발현하는 것일 수 있다.
또한, 상기 미세아교세포는 성숙한 미세아교세포의 마커인 IBA-1, PU1, TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta, MERTK, C1QA, GPR34 및 TGFBR1으로 이루어진 군에서 선택되는 적어도 하나의 유전자를 발현하는 것일 수 있고, 구체적으로 IBA-1 및 TMEM119로 이루어진 군에서 선택되는 적어도 하나의 유전자를 발현하는 것일 수 있다.
일 양상에 있어서, 상기 미세아교세포는 식균 작용(phagocytosis)이 가능한 것일 수 있다. 미세아교세포의 일 기능인 식균 작용(phagocytosis)이 성숙한 미세아교세포와 동등 또는 그와 유사하게 나타날 수 있다.
일 양상에 있어서, 상기 미세아교세포는 라미파이드(Ramified) 형태일 수 있다. 이는 성숙한 미세아교세포의 세포 형태로서, 현미경을 통해 관찰될 수 있는 형태이다.
다른 양상은 상기 성숙한 미세아교세포의 제조 방법에 따라 제조된 성숙한 미세아교세포를 제공한다.
상기 제조 방법에 관해서는 전술한 바와 같으며, 상기 성숙한 미세아교세포는 CD11b, IBA-1, 네스틴(Nestin), PU1, TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta, MERTK, C1QA, GPR34 및 TGFBR1으로 이루어진 군에서 선택되는 적어도 하나의 유전자를 발현하는 것일 수 있다.
또한, 상기 성숙한 미세아교세포는 식균 작용(phagocytosis)이 가능한 것일 수 있고, 라미파이드(Ramified) 형태일 수 있다.
일 양상에 따른 제조 방법에 의하면, 계대배양 및 뱅킹(Banking)이 가능하고, 냉동 보관 및 해동도 가능하므로, 필요할 때마다 간단하게 성숙한 미세아교세포만 분리하여 사용할 수 있다. 또한, 실험에 필요한 개체의 수를 획기적으로 줄일 수 있어, 미세아교세포와 관련된 모든 연구 또는 산업 분야에 경제적으로도 이바지할 수 있다.
도 1a 내지 1d는 신경상피층으로부터 신경상피세포의 분리, 배양 및 신경상피세층으로부터 분리된 혼합 세포들 중 미세아교세포가 존재하는 것을 확인한 도이다.
도 2a 및 2b는 미세아교세포의 유래원으로서 신경상피층과 대뇌 피질의 비교 및 MACS 시스템을 이용한 순수한 미세아교세포의 분리를 나타낸 도이다.
도 3은 순수하게 분리된 미세아교세포의 주요 마커들의 발현을 면역형광염색을 통해 확인한 도이다.
도 4a 및 4b는 미세아교세포를 포함하는 신경상피세포의 계대배양 및 순수하게 분리된 미세아교세포의 식균 기능을 확인한 도이다.
도 5는 순수하게 분리된 미세아교세포 고유의 특징을 면역형광염색을 통해 확인한 도이다.
도 6은 순수하게 분리된 미세아교세포 고유의 특징을 qPCR을 통해 확인한 도이다.
도 7a 및 7b는 태아 미세아교세포(fetal microglia), BV2(미세아교세포 세포주), 성숙 미세아교세포(adult microglia)와 계대배양된 후 순수하게 분리된 미세아교세포의 주요 마커들의 발현량을 비교한 도이다.
도 8a 내지 8c는 순수하게 분리된 미세아교세포의 배양 기간에 따른 변화를 확인한 도이다.
도 9는 13.5일령에 분리한 신경상피세포에서 미세아교세포수가 가장 높음을 면역화학염색을 통해 확인한 도이다.
도 10은 13.5일령의 신경상피세포층을 분리한 후 21일 배양하였을 때 미세아교세포가 증식하고 성숙해지는 것을 확인한 도이다.
도 11은 태아의 신경상피세포층을 분리한 후 21 동안 배양하였을 때 미세아교세포(CD11b)의 %가 높아짐을 flow cytometry를 통해 확인한 도이다.
도 12는 마우스 E13.5일의 신경상피층을 분리하여 21일간 배양한 뒤, 계대배양이 가능함을 확인한 도이다.
도 13은 신경상피세포를 21일 동안 배양한 후 계대배양을 진행하였을 때, 미세아교세포가 증식 능력이 있음을 확인한 도이다.
도 14는 신경상피세포층을 21일 동안 배양 후 미세아교세포만을 MACS시스템으로 분리한 미세아교세포(NEC-MG)는 미세아교세포 마커 (IBA-1, CX3CR1, TMEM119)를 발현하는 것을 확인한 도이다.
도 15는 신경상피층에서 분리한 미세아교세포의 성숙도를 확인한 도이다.
도 16은 계대배양 및 지속적인 배양에도 미세아교세포의 성숙도가 유지됨을 확인한 도이다.
도 17은 계대배양 및 지속적인 배양에 따른 미세아교세포 마커 확인 및 식균작용능력을 확인한 도이다.
도 18a 내지 18c는 미세아교세포의 식균작용 능력을 확인한 도이다.
도 19는 미세아교세포의 이동능력을 확인한 도이다.
도 20은 LPS 처리시 미세아교세포의 사이토카인 분비능력을 확인한 도이다.
도 21은 LPS 처리 후 염증 및 항염증 사이토카인 분비능력을 확인한 도이다.
도 22a 및 22b는 냉동 보관 및 해동한 신경상피층으로부터 분리한 미세아교세포를 확인한 도이다.
도 23은 냉동 보관 및 해동한 신경상피층으로부터 분리한 미세아교세포의 성숙도를 확인한 도이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1
1. 신경상피세포(Neuroepithelial cell; NEC)의 분리, 배양 및 미세아교세포 존재의 확인(도 1a)
신경상피세포를 얻기 위해, 13.5일령 마우스의 배아를 자궁에서 분리한 뒤, 머리 쪽에 존재하는 신경상피층(neuroepithelial layer)을 박리(dissection)하여 Hanks'Balanced Salt Solution(HBBS; gibco, cat. # 14170-112)에서 single cell suspension을 수행하였다.
이 후, HBSS에 담긴 세포들을 1200 rpm으로 3분 간 원심 분리한 뒤에 HBBS 배지를 제거하고 1xTrypsin-EDTA(gibco, cat. # 15400-054)를 1 ml 첨가하였다.
3분 동안 배양한 뒤에 1200 rpm으로 5분 간 원심 분리하여 세포들을 가라앉게 한 후, 새로운 배양 배지(DMEM (gibco, cat. # 11995-065), 10% heat-inactivated fetal bovine serum (gibco, cat. #16000-044), 0.1x GlutaMAX™ (gibco, cat. #35050-061) 및 1% penicillin/streptomycin (Gibco, cat # 15140122))로 갈아주었다.
Poly-D-lysine hydrobromide(SIGMA, cat# P7280)가 코팅된 75T-flask에 3 세트를 37℃, 5% CO2 배양기에서 배양하였다(한 세트는 pups 10 내지 12 마리를 의미하며, 한 세트만 배양할 경우에는 25T-flask를 사용한다.).
하루 뒤, 새로운 배양 배지로 교환해주었고, 15일 이상 배양하여 Flask에 세포 포화 상태에 이르게 되었을 때, 배양된 세포들의 형태 변화(미세아교세포의 유도 과정)를 위상차 현미경(Nikon)을 이용하여 확인하였다. 이미지들은 DS-Ri2 디지털 카메라(Nikon Instech)로 촬영하였다. 그 결과, 현미경을 통해 ramified 형태의 세포를 관찰할 수 있었다(도 1b).
또한, 글루타민 보충제인 GlutaMAX를 더 포함한 배지와 포함하지 않은 배지를 배양한 결과, GlutaMAX를 추가한 배지에서 세포를 배양했을 때, 미세아교세포를 더 빠르게 성장시켰음을 확인하였다(도 1b).
또한, CD11b는 신경상피세포들 중에서 미세아교세포에서만 발현되는 미세아교세포의 마커인 바, 항-CD11b 항체(BD, cat. # 553311)를 이용하여 유세포 분석을 수행하였다.
구체적으로, 생쥐의 CD11b(cat. # 553311; BD Biosciences, San Jose, CA)에 특이적인 형광 색소가 컨쥬게이트된 모노클로날 항체들을 사용하였다. 세포들을 칼슘-마그네슘이 없는 인산염 완충 식염수(phosphate-buffered saline; PBS; cat. #14190-144, gibco)로 세척하였고, 세포 염색 완충액(cat. #420201; BioLegend)에서 4℃의 온도로 5분 간 배양시켰다. 항체들을 4℃에서 30분간 세포 현탁액과 배양시켰고, PBS로 세척하였고, 재현탁하였으며, PBS에서 1% 파라포름알데히드(Wako, Osaka, Japan)로 고정시켰다. CD11b의 발현률을 각 형광 색소의 형광 강도로 계산하였다. 모든 데이터들은 CytoFLEX 유세포분석기(Beckman)에서 수집하였고, CyExpert 소프트웨어(Beckman)로 분석하였다.
유세포 분석 결과, CD11b-양성인 세포가 55.64%까지 증가함을 확인하였고, 계대배양 후(P1) 다시 측정한 결과 59.55%였음을 확인하였다(도 1c).
또한, 상기 CD11b-양성 세포가 미세아교세포인 지 확인하기 위해, 면역형광염색을 통해 미세아교세포의 마커들을 확인하였다.
구체적으로, 1차 배양된 미세아교세포를 24-웰 플레이트의 유리 커버 슬립에 시딩하였다. 세포들을 PBS로 세척한 후, 4% 포름알데히드로 고정시켰고, 0.5% Triton X-100로 5분 간 투과시켰다. ProLong™ Gold Antifade Mountant with DAPI (Invitrogen, cat. # P36931) 시약을 세포들을 고정, 장기 보관, 형광염색 유지 목적으로 사용하였으며, 하기 항체들을 1차 항체로서 사용하여 간접 면역형광을 수행하였다: 토끼의 항-GFAP 항체(abcam, cat. # ab7260), 염소의 항-IBA-1 항체(abcam, cat. # ab48004), 토끼의 항-IBA-1 항체(wakko, cat. # 019-19741) 및 토끼의 항-Nestin 항체(abcam, cat. # ab6142). 세포들을 1% 소 혈청 알부민을 포함하는 PBS에서 0.5% Triton X-100로 희석된 1차 항체와 함께 4℃에서 밤새 배양하였다. 5분 동안 PBS로 3회 헹군 후, Alexa 488(invtrogen, cat. # A11034, # A21202) 또는 Alexa-594(invtrogen cat. # A21203)가 컨쥬게이트된 2차 항체들(항-토끼 IgG H&L(Alexa Fluor, cat. # ab150073), 항-염소 IgG H&L(Alexa Fluor, cat. # ab150129))을 검출에 사용하였다. 핵은 4', 6-diamidino-2-phenylindole(DAPI; Sigma, MO, USA)로 대조 염색하였다. 1차 항체의 첨가가 없던 세포들은 음성 대조군으로 사용하였다. 형광 이미지는 공초점 현미경(TCSSP5 II, Leica microsystems, Wetzlar, Germany)으로 촬영하였다.
면역형광염색(DAPI) 결과, 미세아교세포의 마커인 IBA-1의 발현은 확인할 수 있었으나, 성상 세포의 마커인 GFAP의 발현은 확인할 수 없었으며, 신경상피세포의 마커인 네스틴(Nestin)은 발현되었음을 확인할 수 있었다(도 1d).
결과적으로 신경상피세포를 배양함으로써 기간에 따라 미세아교세포가 증식하고 성숙해지는 것을 확인할 수 있었다.
2. 미세아교세포의 유래원으로서 대뇌 피질과 신경상피층의 비교 및 순수한 미세아교세포의 분리
13.5일령 마우스 배아의 대뇌피질(cortex)에서도 상기 실시예 1과 동일한 방법으로 배양하였지만, 23.38%의 상대적으로 CD11b-양성인 세포가 적었음을 확인할 수 있었다(도 2a).
또한, NEC에서 순수한 CD11b-양성인 세포를 분리하기 위해 MACS시스템을 이용하였다.
구체적으로, 세포의 수를 먼저 측정하고, 세포의 총 수가 1 x 107 cells일 때, 10 ㎕의 CD11b와 PBS 및 0.5% BSA의 buffer 90 ㎕를 4℃에서 15분 동안 배양하였다. PBS 및 0.5% BSA의 buffer를 1 내지 2 ml 첨가하고, 300g로 10분 간 원심분리하였다. 상층액을 제거하고, 세포 수가 1 x 107 cells일 때, 500 ㎕의 PBS 및 0.5% BSA의 buffer를 첨가하였다.
이 후, dounce 균질화시키고, 미엘린(myelin)을 고갈시켰다. CD11b MACS 비드(MS Columns(Miltenyi, cat. # 130-042-201), CD11b(Miltenyi, cat. # 130-093-636))를 이용하여 양성 선별하였다(130-093-636; Miltenyi)(LS columns로 분리도 가능함). 생쥐 실험에 대해 기술된 바와 같이, RNA를 즉시 추출하였고, 순도에 대해 분석하였다.
MACS 분리된 세포를 현미경(bright field)로 관찰한 결과, ramified 형태의 세포만 순수하게 분리됨을 알 수 있었고(도 2b), 세포 수는 5 x 105 cells였다(표 1).
또한, NEC에서 순수한 CD11b-양성인 세포를 분리하기 위해 MACS 시스템 외에 진탕 분리법(shaking method)도 이용할 수 있고, 구체적인 방법은 하기와 같다.
Shaking Incubator(JEIOTECH, KOREA)에서 50 rpm으로 45분동안 진탕 배양하였다. 그 후, Media를 14 ml 제거하고 새 media를 14 ml 첨가하여 최종 부피가 21 ml가 되도록 하고, 37℃ 및 5% CO2 incubator에서 3시간 동안 배양하였다. 또한, 160 rpm으로 2시간 동안 진탕하고, 50 ml conical tube에 담아서 1200 rpm에서 8분 간 원심 분리하였다. 이 후, pellet(microglia)의 양을 세었고, 진탕 분리법도 가능함을 확인하였다(표 1).
MACS system 세포 수
개체의 뇌로부터 분리한 미세아교세포(N=2) 5 x 105 cells
Shaking method 세포 수
1차배양 미세아교세포(pup15) 5 x 105 cells
NECp0-MG(pup15-16) 8-9 x 105 cells
NECp2-MG 2 x 106 cells
3. 순수하게 분리된 미세아교세포의 주요 마커들의 발현 확인
NEC를 배양한 기간에 따른 미세아교세포 마커인 PU1, IBA-1, TMEM119의 발현 양상을 상기 실시예 1에서 수행한 면역형광염색과 동일하기 수행하여 확인하였다(토끼의 항-TMEM119 항체(abcam, cat. # ab209064) 및 생쥐의 항-Pu.1 항체(abcam, cat. # ab88082)).
그 결과, 기간에 따라 PU1, IBA-1, TMEM119 모두 발현량이 증가하였으며, 특히 성인 생쥐의 미세아교세포에서만 발현하는 TMEM119(성숙한 미세아교세포의 마커)의 발현이 약하게 증가하기 시작함을 확인할 수 있었다(도 3).
4. 미세아교세포를 포함하는 신경상피세포의 계대배양 및 순수하게 분리된 미세아교세포의 기능 확인
15일 이상 배양한 NEC에서 CD11b-양성인 세포(미세아교세포)를 MACS 시스템을 이용하여 분리한 미세아교세포(NECp0)와 NEC를 6회 계대배양한 후 MACS시스템을 이용하여 분리한 미세아교세포(NECp6)에서 IBA-1 및 TMEM119 마커를 확인하였고, 특히 NECp6-MG에서 TMEM119의 발현을 DAPI 염색을 통해 확인하였다. 그 결과, NECp0보다 NECp6에서 IBA-1 및 TMEM119의 발현량이 증가함을 확인할 수 있었다(도 4a).
또한, 미세아교세포의 기능을 잘 수행하는 지 확인하기 위해, NECp0-MG에서 미세아교세포 주요 기능인 식균 작용(phagocytosis)을 확인하였다.
구체적으로, 미세아교세포의 식균 작용을 조사하기 위해, 2 x 105 cells/mL 농도의 미세아교세포를 24-웰 세포 배양 접시의 12-mm 커버슬립에 시딩하였다. 세포들은 37℃에서 2시간 동안 2 ㎕의 적색 염색된 Fluoresbrite 미소구체 적색 형광 라텍스 비드(2 μm, cat. # L3030-1ML, Sigma-Aldrich, St. Louis, MO, USA)와 함께 배양하였다. 그 후, 식균 작용을 정지시키기 위해 2 ml의 차가운 PBS를 첨가하였다. 세포들은 차가운 PBS로 2회 세척되었고, DAPI로 대조 염색되었다. 세포들은 공초점 현미경(TPS SP5 II, Leica)으로 분석하였다. 세포 당 식균된 비드의 수는 식균 활성을 나타낸다.
그 결과, 붉은 색의 비드(SIGMA, cat. # L3030-1ML)를 식균하여 세포 내 노란색의 비드를 확인할 수 있었다(도 4b).
5. 순수하게 분리된 미세아교세포 고유의 특징 확인
상기와 같이 제조된 미세아교세포(NECp1-MG, NECp3-MG)에서 성숙 미세아교세포(adult microglia)에서 발현하는 마커인 IBA-1 및 TMEM119의 발현을 실시예 1과 동일하게 면역형광염색을 통해 확인하였고, 이를 성숙 미세아교세포(adult microglia), 태아 미세아교세포(fetal microglia)와 비교하였다.
그 결과, NECp1-MG와 NECp3-MG에서 확연하게 (fetal microglia)보다 많은 IBA-1 및 TMEM119 발현을 확인할 수 있었다(도 5).
또한, qPCR(Quantitative Reverse Transcriptase Polymerase Chain Reaction)을 통한 미세아교세포의 특징 유전자들(microglia signature gene; TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta)의 발현 분석을 수행하였다.
구체적으로, 총 RNA를 TRIzol 시약(Invitrogen)을 이용하여 추출하였고, DS-11 Series 분광광도계/형광계(DeNovlx, DS-11FX)를 이용하여 평가하였다. cDNA는 RevertAid First Strand cDNA 합성 키트(Thermo)를 이용하여 합성하였다. NECp-MG의 미세아교세포의 특징을 평가하기 위해, TREM2(하기 표 1), Olfml3(하기 표 1), P2RY12(Qiagen, Germany, PPM04913C), TMEM119(PPM28876A), CSF1R(PPM03625F), MAFB(PPM05266A), HEXB(PPM27125A) 및 TGFB(PPM02991B) 유전자들의 발현을 분석하였다. cDNA는 95℃에서 10분 간 Applied QuantStudio1 시스템(thermo)을 이용하고, 95℃에서 15초 및 60℃에서 1분으로 40 사이클을 수행하여, 하기 표 1의 프라이머들 및 Qiagen에서 구매한 프라이머들과 함께 Power SYBR Green PCR Master Mix를 이용하여 증폭되었다. 증폭의 특이성을 시험하기 위해 용융 곡선을 생성하였다. 상대량(relative quantity; RQ) 수준은 GAPDH(하기 표 1)를 내부 표준 대조군으로 이용한 2-△△ Ct 방법으로 계산하였다. 결과는 독립적인 세포 배치에 대해 3회의 독립적인 실험으로 수행하였다.
생쥐 프라이머 서열 서열번호
1 GAPDH GAPDH-F CATGGCCTTCCGTGTTCCTA 1
GAPDH-R GCGGCACGTCAGATCCA 2
2 olfml3 olfml3-F CTGCTGCTCCTCTTCTTTTTG 3
olfml3-R CTACTCTGATCCTGGCATTG 4
3 trem2 trem2-F TGGGACCTCTCCACCAGTT 5
trem2-R GTGGTGTTGAGGGCTTGG 6
qPCR 결과, NECp0-MG가 성숙 미세아교세포(adult microglia)와 비슷한 수준으로 발현하는 유전자들을 확인할 수 있었다(도 6).
6. 성숙한 미세아교세포를 획득하기 위한 계대배양 수의 최적화
NEC의 계대배양 후 미세아교세포를 분리하는 것이 TMEM119의 발현량을 증가시키는 것을 상기 도 5와 같이 확인하였다. 이후 최적화된 계대배양 수를 확인하고자 상기 실시예 5와 같이 qPCR을 수행하였다. 추가로 사용된 마커에 대한 프라이머(MERTK(Qiagen, Germany, PPM34425A), C1QA(PPM24525E), GPR34(PPM04860A) 및 TGFBR1(PPH00237C))는 Qiagen에서 구매하였다.
그 결과, 대표적 성숙 미세아교세포(adult microglia)의 마커인 TMEM119는 NEC passage 4에서 분리(NECp4-MG)하였을 때, TMEM119의 발현이 가장 높았음을 확인할 수 있었고, passage 6에서 분리(NECp6-MG)하였을 때, 그 발현량이 일부 감소되는 것을 확인할 수 있었다(도 7a).
NECp0-MG, NECp4-MG를 태아 미세아교세포(fetal microglia), BV2(미세아교세포 세포주), 성숙 미세아교세포(adult microglia)와 주요 미세아교세포의 특징을 나타내는 유전자들(microglia signature gene: TMEM119, MERTK, C1QA, GPR34 및 TGFBR1)의 발현을 비교하였고, 적어도 NECp4-MG부터 주요 유전자(특히 TMEM119)들의 발현이 성숙 미세아교세포(adult microglia)에 유사함을 알 수 있었다(도 7b).
7. 순수하게 분리된 미세아교세포의 배양 기간에 따른 변화 확인
NEC로부터 분리한 미세아교세포가 배양 기간에도 그 특성을 유지하는 지 면역형광염색을 통해 확인하였다(도 8a). TMEM119 및 IBA-1을 인슐린 배양 배지(Insulin culture medium: DMEM (gibco, cat. # 11995-065), 10% heat-inactivated fetal bovine serum (gibco, cat. #16000-044), 0.1x GlutaMAX™ (gibco, cat. #35050-061), 5μg/ml Insulin solution human (sigma, cat. # 19278-5ML) 및 1%penicillin/streptomycin (Gibco, cat # 15140122))와 미세아교세포 배양 배지(Microglia (MG) culture medium: DMEM (gibco, cat. # 11995-065), 1%penicillin/streptomycin (gibco, cat # 15140122), 2ng/ml Human TGF- b2 (Peprotech, Cat. #100-35B), 100ng/ml Murine IL-34 (R&D Systems, Cat. #5195-ML/CF) 및 1.5ug/ml Ovine wool cholesterol (Avanti Polar Lipids, Cat. #700000P))에서 7일 간 배양하였다.
이후, IBA-1과 TMEM119의 발현을 실시예 1과 마찬가지로 면역형광염색을 통해 확인한 결과, 7일 간의 계속된 배양에도 불구하고 IBA-1 및 TMEM119의 발현이 잘 유지되고 있음을 확인할 수 있었다(도 8b 및 8c).
실시예 2
하기 실시예 2의 실험들의 재료 및 방법은 상기 실시예 1에서와 동일하다.
1. 마우스의 일령에 따른 신경상피세포(Neuroepithelial cell; NEC) 내 미세아교세포수의 비교
실시예 1과 동일하게 신경상피세포를 분리하되, 10.5일령 마우스의 배아, 13.5일령 마우스의 배아, 17.5일령 마우스의 배아에서 분리하였다.
그 결과, Embryo stage 13.5일에서 분리한 신경상피세포에서 미세아교세포수가 가장 높음을 면역화학염색법을 통해서 확인하였다(도 9).
기존의 미세아교세포 in vitro model과 비교하였을 때, 계대배양이 가능할 뿐만 아니라, 10배 이상의 높은 수득률을 보여주었다(하기 표 3).
Figure PCTKR2020015709-appb-T000001
2. 분리된 신경상피세포층의 21일 간의 배양에 따른 변화
13.5일령의 신경상피세포층을 분리한 후 21일 배양하였을 때 미세아교세포가 증식 (PU1 positive cell이 증가, ramified form의 IBA-1 positive cell이 증가)하고 성숙(TMEM119 발현)해지는 것을 확인하였다(도 10).
또한, 태아의 신경상피세포층을 분리한 후 21 동안 배양하였을 때 미세아교세포(CD11b)의 %가 높아짐을 flow cytometry를 통해 확인하였다. 구체적으로, 21일 동안 배양 시 약 전체 세포 중에서 70%정도의 미세아교세포(CD11b positive cell)을 얻을 수 있었으나, 같은 시기(E13.5)에서 신경상피층(neuroepithelial layer)대신에 대뇌피질(cortex)에서 분리한 경우에는 21일동안의 배양에도 28.3%의 미세아교세포만을 얻을 수 있었다(도 11).
3. 분리된 신경상피층의 계대 배양 가부 확인
마우스 13.5일의 신경상피층을 분리하여 21일 간 배양한 뒤, 계대배양이 가능함을 확인하였으며, 계대배양 시 50%이상의 미세아교세포를 얻을 수 있었다(도 12).
4. 신경상피세포의 계대배양 후 미세아교세포의 증식능력 확인
신경상피세포를 21일 동안 배양한 후 계대배양을 진행하였을 때, 미세아교세포가 증식능력이 있음을 확인하였다(Ki67 positive cell의 수 증가 및 Ki67 and IBA-1 double positive cell의 증가, 도 13).
또한, 계대배양이 이루어진 후에도 미세아교세포가 존재하는 %가 일정하게 유지되었음을 보여주었고, 이는 일 양상에 따른 방법이 계대배양(subculture)이 가능한 미세아교세포 배양기술임을 의미한다.
5. 분리된 미세아교세포의 확인 및 성숙도 확인
신경상피세포층을 21일 동안 배양 후 미세아교세포만을 MACS시스템으로 분리한 미세아교세포(NEC-MG)는 미세아교세포 마커 (IBA-1, CX3CR1, TMEM119)를 발현하는 것을 확인하였다(도 14).
또한, NEC-MG는 기존의 미세아교세포 모델인 미세아교세포주 (BV2, SIM-A9)과 일차배양 미세아교세포(미성숙한 미세아교세포 fetal microglia) 보다 더 높은 성숙한 미세아교세포 유전자의 발현 수준을 보이고 Pros1, C1qa, Gas6, Trem2, Csf1r, Tgfb1은 adult microglia와 비슷한 수준으로 발현하는 것을 확인하였다(도 15).
6. 미세아교세포의 성숙도 유지 및 식균 능력의 확인
신경상피층을 계대배양하면서 지속적인 배양을 진행하여도 적어도 180일까지 대표적인 성숙한 미세아교세포의 유전자가(P2ry12, Tmem119)가 유지됨을 확인하였다(도 16).
또한, 미세아교세포의 마커 (IBA-1, CX3CR1)들도 계대배양 후 분리한 미세아교세포에서 모두 발현하였을 뿐만 아니라 성숙한 미세아교세포에서 발현하는 TMEM119는 계대배양함에 따라 더 높은 발현양상을 나타내는 것을 확인하였고, 이 세포에서 미세아교세포의 특성인 식균작용능력도 이루어지는 것을 확인하였다(도 17).
7. 신경상피층에서 분리된 미세아교세포의 식균 능력 및 이동 능력의 확인
NEC-MG의 식균작용 능력을 확인하기 위한 형광Bead(도 18a), Amyloid-beta(도 18b), Synaptosome(도 18c)을 처치하고 식균작용을 확인하였다(도 18).
또한, NEC-MG의 이동능력도 wound healing assay를 통해 확인하였다(도 19).
8. 미세아교세포의 사이토카인 분비능 확인
NEC-MG는 100ng/ml의 LPS를 24시간 처리하였을 때 다양한 사이토카인을 분비할 수 있음을 을 확인하였다(도 20).
또한, LPS자극 후의 NEC-MG가 염증 및 항 염증 사이토카인의 mRNA 레벨이 증가시킴을 qPCR을 통해 확인하였다(도 21).
9. 신경상피층의 냉동 보관에 따른 증식 및 계대배양 가부의 확인
13.5일령에서 분리한 신경상피층를 냉동보관 후 해동하여 배양하였을 때도 증식 및 계대배양이 가능한지 확인하고자 하였다.
21일간 배양시 ramified form으로 바뀌며(도 22a), 해동 후 7일, 14일에 MACS시스템으로 분리한 미세아교세포(NEC-MG)는 TMEM119와 CX3CR1을 잘 발현하였고 미세아교세포의 식균작용도 보이는 것을 확인하였다(도 22b).
또한, 대표적인 성숙한 미세아교세포 유전인자인 P2ry12, tmem119 역시 40일간 배양 시 잘 유지됨을 확인하였다(도 23).

Claims (12)

  1. 신경상피세포 및 미세아교세포 전구체가 포함된 혼합물을 배양하는 단계; 및
    상기 혼합물로부터 미세아교세포를 분리하는 단계를 포함하는 성숙한 미세아교세포의 제조 방법.
  2. 청구항 1에 있어서, 개체의 신경상피층(neuroepithelial layer)으로부터 상기 혼합물을 분리하는 단계를 더 포함하는 성숙한 미세아교세포의 제조 방법.
  3. 청구항 2에 있어서, 상기 개체는 임신 중인 부모의 자궁으로부터 분리된 태아인, 성숙한 미세아교세포의 제조 방법.
  4. 청구항 1에 있어서, 상기 배양은 계대배양인, 성숙한 미세아교세포의 제조 방법.
  5. 청구항 4에 있어서, 상기 분리는 2 내지 6회의 계대배양 후 이루어지는 것인, 성숙한 미세아교세포의 제조 방법.
  6. 청구항 1에 있어서, 상기 미세아교세포를 분리하기 이전에 상기 혼합물을 냉동 보관하는 단계; 및
    상기 혼합물을 해동하는 단계를 더 포함하는 성숙한 미세아교세포의 제조 방법.
  7. 청구항 1에 있어서, 상기 분리는 MACS(Magnetic-activated cell sorting) 시스템 또는 FACS(Fluorescent-activated cell sorting) 시스템 및 진탕 분리법(shaking method)으로 이루어진 군에서 선택되는 적어도 하나의 방법을 이용하여 이루어지는 것인, 성숙한 미세아교세포의 제조 방법.
  8. 청구항 1에 있어서, 상기 미세아교세포는 CD11b를 발현하는 것인, 성숙한 미세아교세포의 제조 방법.
  9. 청구항 1에 있어서, 상기 미세아교세포는 IBA-1, 네스틴(Nestin), PU1, TMEM119, P2RY12, CSF1R, MAFB, TREM2, Olfml3, Hexb, TGFbeta, MERTK, C1QA, GPR34 및 TGFBR1으로 이루어진 군에서 선택되는 적어도 하나의 유전자를 발현하는 것인, 성숙한 미세아교세포의 제조 방법.
  10. 청구항 1에 있어서, 상기 미세아교세포는 식균 작용(phagocytosis)이 가능한 것인, 성숙한 미세아교세포의 제조 방법.
  11. 청구항 1에 있어서, 상기 미세아교세포는 라미파이드(Ramified) 형태인, 성숙한 미세아교세포의 제조 방법.
  12. 청구항 1 내지 11 중 어느 한 항에 따라 제조된 성숙한 미세아교세포.
PCT/KR2020/015709 2020-03-13 2020-11-10 뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법 WO2021182712A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/906,165 US20230113221A1 (en) 2020-03-13 2020-11-10 Method for producing bankable and subculturable mature microglia

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20200031304 2020-03-13
KR10-2020-0031304 2020-03-13

Publications (1)

Publication Number Publication Date
WO2021182712A1 true WO2021182712A1 (ko) 2021-09-16

Family

ID=77672403

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/015709 WO2021182712A1 (ko) 2020-03-13 2020-11-10 뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법

Country Status (3)

Country Link
US (1) US20230113221A1 (ko)
KR (1) KR102525642B1 (ko)
WO (1) WO2021182712A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101884278B1 (ko) * 2016-02-15 2018-08-01 충남대학교 산학협력단 Foxp3 및 CD200 수용체 활성화제를 포함하는 발작성 질환 예방 또는 치료용 약학적 조성물
CN109609453A (zh) * 2019-02-15 2019-04-12 中国医学科学院医学生物学研究所 树鼩小胶质细胞培养基与其体外分离培养及纯化的方法

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101883929B1 (ko) * 2017-01-11 2018-08-01 한양대학교 에리카산학협력단 Ｐｕ.１ 넉아웃 생쥐 미세아교세포주 및 이의 용도
KR101975366B1 (ko) 2017-11-10 2019-05-07 대한민국(농촌진흥청장) 세포소기관 특이적 HyPer 유전자 발현을 통한 활성산소 측정용 미세아교세포주 및 이를 이용한 활성산소 측정 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101884278B1 (ko) * 2016-02-15 2018-08-01 충남대학교 산학협력단 Foxp3 및 CD200 수용체 활성화제를 포함하는 발작성 질환 예방 또는 치료용 약학적 조성물
CN109609453A (zh) * 2019-02-15 2019-04-12 中国医学科学院医学生物学研究所 树鼩小胶质细胞培养基与其体外分离培养及纯化的方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TAMASHIRO TAMI T., DALGARD CLIFTON LEE, BYRNES KIMBERLY R.: "Primary Microglia Isolation from Mixed Glial Cell Cultures of Neonatal Rat Brain Tissue", JOURNAL OF VISUALIZED EXPERIMENTS, vol. 66, e3814, 15 August 2012 (2012-08-15), pages 1 - 5, XP055845766, DOI: 10.3791/3814 *

Also Published As

Publication number Publication date
KR102525642B1 (ko) 2023-04-26
US20230113221A1 (en) 2023-04-13
KR20210116190A (ko) 2021-09-27

Similar Documents

Publication Publication Date Title
WO2018074758A2 (ko) 면역질환 치료를 위한 고효능 줄기세포 선별방법
WO2011049414A2 (ko) 지방조직 유래 성체 줄기세포 이동을 유도하는 방법
WO2020130713A1 (ko) 인간 줄기세포 유래 폐포 대식세포를 포함하는 3차원 폐 오가노이드의 제조방법
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2015016420A1 (ko) 직접 리프로그래밍을 통한 유도 도파민성 전구세포 제조방법
WO2022169049A1 (ko) 중간엽 줄기세포 유래의 엑소좀 수득방법
WO2012008733A2 (ko) 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제
WO2017057892A1 (ko) 스페로이드형 세포집합체를 함유하는 난소기능 개선용 약학조성물 및 이의 제조방법
WO2021034164A1 (ko) 유사교세포로 분화 유도된 후기 단계의 인간 중간엽 줄기세포를 유효성분으로 함유하는 알츠하이머 치료용 약학적 조성물
EP4004191A1 (en) Precursor cells of induced pluripotent stem cell-derived mesenchymal stem cells and method for preparing the same
WO2021182712A1 (ko) 뱅킹 및 계대배양이 가능한 성숙한 미세아교세포의 제조 방법
WO2019103436A9 (ko) Nk 세포 배양용 조성물 및 이를 이용하여 nk 세포를 배양하는 방법
WO2019050350A2 (ko) 줄기세포 유래 세르톨리유사세포, 그 제조방법, 및 그의 용도
WO2011159075A2 (ko) 2차원 배양을 이용한 성체줄기세포의 신경전구세포로의 분화방법 및 신경전구세포를 이용한 신경손상 질환 치료용 약학 조성물
WO2022004938A1 (ko) 유사 중간엽 줄기세포의 제조방법
WO2022108165A1 (ko) 역분화 줄기세포 유래 중간엽 줄기세포로부터 분리된 엑소좀의 제조방법 및 이의 용도
WO2021020666A1 (en) Precursor cells of induced pluripotent stem cell-derived mesenchymal stem cells and method for preparing the same
WO2022250477A1 (ko) Hla 동형접합 유도만능줄기세포 유래 신경전구세포를 포함하는 뇌졸중 예방 및 치료용 조성물
WO2021125844A1 (ko) 인간 만능 줄기세포로부터 제작된 3d 오가노이드를 해체하여 희소돌기아교세포를 다량 확보하는 분화방법
WO2019216450A1 (ko) 항염증 성분을 분비하는 줄기세포 배양방법 및 그 줄기세포 배양액을 포함하는 항염증 조성물
WO2018030735A1 (ko) Tctp 단백질을 포함하는 난모세포 노화 방지 또는 수정능력 개선용 조성물
WO2013125899A1 (ko) 줄기세포를 유효 성분으로 함유하는 면역 질환 또는 염증 질환의 예방 또는 치료용 조성물
WO2019190175A2 (ko) 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법
WO2017039251A1 (ko) 향상된 산후 부착형 세포 및 그의 용도
WO2019212123A1 (ko) 수지상세포의 이동능을 증가시키는 방법 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20924771

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20924771

Country of ref document: EP

Kind code of ref document: A1