WO2021145675A1 - 표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법 - Google Patents

표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법 Download PDF

Info

Publication number
WO2021145675A1
WO2021145675A1 PCT/KR2021/000475 KR2021000475W WO2021145675A1 WO 2021145675 A1 WO2021145675 A1 WO 2021145675A1 KR 2021000475 W KR2021000475 W KR 2021000475W WO 2021145675 A1 WO2021145675 A1 WO 2021145675A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
prokr1
derived
cells
derived vesicle
Prior art date
Application number
PCT/KR2021/000475
Other languages
English (en)
French (fr)
Inventor
배신규
오승욱
박중훈
박태섭
Original Assignee
주식회사 엠디뮨
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020200149241A external-priority patent/KR20210091650A/ko
Application filed by 주식회사 엠디뮨, 서울대학교 산학협력단 filed Critical 주식회사 엠디뮨
Priority to US17/758,825 priority Critical patent/US20230257434A1/en
Publication of WO2021145675A1 publication Critical patent/WO2021145675A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4722—G-proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • the present invention relates to a cell-derived vesicle comprising a target protein, PROKR1, and a therapeutic agent for a muscle disease comprising the same.
  • Microvesicles are a type of organelle with a size of generally 0.03 to 1 ⁇ m, which is naturally liberated from the cell membrane in almost all types of cells, and has a double phospholipid membrane, which is the structure of the cell membrane. characterized in that Such a vesicle is a basic cell tool for metabolism, transport of metabolites, enzyme storage, chemical reactions, etc. It is known that it plays a mediating role of intercellular signaling by transferring mRNA, miRNA, and protein between cells. there is.
  • prokineticin is a secreted, multifunctional chemokine-like peptide.
  • Prokineticin performs biological functions by interacting with two G-protein coupled receptors (GPCRs) called prokineticin receptor 1 (PROKR1) and prokineticin receptor 2 (PROKR2). .
  • GPCRs G-protein coupled receptors
  • PROKR1 and PROKR2 share an overall amino acid sequence homology of about 87%.
  • PK1 and PK2 interact with PROKR1 and PROKR2, respectively.
  • activation of prokineticin receptors leads to stimulation of calcium mobilization, phosphoinositide turnover, and activation of the MAP kinase signaling pathway.
  • prokineticin exhibits angiogenic activity and induces cell proliferation and migration.
  • Prokineticins and their receptors have been implicated in the development of several human cancers and have also been shown to be involved in the nociception and transmission of pain.
  • the prokineticin signaling system represents a potential target for the treatment and/or prevention of a variety of diseases and disorders.
  • the present inventors prepared cells overexpressing PROKR1 while searching for and researching substances effective for treating muscle disease, and cell derived vesicles prepared from cells overexpressing PROKR1 contain PROKR1 at a high level. , confirmed that it is effective in treating muscle diseases, thereby completing the present invention.
  • Another object of the present invention is to treat a cell-derived vesicle overexpressing PROKR1 to an individual in need thereof; It is to provide a method for preventing or treating myopathy comprising a.
  • the present invention provides a cell-derived vesicle comprising PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • the present invention provides a reagent composition for intracellular delivery of PROKR1 protein or a gene encoding the same, comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • the present invention provides a reagent composition for promoting muscle differentiation, comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • the present invention provides a pharmaceutical composition for preventing or treating muscle disease, comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • PROKR1 Prokineticin receptor 1
  • the present invention provides a health functional food composition for preventing or improving muscle disease comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • PROKR1 Prokineticin receptor 1
  • the present invention provides the steps of treating a cell-derived vesicle overexpressing PROKR1 to an individual in need thereof; It provides a method for preventing or treating myopathy comprising a.
  • the cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) according to the present invention is treated to myoblasts or myotube cells, it promotes myodifferentiation and induces differentiation into myotube cells, thereby preventing or treating muscle diseases. Because it can be used for various purposes, it can be widely used in the pharmaceutical industry and health functional food field.
  • 1 is a diagram showing cDNA sequence information of the human PROKR1 gene.
  • FIG. 2 is a diagram schematically showing a PROKR1 overexpression vector.
  • FIG. 3 is a diagram showing the results of PROKR1/PROKR1 gene editing.
  • FIG. 4 is a diagram showing gene expression in cells lacking the PROKR1/PROKR1 gene (***p ⁇ 0.001 vs. WT, Dunnett's multiple comparison test).
  • FIG. 5 is a diagram schematically showing the manufacturing process of a cell-derived vesicle using the micro-extrusion method and concentration gradient ultra-high speed centrifugation.
  • FIG. 7 is a diagram showing the results of particle size analysis of cell-derived vesicles.
  • FIG. 10 is a diagram illustrating detection of a green fluorescence signal of GFP protein from a cell-derived vesicle smear sample in order to confirm GFP expression in cell-derived vesicles of GFP-overexpressing HEK293T cells.
  • FIG. 11 is a diagram illustrating the expression of GFP mRNA in HEK293T cells, GFP-overexpressing HEK293T cells, cell-derived vesicles of HEK293T cells, and cell-derived vesicles of GFP-overexpressing HEK293T cells through RT-PCR.
  • FIG. 13 is a diagram illustrating the presence or absence of GFP mRNA by treating HEK293T cells with cell-derived vesicles of GFP-overexpressing HEK293T cells.
  • 14A is a diagram showing the change in cell proliferation capacity for C2C12 cells according to the treatment concentration of vesicles derived from PROKR1 overexpressing cells in treatment group 1 (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 vs. 0 ⁇ g/mL, Dunnett's multiple comparison test).
  • 14B is a diagram showing the change in cell proliferation capacity for C2C12 cells according to the treatment concentration of vesicles derived from PROKR1 overexpressing cells in treatment group 2 (*p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 vs. 0 ⁇ g/mL, Dunnett's multiple comparison test).
  • FIG. 15 is a diagram showing the size distribution of vesicles derived from PROKR1- overexpressing cells or vesicles derived from PROKR1-deficient cells.
  • 16 is a diagram illustrating the analysis of the expression of a marker protein in a protein extracted from a PROKR1 overexpressing cell and a PROKR1 deficient cell and a cell-derived vesicle thereof.
  • 17 is a diagram confirming the PROKR1 protein transport ability of a vesicle derived from a PROKR1 overexpressing cell.
  • FIG. 18 is a microscopic view of the effect of PROKR1 overexpressing cell-derived vesicles on myoblast differentiation and apoptosis when treated with myoblasts.
  • 19A is a diagram confirming the effect of PROKR1 overexpressing cell-derived vesicles on apoptosis after myoblast differentiation by flow cytometry.
  • 19B is a diagram showing a graph prepared based on the flow cytometry results (* p ⁇ 0.05).
  • FIG. 20 is a diagram confirming the effect of a vesicle derived from a PROKR1 overexpressing cell on the differentiation of myoblasts into myotube cells through phalloidin staining.
  • FIG. 21 is a diagram illustrating the expression of a muscle development marker gene to confirm the effect of a vesicle derived from a PROKR1 overexpressing cell on the muscle development ability ( a p ⁇ 0.05, b p ⁇ 0.001 vs. WT C2C12 at differentiation day 0 ( WT Day 0), c p ⁇ 0.01, d p ⁇ 0.001 vs. WT Day 6, e p ⁇ 0.01, f p ⁇ 0.001 vs. C2C12 Prokr1-/- at differentiation day 0 (KO Day 0), Dunnett's multiple comparison test ).
  • 22A is a diagram showing the effect of vesicles derived from PROKR1 overexpressing cells on the insulin-stimulated glucose uptake capacity of wild-type C2C12 cells without gene deletion ( g p ⁇ 0.001 vs. untreated WT C2C12, h p ⁇ 0.05 vs. untreated) C2C12 Prokr1-/- , i p ⁇ 0.05 vs. insulin (INS)-treated C2C12 Prokr1-/- , j p ⁇ 0.05 vs. INS + PROKR1 Tg CDVs-treated C2C12 Prokr1-/- , Dunnett's multiple comparison test).
  • INS insulin
  • 22B is a diagram showing the effect of vesicles derived from PROKR1- overexpressing cells on the glucose uptake capacity of PROKR1- deficient C2C12 cells by insulin stimulation ( g p ⁇ 0.001 vs. untreated WT C2C12, h p ⁇ 0.05 vs. untreated C2C12 Prokr1-/ - , i p ⁇ 0.05 vs. insulin (INS)-treated C2C12 Prokr1-/- , j p ⁇ 0.05 vs. INS + PROKR1 Tg CDVs-treated C2C12 Prokr1-/- , Dunnett's multiple comparison test).
  • insulin stimulation g p ⁇ 0.001 vs. untreated WT C2C12, h p ⁇ 0.05 vs. untreated C2C12 Prokr1-/ - , i p ⁇ 0.05 vs. insulin (INS)-treated C2C12 Pro
  • the present invention provides a cell-derived vesicle comprising PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • the term 'cell-derived vesicle' refers to a vesicle generated from a cell, and is generally a type of cell organelle, which is naturally released from the cell membrane in almost all types of cells, and is a double phospholipid membrane that is a structure of the cell membrane. It means that it has a form.
  • the cell-derived vesicle of the present invention may have a micrometer size, for example, 0.03 to 1 ⁇ m.
  • the vesicle of the present invention is separated from the inside and outside by a lipid bilayer composed of the cell membrane component of the derived cell, has cell membrane lipid, cell membrane protein, nucleic acid, and cell component, and is smaller in size than the original cell. mean, but not limited thereto.
  • the cell-derived vesicle of the present invention may be a cell-derived vesicle from which a vesicle can be prepared, and preferably, a cell-derived cell-derived vesicle prepared from 'PROKR1 (Prokineticin receptor 1) protein or a cell containing a gene encoding the same'. It may be a vesicle.
  • 'PROKR1 Prokineticin receptor 1
  • the 'PROKR1 (Prokineticin receptor 1) cells containing a gene protein or encoding it, may be used without If cells producing PROKR1 protein by expressing a PROKR1 gene limited, and preferably includes a PROKR1 gene It may be a cell transformed to express the PROKR1 protein by transducing the vector into the cell.
  • the process for producing 'PROKR1 or a cell-derived vesicle comprising a gene encoding the same' comprises the steps of introducing a gene encoding the PROKR1 protein to prepare transformed cells; and preparing a cell-derived vesicle from the transformed cell.
  • the 'step of preparing a transformed cell by introducing the gene encoding the PROKR1 protein' is a method known in the art as long as the vector containing the gene encoding the PROKR1 protein is transduced into the cell.
  • 'transduction' means that the PROKR1 gene is introduced into the host so that the PROKR1 gene becomes replicable as an extrachromosomal factor or by chromosomal integration completion.
  • Transduction includes any method of introducing a nucleic acid molecule into an organism, cell, tissue or organ, and as known in the art, can be performed by selecting a suitable standard technique according to the host cell.
  • These methods include electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE (diethylaminoethyl)-dextran method, cationic liposome method. , and lithium acetate-DMSO method, and the like, and may preferably be a transduction method using lipofectamine, but is not limited thereto.
  • the 'step of preparing a cell-derived vesicle from the transformed cell' is extruding the suspension containing the transformed cell, sonication, cell lysis, homogenization, freeze-thaw, electroporation, chemical treatment , but is not limited thereto.
  • the 'preparing a cell-derived vesicle from the transformed cell' comprises: 1) micro-extruding the transformed cell; and 2) filtering.
  • the extrusion force during micro-extrusion may be 5 to 200 psi, 10 to 150 psi, or 50 to 100 psi.
  • the filter used in the micro-extrusion may be a filter of 0.01 um to 20 um, preferably 0.2 um to 10 um, and sequentially use 1 to 10 filters that gradually decrease in size for micro-extrusion. It may be a step to
  • the '2) filtering step' may be a step of filtering the micro-extruded extrudate through a filter of 0.1 to 0.5 um.
  • the 'step of preparing a cell-derived vesicle from the transformed cell' may preferably further include '3) concentration gradient ultra-high speed centrifugation,' and '3) concentration gradient ultra high speed centrifugation.
  • ' may be 50,000G to 150,000G, 2 to 6°C, and to be performed for 1 to 3 hours. If it is prepared by further including the step of ultra-high speed centrifugation of the concentration gradient, a cell-derived vesicle having a more uniform size is formed, thereby increasing the purity.
  • PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding it'
  • PROKR1 or a gene encoding it is transported to the cell, and in the treated cell It may be to express PROKR1 at a high level.
  • the PROKR1 protein may be maintained for 30 minutes to 24 hours after the cell-derived vesicle is treated with the cell, and the gene encoding the PROKR1 is maintained for 1 hour to 48 hours after the vesicle is treated with the cell may be, but is not limited thereto.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding the same' may have a muscle-generating ability, may have a muscle differentiation promoting ability, and PROKR1 is defective.
  • expression of late myogenic markers Mb, Myh7 or Myog and early myogenic markers Pax3, Pax7 or Myod may be expressed at the level of cells in which PROKR1 is not deficient.
  • the myoblast differentiation promotion may be to promote differentiation from myoblasts to myotubes or myocytes.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding it' inhibits apoptosis after myoblasts are differentiated into myotube cells or myocytes.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding it' prevents muscle disease based on the myogenic ability, myocyte differentiation promoting ability and post-differentiation apoptosis inhibitory ability. , can be used to improve or treat.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding the same' may promote glucose uptake of myotube cells by insulin stimulation, and by this mechanism, insulin It may improve resistance and may have a preventive or therapeutic effect on diabetes, and may preferably promote differentiation into myotube cells exhibiting glucose uptake ability by insulin stimulation in cells that have lost myogenic differentiation ability, and based on these effects, It may be possible to prevent or treat diabetes.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding the same' may have an inner diameter of 161.7 ⁇ 12.3 nm (mean ⁇ standard deviation).
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding the same' may include a labeling protein of a derived cell, preferably the labeling protein is CD9 or It may be CD81.
  • the marker protein, preferably CD9 or CD81 may be included in a higher ratio in the cell-derived vesicle than in the derived cell, and may preferably contain three times or more compared to the derived cell.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding the same' may be one in which genes or RNAs of various sizes are conserved in complete form.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding it' is a cell-derived vesicle rather than a 'cell-derived vesicle manufactured using a cell in which the PROKR1 gene is deleted'.
  • production rate, the amount of protein and/or RNA in the cell-derived vesicle may be high.
  • the 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding it' may be one that is not toxic to cells, and preferably has a concentration of 0.0001 to 100 ug/mL.
  • it When treated with, it may be non-toxic, and more preferably, when treated at a concentration of 0.0001 to 80 ug/mL, it may be non-toxic, and more preferably from 0.0001 to 50 ug/mL It may not be toxic when treated at a concentration of
  • the present invention provides a reagent composition for intracellular delivery of PROKR1 protein or a gene encoding the same, comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • the present invention provides a reagent composition for promoting muscle differentiation, including a cell-derived vesicle, containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • PROKR1 Prokineticin receptor 1
  • the reagent composition may include 'PROKR1 (Prokineticin receptor 1) or a cell-derived vesicle comprising a gene encoding the same' at a concentration of 0.0001 to 100 ug/mL, preferably It may be included in a concentration of 0.0001 to 80 ug/mL, more preferably, it may be included in a concentration of 0.0001 to 50 ug/mL.
  • 'PROKR1 Prokineticin receptor 1
  • a cell-derived vesicle comprising a gene encoding the same' at a concentration of 0.0001 to 100 ug/mL, preferably It may be included in a concentration of 0.0001 to 80 ug/mL, more preferably, it may be included in a concentration of 0.0001 to 50 ug/mL.
  • the reagent composition of the present invention contains the cell-derived vesicle at a concentration of more than 100 ug/mL, it may be toxic to cells.
  • the present invention provides a pharmaceutical composition for preventing or treating muscle disease, comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • PROKR1 Prokineticin receptor 1
  • the pharmaceutical composition of the present invention may promote glucose uptake by myotube cells by insulin stimulation, thereby improving insulin resistance and preventing or treating diabetes. Therefore, it may be one capable of simultaneously preventing or treating diabetes and muscle disease.
  • the present invention comprises the steps of treating a cell-derived vesicle overexpressing PROKR1 to an individual in need thereof; It provides a method for preventing or treating myopathy comprising a.
  • the present invention provides the use of a cell-derived vesicle overexpressing PROKR1 for the prevention or treatment of myopathy, and the use for preparing a pharmaceutical composition for preventing or treating myopathy.
  • the muscle disease is MELAS (mitochodrial myophthy, encephalopathy, lactic acsidosis, and stroke-like episodes) syndrome, MERRF (Myoclonic Epilepsy with Ragged Red Fiber) syndrome, Kearns-Sayre syndrome, myopathy, encephalomyopathy, myasthenia , myasthenia gravis, amyotrophic lateral sclerosis, muscular dystrophy, muscular atrophy, hypotonia, muscle weakness and muscle stiffness may be at least one selected from the group consisting of.
  • the cell-derived vesicle may be included in any amount (effective amount) depending on the formulation and purpose of formulation, as long as it can exhibit a preventive or therapeutic effect on muscle disease, where the 'effective amount' refers to a mammal to which it is applied.
  • 1X10 5 to 1X10 13 may comprise a concentration of particles / ml, more preferably from 5X10 7 to 1X10 13 particles / ml concentration of It may be included as, may be to more preferably to 5X10 8 to 1X10 13 particles / ml can be to include a concentration of, and, even more preferably at a concentration of 1X10 9 to 1X10 13 particles / ml.
  • the pharmaceutical composition for the prevention or treatment of muscle disease of the present invention in addition to the active ingredient, is any compound or natural compound whose safety has already been verified and is known to have an effect on the prevention or treatment of muscle disease for the purpose of increasing/reinforcing the effect of preventing or treating muscle disease. It may further include an extract.
  • the pharmaceutical composition of the present invention can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories and sterile injection solutions according to conventional methods, respectively. there is.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the pharmaceutical composition of the present invention, for example, starch, calcium carbonate, sucrose or It is prepared by mixing lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • the dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, and weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. Dosage determination based on these factors is within the level of the skilled artisan, and dosages generally range from 0.01 mg/kg/day to approximately 2000 mg/kg/day. A more preferred dosage is 1 mg/kg/day to 500 mg/kg/day. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition of the present invention may be administered to mammals such as mice, livestock, and humans by various routes. Any mode of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection. Since the compound of the present invention has almost no toxicity and side effects, it is a drug that can be safely used even when taken for a long period for the purpose of prevention.
  • the present invention provides a health functional food composition for preventing or improving muscle disease comprising a cell-derived vesicle containing PROKR1 (Prokineticin receptor 1) or a gene encoding the same.
  • PROKR1 Prokineticin receptor 1
  • the health functional food composition of the present invention may promote glucose absorption by myotube cells by insulin stimulation, thereby improving insulin resistance and preventing or improving diabetes. Therefore, it may be one capable of simultaneously preventing or improving diabetes and muscle disease.
  • the health functional food of the present invention includes ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients and seasonings.
  • a flavoring agent or natural carbohydrate may be included as an additional ingredient in addition to the cell-derived vesicle as an active ingredient.
  • natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.), oligosaccharides, polysaccharides (eg, dextrin, cyclodextrin, etc.), and sugar alcohols (eg, xylitol, sorbitol, erythritol, etc.).
  • natural flavoring agents eg, taumarin, stevia extract, etc.
  • synthetic flavoring agents eg, saccharin, aspartame, etc.
  • the health functional food of the present invention includes the form of tablets, capsules, pills or liquids, and the food to which the cell-derived vesicle of the present invention can be added includes, for example, various drinks, meat, sausage, and bread. , candy, snacks, noodles, ice cream, dairy products, soups, ionic drinks, beverages, alcoholic beverages, gum, tea and vitamin complexes.
  • the health functional food for preventing or improving muscle disease of the present invention has the same active ingredient and effect of the pharmaceutical composition for preventing or treating muscle disease, the content common between the two is to avoid excessive complexity of the present specification, omit the description.
  • the cDNA (1,182 bp) of the human PROKR1 gene was synthesized based on the nucleotide sequence information (NM_138964) confirmed by the US National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov) (Bionics, Seoul, Korea). ).
  • the synthesized PROKR1 gene was inserted into the piggyBac transposon transgene expression system vector (System Biosciences, Palo Alto, CA) to construct a PROKR1 overexpression vector.
  • the PROKR1 gene was inserted into the overexpression vector through Not I restriction enzyme treatment and cloning, and the production of the PROKR1 gene overexpression vector was checked through nucleotide sequence analysis and gene cloning.
  • the cDNA sequence information of the human PROKR1 gene SEQ ID NO: 1
  • its amino acid sequence information SEQ ID NO: 2
  • the human PROKR1 overexpression vector was transferred to human embryonic kidney cell line 293T (HEK293T) cells, and cells that stably expressed were selected.
  • HEK293T cells were prepared by adding 10% (v/v) fetal bovine serum (Gibco BRL, USA) and 1% (v/v) antibiotics (Invitrogen, USA) to Dulbecco's Modified Eagle Medium (DMEM) basal medium at 37°C, 5 % CO 2 Incubated in an incubator. After HEK293T cells were proliferated to 70-80% of the area, the PROKR1 overexpression vector and piggyBac transposase expression vector prepared in Example 1 were transferred together using Lipofectamine 3000 (Invitrogen).
  • DMEM Dulbecco's Modified Eagle Medium
  • the proliferated HEK293T cells were washed with a phosphate buffer and then exchanged with a medium not added with antibiotics.
  • the overexpression vector transfer solution was prepared by mixing 7.5 ⁇ L Lipofectamine 3000 and 2.5 ⁇ g overexpression vector in 250 ⁇ L Opti-MEM (Invitrogen).
  • PiggyBac transposase transfer solution was prepared by mixing 10 ⁇ L Lipofectamine 3000 and 2.5 ⁇ g piggyBac transposase expression vector in 250 ⁇ L Opti-MEM (Invitrogen). The prepared transition solution was left at room temperature for 5 minutes after mixing.
  • the PROKR1 gene-deficient cell line was constructed using the third-generation gene editing technique (CRISPR/Cas9). After constructing a guide RNA expression vector targeting exon 1 of the PROKR1 gene and a vector expressing Cas9 and green fluorescence protein (GFP) at the same time (Sigma, USA), 2.5 ⁇ g each was lipofected in the same amount. It was transferred to C2C12 or HEK293T cells using tamine.
  • CRISPR/Cas9 the third-generation gene editing technique
  • GFP green fluorescence protein
  • metastasized cells were resuspended in phosphate buffer containing 1% (w/v) bovine serum albumin the next day, filtered using a 40 um cell strainer (Becton, Dickinson and Company, USA), and then subjected to a fluorescence-activated cell sorter ( Becton, Dickinson and Company) was used to select only GFP-positive cells.
  • Example 2 exhibited a PROKR1 gene over-expressing cell as in one PROKR1 expression of a gene defect of a gene PROKR1 cell produced in Example 3 produced in the FIG.
  • Cell-derived vesicles using cells overexpressing PROKR1 or GFP were prepared using microextrusion. Cells proliferated to about 10 million cells were resuspended in 1 mL of phosphate buffer and extruded 7 times each in a micro-extruder equipped with 10 um, 5 um, and 1 um filters, and the cell extrudate was passed through a 0.2 um filter. Final filtration. The cell filtrate was centrifuged by ultra-high speed gradient centrifugation using 10% and 50% (v/v) gradient solutions prepared with OptiPrep medium (Sigma).
  • the 10% (v/v) OptiPrep layer was recovered, diluted with phosphate buffer, and ultrafast centrifuged at 4°C at a speed of 100,000 g for 2 hours to recover the precipitated cell-derived vesicles.
  • the recovered cell-derived vesicles were resuspended in phosphate buffer and stored at -80°C until the experiment.
  • the manufacturing process of the cell-derived vesicle using the microextrusion method and concentration gradient ultrafast centrifugation as described above is schematically shown in FIG. 5 .
  • Example 5 Purity and size analysis of cell-derived vesicles
  • the inner diameters of cell-derived vesicles prepared from HEK293T and GFP-overexpressing HEK293T cells were measured to be 168 ⁇ 10.2 nm and 173 ⁇ 12.0 nm (mean ⁇ standard deviation), respectively. This is a size similar to the inner diameter of the exosomes released from the cells, and it was confirmed that the cell-derived vesicles produced through micro-extrusion and concentration gradient ultrafast centrifugation were similar in size to the exosomes naturally released from the cells.
  • the expression of the marker protein in exosomes was analyzed from the cells used for the preparation of the cell-derived vesicle and the protein extracted from the cell-derived vesicle.
  • a Western blot method was applied to the analysis of the labeled protein, and an anti-beta-actin antibody was used as a control to confirm that human anti-CD9 antibody, anti-CD81 antibody, and the same amount of protein solution were analyzed. shown in
  • CD9 and CD81 were observed in HEK293T cells and GFP-overexpressing cells.
  • expression of CD9 and CD81 was also confirmed in cell-derived vesicles prepared from each cell, and in the case of CD9, higher protein expression was confirmed in cell-derived vesicles compared to cells.
  • cell-derived vesicles prepared from 10 million GFP-overexpressing HEK293T cells was 101.2 ug
  • cells prepared from 10 million untransformed HEK293T cells It was confirmed that the amount of derived vesicles was 67.5 ug.
  • cell-derived vesicles derived from GFP-overexpressing HEK293T cells contained 104.9 ug of protein
  • the total RNA amount also contained 13.1 ⁇ g of RNA in cell-derived vesicles derived from GFP-overexpressing cells, and 5.5 ⁇ g of total RNA in cell-derived vesicles derived from non-transformed cells.
  • RNAs of various sizes are conserved in complete form in the prepared cell-derived vesicles.
  • a green fluorescence signal expressed in individual cell-derived vesicles was confirmed. From this, it was confirmed that the target protein, GFP, was contained in a high concentration in the cell-derived vesicle prepared from the GFP-overexpressing cell.
  • GFP mRNA was confirmed from the mRNA recovered from the cell used for preparing the cell-derived vesicle and the cell-derived vesicle, and the results of GFP mRNA expression are shown in FIG. 11 .
  • GFP mRNA was expressed only in cell-derived vesicles derived from GFP-overexpressing HEK293T cells and GFP-overexpressing HEK293T cells.
  • Cell-derived vesicles derived from GFP-overexpressing HEK293T cells prepared in the same manner as in Example 4 were treated to untransformed HEK293T cells, and then the intercellular movement of GFP protein by the cell-derived vesicles was traced, and the tracking result is shown in FIG. 12 .
  • cell-derived vesicles started uptake into HEK293T cells within 30 minutes after treatment, and it was confirmed that GFP was expressed up to 24 hours after treatment. Through these results, it was confirmed that the cell-derived vesicle is smoothly transported to the target cell, and the target protein concentrated in the cell-derived vesicle is also transported to the target cell, and its function is maintained for 24 hours or more.
  • the cell-derived vesicles derived from GFP-overexpressing HEK293T cells prepared in the same manner as in Example 4 were treated to HEK293T cells, and mRNA was recovered from the HEK293T cells for each time period after treatment, and then the residual GFP mRNA was performed by RT-PCR. was confirmed, and the results are shown in FIG. 13 .
  • GFP mRNA was observed from 1 hour after treatment with vesicles derived from GFP-overexpressing HEK293T cells, and it was confirmed that GFP mRNA was maintained until 48 hours. Therefore, it was confirmed that cell-derived vesicles prepared from GFP-overexpressing HEK293T cells contained GFP mRNA in addition to GFP protein, and the contained GFP protein and mRNA were absorbed into target cells and maintained for up to 48 hours or longer.
  • Example 8 Determination of treatment concentration of cell-derived vesicles for cell treatment
  • PROKR1 overexpressing cells was subjected to capacity test by determining the target the target cells of the PROKR1 the rodent-derived muscle cells (myoblast) C2C12 defect to determine the appropriate concentration within the cells of vesicles derived.
  • PROKR1 overexpressing cell-derived vesicles were treated with 0, 10, 25, 50, 100 and 200 ug/mL for 48 hours, treatment group 1 replaced the cell-derived vesicle medium every 24 hours, and treatment group 2 had 48 The same cell-derived vesicle medium was treated in succession time.
  • the results of confirming changes in cell proliferation capacity for C2C12 cells according to the concentration of vesicles derived from PROKR1 overexpressing cells in treatment groups 1 and 2 are shown in FIGS. 14A and 14B, respectively.
  • the cell-derived vesicle dose of 50 ug/mL was non-toxic to the cells under the condition that the entire amount of the cell-derived vesicle medium was replaced at 24 hour intervals.
  • Example 9 PROKR1 Size analysis of vesicles derived from overexpressing cells
  • the size distribution of vesicles derived from PROKR1- overexpressing cells or vesicles derived from PROKR1- deficient cells prepared in the same manner as in Example 4 was measured by dynamic light scattering analysis using Zetasizer (Malvern), and the results are shown in FIG. 15 . .
  • the inner diameters of vesicles derived from PROKR1- overexpressing cells or vesicles derived from PROKR1- deficient cells were measured to be 161.7 ⁇ 12.3 nm and 150.2 ⁇ 3.6 nm (mean ⁇ standard deviation), respectively. Accordingly, it was confirmed that the vesicles derived from the PROKR1-overexpressing cells were larger on average than the vesicles derived from the PROKR1-deficient cells.
  • Example 10 PROKR1 Analysis of labeling and content of vesicles derived from overexpressed cells
  • Proteins were extracted from the PROKR1 overexpressing cells and PROKR1 deficient cells used for the cell-derived vesicle production and the cell-derived vesicles, and the expression of the marker protein was analyzed.
  • Western blot method was applied.
  • mouse monoclonal anti- ⁇ -actin antibody (1:1000, Santa Cruz)
  • rabbit monoclonal anti-CD9 antibody (1:2000)
  • rabbit monoclonal anti-CD81 antibody (1:1000, Abcam
  • rabbit monoclonal anti - PKR1 antibody (1:1000, Biorbyt
  • PROKR1 PROKR1 overexpressing cells overexpressing cells was observed in the expression of PROKR1 derived vesicles, PROKR1 deficient cells and PROKR1 deficient cells, the expression of PROKR1 was not observed in the resulting vesicles.
  • CD9 and CD81 3.7-fold and 5.6-fold higher expression was observed in vesicles derived from PROKR1- overexpressing cells than in PROKR1- overexpressing cells, respectively, and 12-fold and 6.3-fold higher in vesicles derived from PROKR1- deficient cells than in PROKR1-deficient cells, respectively. High expression was observed.
  • PROKR1 Quantitative analysis of protein and RNA contained in vesicles derived from overexpressing cells
  • the amount of cell-derived vesicle, the amount of protein contained in the cell-derived vesicle, and the amount of RNA were quantitatively analyzed. .
  • the amount of the prepared cell-derived vesicles was quantified using the Breadford method, and the amount of protein contained in the cell-derived vesicles was quantified by the Bicinchoninic acid method.
  • total RNA was recovered using a Trizol solution, and then qualitative and quantitative analysis was performed with a bioanalyzer, and the analysis results are shown in Table 2.
  • RNA amount was also confirmed that the vesicles derived from the PROKR1- overexpressing cells contained 13.7 ug of RNA, and the vesicles derived from the PROKR1- deficient cells contained 10.9 ug of total RNA.
  • Example 11 PROKR1 Confirmation of intracellular transport of PROKR1 protein using overexpressing cell-derived vesicles
  • Example 12 PROKR1 Effect of overexpressing cell-derived vesicles on the differentiation of myoblasts
  • the PROKR1- deficient C2C12 cell line treated with the PROKR1-deficient cell-derived vesicle showed a similar level of floating cells to the PROKR1- deficient C2C12 cell line after induction of muscle differentiation.
  • the treatment of vesicles derived from PROKR1 overexpressing cells prevented apoptosis of the C2C12 cell line lacking PROKR1 after induction of muscle differentiation.
  • Example 13 Effects on apoptosis after differentiation of myoblasts
  • PROKR1 Effect of overexpressing cell-derived vesicles
  • C2C12 cells which are myoblasts
  • C2C12 cells deficient in PROKR1 were treated with vesicles derived from PROKR1 overexpressing cells at a concentration of 25 ⁇ g/mL, and cultured for 3 days to induce differentiation of C2C12 cells into myotubes. Thereafter, cells were double-stained with Annexin V and propidium iodide, and the stained cells were subjected to flow cytometry analysis (Becton, Dickinson and Company), followed by counting Annexin V and propidium iodide-positive cells to kill C2C12 cells in which differentiation was initiated. was measured.
  • Annexin V positive cells were judged as early apoptotic cells, and Annexin V and propidium iodide co-positive cells were judged as late apoptotic cells.
  • a group treated with DPBS (dulbecco's phosphate buffered saliine) instead of cell-derived vesicles was used, and flow cytometry was performed through an independent triplicate experiment. The flow cytometry results are shown in FIG. 19A, and the cell death rate relative to the total number of cells is shown in FIG. 19B.
  • Example 14 Effects on the differentiation of myoblasts into myotube cells
  • PROKR1 Effect of overexpressing cell-derived vesicles
  • phalloidin-stained myotube cells were significantly observed compared to cells treated with vesicles derived from DPBS or PROKR1-deficient cells. From these results , it was confirmed that the vesicle derived from the PROKR1 overexpressing cell has the effect of promoting the differentiation of myoblasts into myotubular cells.
  • Example 15 PROKR1 Effects of overexpressed cell-derived vesicles on myogenic capacity
  • cell RNA was extracted using RNeasy mini kit (Qiagen), and 5 ⁇ g of the extracted RNA was converted into cDNA using Super Script III reverse transcriptase (Invitrogen).
  • Super Script III reverse transcriptase Invitrogen
  • real-time PCR systems Applied Biosystems
  • the RT-PCR results are shown in FIG. 21 .
  • the mRNA expression levels of late myogenic markers Mb, Myh7 and Myog correspond to the C2C12 cell line without any manipulation. It was observed at a level similar to the gene expression level.
  • Example 16 Glucose uptake capacity of myotube cells by insulin stimulation PROKR1 Effect of overexpressing cell-derived vesicles
  • PROKR1 overexpressing cells insulin stimulation in PROKR1 defect C2C12 cells treated with-derived vesicles, PROKR1 defect C2C12 cell line and PROKR1 deficient cells derived PROKR1 defect by the vesicle treatment C2C12 cell line compared to, 2-NBDG It was confirmed that the absorption was significantly increased more than 1.5 times.
  • the above ingredients were mixed and filled in an airtight cloth to prepare a powder.
  • tablets were prepared by tableting according to a conventional method for manufacturing tablets.
  • the capsules were prepared by filling in gelatin capsules according to a conventional manufacturing method of capsules.
  • Octacosanol powder 15% by weight, lactose hydrolyzate powder 15% by weight, soy protein isolate 15% by weight, chitooligosaccharide 15% by weight yeast extract powder 10% by weight, vitamin and mineral mixture 10% by weight, magnesium stearate 4.6% by weight, titanium dioxide 0.2% by weight, and 0.2% by weight of glycerin fatty acid ester, and 20% by weight of the cell-derived vesicle of the present invention are mixed to prepare a tablet-type health functional food in a conventional manner.
  • a health drink is prepared by a conventional method by mixing 5% by weight of honey, 3% by weight of fructose, 0.0001% by weight of sodium riboflavin hydrochloride, 0.0001% by weight of pyridoxine hydrochloride, 86.9998% by weight of water and 5% by weight of the cell-derived vesicle of the present invention. .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)

Abstract

본 발명은 표적 단백질인 PROKR1을 포함하는 세포 유래 베시클 및 이를 포함하는 근 질환 치료제에 관한 것이다. 본 발명에 따른 PROKR1 (Prokineticin receptor 1)을 포함하는 세포 유래 베시클은 근모세포에 처리되었을 때, 근분화를 촉진하고, 근관세포로의 분화를 유도하여, 근 질환을 예방 또는 치료하는 용도로 사용할 수 있어, 의약업계 및 건강기능식품 분야에서 널리 사용될 수 있다.

Description

표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법
본 발명은 표적 단백질인 PROKR1을 포함하는 세포 유래 베시클 및 이를 포함하는 근 질환 치료제에 관한 것이다.
마이크로베시클(microvesicles)은 일반적으로 0.03~1㎛의 크기를 가지는 세포 소기관의 일종으로, 거의 모든 종류의 세포에서 세포막으로부터 자연적으로 유리되어, 세포막의 구조인 이중 인지질(phospholipid) 막 형태를 가지고 있는 것을 특징으로 한다. 이와 같은 베시클은 물질 대사, 대사물질의 운송, 효소 저장, 화학 반응 등을 위한 세포의 기본 도구로서, 세포 간에 mRNA, miRNA 및 단백질 등을 전달함으로써 세포 간 신호전달의 매개 역할을 수행하는 것으로 알려져 있다.
반면, 프로키네티신은 분비성의 다기능 케모카인 유사 펩티드이다. 프로키네티신은 프로키네티신 수용체 1(PROKR1) 및 프로키네티신 수용체 2(PROKR2)로 불리는 2가지 G-단백 결합 수용체(GPCR: G-protein coupled receptor)와 상호 작용하여 생물학적 기능을 수행한다. PROKR1과 PROKR2는 약 87%의 전반적인 아미노산 서열 상동성을 공유한다. PK1 및 PK2는 각각 PROKR1 및 PROKR2와 서로 작용한다. 세포 수준에서, 프로키네티신 수용체의 활성화는 칼슘 동원(calcium mobilization), 포스포이노시타이드 교체(phosphoinositide turnover)의 자극 및 MAP 키나아제 신호전달 경로의 활성화로 이어진다. 다세포 수준에서, 프로키네티신은 혈관형성 활동을 보이며 세포 증식 및 이동을 유도한다. 프로키네티신 및 이들의 수용체는 몇 가지 사람의 암 발병과 관련이 있으며 통증의 통각 및 전달에도 관여하는 것으로 나타났다. 프로키네티신 신호전달 체계는 다양한 질병 및 질환의 치료 및/또는 예방에 대한 잠재적 표적을 제시한다.
본 발명자들은 근 질환 치료에 효과적인 물질을 탐색, 연구하던 중, PROKR1을 과발현하는 세포를 제조하고, PROKR1을 과발현하는 세포로부터 제조한 세포 유래 베시클(cell derived vesicle)이 PROKR1을 높은 수준으로 포함하며, 근 질환 치료에 효과적임을 확인하여, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 PROKR1을 과발현하는 세포 유래 베시클을 함유하는 근 질환 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한 본 발명의 목적은 PROKR1을 과발현하는 세포 유래 베시클을 이를 필요로 하는 개체에 처리하는 단계; 를 포함하는 근질환 예방 또는 치료 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 제공한다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, PROKR1 단백질 또는 이를 코딩하는 유전자의 세포 내 전달용 시약 조성물을 제공한다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, 근 분화촉진용 시약 조성물을 제공한다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, 근 질환 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는 근 질환 예방 또는 개선용 건강기능 식품조성물을 제공한다.
또한 본 발명은 PROKR1을 과발현하는 세포 유래 베시클을 이를 필요로 하는 개체에 처리하는 단계; 를 포함하는 근질환 예방 또는 치료 방법을 제공한다.
본 발명에 따른 PROKR1 (Prokineticin receptor 1)을 포함하는 세포 유래 베시클은 근모세포 또는 근관세포에 처리되었을 때, 근분화를 촉진하고, 근관세포로의 분화를 유도하여, 근 질환을 예방 또는 치료하는 용도로 사용할 수 있어, 의약업계 및 건강기능식품 분야에서 널리 사용될 수 있다.
도 1은 인간 PROKR1 유전자의 cDNA 서열 정보를 나타낸 도이다.
도 2는 PROKR1 과발현 벡터를 도식화하여 나타낸 도이다.
도 3은 PROKR1/PROKR1 유전자 편집 결과를 나타낸 도이다.
도 4는 PROKR1/PROKR1 유전자 결손 세포의 유전자 발현을 나타낸 도이다(***p < 0.001 vs. WT, Dunnett's multiple comparison test).
도 5는 미세 압출법 및 농도구배 초고속 원심분리를 이용한 세포 유래 베시클의 제작과정을 도식화하여 나타낸 도이다.
도 6은 크기 배제 크로마토그래피를 이용하여 세포 유래 베시클의 순도 및 크기를 분석한 도이다(파란색 화살표 = OptiPrep 농도구배액. 가로축 = 머무름 시간 (분), 세로축 = 흡광도 (mAU)).
도 7은 세포 유래 베시클의 입도분석 결과를 나타낸 도이다.
도 8은 세포 유래 베시클에서의 표지 단백질 발현을 나타낸 도이다(GFP 293T cell = GFP 과발현 HEK293T 세포의 단백질 추출물, Naive 293T cell = 조작되지 않은 HEK293T 세포의 단백질 추출물).
도 9는 세포 유래 베시클의 전체 RNA 프로파일을 나타낸 도이다(검은색 화살표 = 18S rRNA, 파란색 화살표 = 28S rRNA).
도 10은 GFP 과발현 HEK293T 세포의 세포 유래 베시클의 GFP 발현을 확인하기 위해, 세포 유래 베시클 도말 시료로부터 GFP 단백질의 녹색 형광 신호를 검출한 도이다.
도 11은 HEK293T 세포, GFP 과발현 HEK293T 세포, HEK293T 세포의 세포 유래 베시클 및 GFP 과발현 HEK293T 세포의 세포 유래 베시클의 GFP mRNA 발현을 RT-PCR을 통해 확인한 도이다.
도 12는 GFP 단백질이 함유된 세포 유래 베시클의 세포간 수송을 확인하기 위해, GFP 과발현 세포 유래 베시클 처리 후 24시간까지 녹색 형광 발현을 추적 관찰한 도이다(화살표 = GFP 단백질이 함유된 세포 유래 베시클의 예. 스케일 바 = 200 um).
도 13은 GFP 과발현 HEK293T 세포의 세포 유래 베시클을 HEK293T 세포에 처리하고 시간대 별로 GFP mRNA의 잔존 여부를 확인한 도이다.
도 14A는 처리군 1에서 PROKR1 과발현 세포 유래 베시클의 처리 농도에 따른 C2C12 세포에 대한 세포 증식능 변화를 나타낸 도이다(*p < 0.05, **p < 0.01, ***p < 0.001 vs. 0 μg/mL, Dunnett's multiple comparison test).
도 14B는 처리군 2에서 PROKR1 과발현 세포 유래 베시클의 처리 농도에 따른 C2C12 세포에 대한 세포 증식능 변화를 나타낸 도이다(*p < 0.05, **p < 0.01, ***p < 0.001 vs. 0 μg/mL, Dunnett's multiple comparison test).
도 15는 PROKR1 과발현 세포 유래 베시클 또는 PROKR1 결손 세포 유래 베시클의 크기 분포를 나타낸 도이다.
도 16은 PROKR1 과발현 세포 및 PROKR1 결손 세포와 이의 세포 유래 베시클로부터 추출한 단백질의 표지 단백질 발현을 분석한 도이다.
도 17은 PROKR1 과발현 세포 유래 베시클의 PROKR1 단백질 수송능을 확인한 도이다.
도 18은 PROKR1 과발현 세포 유래 베시클이 근모세포(myoblast)에 처리 되었을 때, 근모세포 분화 및 세포 사멸에 미치는 영향을 현미경으로 관찰한 도이다.
도 19A는 PROKR1 과발현 세포 유래 베시클이 근모세포 분화 후 세포 사멸에 미치는 영향을 유세포 분석으로 확인한 도이다.
도 19B는 유세포 분석 결과에 기초하여 작성한 그래프를 나타낸 도이다(* p < 0.05).
도 20은 PROKR1 과발현 세포 유래 베시클이 근모세포의 근관세포로의 분화에 미치는 영향을 팔로이딘 염색을 통해 확인한 도이다.
도 21은 PROKR1 과발현 세포 유래 베시클의 근육 발생능에 대한 효과를 확인하기 위해, 근육 발생 마커 유전자의 발현을 측정한 도이다( ap < 0.05, bp < 0.001 vs. WT C2C12 at differentiation day 0 (WT Day 0), cp < 0.01, dp < 0.001 vs. WT Day 6, ep < 0.01, fp < 0.001 vs. C2C12 Prokr1-/- at differentiation day 0 (KO Day 0), Dunnett's multiple comparison test).
도 22A는 유전자가 결손되지 않은 야생형 C2C12 세포의 인슐린 자극에 의한 포도당 흡수능에 미치는 PROKR1 과발현 세포 유래 베시클의 효과를 나타낸 도이다( gp < 0.001 vs. untreated WT C2C12, hp < 0.05 vs. untreated C2C12 Prokr1-/-, ip < 0.05 vs. insulin (INS)-treated C2C12 Prokr1-/-, jp < 0.05 vs. INS + PROKR1 Tg CDVs-treated C2C12 Prokr1-/-, Dunnett's multiple comparison test).
도 22B는 PROKR1 결손 C2C12 세포의 인슐린 자극에 의한 포도당 흡수능에 미치는 PROKR1 과발현 세포 유래 베시클의 효과를 나타낸 도이다( gp < 0.001 vs. untreated WT C2C12, hp < 0.05 vs. untreated C2C12 Prokr1-/-, ip < 0.05 vs. insulin (INS)-treated C2C12 Prokr1-/-, jp < 0.05 vs. INS + PROKR1 Tg CDVs-treated C2C12 Prokr1-/-, Dunnett's multiple comparison test).
본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클을 제공한다.
본 발명의 용어 '세포 유래 베시클'은 세포로부터 발생한 베시클을 말하며, 일반적으로 세포 소기관의 일종으로, 거의 모든 종류의 세포에서 세포막으로부터 자연적으로 유리되어, 세포막의 구조인 이중 인지질(phospholipid) 막 형태를 가지고 있는 것을 말한다.
본 발명의 세포 유래 베시클은 마이크로미터 크기, 예컨대 0.03~1㎛를 가질 수 있다. 본 발명의 베시클은 유래한 세포의 세포막 성분으로 이루어진 지질 이중막에 의해 내부와 외부가 구분되며, 세포의 세포막 지질과 세포막 단백질, 핵산 및 세포 성분 등을 가지고 있으며, 원래 세포보다 크기가 작은 것을 의미하지만, 이에 제한되는 것은 아니다.
본 발명의 세포 유래 베시클은 베시클이 제조될 수 있는 세포 유래의 베시클일 수 있으며, 바람직하게는 'PROKR1 (Prokineticin receptor 1) 단백질 또는 이를 코딩하는 유전자를 포함하는 세포'로부터 제조한 세포 유래 베시클일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 단백질 또는 이를 코딩하는 유전자를 포함하는 세포'는 PROKR1 유전자를 발현시켜 PROKR1 단백질을 생산하는 세포라면 제한없이 사용될 수 있으며, 바람직하게는 PROKR1 유전자를 포함하는 벡터를 세포에 형질도입하여 PROKR1 단백질을 발현시키도록 형질전환된 세포일 수 있다.
본 발명에 있어서, 상기 'PROKR1 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클'을 제조하는 공정은, PROKR1 단백질을 코딩하는 유전자를 도입하여 형질전환 세포를 제작하는 단계; 및 상기 형질 전환 세포로부터 세포 유래 베시클을 제조하는 단계;를 포함할 수 있다.
본 발명에 있어서, 상기 'PROKR1 단백질을 코딩하는 유전자를 도입하여 형질전환 세포를 제작하는 단계'는 PROKR1 단백질을 코딩하는 유전자를 포함하는 벡터를 세포에 형질도입하는 방법이면 당업계에 공지된 방법을 제한없이 이용할 수 있다. 여기서 '형질도입'은 PROKR1 유전자를 숙주로 도입하여 PROKR1 유전자가 염색체 외 인자로서 또는 염색체 통합완성에 의해 복제가능하게 되는 것을 의미한다. 형질도입은 핵산 분자를 유기체, 세포, 조직 또는 기관에 도입하는 어떤 방법도 포함되며, 당 분야에서 공지된 바와 같이 숙주 세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 전기천공법 (electroporation), 인산칼슘 (CaPO 4) 침전, 염화칼슘 (CaCl 2) 침전, 미세주입법 (microinjection), 폴리에틸렌글리콜 (PEG)법, DEAE (diethylaminoethyl)-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 포함될 수 있고, 바람직하게는 리포펙타민을 이용한 형질도입 방법일 수 있으나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 '형질 전환 세포로부터 세포 유래 베시클을 제조하는 단계'는 상기 형질전환 세포를 포함하는 현탁액을 압출, 초음파 분해, 세포 용해, 균질화, 냉동-해동, 전기천공, 화학 물질 처리, 기계적 분해 및 외부적으로 세포에 힘을 가한 물리적 자극의 처리로 이루어진 군으로부터 선택된 방법을 사용하여 제조할 수 있으나 이에 제한되는 것은 아니다.
바람직하게 상기 '형질 전환 세포로부터 세포 유래 베시클을 제조하는 단계'는 1) 상기 형질전환 세포를 미세압출하는 단계; 및 2) 여과하는 단계를 포함하는 것일 수 있다.
상기 '1) 상기 형질전환 세포를 미세압출하는 단계'는 미세압출시 압출력은 5 내지 200 psi일 수 있고, 10 내지 150 psi일 수 있으며, 50 내지 100 psi일 수 있다. 또한, 상기 미세압출시 사용하는 여과기는 0.01 um 내지 20 um의 여과기 일 수 있으며, 바람직하게는 0.2 um 내지 10 um일 수 있고, 크기가 점차 작아지는 여과기 1 내지 10개를 순차적으로 사용하여 미세압출하는 단계일 수 있다.
상기 '2) 여과하는 단계'는 미세압출된 압출물을 0.1 내지 0.5 um의 여과기를 통해 여과하는 단계 일 수 있다.
또한, 상기 '형질 전환 세포로부터 세포 유래 베시클을 제조하는 단계'는 바람직하게 '3) 농도구배 초고속 원심분리하는 단계'를 더 포함하여 제조할 수 있으며, '3) 농도구배 초고속 원심분리하는 단계'는 50,000G 내지 150,000G, 2 내지 6℃, 1 내지 3시간 동안 진행되는 것 일 수 있다. 농도구배 초고속 원심분리하는 단계를 더 포함하여 제조하면 크기가 보다 균일한 세포 유래 베시클이 형성되어 순도가 더 높아지는 것일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 세포에 처리되었을 때, PROKR1 또는 이를 코딩하는 유전자를 세포로 수송하여, 처리된 세포에서 PROKR1을 높은 수준으로 발현시키는 것일 수 있다. 바람직하게 상기 PROKR1 단백질은 세포 유래 베시클이 세포에 처리된 후 30분 내지 24시간 유지되는 것 일 수 있으며, 상기 PROKR1을 코딩하는 유전자는 베시클이 세포에 처리 후 1시간 내지 48시간 유지되는 것 일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 근육발생능이 있는 것 일 수 있고, 근 분화촉진능이 있는 것 일 수 있으며, PROKR1이 결손된 세포에 처리되었을때, 근육 발생 후기 마커인 Mb, Myh7 또는 Myog와 근육 발생 초기 마커인 Pax3, Pax7 또는 Myod의 발현을 PROKR1이 결손되지 않은 세포 수준으로 발현시키는 것일 수 있다. 또한, 바람직하게 상기 근 분화촉진은 근모세포(myoblast)에서 근관세포(myotube) 또는 근세포(myocyte)로 분화를 촉진하는 것 일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 근모세포가 근관세포 또는 근세포로 분화된 후, 세포자멸사(apoptosis)를 억제하는 것 일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 상기 근육발생능, 근 분화 촉진능 및 분화 후 세포자멸사 억제능을 기초로 근 질환을 예방, 개선 또는 치료하는 용도로 사용될 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 인슐린 자극에 의한 근관세포의 포도당 흡수를 촉진시키는 것 일 수 있으며, 이러한 기전에 의해 인슐린 저항성을 개선시키고, 당뇨병 예방 또는 치료 효과가 있는 것 일 수 있고, 바람직하게는 근 분화능이 상실된 세포에 인슐린 자극에 의한 포도당 흡수능을 나타내는 근관세포로 분화를 촉진시키는 것일 수 있으며, 이러한 효과에 기초하여 당뇨병의 예방 또는 치료가 가능한 것일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 161.7 ± 12.3 nm (평균 ± 표준편차)의 내경을 갖는 것 일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 유래되는 세포의 표지 단백질을 포함하는 것 일 수 있으며, 바람직하게 상기 표지 단백질은 CD9 또는 CD81인 것 일 수 있다. 특히, 유래되는 세포보다 세포 유래 베시클에서 표지 단백질, 바람직하게는 CD9 또는 CD81을 더 높은 비율로 포함하는 것 일 수 있으며, 바람직하게는 유래되는 세포 대비 3배 이상 더 포함하는 것 일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 다양한 크기의 유전자 또는 RNA가 완전한 형태로 보존되어 있는 것 일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 ' PROKR1 유전자를 결손시킨 세포를 이용하여 제조한 세포 유래 베시클'보다 세포 유래 베시클의 생산률, 세포 유래 베시클 내 단백질량 및/또는 RNA량이 높은 것일 수 있다.
본 발명에 있어서, 상기 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'은 세포에 독성을 띄지 않는 것 일 수 있으며, 바람직하게는 0.0001 내지 100 ug/mL의 농도로 처리되었을 때, 독성을 나타내지 않는 것 일 수 있고, 보다 바람직하게는 0.0001 내지 80 ug/mL의 농도로 처리되었을 때, 독성을 나타내지 않는 것 일 수 있으며, 더욱 바람직하게는 0.0001 내지 50 ug/mL의 농도로 처리되었을 때, 독성을 나타내지 않는 것 일 수 있다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, PROKR1 단백질 또는 이를 코딩하는 유전자의 세포 내 전달용 시약 조성물을 제공한다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클을 포함하는, 근 분화촉진용 시약 조성물을 제공한다.
본 발명에 있어서, 상기 시약 조성물은 'PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클'을 0.0001 내지 100 ug/mL의 농도로 포함하는 것 일 수 있으며, 바람직하게는 0.0001 내지 80 ug/mL의 농도로 포함하는 것 일 수 있고, 더욱 바람직하게는 0.0001 내지 50 ug/mL의 농도로 포함하는 것일 수 있다. 본 발명의 상기 시약 조성물이 상기 세포 유래 베시클을 100 ug/mL의 농도를 초과하여 포함하는 경우, 세포에 독성을 나타낼 수 있다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, 근 질환 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 상기 약학적 조성물은 인슐린 자극에 의한 근관세포의 포도당 흡수를 촉진시켜, 인슐린 저항성을 개선하고, 당뇨병을 예방 또는 치료할 수 있는 것 일 수 있다. 따라서, 당뇨병 및 근 질환을 동시에 예방 또는 치료할 수 있는 것 일 수 있다.
따라서 본 발명은 PROKR1을 과발현하는 세포 유래 베시클을 이를 필요로 하는 개체에 처리하는 단계; 를 포함하는 근질환 예방 또는 치료 방법을 제공한다.
또한 본 발명은 PROKR1을 과발현하는 세포 유래 베시클의 근질환 예방 또는 치료 용도 및 근질환 예방 또는 치료용 약학적 조성물 제조에 사용하기 위한 용도를 제공한다. 본 발명에 있어서, 상기 근 질환은 MELAS(mitochodrial myophthy, encephalopathy, lactic acsidosis, and stroke-like episodes) 증후군, MERRF(Myoclonic Epilepsy with Ragged Red Fiber) 증후군, Kearns-Sayre 증후군, 근병증, 뇌근육병증, 근무력증, 중증 근무력증, 근위축성 측삭 경화증, 근육퇴행위축, 근위축증, 근긴장저하, 근력약화 및 근경직증으로 이루어진 군에서 선택된 1종 이상일 수 있다.
본 발명에 있어서, 상기 세포 유래 베시클은 근 질환의 예방 또는 치료효과를 나타낼 수 있는 한 제형, 배합 목적 등에 따라 임의의 양(유효량)으로 포함될 수 있으며, 여기서 '유효량'이란 그 적용 대상인 포유동물 바람직하게는 사람에게 의료 전문가 등의 제언에 의한 투여 기간 동안 본 발명의 조성물이 투여될 때, 근 분화능 회복 효과 등 의도한 기능적·약리학적 효과를 나타낼 수 있는, 본 발명의 조성물에 포함되는 유효성분의 양을 말한다. 이러한 유효량은 당업자의 통상의 능력 범위 내에서 실험적으로 결정될 수 있고, 바람직하게는 1X10 5 내지 1X10 13 particles/ml의 농도로 포함할 수 있으며, 보다 바람직하게는 5X10 7 내지 1X10 13 particles/ml의 농도로 포함하는 것일 수 있고, 더욱 바람직하게는 5X10 8 내지 1X10 13 particles/ml의 농도로 포함하는 것일 수 있으며, 더더욱 바람직하게는 1X10 9 내지 1X10 13 particles/ml의 농도로 포함하는 것일 수 있다.
본 발명의 근 질환 예방 또는 치료용 약학적 조성물은 유효성분 이외에, 근 질환 예방 또는 치료 효과의 상승·보강을 위하여 이미 안전성이 검증되고 근 질환 예방 또는 치료 효과를 갖는 것으로 공지된 임의의 화합물이나 천연 추출물을 추가로 포함할 수 있다.
본 발명의 약학적 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학적 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 약학적 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1㎎/㎏/일 내지 500㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 약학적 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. 본 발명의 화합물은 독성 및 부작용이 거의 없으므로 예방 목적으로 장기간 복용시에도 안심하고 사용할 수 있는 약제이다.
또한, 본 발명은 PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는 근 질환 예방 또는 개선용 건강기능 식품조성물을 제공한다.
본 발명의 상기 건강기능 식품조성물은 인슐린 자극에 의한 근관세포의 포도당 흡수를 촉진시켜, 인슐린 저항성을 개선하고, 당뇨병을 예방 또는 개선할 수 있는 것 일 수 있다. 따라서, 당뇨병 및 근 질환을 동시에 예방 또는 개선할 수 있는 것 일 수 있다.
본 발명의 건강기능식품은 식품 제조 시 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함한다. 예컨대, 드링크제로 제조되는 경우에는 유효성분으로서 세포 유래 베시클 이외에 향미제 또는 천연 탄수화물을 추가 성분으로 포함시킬 수 있다. 예를 들어, 천연 탄수화물은 모노사카라이드(예컨대, 글루코오스, 프럭토오스 등), 디사카라이드(예컨대, 말토스, 수크로오스 등), 올리고당, 폴리사카라이드(예컨대, 덱스트린, 시클로덱스트린 등), 및 당알코올(예컨대, 자일리톨, 소르비톨, 에리쓰리톨 등)을 포함한다. 향미제로서 천연 향미제(예컨대, 타우마린, 스테비아 추출물 등) 및 합성 향미제(예컨대, 사카린, 아스파르탐 등)을 이용할 수 있다.
본 발명의 건강기능식품은 정제, 캡슐제, 환제 또는 액제 등의 형태를 포함하며, 본 발명의 세포 유래 베시클을 첨가할 수 있는 식품으로는, 예를 들어, 각종 드링크제, 육류, 소세지, 빵, 캔디류, 스넥류, 면류, 아이스크림, 유제품, 스프, 이온음료, 음료수, 알코올 음료, 껌, 차 및 비타민 복합제 등이 있다.
본 발명의 근 질환 예방 또는 개선용 건강기능식품은 상기 근 질환 예방 또는 치료용 약학적 조성물의 유효성분 및 효과가 동일하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.
본 발명을 이하 실시예를 통하여 상세히 설명하기로 한다. 이들 실시예는 오로지 발명을 설명하기 위한 것으로 본 발명의 범위를 한정하는 것은 아니다.
실시예 1. Prokineticin receptor 1 ( PROKR1 ) 과발현 벡터의 제작
인간 PROKR1 유전자의 cDNA(1,182 bp)는 미국 국립 생물공학 정보센터 (http://www.ncbi.nlm.nih.gov)에서 확인한 염기서열 정보 (NM_138964)를 기반으로 합성하였다(Bionics, Seoul, Korea). 합성된 PROKR1 유전자는 piggyBac transposon transgene expression system vector (System Biosciences, Palo Alto, CA)에 삽입하여 PROKR1 과발현 벡터를 제작하였다. PROKR1 유전자는 Not I 제한효소 처리 및 클로닝을 통하여 과발현 벡터에 삽입하였으며, 염기서열 분석 및 유전자 클로닝을 통해 PROKR1 유전자의 과발현 벡터 제작 여부를 점검하였다. 인간 PROKR1 유전자의 cDNA 서열 정보(서열번호 1) 및 이의 아미노산 서열 정보(서열번호 2)를 도 1에 나타내었고, PROKR1 과발현 벡터를 도식화하여 도 2에 나타내었다.
실시예 2. PROKR1 유전자 과발현 세포주의 제작
인간 PROKR1 과발현 벡터를 사람 배아 신장 세포주 293T (HEK293T) 세포에 전이하고, 안정적으로 발현하는 세포를 선발하였다. HEK293T 세포는 Dulbecco's Modified Eagle Medium (DMEM) 기본 배지에 10% (v/v) 소 태아 혈청 (Gibco BRL, USA)과 1% (v/v) 항생제 (Invitrogen, USA)를 첨가하여 37℃, 5% CO 2 배양기에서 배양하였다. HEK293T 세포가 70~80% 면적까지 증식 한 후 리포펙타민 3000 (Invitrogen)을 이용하여 실시예 1에서 제작한 PROKR1 과발현 벡터 및 piggyBac transposase 발현 벡터를 함께 공전이 하였다. PROKR1 과발현 벡터 전이를 위해서 증식된 HEK293T 세포를 인산염 완충액으로 세척 후 항생제가 첨가되지 않은 배지로 교환하였다. 과발현 벡터 전이용액은 250 μL Opti-MEM (Invitrogen)에 7.5 μL 리포펙타민 3000과 2.5 μg 과발현 벡터를 혼합하여 제작하였다. piggyBac transposase 전이용액은 250 μL Opti-MEM (Invitrogen)에 10 μL 리포펙타민 3000과 2.5 μg piggyBac transposase 발현 벡터를 혼합하여 제작하였다. 제작된 전이용액은 혼합 후 5분간 실온에서 방치하였다. 최종적인 전이 혼합물 500 uL는 HEK293T 세포에 모두 소적한 후 37℃, 5% CO 2 배양기에서 3시간 동안 배양하였다. PROKR1 과발현 벡터의 전이가 종료된 세포는 인산염 완충액으로 3회 세척한 다음 배양 배지를 첨가하였다. PROKR1 과발현 벡터 전이 다음 날 배양 배지에 10 μg/mL puromycin을 첨가하여 PROKR1 과발현 벡터가 전이된 HEK293T 세포만을 선발하였다. 전이 대조구로는 PROKR1 유전자가 없는 공벡터를 전이한 HEK293T 세포를 puromycin으로 선발한 후 사용하였다. 제작된 세포는 염기서열 분석 및 유전자 발현 분석을 통해 PROKR1 유전자 과발현을 확인하였다.
실시예 3. PROKR1 유전자 결손 세포주의 제작
C2C12 또는 HEK293T 세포에서 PROKR1 유전자 결손 세포주는 3세대 유전자 가위 기법 (CRISPR/Cas9)을 통해 제작하였다. PROKR1 유전자의 엑손 1번을 표적으로 하는 가이드 RNA 발현 벡터와 Cas9 및 녹색 형광단백질 (green fluorescence protein; GFP)를 동시에 발현하는 벡터를 제작한 후 (Sigma, USA), 각각 2.5 ug씩 동량으로 리포펙타민을 이용하여 C2C12 또는 HEK293T 세포에 전이하였다. 전이된 세포는 다음날 1% (w/v) 소 혈청 알부민이 함유된 인산염 완충액으로 재부유한 다음, 40 um 세포 여과기 (Becton, Dickinson and Company, USA)를 이용하여 여과한 후 형광활성 세포분류기 (Becton, Dickinson and Company)를 이용하여 GFP 양성 세포만을 선발하였다. 선발한 단일 세포는 염기서열 분석 및 유전자 발현 분석을 통해 PROKR1 유전자 결손을 확인하였으며, PROKR1 유전자 편집을 위한 가이드 RNA 결합 위치를 이탤릭체로 표기된 PROKR1 유전자 결손 세포의 염기서열을 도 3에 나타내었으며, 실시예 2에서 제작한 PROKR1 유전자 과발현 세포와 실시예 3에서 제작한 PROKR1 유전자 결손 세포의 PROKR1 유전자의 발현을 도 4에 나타내었다.
실시예 4. 형질전환 세포 유래 베시클의 제작
PROKR1 또는 GFP가 과발현 세포를 이용한 세포 유래 베시클은 미세 압출법을 이용하여 제작하였다. 약 1천만개로 증식된 세포는 1 mL의 인산염 완충액으로 재부유 한 후, 10 um, 5 um, 그리고 1 um 여과기가 장착된 미세 압출기에 각 7회 압출하였고, 세포 압출물은 0.2 um 여과기를 통해 최종 여과하였다. 세포 여과물은 OptiPrep 배지 (Sigma)로 제작한 10% 및 50% (v/v) 농도구배 용액을 이용하여 농도구배 초고속 원심분리 하였다. 농도구배 초고속 원심분리 후 10% (v/v) OptiPrep층을 회수하여 인산염 완충액으로 희석한 다음 4℃에서 100,000 g의 속도로 2시간 동안 초고속 원심 분리하여 침전된 세포 유래 베시클을 회수하였다. 회수된 세포 유래 베시클은 인산염 완충액으로 재부유 후 실험 전까지 -80℃에서 보관하였다. 상기와 같은 미세 압출법 및 농도구배 초고속 원심분리를 이용한 세포 유래 베시클의 제작과정을 도식화하여 도 5에 나타내었다.
실시예 5. 세포 유래 베시클의 순도 및 크기 분석
5.1 크기 배제 크로마토그래피(size exclusive chromatography; SEC)를 이용한 GFP 과발현 세포 유래 베시클의 순도 및 크기 분석
크기 배제 크로마토그래피를 이용하여 실시예 4의 방법과 동일한 방법으로 제조한 GFP 과발현 세포 유래 베시클의 순도 및 크기를 분석하였으며, 그 결과를 도 6에 나타내었다.
도 6에 나타낸 바와 같이, 농도구배 초고속 원심분리 전 세포 유래 베시클 시료에서는 3-7분대의 다양한 피크가 검출된 반면, 농도구배 초고속 원심분리 후 세포 유래 베시클 시료에서는 3.229분의 단일 피크가 검출되었다. 따라서, 농도구배 초고속 원심분리를 통해 고순도의 세포 유래 베시클이 제작되었음을 확인하였고, 제작된 세포 유래 베시클의 머무름 시간 (retention time)을 3.229분으로 확인하였다.
5.2 입도분석을 이용한 GFP 과발현 세포 유래 베시클의 크기 분석
실시예 4와 동일한 방법으로 제조한 농도구배 초고속 원심분리 후 세포 유래 베시클에 대하여, 입도분석 (Zetasizer, Malvern Panalytical, UK)을 진행하였으며, 3회 반복하여 측정한 결과를 도 7에 나타내었다.
도 7에 나타낸 바와 같이, HEK293T 및 GFP 과발현 HEK293T 세포로 제작한 세포 유래 베시클의 내경은 각각 168 ± 10.2 nm와 173 ± 12.0 nm (평균 ± 표준편차)로 측정되었다. 이는 세포로부터 방출되는 엑소좀의 내경과 유사한 크기로, 미세 압출 및 농도구배 초고속 원심분리를 통해 제작된 세포 유래 베시클이 크기면에서 세포로부터 자연적으로 방출되는 엑소좀과 유사함을 확인하였다.
실시예 6. GFP 과발현 세포 유래 베시클의 표지 및 함유 성분 분석
6.1 GFP 과발현 세포 유래 베시클의 표지 단백질 발현 분석
세포 유래 베시클 제작에 사용된 세포와 세포 유래 베시클로부터 추출한 단백질로부터 엑소좀의 표지 단백질 발현을 분석하였다. 표지 단백질의 분석은 웨스턴 블롯 방법을 적용하였고, 사람의 항CD9 항체, 항CD81 항체, 그리고 동량의 단백질액을 분석했는지 확인하고자 항 beta-actin 항체를 대조군으로 사용하였으며, 웨스턴 블롯 분석 결과를 도 8에 나타내었다.
도 8에 나타낸 바와 같이, HEK293T 세포와 GFP 과발현 세포에서 CD9, CD81의 발현이 관찰되었다. 또한 각각의 세포로부터 제작된 세포 유래 베시클에서도 CD9, CD81의 발현이 확인되었고, CD9의 경우 세포에 비하여 세포 유래 베시클에서 높은 단백질 발현이 확인되었다.
6.2 GFP 과발현 세포 유래 베시클에 함유된 단백질 및 RNA의 정량 분석
실시예 4와 동일한 방법으로 제조한 세포 유래 베시클에 대하여, 세포 유래 베시클량, 세포 유래 베시클에 함유된 단백질량 및 RNA량에 대한 정량적 분석을 실시하였다. 제작된 세포 유래 베시클량은 브레드포드법을 이용하여 정량하였고, 세포 유래 베시클에 함유된 단백질량은 비친코니닉산 (Bicinchoninic acid)법으로 정량하였다. 세포 유래 베시클 내 RNA량은 트리졸 (Trizol) 용액을 이용하여 전체 RNA를 회수한 다음 바이오분석기 (BioAnalyzer)로 정성 및 정량 분석을 실시하였으며, 분석 결과를 표 1에 나타내었다.
Figure PCTKR2021000475-appb-img-000001
표 1에 나타낸 바와 같이, 세포 유래 베시클의 정량 분석 결과, GFP 과발현 HEK293T 세포 천만 개로부터 제작한 세포 유래 베시클량은 101.2 ug인 것을 확인하였고, 형질전환되지 않은 HEK293T 세포 천만 개로부터 제작한 세포 유래 베시클량은 67.5 ug인 것을 확인하였다. 세포 유래 베시클 내 단백질량을 분석한 결과, GFP 과발현 HEK293T 세포 유래의 세포 유래 베시클은 104.9 ug의 단백질을 함유하고, 형질전환되지 않은 HEK293T 세포 유래의 세포 유래 베시클은 63.3 ug의 단백질을 함유하는 것을 확인하였다. 또한 전체 RNA량도 GFP 과발현 세포 유래의 세포 유래 베시클은 13.1 ug의 RNA를 함유하고, 형질전환되지 않은 세포 유래의 세포 유래 베시클은 5.5 ug의 전체 RNA를 함유하는 것을 확인하였다.
6.3 세포 유래 베시클 내 전체 RNA 프로파일링 분석
실시예 4와 동일한 방법으로 제조한 GFP 과발현 HEK294T 세포 유래의 세포 유래 베시클에 대하여, 세포 유래 베시클 내 전체 RNA 프로파일을 분석한 결과를 도 9에 나타내었다.
도 9에 나타낸 바와 같이, miRNA 및 tRNA 등은 25초 전후로 관찰되었고, 18S rRNA는 40초 전후, 28S rRNA는 47초 전후에 관찰되었고, 18S rRNA 및 28S rRNA의 흡광도 비율은 약 1:2로 관찰되었다. 이는 제작된 세포 유래 베시클 내에 다양한 크기의 RNA가 완전한 형태로 보존되어 있음을 나타낸다.
실시예 7. 세포 유래 베시클을 이용한 표적물질의 세포간 수송 확인
7.1 세포 유래 베시클 내 표적 물질 분석
실시예 4와 같은 방법으로 제조한, GFP 과발현 HEK293T 세포 유래의 세포 유래 베시클의 GFP 발현을 확인하였다. 세포 유래 베시클 시료를 슬라이드글라스에 도말 후 형광현미경에서 관찰하고, 관찰 결과를 도 10에 나타내었다.
도 10에 나타낸 바와 같이, 개별 세포 유래 베시클 내에서 발현되는 녹색형광 신호를 확인하였다. 이로부터 GFP 과발현 세포로부터 제작된 세포 유래 베시클 내에 표적 단백질인 GFP가 고농도로 함유되어 있는 것을 확인하였다.
또한 세포 유래 베시클 제작에 사용한 세포 및 해당 세포 유래의 세포 유래 베시클에서 회수한 mRNA로부터 GFP mRNA를 확인하였으며, GFP mRNA 발현 결과를 도 11에 나타내었다.
도 11에 나타낸 바와 같이, GFP 과발현 HEK293T 세포 및 GFP 과발현 HEK293T 세포 유래의 세포 유래 베시클에서만 GFP mRNA가 발현되는 것을 확인하였다.
7.2 세포 유래 베시클에 의한 표적 물질의 수송
7.2.1 세포 유래 베시클에 의한 GFP 단백질의 수송 확인
실시예 4와 같은 방법으로 제조한, GFP 과발현 HEK293T 세포 유래의 세포 유래 베시클을 형질전환되지 않은 HEK293T 세포에 처리한 다음, 세포 유래 베시클에 의한 GFP 단백질의 세포간 이동을 추적하였으며, 추적 결과를 도 12에 나타내었다.
도 12에 나타낸 바와 같이, 세포 유래 베시클은 세포에 처리 후 30분 이내에 HEK293T 세포로 흡수가 시작되었고, 처리 후 24시간까지 GFP가 발현되는 것을 확인하였다. 이러한 결과를 통해, 세포 유래 베시클은 표적 세포로 원활하게 수송되며, 세포 유래 베시클 내 농축된 표적 단백질도 표적 세포로 수송되고, 그 기능이 24시간 이상 유지되는 것을 확인하였다.
7.2.2 세포 유래 베시클에 의한 GFP mRNA의 수송 확인
실시예 4와 같은 방법으로 제조한, GFP 과발현 HEK293T 세포 유래의 세포 유래 베시클을 HEK293T 세포에 처리하고, 처리 후 시간대 별로 상기 HEK293T 세포로부터 mRNA를 회수한 다음, RT-PCR을 통한 GFP mRNA의 잔존 여부를 확인하였으며, 결과를 도 13에 나타내었다.
도 13에 나타낸 바와 같이, GFP 과발현 HEK293T 세포 유래의 세포 유래 베시클 처리 후 1시간째부터 GFP mRNA가 관찰되었고, 48시간까지 GFP mRNA가 유지되는 것을 확인하였다. 따라서, GFP 과발현 HEK293T 세포로부터 제작한 세포 유래 베시클은 GFP 단백질 외에 GFP mRNA를 함유하고, 함유된 GFP 단백질 및 mRNA는 표적 세포로 흡수되어 최대 48시간 이상 유지되는 것을 확인하였다.
실시예 8. 세포 처리를 위한 세포 유래 베시클의 처리 농도 결정
PROKR1 과발현 세포 유래 베시클의 세포 내 적정 처리 농도를 결정하기 위하여 표적 세포인 PROKR1이 결손된 설치류 유래 근모세포 (myoblast)인 C2C12를 대상으로 용량 결정 시험을 실시하였다. PROKR1 과발현 세포 유래 베시클은 0, 10, 25, 50, 100 및 200 ug/mL을 48시간 동안 처리하였고, 처리군 1은 24시간 간격으로 세포 유래 베시클 배지를 전량 교체하였고 처리군 2는 48시간 연속으로 동일 세포 유래 베시클 배지를 처리하였다. 처리군 1 및 2에서 PROKR1 과발현 세포 유래 베시클의 처리 농도에 따른 C2C12 세포에 대한 세포 증식능 변화 확인 결과는 각각 도 14A 및 B에 나타내었다.
도 14A에 나타낸 바와 같이, 처리군 1에서는 50 ug/mL의 세포 유래 베시클 용량군까지 대조군과 유의적인 차이가 없는 세포 생존율이 관찰되었고, 100 ug/mL 이상의 용량군에서는 60% 이상의 세포 증식 억제가 관찰되었다.
도 14B에 나타낸 바와 같이, 처리군 2에서는 50 ug/mL 세포 유래 베시클 용량군에서부터 유의적인 세포 증식 억제가 관찰되었다.
따라서, 24시간 간격으로 세포 유래 베시클 배지를 전량 교체하는 조건에서 50 ug/mL의 세포 유래 베시클 용량이 세포에 대한 무독성량인 것을 확인하였다.
실시예 9. PROKR1 과발현 세포 유래 베시클의 크기 분석
실시예 4와 동일한 방법으로 제조한 PROKR1 과발현 세포 유래 베시클 또는 PROKR1 결손 세포 유래 베시클의 크기 분포는 제타사이저 (Malvern)를 이용한 동적 광산란 분석을 통해 측정하였으며, 그 결과를 도 15에 나타내었다.
도 15에 나타낸 바와 같이, PROKR1 과발현 세포 유래 베시클 또는 PROKR1 결손 세포 유래 베시클의 내경은 각각 161.7 ± 12.3 nm와 150.2 ± 3.6 nm (평균 ± 표준편차)로 측정되었다. 이에 따라, PROKR1 과발현 세포 유래 베시클이 PROKR1 결손 세포 유래 베시클보다 평균적으로 크기가 큰 것을 확인하였다.
실시예 10. PROKR1 과발현 세포 유래 베시클의 표지 및 함유 성분 분석
10.1 PROKR1 과발현 세포 유래 베시클의 표지 단백질 발현 분석
세포 유래 베시클 제작에 사용된 PROKR1 과발현 세포 및 PROKR1 결손 세포와 상기 세포 유래 베시클로부터 단백질을 추출하여, 표지 단백질 발현을 분석하였다. 표지 단백질의 분석은 웨스턴 블롯 방법을 적용하였다. 1차 항체로 마우스 단클론 항-β-액틴 항체 (1:1000, Santa Cruz), 토끼 단클론 항-CD9 항체 (1:2000), 토끼 단클론 항-CD81 항체 (1:1000, Abcam) 및 토끼 단클론 항- PKR1 항체 (1:1000, Biorbyt)를 사용하였다. 또한, 1차 항체 반응의 화학 발광 측정을 위해 염소 항-마우스 IgG 항체(1:1000) 및 염소 항-토끼 IgG 항체(1:1000, Thermo Fisher Scientific)를 2차 항체로 사용하였다. 웨스턴 블롯 분석 결과를 도 16에 나타내었다.
도 16에 나타낸 바와 같이, PROKR1 과발현 세포 및 PROKR1 과발현 세포 유래 베시클에서 PROKR1의 발현이 관찰되었으며, PROKR1 결손 세포 및 PROKR1 결손 세포 유래 베시클에서는 PROKR1의 발현이 관찰되지 않았다. 또한, CD9 및 CD81의 경우, PROKR1 과발현 세포보다는 PROKR1 과발현 세포 유래 베시클에서 각각 3.7배 및 5.6배 더 높은 발현이 관찰되었고, PROKR1 결손 세포보다는 PROKR1 결손 세포 유래 베시클에서 각각 12배 및 6.3배 더 높은 발현이 관찰되었다.
10.2 PROKR1 과발현 세포 유래 베시클에 함유된 단백질 및 RNA의 정량 분석
실시예 4와 동일한 방법으로 제조한 PROKR1 과발현 세포 유래 베시클 또는 PROKR1 결손 세포 유래 베시클에 대하여, 세포 유래 베시클량, 세포 유래 베시클에 함유된 단백질량 및 RNA량에 대한 정량적 분석을 실시하였다. 제작된 세포 유래 베시클량은 브레드포드법을 이용하여 정량하였고, 세포 유래 베시클에 함유된 단백질량은 비친코니닉산 (Bicinchoninic acid)법으로 정량하였다. 세포 유래 베시클 내 RNA량은 트리졸 (Trizol) 용액을 이용하여 전체 RNA를 회수한 다음 바이오분석기 (BioAnalyzer)로 정성 및 정량 분석을 실시하였으며, 분석 결과를 표 2에 나타내었다.
Figure PCTKR2021000475-appb-img-000002
표 2에 나타낸 바와 같이, 세포 유래 베시클의 정량 분석 결과, PROKR1 과발현 세포 천만 개로부터 제작한 세포 유래 베시클량은 95.9 ug인 것을 확인하였고, PROKR1 결손 세포 천만 개로부터 제작한 세포 유래 베시클량은 85.7 ug인 것을 확인하였다. 세포 유래 베시클 내 단백질량을 분석한 결과, PROKR1 과발현 세포 유래 베시클은 120.5 ug의 단백질을 함유하고, PROKR1 결손 세포 유래 베시클은 87.0 ug의 단백질을 함유하는 것을 확인하였다. 또한 전체 RNA량도 PROKR1 과발현 세포 유래 베시클은 13.7 ug의 RNA를 함유하고, PROKR1 결손 세포 유래 베시클은 10.9 ug의 전체 RNA를 함유하는 것을 확인하였다.
실시예 11. PROKR1 과발현 세포 유래 베시클을 이용한 PROKR1 단백질의 세포 내 수송 확인
PROKR1 과발현 세포 유래 베시클이 세포 내로 PROKR1 단백질을 수송하는지 확인하기 위한 실험을 실시하였다. 실험군으로 아무것도 처리하지 않은 C2C12 세포주, PROKR1을 결손 시킨 C2C12 세포주, PROKR1 과발현 세포 유래 베시클을 처리한 PROKR1을 결손 시킨 C2C12 세포주, PROKR1 결손 세포 유래 베시클을 처리한 PROKR1을 결손 시킨 C2C12 세포주를 설정하였으며, 실시예 10.1과 동일한 방법으로 PROKR1의 발현을 측정하였고, 그 결과를 도 17에 나타내었다.
도 17에 나타낸 바와 같이, PROKR1을 결손시킨 C2C12 세포주에 PROKR1 과발현 세포 유래 베시클을 처리하면 세포 내에 PROKR1 단백질을 높은 수준으로 포함하는 것을 확인하였다. 이러한 결과로부터 PROKR1 과발현 세포 유래 베시클이 세포 내로 PROKR1 단백질을 수송한다는 것을 확인하였다.
실시예 12. PROKR1 과발현 세포 유래 베시클의 근모세포의 분화에 미치는 영향
PROKR1 과발현 세포 유래 베시클이 근모세포(myoblast)의 분화에 미치는 영향을 확인하였다. 실시예 11에서 설정한 실험군에 대하여 근육 분화(myogenic differentiation)를 유도하고, 유도 1일부터 3일의 조직 샘플을 현미경으로 관찰하였으며, 관찰 결과를 도 18에 나타내었다.
도 18에 나타낸 바와 같이, 아무것도 처리하지 않은 C2C12 세포주는 근육 분화 유도 3일째부터 근관세포의 형성이 관찰되었고, PROKR1을 결손 시킨 C2C12 세포주는 근육 분화 유도 1일째부터 부유 세포가 관찰되었고, 근육 분화 유도가 진행됨에 따라 부유 세포의 수는 현저하게 증가하였다. 이와 비교하여, PROKR1 과발현 세포 유래 베시클을 처리한 PROKR1을 결손 시킨 C2C12 세포주는 근육 세포 분화 유도 후 부유 세포의 출현이 현저하게 감소하였고, 아무것도 처리하지 않은 C2C12 세포주의 근육 분화 결과와 유사한 초기 근관 세포의 출현이 관찰되었다. 반면, PROKR1 결손 세포 유래 베시클을 처리한 PROKR1을 결손 시킨 C2C12 세포주는 근육 분화 유도 후 PROKR1을 결손 시킨 C2C12 세포주와 유사한 수준의 부유 세포의 출현이 관찰되었다. 이를 통하여 PROKR1 과발현 세포 유래 베시클의 처리가 근육 분화 유도 후 PROKR1을 결손 시킨 C2C12 세포주의 세포 사멸을 방지하는 것을 확인하였다.
실시예 13. 근모세포의 분화 후 세포사멸에 미치는 PROKR1 과발현 세포 유래 베시클의 효과
근모세포인 C2C12 세포의 분화 후 세포 사멸에 대한 세포 유래 베시클의 효과를 유세포 분석을 통해 측정하였다. PROKR1을 결손시킨 분화 전 C2C12 세포에 PROKR1 과발현 세포 유래의 베시클을 25 μg/mL의 농도로 처리하고, 3일간 배양하여 C2C12 세포의 근관세포 분화를 유도하였다. 그 후, 세포를 Annexin V 및 요오드화 프로피디움으로 이중 염색하고, 염색된 세포를 유세포 분석 (Becton, Dickinson and Company) 한 후, Annexin V 및 요오드화 프로피디움 양성 세포를 계수하여 분화가 개시된 C2C12 세포의 사멸을 측정하였다. 세포 사멸 분석 시, Annexin V 양성 세포는 초기 사멸 세포로 판단하고, Annexin V 및 요오드화 프로피디움 동시 양성 세포는 후기 사멸 세포로 판단하였다. 대조군으로는 세포 유래 베시클 대신 DPBS(dulbecco's phosphate buffered saliine)을 처리한 군을 사용하였고, 유세포 분석은 독립적인 3반복 실험을 통해 실시하였다. 유세포 분석 결과를 도 19a에 나타내었고, 전체 세포 수 대비 세포 사멸률을 도 19b에 나타내었다.
도 19a에 나타낸 바와 같이, PROKR1을 결손시킨 분화 전 C2C12 세포에 DPBS만을 처리한 한 근육 세포 분화를 유도한 결과, Annexin V 및 Annexin V/ 요오드화 프로피디움 음성인 생존 세포의 수가 감소한 반면, PROKR1 과발현 세포 유래의 베시클을 처리한 PROKR1을 결손시킨 분화 전 C2C12 세포는 근육 세포 분화 후 생존 세포의 수가 현저하게 증가하였다.
도 19b에 나타낸 바와 같이, PROKR1을 결손시킨 분화 전 C2C12 세포에 PROKR1 과발현 세포 유래의 베시클을 처리한 경우, 세포 사멸율이 8.4% 수준으로 유의적으로 감소한 것을 확인하였다. 이와 같은 결과로부터, PROKR1 과발현 세포 유래의 베시클이 PROKR1을 결손시킨 C2C12세포의 생존률을 증가시키는 효과가 있음을 확인하였다.
실시예 14. 근모세포의 근관세포로의 분화에 미치는 PROKR1 과발현 세포 유래 베시클의 효과
근모세포의 근관세포로의 분화에 미치는 PROKR1 과발현 세포 유래 베시클의 효과를 확인하기 위한 실험을 실시하였다. 아무 조작을 거치지 않은 C2C12 세포주 또는 PROKR1 결손 C2C12 세포주에 DPBS, PROKR1 과발현 세포 유래 베시클 또는 PROKR1 결손 세포 유래 베시클을 처리하고, 근관세포 특이적 액틴(actin) 염료인 팔로이딘 염색을 실시하였다. 구체적으로 C2C12 세포를 약 만개씩 챔버 슬라이드에서 배양 및 분화시켰고, 6일간의 근관세포 분화 후 포르말린 (Sigma-Aldrich)으로 고정하였다. 고정된 세포는 0.1% (v/v) Triton X-100으로 세포막을 천공하였고, 2% (v/v) BSA로 블록킹 한 다음 Alexa Fluor ® 488 팔로이딘 (phalloidin, Thermo Fisher Scientific)으로 염색하였다. 세포핵은 DAPI로 염색하였다. 액틴 및 세포핵의 형광신호는 Cytation 5 (BioTek)를 이용하여 관찰하였으며, 관찰 결과를 도 20에 나타내었다.
도 20에 나타낸 바와 같이, PROKR1 과발현 세포 유래 베시클을 처리한 세포에서는 DPBS 또는 PROKR1 결손 세포 유래 베시클을 처리한 세포 대비 팔로이딘 염색된 근관세포가 현저하게 관찰되었다. 이와 같은 결과로부터 PROKR1 과발현 세포 유래 베시클이 근모세포의 근관세포 분화를 촉진하는 효과가 있음을 확인하였다.
실시예 15. PROKR1 과발현 세포 유래 베시클의 근육발생능에 대한 효과
PROKR1 과발현 세포 유래 베시클의 근육발생능에 대한 효과를 확인하기 위한 실험을 실시하였다. 아무 조작을 거치지 않은 C2C12 세포주 또는 PROKR1 결손 C2C12 세포주에 아무것도 처리하지 않은 실험군과 PROKR1 과발현 세포 유래 베시클을 처리한 실험군을 처리하고, 실시예 14와 동일한 방법으로 근분화를 유도하였다. 근분화 유도 0일차 및 6일차 세포에 대하여, 근육발생 마커 유전자인 Myh7, Mb, Myog, Pax3, Pax7, Myod 유전자의 발현을 RT-PCR을 통해 측정하였다. 구체적으로, 세포 RNA를 RNeasy mini kit (Qiagen)를 이용하여 추출하고, 추출된 5 μg의 RNA를 Super Script III 역전사 효소 (Invitrogen)를 이용하여 cDNA로 전환하였다. 전환한 cDNA로부터 표적 mRNA 발현의 정성 및 정량적 측정을 위해 표 3에 개시된 프라이머를 이용하여 real-time PCR systems (Applied Biosystems)을 수행하였다. RT-PCR 결과를 도 21에 나타내었다.
gene symbol Forward Reverse Tm
(℃)		 Amplicon
(bp)
Gapdh AGGTCGGTGTGAACGGATTTG(서열번호 3) TGTAGACCATGTAGTTGAGGTCA(서열번호 4) 60 123
Human-GAPDH AGGGCTGCTTTTAACTCTGGT(서열번호 5) CCCCACTTGATTTTGGAGGGA(서열번호 6) 60 206
Prokr1 GCTCTGGTTCGCAGGTTGAA(서열번호 7) GCAAGGTTGACGACTCCTCT(서열번호 8) 60 119
Human-PROKR1 CAATTCCAGGACGTTCTTTGCT(서열번호 9) CTGCGGATGATCTTGTCGGT(서열번호 10) 60 122
GFP CCGCATCGAGAAGTACGAGG(서열번호 11) CTGCGGATGATCTTGTCGGT(서열번호 12) 60 147
Myh7 ACTGTCAACACTAAGAGGGTCA(서열번호 13) TTGGATGATTTGATCTTCCAGGG(서열번호 14) 60 114
Mb CTGTTTAAGACTCACCCTGAGAC(서열번호 15) GGTGCAACCATGCTTCTTCA(서열번호 16) 60 108
Myog GAGACATCCCCCTATTTCTACCA(서열번호 17) GCTCAGTCCGCTCATAGCC(서열번호 18) 60 106
Pax3 TTTCACCTCAGGTAATGGGACT(서열번호 19) GAACGTCCAAGGCTTACTTTGT(서열번호 20) 60 275
Pax7 TCTCCAAGATTCTGTGCCGAT(서열번호 21) CGGGGTTCTCTCTCTTATACTCC(서열번호 22) 60 132
Myod CTACAGTGGCGACTCAGA(서열번호 23) GTAGTAGGCGGTGTCGTA(서열번호 24) 60 118
도 21에 나타낸 바와 같이, PROKR1 과발현 세포 유래 베시클을 처리한 PROKR1 결손 C2C12 세포주에서 근육 분화 유도 6일째에 근육 발생 후기 마커인 Mb, Myh7 및 Myog의 mRNA 발현량이 아무 조작을 거치지 않은 C2C12 세포주의 해당 유전자 발현 수준과 유사한 수준으로 관찰되었다. 또한, PROKR1 과발현 세포 유래 베시클을 처리한 PROKR1 결손 C2C12 세포주에서 근육 분화 유도 6일째에 근육 발생 초기 마커인 Pax3, Pax7 및 Myod도 아무 조작도 하지 않은 C2C12 세포주와 해당 유전자의 발현 수준이 유사한 것으로 관찰되었다.
실시예 16. 인슐린 자극에 의한 근관세포의 포도당 흡수능에 대한 PROKR1 과발현 세포 유래 베시클의 효과
인슐린 자극에 의한 근관세포의 포도당 흡수능에 대한 PROKR1 과발현 세포 유래 베시클의 효과를 확인하기 위해, 2-[N-(7-nitrobenzene-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D glucose (2-NBDG) (Thermo Fisher Scientific)를 이용하여 인슐린 자극에 의한 근관세포의 포도당 흡수능을 평가하였다. 근관세포로 분화된 C2C12 세포의 배지를 포도당이 없는 DMEM 배양 배지로 교체하였고, 100 nM 인슐린 (Cell applications, Inc.)을 30분간 처리하였다. 인슐린 처리 후 근관세포의 배지를 다시 포도당이 없는 DMEM 배양 배지로 교체하였고, 80 μM의 2-NBDG를 30분간 처리하였다. 세포 내 2-NBDG 흡수량은 Cytation 5 (BioTek)을 이용하여 535 nm의 흡광도에서 측정하였으며, 독립적인 3반복 실험을 실시하였다. 포도당 흡수능 측정 결과를 도 22에 나타내었다.
도 22a에 나타낸 바와 같이, 유전자 결손되지 않은 야생형 C2C12 세포주에 인슐린 자극시, PROKR1 결손 세포 유래 베시클 또는 PROKR1 과발현 세포 유래 베시클의 처리에 따른 2-NBDG 흡수의 유의한 차이가 나타나지 않았다. 따라서, 야생형 C2C12에서는 PROKR1 결손 세포 유래 베시클 또는 PROKR1 과발현 세포 유래 베시클의 처리와 무관하게, 특별한 부작용 없이 정상적인 포도당 흡수능을 나타내는 것을 확인하였다.
그러나, 도 22b에 나타낸 바와 같이, PROKR1 과발현 세포 유래 베시클을 처리한 PROKR1 결손 C2C12 세포주에 인슐린 자극시, PROKR1 결손 C2C12 세포주 및 PROKR1 결손 세포 유래 베시클을 처리한 PROKR1 결손 C2C12 세포주 대비, 2-NBDG의 흡수가 1.5배 이상 유의하게 증가한 것을 확인하였다.
이러한 결과를 통해, 분화능이 상실된 C2C12세포에 PROKR1 과발현 세포 유래 베시클을 처리하였을 때, 인슐린 자극에 의한 포도당 흡수능을 갖는 근관세포로 분화가 촉진되는 것을 확인하였다. 본 실시예에서 확인한 내용을 통해, PROKR1 과발현 세포 유래 베시클이 인슐린 감수성을 갖는 근육세포 분화율 향상을 통해 당뇨병 치료에 효과가 있는 것을 확인하였다.
이하, 본 발명의 세포 유래 베시클을 포함하는 근 질환 예방 또는 치료용 약학적 조성물의 제제예를 설명하나, 본 발명을 한정하고자 함이 아니고 단지 이를 구체적으로 설명하고자 함이다.
제제예 1. 산제의 제조
본 발명의 세포 유래 베시클 100 ㎎
유당 1 g
상기의 성분을 혼합하고 기밀포에 충진하여 산제를 제조하였다.
제제예 2. 정제의 제조
본 발명의 세포 유래 베시클 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조하였다.
제제예 3. 캡슐제의 제조
본 발명의 세포 유래 베시클 100 ㎎
옥수수전분 100 ㎎
유 당 100 ㎎
스테아린산 마그네슘 2 ㎎
상기의 성분을 혼합한 후, 통상의 캡슐제의 제조방법에 따라서 젤라틴 캡슐에 충전하여 캡슐제를 제조하였다.
제제예 4. 환의 제조
본 발명의 세포 유래 베시클 100 ㎎
유당 1.5 g
글리세린 1 g
자일리톨 0.5 g
상기의 성분을 혼합한 후, 통상의 방법에 따라 1환 당 4 g이 되도록 제조하였다.
제제예 5. 과립의 제조
본 발명의 세포 유래 베시클 100 ㎎
대두추출물 50 ㎎
포도당 200 ㎎
전분 600 ㎎
상기의 성분을 혼합한 후, 30% 에탄올 100 ㎎을 첨가하여 섭씨 60 ℃에서 건조하여 과립을 형성한 후 포에 충진하였다.
제제예 6. 정제형 건강기능식품
옥타코사놀분말 15중량%, 유당가수분해물분말 15중량%, 분리대두단백분말 15중량%, 키토올리고당 15중량% 효모추출물분말 10중량%, 비타민미네랄혼합제재 10중량%, 스테아린산 마그네슘 4.6중량%, 이산화티타늄 0.2 중량%, 및 글리세린지방산에스테르 0.2중량%와 본 발명의 세포 유래 베시클 20중량%를 배합하여 통상의 방법으로 정제형 건강기능식품을 제조한다.
제제예 7. 건강 음료
꿀 5중량%, 과당 3중량%, 염산리보플라빈나트륨 0.0001중량%, 염산피리독신 0.0001중량%, 물 86.9998중량% 및 본 발명의 세포 유래 베시클 5중량%를 배합하여 통상의 방법으로 건강 음료를 제조한다.

Claims (21)

  1. PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는, 세포 유래 베시클.
  2. 제1항에 있어서, 상기 세포 유래 베시클은 PROKR1 유전자를 도입하여 형질전환 세포를 제작하는 단계; 및 상기 형질전환 세포를 미세압출하는 단계;를 거쳐 제작하는 것인, 세포 유래 베시클.
  3. 제1항 또는 제2항에 있어서, 상기 세포 유래 베시클은 세포 내로 PROKR1 단백질 또는 이를 코딩하는 유전자의 수송능이 있는 것인, 세포 유래 베시클.
  4. 제1항 또는 제2항에 있어서, 상기 세포 유래 베시클은 근 분화촉진능이 있는 것인, 세포 유래 베시클.
  5. 제1항 또는 제2항에 있어서, 상기 세포 유래 베시클은 근모세포의 분화 후 세포자멸사(apoptosis)를 억제하는 것인, 세포 유래 베시클.
  6. 제1항 또는 제2항에 있어서, 상기 세포 유래 베시클은 인슐린 자극에 의한 근관세포의 포도당 흡수를 촉진시키는 것인, 세포 유래 베시클.
  7. 제1항 또는 제2항에 있어서, 상기 세포 유래 베시클은 유래 세포의 표지 단백질을 유래 세포 대비 3배 이상 포함하는 것인, 세포 유래 베시클.
  8. 제7항에 있어서, 상기 표지 단백질은 CD9 또는 CD81인, 세포 유래 베시클.
  9. PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, PROKR1 단백질 또는 이를 코딩하는 유전자의 세포 내 전달용 시약 조성물.
  10. 제9항에 있어서, 상기 세포 유래 베시클은 0.0001 내지 80 ㎍/mL의 농도인, PROKR1 단백질 또는 이를 코딩하는 유전자의 세포 내 전달용 시약 조성물.
  11. PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, 근 분화촉진용 시약 조성물.
  12. 제11항에 있어서, 상기 세포 유래 베시클은 0.0001 내지 80 ㎍/mL의 농도인, 근 분화촉진용 시약 조성물.
  13. 제11항에 있어서, 상기 세포 유래 베시클은 근 분화 후 세포자멸사(apoptosis)를 억제하는 것인, 근 분화촉진용 시약 조성물.
  14. PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는, 근 질환 예방 또는 치료용 약학적 조성물.
  15. 제14항에 있어서, 상기 약학적 조성물은 당뇨병 및 근 질환의 예방 또는 치료용인, 근 질환 예방 또는 치료용 약학적 조성물.
  16. 제14항에 있어서, 상기 세포 유래 베시클은 PROKR1 유전자를 도입하여 형질전환 세포를 제작하는 단계; 및 상기 형질전환 세포를 미세압출하는 단계;를 거쳐 제작하는 것인, 근 질환 예방 또는 치료용 약학적 조성물.
  17. 제14항에 있어서, 상기 근 질환은 MELAS(mitochodrial myophthy, encephalopathy, lactic acsidosis, and stroke-like episodes) 증후군, MERRF(Myoclonic Epilepsy with Ragged Red Fiber) 증후군, Kearns-Sayre 증후군, 근병증, 뇌근육병증, 근무력증, 중증 근무력증, 근위축성 측삭 경화증, 근육퇴행위축, 근위축증, 근긴장저하, 근력약화 및 근경직증으로 이루어진 군에서 선택된 1종이상의 질환인, 근 질환 예방 또는 치료용 약학적 조성물.
  18. PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 포함하는 근 질환 예방 또는 개선용 건강기능 식품조성물.
  19. 제18항에 있어서, 상기 건강기능 식품조성물은 당뇨병 및 근 질환의 예방 또는 개선용인, 근 질환 예방 또는 개선용 건강기능 식품조성물.
  20. PROKR1 (Prokineticin receptor 1) 또는 이를 코딩하는 유전자를 포함하는 세포 유래 베시클을 이를 필요로 하는 개체에 처리하는 단계; 를 포함하는 근질환 예방 또는 치료 방법.
  21. 제20항에 있어서, 상기 세포 유래 베시클은 PROKR1 유전자를 도입하여 형질전환 세포를 제작하는 단계; 및 상기 형질전환 세포를 미세압출하는 단계;를 거쳐 제작하는 것인, 방법.
PCT/KR2021/000475 2020-01-14 2021-01-13 표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법 WO2021145675A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/758,825 US20230257434A1 (en) 2020-01-14 2021-01-13 Cell-derived vesicles comprising target protein and method for producing same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200005014 2020-01-14
KR10-2020-0005014 2020-01-14
KR10-2020-0149241 2020-11-10
KR1020200149241A KR20210091650A (ko) 2020-01-14 2020-11-10 표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법

Publications (1)

Publication Number Publication Date
WO2021145675A1 true WO2021145675A1 (ko) 2021-07-22

Family

ID=76864353

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/000475 WO2021145675A1 (ko) 2020-01-14 2021-01-13 표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법

Country Status (2)

Country Link
US (1) US20230257434A1 (ko)
WO (1) WO2021145675A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110002443A (ko) * 2009-07-01 2011-01-07 주식회사이언메딕스 포유류의 유핵세포에서 유래된 마이크로베시클 및 이의 용도
KR20160093321A (ko) * 2015-01-29 2016-08-08 포항공과대학교 산학협력단 세포의 지질막에서 유래된 나노소포체 및 이의 용도

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110002443A (ko) * 2009-07-01 2011-01-07 주식회사이언메딕스 포유류의 유핵세포에서 유래된 마이크로베시클 및 이의 용도
KR20160093321A (ko) * 2015-01-29 2016-08-08 포항공과대학교 산학협력단 세포의 지질막에서 유래된 나노소포체 및 이의 용도

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BOULBERDAA M., URAYAMA K., NEBIGIL C. G.: "Prokineticin receptor 1 (PKR1) signalling in cardiovascular and kidney functions", CARDIOVASCULAR RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 92, no. 2, 1 November 2011 (2011-11-01), GB, pages 191 - 198, XP055828483, ISSN: 0008-6363, DOI: 10.1093/cvr/cvr228 *
JO W., KIM J., YOON J., JEONG D., CHO S., JEONG H., YOON Y. J., KIM S. C., GHO Y. S., PARK J.: "Large-scale generation of cell-derived nanovesicles", NANOSCALE, ROYAL SOCIETY OF CHEMISTRY, UNITED KINGDOM, vol. 6, no. 20, 1 January 2014 (2014-01-01), United Kingdom, pages 12056 - 12064, XP055780901, ISSN: 2040-3364, DOI: 10.1039/C4NR02391A *
MOK JONGSOO, PARK TAE SUB, KIM SUNHONG, KIM DAEHOON, CHOI CHEOL SOO, PARK JOONGHOON: "Prokineticin receptor 1 ameliorates insulin resistance in skeletal muscle", THE FASEB JOURNAL, FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY, & EXPERIMENTAL BIOLOGY MEETING; SAN DIEGO, CA, USA; APRIL 21 -25, 2018, vol. 35, no. 2, 1 February 2021 (2021-02-01), & EXPERIMENTAL BIOLOGY MEETING; SAN DIEGO, CA, USA; APRIL 21 -25, 2018, XP055828482, ISSN: 0892-6638, DOI: 10.1096/fj.202001641R *

Also Published As

Publication number Publication date
US20230257434A1 (en) 2023-08-17

Similar Documents

Publication Publication Date Title
WO2019198995A1 (ko) 엑소좀 기반의 면역세포의 교차분화 방법
WO2021167389A1 (ko) 엠토르 신호전달 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약제학적 조성물
WO2011052883A9 (ko) Ｓｏｃｓ２ 유전자의 발현을 조절하여 자연 살해 세포를 활성화시키는 방법
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
WO2022131756A1 (ko) 근육질환, 비만 또는 당뇨병 치료, 또는 예방용 조성물
WO2021145675A1 (ko) 표적 단백질을 포함하는 세포 유래 베시클 및 이의 제조방법
WO2020071641A1 (ko) Tsp1 단백질 억제제를 유효성분으로 함유하는 파브리 병의 예방 또는 치료용 약학적 조성물
WO2019124803A1 (ko) 셀라지넬라 로씨 추출물, 이의 분획물을 포함하는 대사증후군의 예방 또는 치료용 조성물
WO2016159627A1 (ko) 항암 활성을 갖는 펩티드, 이를 유효성분으로 함유하는 암 예방 및 치료용 약학 조성물 및 건강기능식품 조성물
WO2021045567A1 (ko) 세포 유래 베시클을 이용한 침샘 질환 예방 또는 치료용 조성물
WO2022211473A1 (ko) Faf1(fas-associated factor 1)이 탑재된 엑소좀 및 이의 항암제로서의 용도
WO2018135738A1 (ko) 매트릭스 gla 단백질을 유효성분으로 함유하는 미오스타틴 활성 저해용 조성물
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2022124626A1 (ko) 자가유지능이 향상된 중간엽줄기세포를 선별하는 방법 및 그에 의해 선별된 중간엽줄기세포
WO2020122498A1 (ko) 클로날 줄기세포를 포함하는 췌장염 치료용 약학적 조성물
WO2015108372A1 (ko) 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법
WO2022131700A1 (ko) 펩타이드를 이용하는 줄기세포 유래 고순도 세포외 소포체의 대량 생산 방법
WO2023214824A1 (ko) 효능이 증진된 줄기세포 유래 세포외소포를 포함하는 상처 치료용 조성물
WO2022235054A1 (ko) 2,6-디클로로-4-(4-(4-하이드록시사이클로헥실아미노)-7h-피롤로[2,3-d]피리미딘-5-일)페놀을 유효성분으로 포함하는 암의 예방, 개선 또는 치료용 약학적 조성물
WO2019245266A1 (ko) 암 유래 amf를 유효성분으로 함유하는 항암용 조성물
WO2023244026A1 (ko) Foxm1 억제제 및 면역관문 억제제를 포함하는 암의 예방 또는 치료용 약학적 조성물
WO2022114747A1 (ko) 3중 공배양을 이용한 생체외 간질환 모델 및 그 제조 방법
WO2021085920A1 (ko) PPARγ 단백질에 특이적으로 결합하는 RNA 앱타머 및 상기 RNA 앱타머의 용도
WO2022154169A9 (ko) Sp-fa 접합체를 유효성분으로 함유하는 항암용 조성물
WO2022102962A1 (ko) 카우다틴 화합물을 유효성분으로 포함하는 항암용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21741710

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21741710

Country of ref document: EP

Kind code of ref document: A1