WO2021132309A1 - Composition pharmaceutique - Google Patents

Composition pharmaceutique Download PDF

Info

Publication number
WO2021132309A1
WO2021132309A1 PCT/JP2020/048114 JP2020048114W WO2021132309A1 WO 2021132309 A1 WO2021132309 A1 WO 2021132309A1 JP 2020048114 W JP2020048114 W JP 2020048114W WO 2021132309 A1 WO2021132309 A1 WO 2021132309A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
gene
cancer
tumor
cells
Prior art date
Application number
PCT/JP2020/048114
Other languages
English (en)
Japanese (ja)
Inventor
稲澤　譲治
泰行 玄
井上　純
智輝 村松
祐希 ▲高▼川
Original Assignee
国立大学法人 東京医科歯科大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人 東京医科歯科大学 filed Critical 国立大学法人 東京医科歯科大学
Publication of WO2021132309A1 publication Critical patent/WO2021132309A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the present invention relates to a pharmaceutical composition.
  • Cancer is the leading cause of death in Japan, and according to the statistics of the National Cancer Center (2012), the probability of getting cancer in a lifetime is high at 63% for Japanese men and 47% for women. According to Ministry of Health, Labor and Welfare statistics (2015), cancer accounts for 32% of Japanese deaths, 24% of women, and about one-third of the total population dies of cancer. Cancer deaths continue to increase, with 11.4 million people worldwide expected to die from cancer annually in 2030.
  • WO 2019/107487 focuses on the relationship between bromodomain protein (BRD4) and cancer, and contains specific microRNAs and pharmaceutical compositions used in the treatment of tumors. Proposed.
  • An object of the present invention is to provide a pharmaceutical composition that suppresses the expression of a bromodomain protein (BRD4) gene and can be used for treating tumors.
  • BBD4 bromodomain protein
  • the first aspect encodes at least one microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p.
  • it contains a polynucleotide having the same base sequence as the transcript of a gene or its processing product, or a base sequence in which 1 to 5 bases are substituted, deleted or added in the base sequence of the transcript or its processing product.
  • the second aspect encodes at least one microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p.
  • BRD4 gene-related disease containing a polynucleotide having the same base sequence as the transcript of a gene or its processing product, or a base sequence in which 1 to 5 bases are substituted, deleted or added in the base sequence of the transcript or its processing product. It is a pharmaceutical composition used for the treatment of.
  • the third aspect encodes at least one microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p.
  • a method of treating a tumor including administering the dose to the subject.
  • the fourth aspect encodes at least one microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p.
  • a method of treating a BRD4 gene-related disorder which comprises administering an amount to a subject.
  • the present invention it is possible to provide a pharmaceutical composition that suppresses the expression of the BRD4 gene and can be used for treating tumors.
  • FIG. 5 is a diagram showing the effect on cell proliferation when knockdown of APEX1 gene, PRA1 gene, and POLD4 gene is performed on colorectal cancer cell line using siRNA.
  • microRNA includes a polynucleotide (oligonucleotide) composed of a ribonucleotide, a polynucleotide (oligonucleotide) composed of a ribonucleotide and a modified nucleotide, and a polynucleotide (oligonucleotide) composed of a modified nucleotide. included.
  • the microRNA may be single-stranded or double-stranded.
  • the pharmaceutical composition is at least one microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p.
  • a polynucleotide having the same base sequence as a transcript of a gene encoding (hereinafter, also referred to as a specific microRNA) or a processing product thereof, or a polynucleotide having the same base sequence as the transcript thereof or a processing product thereof contains 1 to 5 bases.
  • the pharmaceutical composition may be an agent that suppresses the expression of the BRD4 gene.
  • the pharmaceutical composition is at least one micro selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p.
  • the tumor to be treated may be a tumor expressing the BRD4 gene.
  • the pharmaceutical composition encodes at least one microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751 and miR-92a-2-5p.
  • BRD4 is a protein having two bromodomains that bind to acetylated modified lysine and a region that binds to p-TEFb (positive transcription evolution factor b) on the C-terminal side. Acetylation modification of histones is positively correlated with transcriptional activity, and p-TEFb activates transcription by inactivating a protein that suppresses transcriptional RNA polymerase II.
  • BRD4 is said to have the function of mobilizing p-TEFb and promoting transcription by binding to the lysine of acetylated modified histones.
  • abnormal activation of BRD4 gene expression is thought to contribute to tumor cell proliferation. Therefore, suppressing the expression of the BRD4 gene may be effective in the treatment of cancer.
  • MicroRNAs are endogenous, suppressing gene expression by interfering with their translation or stabilization through binding of the target transcript (mRNA) to the coding (CDS) region or the 3'untranslated region (3'UTR). It is a small non-coding RNA.
  • mRNA target transcript
  • CDS coding
  • 3'UTR 3'untranslated region
  • miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p are excellent for tumor cells in which expression of BRD4 gene is observed by suppressing expression of BRD4 gene.
  • at least miR-876-3p suppresses the expression of the RSK1 gene and has an excellent growth-suppressing effect on tumor cells in which the expression of the RSK1 gene is observed.
  • at least miR-1293 has an excellent growth inhibitory effect on tumor cells in which expression of at least one selected from the group consisting of APEX1, RPA1 and POLD4 is observed.
  • the specific microRNA By suppressing the expression of not only the BRD4 gene but also other tumor-related genes, the specific microRNA can exhibit a more excellent growth-suppressing effect on tumor cells. Furthermore, at least miR-1293 has an excellent growth inhibitory effect on tumor cells having a pathogenic mutation in the BRCA1 / 2 gene or in a BRCAness state.
  • the polynucleotide contained in the pharmaceutical composition encodes a microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p. It may have the same base sequence as the transcript of the gene or its processing product.
  • the primary transcript of the gene encoding the microRNA is called the early transcript (pri-miRNA) and generally has a stem-loop hairpin structure.
  • Pri-miRNAs are converted to mature miRNA precursors (pre-miRNAs) with a stem-loop structure by an RNase III-like enzyme called Drosha.
  • transcripts of genes encoding microRNAs or processing products thereof include tri-miRNAs, pre-miRNAs and mature miRNAs.
  • double-stranded mature miRNA there are three embodiments: when only one strand exerts a desired effect, when each strand exerts a desired effect, and when a double-stranded state exerts a desired effect.
  • the miRNA-derived polynucleotides herein may be either single-stranded or double-stranded, preferably double-stranded.
  • the polynucleotide contained in the pharmaceutical composition is a microRNA selected from the group consisting of miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634 and miR-92a-2-5p. It may have the same base sequence as a mutant that retains the function of the transcript of the encoding gene or its processing product.
  • the mutant may have a base sequence in which 1 to 5 bases are substituted, deleted or added in the base sequence of the transcript of the gene encoding microRNA or the processing product thereof.
  • the number of bases substituted, deleted or added is preferably 1 to 3, and may be 1 or 2.
  • the mutant may have, for example, 80% or more, preferably 85% or more, 90% or more, or 95% or more sequence homology with respect to the original base sequence. Sequence homology is calculated using, for example, BLAST.
  • miR-1293 may be hsa-miR-1293 and may have the base sequence of SEQ ID NO: 1.
  • miR-876-3p may be hsa-miR-876-3p and may have the nucleotide sequence of SEQ ID NO: 2.
  • miR-4438 may be hsa-miR-4438 and may have the nucleotide sequence of SEQ ID NO: 3.
  • miR-6751 may be hsa-miR-6751, hsa-miR-6751-5p, and may have the nucleotide sequence of SEQ ID NO: 4.
  • miR-634 may be hsa-miR-634 and may have the nucleotide sequence of SEQ ID NO: 5.
  • miR-92a-2-5p may be hsa-miR-92a-2-5p and may have the base sequence of SEQ ID NO: 6.
  • the pharmaceutical composition may contain the polynucleotide as a single strand or may contain the polynucleotide as a double strand.
  • the polynucleotide When the polynucleotide is contained as a double strand, it may have at least a partially double strand, and at least one of the ends of the double strand may have a single strand portion. May have at least one pair of mismatched base pairs or base deficiencies.
  • the double-stranded portion has a single-stranded portion at the end, it is preferable to have the single-stranded portion at least on the 3'side.
  • the chain length of the single-stranded portion is, for example, 2 residues or more and 20 residues or less, preferably 2 residues or more and 12 residues or less, or 2 residues or more and 5 residues or less.
  • the mismatched base pairs may be arranged continuously or discontinuously, and the total number of mismatched base pairs is, for example, 10 bases. It may be pair or less, preferably 6 base pairs or less, or 4 base pairs or less, and may be, for example, 1 base pair or more, 2 base pairs or more, or 3 base pairs or more.
  • complementary base pairs include thermodynamically stable non-Watson click type wobble base pairs (eg, GU).
  • the double-stranded polynucleotide contained in the pharmaceutical composition may have the base sequence of any of the following (1) to (6) or the base sequence of a mutant thereof.
  • the pharmaceutical composition may contain at least one selected from the group consisting of double-stranded polynucleotides having the base sequence of any of the following (1) to (6) or the base sequence of a variant thereof. ..
  • the first double-stranded polynucleotide is derived from the gene encoding hsa-miR-1293.
  • the first double-stranded polynucleotide consists of a single-stranded polynucleotide having the nucleotide sequence "UGGGUGGUCUGGAGAUUGUGGC” (SEQ ID NO: 1) and a single-stranded polynucleotide having the nucleotide sequence "GCACAAAUCUCCGGACCUUA” (SEQ ID NO: 7). It is a chain polynucleotide.
  • SEQ ID NO: 1 is the base sequence of hsa-miR-1293 (mature miRNA) and can form the complementary structure shown below.
  • the RNA on the 5'side having the nucleotide sequence of SEQ ID NO: 1 is positioned as the guide strand
  • the RNA on the 3'side having the nucleotide sequence of SEQ ID NO: 7 is positioned as the passenger strand.
  • the second double-stranded polynucleotide is derived from the gene encoding hsa-miR-876-3p.
  • the second double-stranded polynucleotide is a substantially complementary 2 consisting of a single-stranded polynucleotide having the nucleotide sequence "UGGUGUUUAGAAAGUAAUUCA" (SEQ ID NO: 2) and a single-stranded polynucleotide having the nucleotide sequence "UGGAUUUCUUGUAUCCA” (SEQ ID NO: 8). It is a main chain polynucleotide.
  • SEQ ID NO: 2 is the base sequence of hsa-miR-876-3p (mature miRNA) and can form a substantially complementary structure shown below.
  • the RNA on the 3'side having the nucleotide sequence of SEQ ID NO: 2 is positioned as the guide strand
  • the RNA on the 5'side having the nucleotide sequence of SEQ ID NO: 8 is positioned as the passenger strand.
  • substantially complementary means a portion in which a part of the double-stranded polynucleotide is a single strand and / or a portion in which a part of the base pair is not bonded by a hydrogen bond, as shown in the following formula. It is in a state of constituting a double-stranded polynucleotide as a whole while containing (mismatch).
  • the third double-stranded polynucleotide is derived from the gene encoding hsa-miR-4438.
  • the third double-stranded polynucleotide is a complementary two-stranded polynucleotide consisting of the single-stranded polynucleotide of the base sequence "CAAGGCUUAGAAAAGACAGU” (SEQ ID NO: 3) and the single-stranded polynucleotide of the base sequence "ACUGUCUUUCUAAGCCUGUG” (SEQ ID NO: 9). It is a chain polynucleotide.
  • SEQ ID NO: 3 is the base sequence of hsa-miR-4438 (mature miRNA) and can form the complementary structure shown below.
  • the RNA on the 3'side having the nucleotide sequence of SEQ ID NO: 3 is positioned as the guide strand
  • the RNA on the 5'side having the nucleotide sequence of SEQ ID NO: 9 is positioned as the passenger strand.
  • the fourth double-stranded polynucleotide is derived from the gene encoding hsa-miR-6751-5p.
  • the fourth double-stranded polynucleotide is a substantially complementary 2 consisting of a single-stranded polynucleotide having the nucleotide sequence "UGGGGGGUGAGGUGUGGUGUCUGUGG” (SEQ ID NO: 4) and a single-stranded polynucleotide having the nucleotide sequence "ACUGAGCCUCUCUCUCUCCAG" (SEQ ID NO: 10). It is a main chain polynucleotide.
  • SEQ ID NO: 4 is the base sequence of hsa-miR-6751-5p (mature miRNA), which can form a substantially complementary structure shown below.
  • the RNA on the 5'side having the nucleotide sequence of SEQ ID NO: 4 is positioned as the guide strand
  • the RNA on the 3'side having the nucleotide sequence of SEQ ID NO: 10 is positioned as the passenger strand.
  • the fifth double-stranded polynucleotide is derived from the gene encoding hsa-miR-634.
  • the fifth double-stranded polynucleotide is a substantially complementary 2 consisting of a single-stranded polynucleotide having the nucleotide sequence "AACCAGCACCCCAAACUUGGAC” (SEQ ID NO: 5) and a single-stranded polynucleotide having the nucleotide sequence "AUCGAGGGUUGGGGGCUUGGU” (SEQ ID NO: 11). It is a main chain polynucleotide.
  • SEQ ID NO: 5 is the base sequence of hsa-miR-634 (mature miRNA) and can form a substantially complementary structure as shown below.
  • the RNA on the 3'side having the nucleotide sequence of SEQ ID NO: 5 is positioned as the guide strand
  • the RNA on the 5'side having the nucleotide sequence of SEQ ID NO: 11 is positioned as the passenger strand.
  • the sixth double-stranded polynucleotide is derived from the gene encoding hsa-miR-92a-2.
  • the sixth double-stranded polynucleotide is a substantially complementary 2 consisting of a single-stranded polynucleotide having the nucleotide sequence "GGGUGGGAUUUGUGCAUUAC” (SEQ ID NO: 6) and a single-stranded polynucleotide having the nucleotide sequence "UAUUGCACUUGUCCGCGCCUGU" (SEQ ID NO: 12). It is a main chain polynucleotide.
  • SEQ ID NO: 6 is the base sequence of hsa-miR-92a-2 (mature miRNA) and can form a substantially complementary structure as shown below.
  • the RNA on the 5'side having the nucleotide sequence of SEQ ID NO: 6 is positioned as the guide strand
  • the RNA on the 3'side having the nucleotide sequence of SEQ ID NO: 12 is positioned as the passenger strand.
  • the nucleotide constituting the polynucleotide may contain at least one ribonucleotide, and may contain at least one of the corresponding deoxyribonucleotide and modified nucleotide in place of the ribonucleotide.
  • Modified nucleotides include nucleotides with a modified phosphate moiety, nucleotides with a modified sugar moiety, nucleotides with a modified base moiety, and the like.
  • the modified nucleotide may be one in which any of the phosphoric acid moiety, the sugar moiety and the base moiety is modified, and may be a combination of two or more kinds of modifications.
  • JP-A-10-304889, WO 2005/021570, JP-A-10-195098, JP-A-2002-521310, WO 2007/143315, International Publication No. Publication No. 2008/043753, International Publication No. 2008/029619, International Publication No. 2008/049085, etc. can be referred to.
  • Non-crosslinked modification and crosslinked modification are known as modifications of the sugar moiety.
  • Non-crosslinking type modification include modification of the 2'-hydroxyl group such as fluorination (F) at the 2'position, O-methylation, and MOE formation, and morpholinonucleation.
  • examples of the crosslinked modification include LNA (2', 4'-BNA) conversion, ENA conversion and the like.
  • the polynucleotide according to this embodiment can be synthesized by using a known method for synthesizing a polynucleotide or the like.
  • Examples of the method for synthesizing a polynucleotide include a phosphoromidide method and an improved method thereof, an H-phosphonate method and an improved method thereof, and an enzyme synthesis method (in vitro transcription method). It is also possible to apply the nucleic acid of a commercially available product or the nucleic acid of which is manufactured by consignment.
  • the pharmaceutical composition may further contain other antitumor compounds as an active ingredient in addition to the polynucleotide.
  • Other antitumor compounds include, for example, antimetabolites, molecular targeted drugs, alkylating agents, plant alkaloids, anticancer antibiotics, platinum preparations, hormonal agents, biological response regulators, immune checkpoints. Inhibitors and the like can be mentioned.
  • the pharmaceutical composition may be prepared in the form of a pharmaceutical composition by containing a suitable pharmaceutical pharmaceutical carrier together with the nucleic acid (polynucleotide) as the active ingredient described above.
  • a suitable pharmaceutical pharmaceutical carrier can be selected according to the mode of use, and excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, diluents and the like can be used. Can be used. It is also possible to prepare a desiccant that can be made liquid at the time of use by adding an appropriate carrier to the nucleic acid as the active ingredient.
  • the pharmaceutical composition may contain a polynucleotide as an active ingredient in a pharmaceutically acceptable carrier in a state of being encapsulated or bound.
  • a pharmaceutically acceptable carrier in a state of being encapsulated or bound.
  • drug delivery systems such as high molecular weight micelles, nanoparticles composed of cyclodextrin-containing polymers, stable nucleic acid lipid particles, and multifunctional envelope-type nanostructures can be utilized to further improve the effects of pharmaceutical compositions. It is possible.
  • the form of the pharmaceutical composition is not particularly limited as long as it can effectively contain the nucleic acid as the active ingredient, and is a solid agent such as a tablet, a powder, a granule, or a pill, or an ointment. It may be an agent or a pill agent. It is also preferable to use an injection form such as a liquid, a suspension, or an emulsion. At present, topical administration of pharmaceutical compositions is effective. Dosage forms suitable for this dosage form are usually in the form of injections, ointments, or haps.
  • the active ingredient is directly injected into the tumor by injection from outside the body such as intravenous, subcutaneous, intradermal, or intramuscular injection, and further, the active ingredient is injected into the body using an endoscope. It is performed by directly injecting the active ingredient into a tumor (intradigestive tract, uterus, bladder, etc.). Topical administration using an ointment or a happing agent is carried out in such a manner that the active ingredient is directly infiltrated against skin cancer.
  • the dose of the nucleic acid as the active ingredient to the human body is, for example, 0.01 ⁇ g or more and 1000 mg or less per adult per day. This administration may be performed once a day, or twice or more and 5 times or less, and may be performed every day or every few days.
  • the pharmaceutical composition is used in the treatment of tumors.
  • the treatment of the tumor may be any treatment performed on the tumor, and examples thereof include treatment of the tumor, improvement, suppression of progression (prevention of deterioration), prevention, alleviation of symptoms caused by the tumor, and the like. ..
  • the pharmaceutical composition contains a polynucleotide that suppresses the expression of the BRD4 gene
  • the tumor to be treated preferably contains a tumor cell expressing the BRD4 gene.
  • Tumors to be treated include esophageal cancer, lung cancer, oral cancer, gastric cancer, colon cancer, uterine cancer, skin cancer, brain tumor, neuroblastoma, glioblastoma, breast cancer, pancreatic cancer, and ovary.
  • the tumors to be treated are preferably colon cancer, pancreatic cancer, oral cancer, lung cancer, esophageal cancer, gastric cancer, uterine cancer, skin cancer, hematological tumor, brain tumor, neuroblastoma, collagen bud. It may be at least one selected from the group consisting of tumor, breast cancer, ovarian cancer, prostate cancer, bladder cancer, esophageal cancer, liver cancer and renal cancer.
  • topical administration that is, a tumor in which the pharmaceutical composition can be brought into direct contact with the tumor is suitable as a treatment target.
  • the pharmaceutical composition may be used in the treatment of tumors expressing the RSK1 gene. It is particularly suitable when the pharmaceutical composition contains, for example, a polynucleotide derived from a gene encoding miR-876-3p as an active ingredient.
  • RSK1 is a member of the RSK (ribosomal S6 kinase) family and is a growth factor-controlled serine threonine kinase.
  • RSK1 is involved in mitogen-activated kinase (MAPK) cascade activation and stimulates cell proliferation and differentiation.
  • MAPK mitogen-activated kinase
  • RSK1 activated by the MAPK cascade is known to activate S6 kinase, and as a result, the mTOR pathway is activated to promote cell proliferation and survival. Inhibitors of this mTOR pathway have already been clinically applied in the treatment of cancer.
  • the pharmaceutical composition may be used in the treatment of tumors expressing at least one gene selected from the group consisting of APEX1, RPA1 and POLD4. It is particularly suitable when the pharmaceutical composition contains, for example, a polynucleotide derived from a gene encoding miR-1293 as an active ingredient.
  • APEX1, RPA1 and POLD4 are all genes involved in DNA repair. It is considered that replication stress is applied to cancer due to the accumulation of gene mutations and structural abnormalities, and PARP inhibitors are clinically applied as therapeutic agents that inhibit the DNA repair pathway.
  • the pharmaceutical composition when aiming for "coexistence with cancer", it can be an indication target for pharmaceutical compositions. That is, the pharmaceutical composition is also used when aiming to prevent malignant transformation of cancer and complete natural life by suppressing the expression of genes such as RSK1, APEX1, RPA1, and POLD4, as well as the expression of BRD4 gene in cancer. Things are considered suitable.
  • the above gene expression can be quantified according to a conventional method.
  • a method for quantifying the expression of BRD4 gene, RSK1 gene, APEX1 gene, RPA1 gene, POLD4 gene and the like Northern blotting method, Western blotting method, in situ hybridization method (ISH method), quantitative RT-PCR method and the like.
  • Examples thereof include (including real-time PCR method), RNase protection assay, in situ transcription method, expression array analysis method, immunohistochemical staining method, and modifications of these methods.
  • genes such as BRD4, RSK1, APEX1, RPA1, and POLD4 in the tumor to be treated may be overexpressed.
  • the presence or absence of overexpression of a predetermined gene can be specified as follows. Appropriate cutoff values are set comprehensively or individually for each tumor based on the normal expression level of each gene. By applying the above-mentioned gene expression quantification method to a tumor to be treated and applying the cutoff value to the expression quantification value of a predetermined gene in the tumor, an excess of the predetermined gene is applied. The presence or absence of expression can be specified. Cancers in which such overexpression of a predetermined gene is observed can be specified as an appropriate application target of the pharmaceutical composition.
  • the pharmaceutical composition may be used in the treatment of tumors having a pathogenic mutation in the BRCA1 / 2 gene. It is particularly suitable when the pharmaceutical composition contains, for example, a polynucleotide derived from a gene encoding miR-1293 as an active ingredient.
  • the BRCA1 / 2 gene is a gene that plays an important role in homologous recombination repair at the time of DNA damage, and BRCA1 and BRCA2 are known. Examples of pathogenic mutations in the BRCA1 / 2 gene include frameshift mutations, nonsense mutations, and methylation. Further, the tumor to be treated may be a so-called BRCAness. BRCAness is a DNA damage repair mechanism similar to the pathological mutation of the BRCA1 / 2 gene, which causes homologous recombination dysfunction due to modulation of other factors even if no pathological mutation is found in the BRCA1 / 2 gene itself. The state in which the abnormality of is caused.
  • PAPR poly (ADP ribose) polymerase
  • PAPR poly (ADP ribose) polymerase
  • a pharmaceutical composition containing a polynucleotide derived from a gene encoding miR-1293 is also expected to be effective against tumors that have become resistant to PAPR inhibitors.
  • the target of treatment of the pharmaceutical composition is not limited to the tumor, but may be a disease exhibiting the above-mentioned genetic characteristics.
  • Diseases to be treated based on genetic characteristics include, for example, acute myelogenous leukemia (AML), mixed lineage leukemia (MLL), and barkit lymphoma as diseases related to the BRD4 gene.
  • lymphoma the most common brain tumors in childhood, medulloblastoma, MYCN-amplified neuroblastoma, castration-resistant prostate cancer (CRPC), Ewing's sarcoma, colorectal cancer, lymphoma, leukemia, multiple myeloma, solid tumor (eg, cancer of the pancreas and prostate) ), Breast cancer, non-small cell lung carcinoma (NSCLC), myelodysplastic syndromes (MDS), myeloproliferative neoplasms, foliar tumors that cannot be classified (Phyllodes) tumor), diffuse large B-cell lymphoma (DLBCL), triple negative breast cancer (TNBC), pancreatic ductal adenocarcinoma, polymorphic glioma Cancer (glioblastoma multiforme), type 2 diabetes (Type 2 diabetes mellitus), ischemic heart diseases (for example, Int. J. Mol. Sci. 2016, 17, _1849; Cold Spring
  • a tumor treatment method is a method of treating a tumor, which comprises administering an effective amount of the pharmaceutical composition to a subject.
  • the tumor to be treated is as described above, and is, for example, a tumor expressing at least one gene selected from the group consisting of BRD4, RSK1, APEX1, RPA1 and POLD4. Further, the tumor may have a pathological mutation in the BRCA1 / 2 gene or is in a BRCAness state.
  • the details of the pharmaceutical composition and the administration method are as described above.
  • the subject of treatment is, for example, a mammal, which includes a human.
  • the target of treatment may be a non-human animal or a human.
  • the present invention also includes, as another aspect, the use of the polynucleotide in the production of a pharmaceutical composition used in the treatment of a tumor, the use of the polynucleotide in the treatment of a tumor, and the polynucleotide used in the treatment of a tumor. To do.
  • MicroRNA and siRNA A synthetic product of double-stranded microRNA using hsa-miR-1293 (mature miRNA) as a guide strand (SEQ ID NO: 1) was obtained from Ambion (Ambion, Inc .: USA) (trade name: MC13698).
  • the microRNA is a double-stranded RNA having the same base sequence as the following natural type, and contains a modified nucleotide.
  • this double-stranded RNA will be referred to as "miR-1293" unless otherwise specified.
  • a synthetic product of double-stranded microRNA using hsa-miR-876-3p (mature miRNA) as a guide strand (SEQ ID NO: 2) was obtained from Ambion (trade name: MC12886).
  • the microRNA is a double-stranded RNA having the same base sequence as the following natural type, and contains a modified nucleotide.
  • this double-stranded RNA will be referred to as "miR-876-3p" unless otherwise specified.
  • a synthetic product of double-stranded microRNA using hsa-miR-4438 (mature miRNA) as a guide strand (SEQ ID NO: 3) was obtained from Ambion (trade name: MC22634).
  • the microRNA is a double-stranded RNA having the same base sequence as the following natural type, and contains a modified nucleotide.
  • this double-stranded RNA will be referred to as "miR-4438" unless otherwise specified.
  • a synthetic product of double-stranded microRNA using hsa-miR-6751-5p (mature miRNA) as a guide strand (SEQ ID NO: 4) was obtained from Ambion (trade name: MC27194).
  • the microRNA is a double-stranded RNA having the same base sequence as the following natural type, and contains a modified nucleotide.
  • this double-stranded RNA will be referred to as "miR-6751" unless otherwise specified.
  • microRNA A synthetic product of double-stranded microRNA using hsa-miR-634 (mature miRNA) as a guide strand (SEQ ID NO: 5) was obtained from Ambion (trade name: MC11538).
  • the microRNA is a double-stranded RNA having the same base sequence as the following natural type, and contains a modified nucleotide.
  • this double-stranded RNA will be referred to as "miR-634" unless otherwise specified.
  • a synthetic product of double-stranded microRNA using hsa-miR-92a-2 (mature miRNA) as a guide strand (SEQ ID NO: 6) was obtained from Ambion (trade name: MC12524).
  • the microRNA is a double-stranded RNA having the same base sequence as the following natural type, and contains a modified nucleotide.
  • this double-stranded RNA will be referred to as "miR-92a-2" unless otherwise specified.
  • Control miRNA negative control # 1; miR-NC (Ambion) was used as the control microRNA.
  • RSK1 siGENOME SMARTpool: M-003025-04
  • APEX1 siGENOME SMARTpool: M-01237-01
  • BRD4 siGENOME SMARTpool: M-004937-02-0005
  • RPA1 siGENOME49ol
  • the siRNAs for POLD4 siGENOME SMARTpool: M-014013-1) were obtained from Dermacon.
  • Antibodies As antibodies for Western blot, anti-BRD4 antibody (cell signing), anti-cleave PARP antibody (cell signing), anti-RSK1 antibody (R & D Systems), anti-APEX1 antibody (proteintech), anti-phosphorylation RSK1 antibody (R & D Systems), anti-phosphorylated P70S6K antibody (cell signing), anti-phosphorylated S6 antibody (cell signing), anti-MYC antibody (cell signing), anti-POLD4 antibody (proteintech), anti- ⁇ H2AX antibody (Cell signing) and anti- ⁇ -actin antibody (Sigma) were used.
  • Anti-BRD4 antibody (Atlas antibodies), anti-RSK1 antibody (Atlas antibodies), anti-APEX1 antibody (proteintech), anti-RPA1 antibody (abcam), and anti-POLD4 antibody (MyBioSour) for immunohistochemical staining. ..
  • Example A1 Primary screening of miRNA that suppresses cell proliferation HCT116 +/ + cells and HCT116 ⁇ / ⁇ cells (6000 cells / well) are included in the miRNA library [miRVana miRNA mimic Library V21 (Ambion)]. 10 nmol / L of 2565 types of miRNA or control miRNA (miR-NC) was introduced using Lipofectamine RNAiMAX (Invitrogen) according to the attached procedure manual. Cell viability was evaluated by crystal violet (CV) staining assay 3 days after introduction. The CV staining assay was performed as follows. Cells were washed with PBS and fixed with 10% formaldehyde PBS containing 0.2% CV for 5 minutes.
  • CV staining assay was performed as follows. Cells were washed with PBS and fixed with 10% formaldehyde PBS containing 0.2% CV for 5 minutes.
  • FIG. 1 shows the results of the primary screening in the above HCT116 +/+ and HCT116 ⁇ / ⁇ cells.
  • the ratio of the number of surviving cells when compared with the control miRNA when 2565 kinds of miRNAs are introduced is shown.
  • the horizontal axis shows the result of HCT116 +/ + cells, and the vertical axis shows the result of HCT116 ⁇ / ⁇ cells.
  • the relative number of viable cells when the number of viable cells when transfected with the control miRNA is 1.
  • the ratio to the control was set to less than 0.3 as a standard for the cell proliferation inhibitory effect.
  • 138 types of miRNAs showed a growth inhibitory effect on both HCT116 + / + and HCT116 ⁇ / ⁇ cells.
  • the cell proliferation inhibitory effect was observed in 630 types in HCT116 + / +, 141 types were observed in HCT116 ⁇ / ⁇ , and 138 types of miRNAs were common to both.
  • Table 14 shows the results of the secondary screening.
  • the ratio of the number of surviving cells when compared with the control miRNA when each of the 138 kinds of miRNAs extracted in the primary screening is introduced is shown.
  • the relative number of viable cells when the number of viable cells when transfected with the control miRNA is 1.
  • the ratio with the control was set to less than 0.6.
  • 7 types of miRNAs showing a growth inhibitory effect in all 10 types of cancer cells are shown.
  • Example A2> (Western blot) HCT116 +/ + cells, HCT116 into which miR-NC, miR-876-3p, miR-1293, miR-4438, miR-6751-5p, miR-92a-5p, miR-634, or miR-3140-3p were introduced.
  • Western blots were performed on the samples obtained from ⁇ / ⁇ cells and HOC313 cells to examine the expression level of BRD4. Western blotting was performed as follows. SDS-PAGE was performed on the lysates of all cells, and the protein was transferred to a PVDF membrane (GE Healthcare).
  • the membrane was reacted with the antibody overnight at 4 ° C.
  • the dilution ratio of the primary antibody was anti-BRD4 antibody (1/1000) and anti- ⁇ -actin antibody (1/5000).
  • HRP-binding anti-mouse or anti-rabbit IgG antibody both 1/5000 was exposed to HRP-binding anti-mouse or anti-rabbit IgG antibody (both 1/5000) at room temperature for 1 hour.
  • the bound antibody was visualized using the SuperSignal West Femto Substrate (Thermo Fisher Scientific). The results are shown in Fig. 2-1.
  • miR-876-3p As shown in FIG. 2-1 in these three types of cancer cell lines, miR-876-3p, miR-1293, miR-4438, miR-6751-5p, miR-92a-5p, miR-634, or Suppression of BRD4 gene expression was observed by introducing miR-3140-3p.
  • Example A3> (Luciferase Reporter Assay) The interaction between miRNA and the BRD4 gene was evaluated by a luciferase reporter assay using a construct in which the 3'UTR region of the BRD4 gene was incorporated into a luciferase vector.
  • FIG. 2-2 (A) shows the results of verification of miR-1293 by the luciferase reporter assay.
  • the luciferase reporter plasmid used for the assay is pmiRGlo Dual-Luciferase miRNA Target Expression Vector (Promega).
  • Wt oligonucleotide
  • Mt oligonucleotide
  • the luciferase reporter plasmid was introduced into HOC313 cells using Lipofectamine 2000 (In vitrogen) according to the attached procedural document, and the next day miR-1293 or control miRNA was introduced. Two days later, firefly luciferase activity and sea shiitake mushroom luciferase activity were measured using Dual-Luciferase Reporter Assay System (Promega). Relative luciferase activity was calculated by standardizing firefly luciferase activity by correcting for the corresponding internal standard control, Shiitake mushroom luciferase activity.
  • miR-1293 With the introduction of miR-1293, a decrease in luciferase activity corresponding to the wild-type 3'UTR region was observed at two locations, R1 and R4, in the 3'UTR region of BRD4, and the nucleotide sequence of the guide chain of miR-1293 was observed. Luciferase activity was restored in the vector in which the matching region was mutated. From these results, it was shown that miR-1293 significantly suppressed the expression of the BRD4 gene directly by the action of the BRD4 gene on the two 3'UTR regions of R1 and R4.
  • FIG. 2-2 shows the results of verification by the luciferase reporter assay of miR-876-3p.
  • the assay was performed in the same manner as above except that the sequence of the region was mutated.
  • miR-876-3p significantly suppressed the expression of the BRD4 gene directly by the action of the BRD4 gene on the 3'UTR region.
  • FIG. 2-2 (C) shows the results of verification by the luciferase reporter assay of miR-6751-5p.
  • the assay was performed in the same manner as above except that the sequence of the region was mutated.
  • miR-6751-5p significantly suppressed the expression of the BRD4 gene directly by the action of the BRD4 gene on the 3'UTR region.
  • Figure 2-3 shows the effect on cell proliferation when siRNA against the BRD4 gene is allowed to act on a colon cancer cell line (HCT116 ⁇ / ⁇ cells) and the BRD4 gene is knocked down. For comparison, the effect on cell proliferation when control siRNA (si-NC) is introduced is also shown.
  • the results of Western blotting performed in the same manner as in Example A2 are shown in FIG. 2-3 (B).
  • Target cancer cell lines include colon cancer cell lines (HCT116 + / + cells, HCT116 ⁇ / ⁇ cells), oral cancer cell lines (HOC313 cells, HSC2 cells), and lung cancer cell lines (A549 cells (non-small cell lung cancer)).
  • Cell line)) and esophageal cancer cell line (KYSE150 cells) were used to evaluate the cell growth inhibitory effect of the introduction of miRNA. 10 nmol / L of miR-876-3p, miR-1293 or control miRNA (miR-NC) as a control was introduced into each target cancer cell line using Lipofectamine RNAiMAX according to the procedure manual in the package insert.
  • the number of viable cells was evaluated 2 days and 4 days after the introduction.
  • the cell proliferation curve is shown in FIG. 3-1.
  • a micrograph of a colorectal cancer cell line (HCT116 ⁇ / ⁇ cells) 72 hours after introduction is shown in FIG. 3-2.
  • the cell proliferation was significantly suppressed by the introduction of miR-876-3p or miR-1293 in any of the cell lines, and a remarkable proliferation inhibitory effect was observed.
  • FIG. 3-2 in the colorectal cancer cell line, a large number of dead cells were confirmed by introducing miR-876-3p or miR-1293, and the number of viable cells was smaller than that of the control.
  • Example A5> (Apoptosis evaluation 1) 10 nmol / L of miR-NC, miR-876-3p or miR-1293 was added to the colorectal cancer cell line (HCT116 + / +, HCT116 ⁇ / ⁇ cells) and oral cancer cell line (HOC313 cells). RNAiMAX was used and introduced into each cancer cell line according to the procedure manual in the package insert. The proportion of apoptotic cells 72 hours after introduction was evaluated by Annexin V / PI staining. The proportion of annexin V / PI positive cells was evaluated using Accuri C6 Flow Cytometry (BD Biosciences). The results are shown in Fig. 3-3.
  • miR-876-3p or miR-1293 increased the proportion of apoptotic cells in each cell as compared with the control (miR-NC).
  • Apoptosis evaluation 2 10 nmol / L of miR-NC, miR-876-3p or miR-1293 to colorectal cancer cell line (HCT116 +/+, HCT116 ⁇ / ⁇ cells) or oral cancer cell line (HOC313 cells), Lipofectamine RNAiMAX was used and introduced into each cancer cell line according to the procedure manual in the package insert.
  • the expression level of cleared PARP which is a marker of apoptosis, was evaluated by Western blotting on cells 72 hours after introduction. Western blotting was performed in the same procedure as described above. The results are shown in Figure 3-4.
  • miR-876-3p or miR-1293 increased the expression level of cleared PARP in each cell as compared with the control (miR-NC). Shown.
  • miR-876-3p and miR-1293 induce apoptosis in various cancer types including intractable cancers and show a remarkable growth inhibitory effect.
  • Example A1 for colon cancer cell line HCT116 ⁇ / ⁇ cells
  • oral cancer cell line HSC2, HOC313 cells
  • lung cancer cell line A549 cells
  • esophageal cancer cell line KYSE150 cells
  • MiR-NC or miR-876-3p was introduced as described. Forty-eight hours after introduction, gene expression array analysis was performed as follows. Gene expression array analysis was performed using an Agilent 4x44K gene expression array (Agilent Technologies, Inc.) according to its operating manual. The data of the gene expression array analysis was analyzed using GeneSpring software (Agilent Technologies).
  • FIG. 4-1 shows the number of genes whose gene expression decreased by more than 1.5 times as a result of the expression array performed on these miR-introduced cells.
  • 1223 genes were common to 4 or more of the 5 types of cancer cell lines. there were.
  • a pathway analysis of 1223 of these common genes using DAVID software revealed that multiple genes involved in the mTOR pathway shown in the table below were significantly suppressed, resulting in significant suppression. It was shown that the mTOR pathway was suppressed.
  • Example A6> (Western blot) MiR-NC or miR-876-3p was introduced into a colon cancer cell line (HCT116 ⁇ / ⁇ cells) or an oral cancer cell line (HOC313 cells, KOSC3 cells) in the manner described in Example A1. Forty-eight hours after introduction, the expression levels of RSK1, phosphorylated RSK1 (p-RSK1), phosphorylated p70S6K (p-p70S6K) and pS6 (p-S6), which are indicators of activation of the mTOR signal pathway, were adjusted in the same manner as above. It was evaluated by performing Western blotting with the expression of ⁇ -actin protein as a positive control. The results are shown in FIG. 4-2.
  • the expression of RSK1 was remarkably suppressed by the introduction of miR-876-3p in HCT116 ⁇ / ⁇ cells, HOC313 cells, and KOSC3 cells, and further, p-p70S6K of the mTOR signal pathway, Suppression of the expression of p-S6 protein was observed, and suppression of RSK1 and mTOR signal pathway was confirmed by the introduction of miR-876-3p.
  • Example A7 (Luciferase Reporter Assay) The interaction between miR-876-3p and the RSK1 gene was evaluated by a luciferase reporter assay using a construct in which the 3'UTR region of the RSK1 gene was incorporated into a luciferase vector. There is one region in the RSK1 gene that is homologous to the nucleotide sequence of the guide strand of miR-876-3p. A luciferase reporter assay was performed in the same manner as above except that the region was mutated. The results are shown in Figure 4-3.
  • miR-876-3p As shown in FIG. 4-3, the introduction of miR-876-3p showed a decrease in luciferase activity corresponding to the wild-type 3'UTR region, and a region matching the base sequence of the guide chain of miR-876-3p. The luciferase activity was restored in the vector mutated in. From these results, it was shown that miR-876-3p directly suppressed the expression of the RSK1 gene by the action of the RSK1 gene on the 3'UTR region.
  • knockdown of at least one of the BRD4 gene and the RSK1 gene suppresses the expression of the knocked down gene.
  • the expression level of cleared PARP which is an index of apoptosis
  • cell proliferation was suppressed by knocking down at least one of the BRD4 gene and the RSK1 gene, and synergistically suppressed when both were knocked down.
  • FIG. 4-5 is a conceptual diagram schematically showing the presumed mechanism by which miR-876-3p suppresses the growth of tumor cells, which is derived from the results of the above examples.
  • Example A8 Examples A1 were described in a colon cancer cell line (HCT116 ⁇ / ⁇ cells), an oral cancer cell line (HSC2, HOC313 cells), a lung cancer cell line (A549 cells), and an esophageal cancer cell line (KYSE150 cells).
  • HCT116 ⁇ / ⁇ cells colon cancer cell line
  • HSC2, HOC313 cells oral cancer cell line
  • A549 cells lung cancer cell line
  • KYSE150 cells esophageal cancer cell line
  • FIG. 5-1 shows the number of genes whose gene expression decreased by more than 1.5 times as a result of the expression array performed on these miR-introduced cells.
  • 1248 genes were common to 4 or more of the 5 types of cancer cell lines. there were.
  • pathway analysis was performed on 1248 of these common genes using DAVID software, multiple pathways involved in DNA repair, that is, Homologous recombination (homologous recombination repair), base excision repair (base excision repair), and Mismatch repair, nail It was shown that excision repair was suppressed.
  • the table below shows each pathway and the genes involved in that pathway.
  • Example A9> (Western blot) MiR-NC or miR-1293 was introduced into a colon cancer cell line (HCT116 ⁇ / ⁇ cells) or an oral cancer cell line (HOC313 cells) into which miR-1293 was introduced, in the manner described in Example A1. .. Forty-eight hours after the introduction, the expression levels of APEX1, RPA1 and POLD4 proteins were evaluated by performing Western blotting in the same manner as above with the expression of ⁇ -actin protein as a positive control. The results are shown in Figure 5-2.
  • Example A10> (Luciferase Reporter Assay) The interaction of miR-1293 with the APEX1, RPA1 or POLD4 gene was evaluated by a luciferase reporter assay using a construct that incorporated the 3'UTR region of the APEX1, RPA1 or POLD4 gene into a luciferase vector. There is one region homologous to the nucleotide sequence of the guide strand of miR-1293 for each of the APEX1, RPA1 and POLD4 genes. A luciferase reporter assay was performed in the same manner as above, except that mutations were placed in each region. The results are shown in Figure 5-3.
  • miR-1293 significantly reduced the luciferase activity corresponding to the wild-type 3'UTR region in all of the APEX1, RPA1 and POLD4 genes, and the guide chain of miR-1293 was observed.
  • the luciferase activity was significantly restored in the vector in which the mutation was added to the region matching the nucleotide sequence of. From these results, it was shown that miR-1293 directly suppresses the expression of APEX1, RPA1 and POLD4 genes by the action of APEX1, RPA1 and POLD4 genes on the 3'UTR region.
  • siRNA When siRNA is allowed to act on a colon cancer cell line (HCT116 ⁇ / ⁇ cells) and both the BRD4 gene, APEX1 gene or BRD4 gene and APEX1 gene are knocked down at the same time (A), the BRD4 gene, RPA1 gene or BRD4 gene Control siRNA of the effect on gene expression and cell proliferation when both the RPA1 gene and the RPA1 gene are knocked down at the same time (B) and when both the BRD4 gene, POLD4 gene or both the BRD4 gene and the POLD4 gene are knocked down at the same time (C) It was evaluated in comparison with the case where (si-NC) was used. Gene expression was evaluated by Western blot in the same manner as above. The results of Western blotting are shown in FIGS. 5-4 (A) to (C). The effect on cell proliferation is shown in FIG. 5-4 (D).
  • NCS neocarzinostatin
  • Blocking was performed with PBS containing 3% bovine serum, and then anti- ⁇ H2AX antibody (1/400 dilution) was reacted at room temperature for 1 hour.
  • the bound antibody was visualized using an Alexa Fluor555 anti-rabbit IgG antibody (1/500 dilution, Life Technologies).
  • the section was counter-stained with VECTASHILD connecting DAPI (Vector Laboratories), and observed and photographed with a fluorescence microscope of Nikon. The results are shown in Figure 5-5.
  • the proportion of ⁇ H2AX-positive cells in three randomly extracted visual fields in fluorescence microscope observation was measured. The results are shown in Figure 5-6.
  • FIGS. 5-5 and 5-6 a large amount of ⁇ H2AX was observed in miR-1293-introduced cells. That is, it is a result showing that the introduction of miR-1293 suppressed DNA repair from DNA damage caused by neocarzinostatin. Further, as shown in FIGS. 5-5 and 5-6, suppression of APEX1, RPA1, POLD4 and BRD4, which are targets of miR-1293, resulted in suppression of DNA repair as in miR-1293. From these results, it was shown that the DNA repair inhibitory effect of miR-1293 was mediated by the inhibition of APEX1, RPA1, POLD4 and BRD4.
  • Example A12 Homologous recombination repair was evaluated for colorectal cancer cell lines (HCT116 ⁇ / ⁇ cells) when the BRD4 gene was knocked down using siRNA and when miR-1293 was introduced. Evaluation of homologous recombination repair was performed using a DR-GFP vector according to a known method (Genes Dev. 2001 Dec 15.15 (24): 3237-42.).
  • the DR-GFP vector is a vector in which a sequence cleaved by endonuclease Scel is incorporated into the sequence of the fluorescent dye GFP, and when the DNA of the vector cleaved by homologous recombination repair is repaired after being cleaved by Scel It is a vector expressing GFP.
  • the DR-GFP vector was introduced into HCT116 ⁇ / ⁇ cells, and cells in which the DR-GFP vector was stably expressed by neomycin were established.
  • neomycin resistance gene is integrated into the DR-GFP vector, and cells expressing the DR-GFP vector can survive by having resistance to neomycin, but conversely, cells expressing the DR-GFP vector do not. It cannot survive because it is not resistant to neomycin.
  • MiR-1293 or miR-NC as a control was introduced into the DR-GFP expressing HCT116 ⁇ / ⁇ cells, and then treated with endonuclease Scel, and 24 hours later, the number of cells developing DR-GFP was flowed. The analysis was performed by cytometry, and the relative number of cells was calculated when the number of cells in the miR-NC administration group was 1.
  • the number of GFP-expressing cells became lower than that of the control due to knockdown of the BRD4 gene or introduction of miR-1293. That is, it was shown that the introduction of miR-1293 suppresses homologous recombination repair.
  • FIG. 5-8 is a conceptual diagram schematically showing the presumed mechanism by which miR-1293, which is derived from the results of the above examples, suppresses the growth of tumor cells.
  • Example B1> In vivo tumor cell growth inhibitory effect by administration of miR-876-3p and miR-1293 7-week-old Balb / c nude mice were purchased from Oriental Bioservice and bred in a sterile condition. 100 ⁇ l of PBS containing 10 ⁇ 10 6 colorectal cancer cell lines (HCT116 ⁇ / ⁇ cells) was subcutaneously injected into the dorsal flank of mice. The schedule of the in vivo test after this subcutaneous injection is shown in FIG. 6-1.
  • a mixture of 1 nmol miR-876-3p, miR-1293 or control miRNA and 200 ⁇ l AteroGene (KOKEN) was administered into the gap between the tumor and the skin a total of 5 times (from HCT116 ⁇ / ⁇ cell injection). After 3, 7, 10, 14, 17 days). Nineteen days after cell administration, mice were euthanized and tumors were removed. The experimental procedure performed on all mice was approved by the Animal Experiment Committee of Tokyo Medical and Dental University.
  • FIG. 6-2 shows the appearance of a typical mouse subcutaneous tumor 19 days after injection of HCT116 ⁇ / ⁇ cells and a photograph of the excised tumor.
  • Figure 6-3 shows the transition of tumor volume. Tumor volume was calculated as (major) x (minor) 2 x 0.5. As shown in FIG. 6-3, tumor volume was significantly reduced by administration of miR-876-3p, miR-1293 compared to administration of control miRNA (miR-NC).
  • the weight of the removed tumor was weighed for each mouse. The results are shown in Figure 6-4. As shown in FIG. 6-4, the tumor weight in the miR-876-3p or miR-1293-administered group was significantly lighter than that in the control miRNA-administered group.
  • Example B2> Expression analysis of miR-876-3p and miR-1293 was performed in the excised tumor tissue using quantitative RT-PCR. Total RNA was separated from the tumor tissue by a standard method using a TRIsure reagent (Bioline). The single-stranded RNA prepared from the total RNA was amplified using a primer specific to miR-876-3p or miR-1293.
  • Real-time RT-PCR for miR-876-3p and miR-1293 includes ABI Prism 7500 Fast Real-time PCR system (Applied Biosystems), Taqman Universal PCR Master Mix (Applied Biosystems), TaqMan MultiMix (Applied Biosystems).
  • Example B3> The expression levels of the BRD4 gene, RSK1 gene, APEX1 gene, RPA1 gene and POLD4 gene in the excised tumor tissue were evaluated by immunostaining. Tumor tissue was fixed with PBS containing 10% formaldehyde, embedded in paraffin, and sliced into 4 ⁇ m thick sections. Tumor sections were immunohistochemically stained for BRD4, RSK1, APEX1, RPA1 and POLD4 using the avidin-biotin-peroxidase method as shown below. Tumor sections embedded in paraffin were deparaffinized with xylene and then rehydrated with ethanol.
  • the antigen was activated by boiling in 10 mM citrate buffer (pH 6.0) and treated with methanol containing 0.3% hydrogen peroxide to inactivate the endogenous peroxidase. Then, for the section, anti-BRD4 antibody (1/500 dilution), anti-RSK1 antibody (1/100 dilution), anti-APEX1 antibody (1/200 dilution), RPA1 antibody (1/100 dilution) or anti-POLD4 antibody (1). / 100 dilution) was used to react overnight at 4 ° C. The bound antibody was visualized using diaminobenzidine (VECTASTAIN-EluteABCkit: Vector Laboratory). The sections were then counterstained with hematoxylin.
  • VECTASTAIN-EluteABCkit Vector Laboratory
  • FIG. 6-6 The results of immunostaining using the anti-BRD4 antibody are shown in FIG. 6-6.
  • the results of immunostaining using the anti-RSK1 antibody are shown in FIG. 6-7.
  • the results of immunostaining using an anti-APEX1 antibody, an RPA1 antibody or an anti-POLD4 antibody are shown in FIG. 6-8.
  • the administration of miR-876-3p suppressed the expression of the BRD4 gene and the RSK1 gene and suppressed the tumor growth in the in vivo tumor tissue. It was. That is, the pharmaceutical composition containing miR-876-3p is expected to have an effect on various tumors resulting from the expression of at least one selected from the group consisting of BRD4 and RSK1.
  • miR-1293 suppressed the expression of the BRD4 gene, APEX1 gene, RPA1 gene, and POLD4 gene in the in vivo tumor tissue, and suppressed tumor growth. It was shown that That is, the pharmaceutical composition containing miR-1293 is expected to have an effect on various tumors resulting from the expression of at least one selected from the group consisting of BRD4, APEX1, RPA1, and POLD4.
  • miRNAs can inhibit the expression of multiple targets by directly binding to the coding region or 3'UTR region of each gene. This indicates that a single miRNA can target multiple pathways involved in cancer activation.
  • hsa-miR-34a is known to suppress tumor growth via a plurality of targets such as CCND1 gene, CDK6 gene, MYC gene, c-MET gene, and NOTCH gene.
  • miR-876-3p can target the BRD4 and RSK1 genes.
  • miR-1293 can target the BRD4 gene, APEX1 gene, RPA1 gene and POLD4 gene. The introduction of these miRNAs was found to have the effect of suppressing the growth of tumors derived from HCT116 ⁇ / ⁇ cells, which are colon cancer cell lines formed subcutaneously in nude mice.
  • the present embodiment provides a pharmaceutical composition containing a polynucleotide derived from miR-876-3p and which is found to be effective against a tumor in which the BRD4 gene and the RSK1 gene are activated. Further, the present invention provides a pharmaceutical composition containing a polynucleotide derived from miR-1293 and having an effect on a tumor in which the BRD4 gene, APEX1 gene, RPA1 gene and POLD4 gene are activated.
  • Cell lines include breast cancer 14 strains, colon cancer 10 strains, uterine body cancer 5 strains, esophageal cancer 43 strains, gastric cancer 4 strains, liver cancer 2 strains, lung cancer 3 strains, neuroblastoma 1 strain, oral cancer Twenty-two strains, ovarian cancer 22 strains, pancreatic cancer 1 strain, prostate cancer 4 strains, sarcoma 8 strains, thyroid cancer 12 strains, and urinary tract cancer 1 strain were prepared.
  • the table below exemplifies cell lines having a pathological mutation in BRCA1 or BRCA2 (hereinafter, may be abbreviated as BRCA1 / 2) in the prepared cell lines.
  • the pathological mutations of BRCA1 / 2 were intended to be frameshift mutations, nonsense mutations, and methylation.
  • 8,000 cells were seeded in 1 well of 96 well plate and cultured in a medium suitable for each cell line in a 37 ° C., 5% CO 2 environment or an environment free of CO 2. After 24 hours, miR-Negative Control (miR-NC; 20 ⁇ M) or miR-1293 (2.5, 5, 10, or 20 ⁇ M) was mixed with Lipofectamine RNAiMAX (Thermo Fisher scientific) and transfected.
  • miR-NC miR-Negative Control
  • miR-1293 2.5, 5, 10, or 20 ⁇ M
  • the cells were stained with a crystal violet solution (10% formalin, 0.1% crystal violet). Then, it was washed with water, completely dried, and then dissolved in a 2% SDS solution. The lysate was measured with an absorptiometer using a wavelength of 560 nm, and the obtained value was taken as the amount of viable cells. Based on miR-NC, the cell viability at each concentration of miR-1293 was calculated and graphed. A part of the result is shown in FIG. 7-1.
  • the cell line whose cell viability decreased to 0.5 or less at a concentration of less than 20 nM was designated as a miR-1293 high-sensitivity strain, and the miR-1293 sensitivity in the BRCA1 / 2 pathological mutation group (+) and the non-mutation group (-) was determined. evaluated. The results are shown in Figure 7-2.
  • the present embodiment provides a pharmaceutical composition comprising a polynucleotide derived from miR-1293 and found to be effective against tumors having a pathogenic variant in BRCA1 / 2 or in a state of BRCAness. .. Furthermore, it provides a pharmaceutical composition that is expected to be effective against tumors that are resistant to PAPR inhibitors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne une composition pharmaceutique qui supprime l'expression d'un gène de protéine de bromodomaine (BRD4) et qui peut être utilisée pour traiter une tumeur. Cette composition pharmaceutique utilisée pour traiter une tumeur comprend un polynucléotide ayant une séquence de base identique à un produit de transcription d'un gène codant pour au moins un micro-ARN sélectionné dans le groupe constitué des miR-1293, miR-876-3p, miR-4438, miR-6751, miR-634, et miR-92a-2-5p ou un produit de traitement du produit de transcription, ou ayant une séquence de base obtenue par substitution, délétion, ou addition de 1 à 5 bases dans ladite séquence de base.
PCT/JP2020/048114 2019-12-24 2020-12-23 Composition pharmaceutique WO2021132309A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2019233250A JP2023011959A (ja) 2019-12-24 2019-12-24 医薬組成物
JP2019-233250 2019-12-24

Publications (1)

Publication Number Publication Date
WO2021132309A1 true WO2021132309A1 (fr) 2021-07-01

Family

ID=76573008

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2020/048114 WO2021132309A1 (fr) 2019-12-24 2020-12-23 Composition pharmaceutique

Country Status (2)

Country Link
JP (1) JP2023011959A (fr)
WO (1) WO2021132309A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019107487A1 (fr) * 2017-11-29 2019-06-06 国立大学法人 東京医科歯科大学 Micro-arn et composition pharmaceutique ayant un dérivé de celui-ci en tant que composant actif

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019107487A1 (fr) * 2017-11-29 2019-06-06 国立大学法人 東京医科歯科大学 Micro-arn et composition pharmaceutique ayant un dérivé de celui-ci en tant que composant actif

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
INAZAWA, JOHJI: "Identification of a histone reader involved in cancer stem cell properties", CANCER SCIENCE, vol. 109, no. S2, 1 December 2018 (2018-12-01), pages 1079, XP055712219 *
LI PING, MA YUNYUN, WANG YUANYUAN, CHEN TENGFEI, WANG HUAQI, CHU HEYING, ZHAO GUOQIANG, ZHANG GUOJUN: "Identification of miR-1293 potential target gene : TIMP-1", MOL. CELL . BIOCHEM., vol. 384, no. 1-2, 13 August 2013 (2013-08-13), pages 1 - 6, XP055838023, DOI: https://doi.org/10.1007/s11010-013-1775-7 *
MENSAH AFUA A., CASCIONE LUCIANO, GAUDIO EUGENIO, TARANTELLI CHIARA, BOMBEN RICCARDO, BERNASCONI ELENA, ZITO DOMENICO, LAMPIS ANDR: "Bromodomain and extra- terminal domain inhibition modulates the expression of pathologically relevant microRNAs in diffuse large B- cell lymphoma", HAEMATOLOGICA, vol. 103, no. 12, 3 August 2018 (2018-08-03), pages 2049 - 2058, XP055838017, DOI: https://doi.org/10.3324/haematol.2018.191684 *
MURAMATSU, TOMOKI ET AL.: "miR-3140 suppresses tumor cell growth by targeting BRD4 via its coding sequence and downregulates the...", CANCER RESEARCH, vol. 13, no. 13, July 2018 (2018-07-01) *
PATHAK, EKTA ET AL.: "Deciphering the Role of microRNAs in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma", BIOINFORMATION, vol. 13, no. 6, June 2017 (2017-06-01), pages 209 - 213, XP055615195, DOI: 10.6026/97320630013209 *
TANG JIAO, XU JIE, ZHI ZHONGWEN, WANG XIANG, WANG YU, ZHOU YONG, CHEN RUI: "MiR-876-3p targets KIF20A to block JAK2/STAT3 pathway in glioma", AM. J. TRANSL. RES., vol. 11, no. 8, 15 August 2019 (2019-08-15), pages 4957 - 4855, XP055838007 *
TONOUCHI, ERINA ET AL.: "Function-based microRNA library screening identified a novel tumor suppressive miRNA regulating BRD4", ANNUAL MEETING OF THE JAPANESE CANCER ASSOCIATION, September 2017 (2017-09-01), pages 597 *
YANG FU, WAN, ZHAO JUN, JIA CONG LI, LI XIAO KAI, WANG QIANG, CHEN ZI LI, JIANG DE QUAN: "MicroRNA-876-3p functions as a tumor suppressor gene and correlates with cell metastasis in pancreatic adenocarcinoma via targeting JAG2", AM. J. CANCER. RES., vol. 8, no. 4, 1 April 2018 (2018-04-01), pages 636 - 649, XP055838011 *

Also Published As

Publication number Publication date
JP2023011959A (ja) 2023-01-25

Similar Documents

Publication Publication Date Title
US9580712B2 (en) Compositions and methods for treatment of prostate and other cancers
Silber et al. Expression of miR-124 inhibits growth of medulloblastoma cells
JP7392954B2 (ja) トリプルネガティブ乳癌の治療方法
JP6153932B2 (ja) 骨肉腫のためのマイクロｒｎａに基づく方法およびアッセイ
US20160024597A1 (en) miRNAs AS THERAPEUTIC TARGETS IN CANCER
US8933051B2 (en) Treatment of B-cell lymphoma with microRNA
Telford et al. Multi-modal effects of 1B3, a novel synthetic miR-193a-3p mimic, support strong potential for therapeutic intervention in oncology
CN109328072B (zh) 细胞死亡诱导剂、细胞增殖抑制剂及用于治疗起因于细胞增殖异常的疾病的医药组合物
Liu et al. MicroRNA-22 inhibits proliferation, invasion and metastasis of breast cancer cells through targeting truncated neurokinin-1 receptor and ERα
JP5933010B2 (ja) 癌治療剤
JP2009541304A5 (fr)
WO2021132309A1 (fr) Composition pharmaceutique
WO2019107487A1 (fr) Micro-arn et composition pharmaceutique ayant un dérivé de celui-ci en tant que composant actif
KR102120659B1 (ko) 난소과립막세포암 또는 자궁내막암의 진단 및 치료를 위한 마이크로rna-1236의 용도
US8828964B2 (en) Cancer cell identification marker and cancer cell proliferation inhibitor
CN114269920A (zh) 用于治疗癌症的方法和组合物
KR102143701B1 (ko) nc886 및/또는 PKR 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법
JP7453145B2 (ja) Ｈｓｐ４７の阻害物質を用いた、化学療法剤感受性の増強
Zhu RNA pull-down-confocal nanoscanning (RP-CONA), a novel method for studying RNA/protein interactions in cell extracts that detected potential drugs for Parkinson’s disease targeting RNA/HuR complexes
US11123361B2 (en) Double-stranded oligo RNA structure comprising miRNA
Gandham Reprogramming of Tumor and Extracellular Vesicular MicroRNA in Relapsed Ovarian Cancer
WO2021209608A1 (fr) Procédés médicaux et utilisations médicales
Delgado Targeting MicroRNA-143 in Glioblastoma
KR20230019774A (ko) Gas5 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 조성물
Mody Investigation of Micro-RNA-based Approaches to Overcome Epithelial-Mesenchymal Transition in Pancreatic Cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20908011

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20908011

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP