WO2021117769A1 - 医薬組成物及び処置剤 - Google Patents

医薬組成物及び処置剤 Download PDF

Info

Publication number
WO2021117769A1
WO2021117769A1 PCT/JP2020/045874 JP2020045874W WO2021117769A1 WO 2021117769 A1 WO2021117769 A1 WO 2021117769A1 JP 2020045874 W JP2020045874 W JP 2020045874W WO 2021117769 A1 WO2021117769 A1 WO 2021117769A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
carbon atoms
lipid
formula
represented
Prior art date
Application number
PCT/JP2020/045874
Other languages
English (en)
French (fr)
Japanese (ja)
Inventor
泰輔 遠藤
淳一 井本
雄一 船瀬
Original Assignee
富士フイルム株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 富士フイルム株式会社 filed Critical 富士フイルム株式会社
Priority to JP2021564001A priority Critical patent/JPWO2021117769A1/ja
Publication of WO2021117769A1 publication Critical patent/WO2021117769A1/ja

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18—Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/28—Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34—Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/44—Oils, fats or waxes according to two or more groups of A61K47/02-A61K47/42; Natural or modified natural oils, fats or waxes, e.g. castor oil, polyethoxylated castor oil, montan wax, lignite, shellac, rosin, beeswax or lanolin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the present invention relates to a pharmaceutical composition containing an artificial match type miRNA and a lipid, and a treatment agent.
  • MicroRNA is known as a nucleic acid molecule that suppresses gene expression. It is known that miRNA suppresses transcription of a protein encoded by a gene through the following production process. First, in the nucleus, a miRNA transcript (Pri-miRNA) having a cap structure at the 5'end and a poly (A) at the 3'end is produced. Pri-miRNA is cleaved by RNase (Drosha) to produce miRNA precursors (Pre-miRNA). Pre-miRNA has a hairpin structure with a loop region and a stem region.
  • Pri-miRNA miRNA transcript having a cap structure at the 5'end and a poly (A) at the 3'end is produced.
  • Pri-miRNA is cleaved by RNase (Drosha) to produce miRNA precursors (Pre-miRNA).
  • Pre-miRNA has a hairpin structure with a loop region and a stem region.
  • this Pre-miRNA is degraded by cytoplasmic RNase (Dicer), and a double-stranded miRNA (mature miRNA) having an overhang of 1 to 4 bases at the 3'end is excised.
  • double-stranded miRNAs one strand is called a guide strand and the other strand is called a passenger strand, and the guide strand binds to a complex similar to RNA-induced silencing Complex (RISC).
  • RISC RNA-induced silencing Complex
  • miRNA is deeply involved in many biological phenomena such as differentiation, cell proliferation and apoptosis, viral infections, and many diseases such as cancer, and its application to nucleic acid drugs is expected.
  • nucleic acid delivery techniques a method of administering nucleic acid-containing particles in which nucleic acid is encapsulated in particles (liposomes or lipid particles) is known.
  • nucleic acid-containing particles are prepared using lipids having an amino group or the like and becoming cations at a low pH, and delivery of nucleic acids is realized by imparting an appropriate charge to the particles.
  • Patent Document 1 discloses a compound having an ester group, an acetal group or the like as a linking group connecting an aliphatic group and an amino group.
  • Patent Document 2 discloses a compound having a vinyloxy group, an amide group, an oxime group or the like as a linking group connecting an aliphatic group and an amino group.
  • a lipid having an amino group or the like and becoming a cation at a low pH may be referred to as a cationic lipid.
  • Patent Document 3 describes (a) nucleic acids; (b) cationic lipids constituting about 50 mol% to about 85 mol% of total lipids present in particles; (c) approximately 13 mol% of total lipids present in particles. Non-cationic lipids constituting up to about 49.5 mol%; and (d) complex lipids constituting about 0.5 mol% to about 2 mol% of the total lipids present in the particles, which inhibit the aggregation of the particles. Nucleic acid-lipid particles containing are described.
  • Patent Document 4 contains 40 to 65% of a cationic lipid having a specific structure, 5 to 10% of a neutral lipid, 25 to 40% of a sterol, and 0.5 to 10% of a PEG or a PEG-modified lipid. Lipid preparations are described.
  • Nucleic acid delivery technology using lipids having an amino group is not yet sufficient, and a technology capable of delivering nucleic acid more efficiently is required.
  • the present invention is a pharmaceutical composition in which a new artificial match type miRNA using miRNA and a lipid excellent in nucleic acid delivery are combined, and the artificial match type miRNA has a base sequence represented by the following sequence A.
  • An object of the present invention is to provide a pharmaceutical composition containing a nucleic acid molecule and a treatment agent comprising the same.
  • an artificially matched miRNA a lipid which is a compound represented by the formula (1) or a salt thereof, a nonionic lipid, and a nonionic lipid.
  • a pharmaceutical composition comprising an artificially matched miRNA, a lipid which is a compound represented by the formula (1) or a salt thereof, a nonionic lipid, and a lipid having a nonionic hydrophilic polymer structure.
  • a pharmaceutical composition in which an artificially matched miRNA contains a nucleic acid molecule consisting of the base sequence represented by the following sequence A. (Array A) 5'-UAGCACCAUUUGAAAUCAGUGUU-P-AACACUGAUUUCAAAUGGUGCUAGA-3' In the formula, P Is shown.
  • X represents -NR 1- or -O-
  • R 1 is a hydrogen atom, a hydrocarbon group, or R 21 -L 1 -R 22, 6 to 24 carbon atoms - a group represented by, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 2 and R 3 independently represent a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31- L 2- R 32- , and R 31 is a hydrocarbon having 1 to 24 carbon atoms.
  • L 2 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and any one or more pairs of R 8 may form a linked 4 may contain O atoms to 7-membered ring together, Substituents on alkyl groups having 1 to 18 carbon atoms that may be substituted are hydroxyl groups, carboxyl groups, amino groups represented by -NR 45 R 46 , substituted or unsubstituted aryl groups, substituted or unsubstituted heteros.
  • R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms.
  • Substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46, and-.
  • R 2 and R 3 independently represent a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31- L 2- R 32- .
  • R 31 represents a hydrocarbon group having 1 to 24 carbon atoms.
  • L 2 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or Show
  • R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 5 represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • Substituents on alkyl groups having 1 to 18 carbon atoms that may be substituted are hydroxyl groups, carboxyl groups, amino groups represented by -NR 45 R 46 , substituted or unsubstituted aryl groups, substituted or unsubstituted heteros. It is a group represented by an aryl group, —O (CO) OR 41 , —O (CO) —R 42 , —— (CO) OR 43 , or —OR 44 , R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms.
  • Substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46, and-. It is a group represented by O (CO) OR 41 , -O (CO) -R 42 ,-(CO) OR 43 , or -OR 44 , and is a group represented by R 41 , R 42 , R 43 , R. 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms. e indicates 2 or 3.
  • Treatment agent. [12] The treatment agent according to [11], which is orally administered.
  • [A] Fibrosis of tissues including the liver, chronic liver damage, cirrhosis, and non-alcoholic fat which comprises administering the pharmaceutical composition according to any one of [1] to [10] to a subject. How to treat a disease of choice from hepatitis.
  • Pharmaceutical composition In any one of [1] to [10] for producing a therapeutic agent for a disease selected from fibrosis of tissues including the liver, chronic liver damage, cirrhosis, and non-alcoholic steatohepatitis. Use of the described pharmaceutical composition.
  • the pharmaceutical composition of the present invention exhibits excellent medicinal properties. In particular, it can exert an excellent effect as a therapeutic agent for diseases selected from fibrosis of tissues including the liver, chronic liver damage, liver cirrhosis, and non-alcoholic steatohepatitis.
  • FIG. 1 shows the expression level of the Col1a1 gene associated with cholesterol production in a drug efficacy test using carbon tetrachloride-induced liver fibrosis model mice.
  • FIG. 2 shows the expression level of the ⁇ -SMA gene, which is a marker for activation of stellate cells, in a drug efficacy test using carbon tetrachloride-induced liver fibrosis model mice.
  • FIG. 3 shows the expression level of the Col1a1 gene associated with cholesterol production in a drug efficacy test using carbon tetrachloride-induced liver fibrosis model mice.
  • FIG. 4 shows the expression level of the ⁇ -SMA gene, which is a marker for activation of stellate cells, in a drug efficacy test using carbon tetrachloride-induced liver fibrosis model mice.
  • the pharmaceutical composition of the present invention contains an artificially matched miRNA, a lipid which is a compound represented by the formula (1) or a salt thereof, a nonionic lipid, and a lipid having a nonionic hydrophilic polymer structure, and is artificial.
  • the matched miRNA comprises a nucleic acid molecule consisting of the nucleotide sequence represented by sequence A.
  • the pharmaceutical composition of the present invention preferably contains lipid particles.
  • Lipid particles mean particles composed of components classified as lipids.
  • the structure of the lipid particles any structure selected from lipid aggregates, micelles, and liposomes in which lipids are aggregated can be considered, but the structure is not limited to this.
  • the pharmaceutical composition of the present invention contains lipid particles, the lipids constituting the lipid particles are the lipid represented by the formula (1) or a salt thereof, a nonionic lipid, and a nonionic hydrophilic polymer. It preferably contains a lipid having a structure.
  • the artificial match type miRNA is preferably encapsulated in lipid particles.
  • the morphology of lipid particles can be confirmed by electron microscope observation or structural analysis using X-rays.
  • the lipid particles have a lipid bilayer structure (lamella structure) and an inner aqueous layer like liposomes, or the electron density inside the particles. It can be confirmed whether or not it has a high core and has a structure packed with constituents such as lipids.
  • the presence or absence of a lipid bilayer structure (lamellar structure) on lipid particles can also be confirmed by X-ray small-angle scattering (SAXS) measurement.
  • SAXS X-ray small-angle scattering
  • the particle size of the lipid particles is not particularly limited, but is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and further preferably 50 to 250 nm.
  • the particle size of the lipid particles can be measured by a general method (for example, dynamic light scattering method, laser diffraction method, etc.).
  • the pharmaceutical composition of the present invention comprises an artificially matched miRNA.
  • the artificial match type miRNA contains a nucleic acid molecule consisting of the base sequence represented by the following sequence A.
  • Array A 5'-UAGCACCAUUUGAAAUCAGUGUU (SEQ ID NO: 1)-P-AACACUGAUUUCAAAUGGUGCUAGA (SEQ ID NO: 2) -3' In the formula, P Is shown.
  • the nucleic acid molecule consisting of the base sequence represented by the sequence A can be synthesized by a commercially available nucleic acid synthesizer based on the phosphoramidite method.
  • RNA amidite for example, EMM amidite (International Publication No. 2013/027843) can be used, and deprotection of the amidite can be performed by a conventional method.
  • the linker represented by P can be introduced into the oligomer using the following L-proline diamide amidite.
  • the content of the artificially matched miRNA with respect to the total lipid is preferably 1% by mass to 25% by mass, and more preferably 2% by mass to 15% by mass.
  • the pharmaceutical composition of the present invention contains a lipid which is a compound represented by the formula (1) or a salt thereof.
  • X represents -NR 1- or -O-
  • R 1 is a hydrogen atom, a hydrocarbon group, or R 21 -L 1 -R 22, 6 to 24 carbon atoms - a group represented by, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 2 and R 3 independently represent a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31- L 2- R 32- , and R 31 is a hydrocarbon having 1 to 24 carbon atoms.
  • L 2 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and any one or more pairs of R 8 may form a linked 4 may contain O atoms to 7-membered ring together, Substituents on alkyl groups having 1 to 18 carbon atoms that may be substituted are hydroxyl groups, carboxyl groups, amino groups represented by -NR 45 R 46 , substituted or unsubstituted aryl groups, substituted or unsubstituted heteros.
  • R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms.
  • Substituents of the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46, and -O.
  • the hydrocarbon group having 6 to 24 carbon atoms in R 1 and the hydrocarbon group having 3 to 24 carbon atoms in R 2 and R 3 are preferably an alkyl group, an alkenyl group or an alkynyl group, and are preferably an alkyl group or an alkenyl group. More preferably it is a group.
  • the alkyl group having 6 to 24 carbon atoms and the alkyl group having 3 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 6 to 20 carbon atoms, and the alkyl group having 3 to 24 carbon atoms is more preferably an alkyl group having 6 to 20 carbon atoms.
  • the alkenyl group having 6 to 24 carbon atoms and the alkenyl group having 3 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 6 to 20 carbon atoms, and the alkenyl group having 3 to 24 carbon atoms is more preferably an alkenyl group having 6 to 20 carbon atoms.
  • the alkynyl group having 6 to 24 carbon atoms is preferably an alkynyl group having 6 to 20 carbon atoms, and the alkynyl group having 3 to 24 carbon atoms is more preferably an alkynyl group having 6 to 20 carbon atoms.
  • a hexynyl group a heptynyl group, an octynyl group, a nonynyl group, a decynyl group, an undecynyl group, a dodecynyl group, a tetradecynyl group, a pentadecynyl group, a hexadecynyl group, a heptadecynyl group, and an octadecynyl group.
  • All of the above alkenyl groups preferably have one or two double bonds, and all alkynyl groups preferably have one or two triple bonds.
  • the hydrocarbon group having 1 to 24 carbon atoms for R 21 and R 31 is preferably an alkyl group having 10 to 24 carbon atoms, an alkenyl group having 10 to 24 carbon atoms, or an alkynyl group having 10 to 24 carbon atoms. ..
  • the alkyl group having 10 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkyl group having 10 to 24 carbon atoms is preferably an alkyl group having 12 to 24 carbon atoms.
  • heptadecyl group heptadecyl group, octadecyl group, 2-butylhexyl group, 2-butyloctyl group, 1-pentylhexyl group, 2-pentylheptyl group, 3- Pentyloctyl group, 1-hexylheptyl group, 1-hexylnonyl group, 2-hexyloctyl group, 2-hexyldecyl group, 3-hexylnonyl group, 1-heptyloctyl group, 2-heptylnonyl group, 2-heptylundecyl Group, 3-heptyldecyl group, 1-octylnonyl group, 2-octyldecyl group, 2-octyldodecyl group, 3-octylundecyl group, 2-nonylundecyl group, 2-nonylundecyl group,
  • the alkenyl group having 10 to 24 carbon atoms may be linear or branched, and may be chain or cyclic. Specifically, a decenyl group, an undecenyl group, a dodecenyl group, a dodecadienyl group, a tridecenyl group (preferably (Z) -trideca-8-enyl group), a tetradecenyl group (preferably a tetradeca-9-enyl group), a pentadecenyl group.
  • Group (preferably (Z) -pentadeca-8-enyl group), hexadecenyl group (preferably (Z) -hexadeca-9-enyl group), hexadecadienyl group, heptadecenyl group (preferably (Z)) -Heptadeca-8-enyl group), heptadecadienyl group (preferably (8Z, 11Z) -heptadeca-8,11-dienyl group), octadecenyl group (preferably (Z) -octadeca-9-enyl group) ), Octadecadienyl group (preferably (9Z, 12Z) -octadeca-9,12-dienyl group) and the like.
  • the alkynyl group having 10 to 24 carbon atoms may be linear or branched, and may be chain or cyclic. Specific examples thereof include a decynyl group, an undecynyl group, a dodecinyl group, a tetradecynyl group, a pentadecynyl group, a hexadecynyl group, a heptadecynyl group, and an octadecynyl group. All of the above alkenyl groups preferably have one or two double bonds, and all alkynyl groups preferably have one or two triple bonds.
  • the divalent linking group and the hydrocarbon linking group having 1 to 18 carbon atoms may be an alkylene group having 1 to 18 carbon atoms or an alkaneylene group having 2 to 18 carbon atoms. preferable.
  • the alkylene group having 1 to 18 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the number of carbon atoms is preferably 1 to 12, more preferably 1 to 10, and even more preferably 2 to 10.
  • alkenylene group having 2 to 18 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the number of carbon atoms is preferably 1 to 12, more preferably 2 to 10.
  • L 1 a preferable range of L 1 , -O (CO) O-, -O (CO)-, or-(CO) O- is preferable, and -O (CO)-or- (CO) O- is more preferable.
  • L 2 a preferable range of L 2 , -O (CO) O-, -O (CO)-, or-(CO) O- is preferable, and -O (CO)-or- (CO) O- is more preferable.
  • Alkyl groups having 1 to 18 carbon atoms that may be substituted for R 4 , R 6 , R 9 , R 10 , R 11 and R 12 are linear or branched. It may be in the form of a chain or a ring. The number of carbon atoms is preferably 1 to 12.
  • the substituent is a hydroxyl group, a carboxyl group, -O (CO) OR 41 , -O (CO) -R 42 ,-(CO) OR 43 , or -O.
  • the group represented by —R 44 is preferred, and the group represented by —O (CO) —R 42 or ⁇ (CO) OR 43 is more preferred.
  • Alkyl groups having 1 to 18 carbon atoms which may be substituted for R 5 , R 7 and R 8 may be linear or branched, and may be chained or cyclic. May be.
  • the number of carbon atoms is preferably 1 to 12, more preferably 1 to 8.
  • the substituent is a hydroxyl group, a carboxyl group, -O (CO) OR 41 , -O (CO) -R 42 ,-(CO) OR 43 , or -O.
  • the group represented by —R 44 is preferred, and the group represented by —O (CO) —R 42 , ⁇ (CO) OR 43 , or —OR 44 is more preferred.
  • Examples of the 4- to 7-membered ring that may contain an O atom include an azetidine ring, a pyrrolidine ring, a piperidine ring, a morpholine ring, and an azepane ring, and a 6-membered ring is preferable, and a piperidine ring and a morpholine ring are preferable.
  • Substituents in alkyl groups with 1-18 carbon atoms that may be substituted are substituted or unsubstituted for R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12.
  • the aryl group in the case of the aryl group of the number of carbon atoms is preferably 6 to 22, more preferably 6 to 18, and even more preferably 6 to 10. Specific examples thereof include a phenyl group, a naphthyl group, an anthrasenyl group and a phenanthrenyl group.
  • Substituents on the aryl group include an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46 , -O (CO) OR 41 , and -O (CO).
  • the groups represented by —R 42 , — (CO) OR 43 , or —OR 44 are preferred, with hydroxyl or carboxyl groups being more preferred.
  • Specific examples of the substituted aryl group include a hydroxyphenyl group and a carboxyphenyl group.
  • Substituents in alkyl groups with 1-18 carbon atoms that may be substituted are substituted or unsubstituted for R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12.
  • the heteroaryl group in the case of the heteroaryl group the number of carbon atoms is preferably 1 to 12, and more preferably 1 to 6. Specific examples thereof include a pyridyl group, a pyrazolyl group, an imidazolyl group, a benzoimidazolyl group, a thiazolyl group and an oxazolyl group.
  • Substituents on the heteroaryl group include an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46 , -O (CO) OR 41 , and -O (CO). ) -R 42 ,-(CO) OR 43 , or —OR 44 is preferred, with hydroxyl or carboxyl groups being more preferred.
  • Specific examples of the substituted or unsubstituted heteroaryl group include a hydroxypyridyl group, a carboxypyridyl group, a pyridonyl group and the like.
  • the hydrocarbon groups having 1 to 18 carbon atoms for R 41 , R 42 , R 43 , R 44 , R 45 and R 46 include alkyl groups having 1 to 18 carbon atoms, alkenyl groups having 2 to 18 carbon atoms or carbons. It is preferably an alkynyl group having a number of 2 to 18, and more preferably an alkyl group having 1 to 18 carbon atoms or an alkenyl group having 2 to 18 carbon atoms.
  • the alkyl group having 1 to 18 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the number of carbon atoms is preferably 3 to 18, and more preferably 5 to 18.
  • the alkenyl group having 2 to 18 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the number of carbon atoms is preferably 3 to 18, and more preferably 5 to 18.
  • the alkynyl group having 2 to 18 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the number of carbon atoms is preferably 3 to 18, and more preferably 5 to 18.
  • R 1 is a hydrocarbon group or R 21 -L 1 -R 22, 6 to 24 carbon atoms - - X is -NR 1 preferably exhibits a group represented by.
  • one of R 2 and R 3 is a hydrogen atom; the other of R 2 and R 3 is a hydrocarbon group having 6 to 24 carbon atoms, or a group represented by R 31- L 2- R 32-. It is preferable to show.
  • R 2 and R 3 each independently preferably represent a hydrocarbon group having 6 to 24 carbon atoms or a group represented by R 31 ⁇ L 2 ⁇ R 32- .
  • R 4 , R 6 , R 9 , R 10 , R 11 and R 12 are preferably hydrogen atoms.
  • R 5 is a hydrogen atom, an alkyl group having 1 to 18 carbon atoms, an alkyl group having 1 to 18 carbon atoms which may be substituted with —O (CO) -R 42 or ⁇ (CO) OR 43, and an aryl group. It is preferably an alkyl group having 1 to 18 carbon atoms which may be substituted with, an alkyl group having 1 to 18 carbon atoms which may be substituted with a hydroxyl group, and when it is an alkyl group, R 4 , R 6 , R 10 And R 12 may be linked to each other to form a ring which may contain an O atom.
  • an alkyl group having 1 to 18 carbon atoms an alkyl group having 1 to 18 carbon atoms which may be substituted with —O (CO) -R 42 or ⁇ (CO) OR 43, or an aryl group is substituted. It is preferably an alkyl group having 1 to 12 carbon atoms, an alkyl group having 1 to 8 carbon atoms which may be substituted with a hydroxyl group, and an alkyl group having 1 to 18 carbon atoms, —O (CO) —R 42. Alternatively, it is more preferably an alkyl group having 1 to 18 carbon atoms which may be substituted with ⁇ (CO) OR 43.
  • R 7 and R 8 may be independently substituted with a hydrogen atom, a hydrocarbon group having 1 to 18 carbon atoms, —O (CO) -R 42 or ⁇ (CO) OR 43 , respectively. It is an alkyl group of 18, an alkyl group having 1 to 8 carbon atoms which may be substituted with an aryl group, or an alkyl group having 1 to 8 carbon atoms which may be substituted with a hydroxyl group, or R 7 and R 8 are mutually exclusive. It is preferable that they are linked to form a 4- to 7-membered ring which may contain an O atom.
  • R 5 and R 7 or R 8 are not connected to each other and do not form a ring.
  • a + b is preferably 1 or 2, more preferably 1.
  • c + d is preferably 1 or 2, more preferably 1.
  • the compound represented by the formula (1) is preferably a compound represented by the following formula (1-1).
  • R 24 is a hydrogen atom, a hydrocarbon group, or R 21 -L 1 -R 22, 6 to 24 carbon atoms - a group represented by, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 25 represents a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31- L 2- R 32- , and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 2 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 4 , R 5 , R 6 , R 7 , R 8 , R 10 , and R 12 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • Substituents on alkyl groups having 1 to 18 carbon atoms that may be substituted are hydroxyl groups, carboxyl groups, amino groups represented by -NR 45 R 46 , substituted or unsubstituted aryl groups, substituted or unsubstituted heteros.
  • An aryl group a group represented by —O (CO) OR 41 , —O (CO) —R 42 , —— (CO) OR 43 , or —OR 44 , R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms, and the substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are , Alkyl group with 1 to 18 carbon atoms, hydroxyl group, carboxyl group, amino group represented by -NR 45 R 46 , -O (CO) OR 41 , -O (CO) -R 42 ,-(CO) It is a group represented by OR 43 or —OR 44 , and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently have a hydrocarbon group having 1 to 18 carbon atoms. Shown.
  • R 4, R 5, R 6 , R 7, R 8, R 10, and R 12 in the formula (1-1) are the same as those of the formula (1).
  • R 24 of the formula (1-1) is preferably an alkyl group or an alkenyl group having 6 to 24 carbon atoms.
  • the alkyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 8 to 20 carbon atoms.
  • the alkenyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 8 to 20 carbon atoms.
  • R 25 of the formula (1-1) is preferably an alkyl group or an alkenyl group having 6 to 24 carbon atoms.
  • the alkyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 7 to 20 carbon atoms.
  • the alkenyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain or cyclic.
  • the alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 8 to 20 carbon atoms.
  • X indicates -O-;
  • R 2 , R 3 , R 31 , L 2 , and R 32 are synonymous with the definitions in equation (1).
  • R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • a substituent on an alkyl group having 1 to 18 carbon atoms which may be substituted, and a substituent on a substituted or unsubstituted aryl group, and a substituent on a substituted or unsubstituted heteroaryl group are defined in the formula (1).
  • a + b is 1 and c + d is 1 or 2.
  • the compound represented by the formula (1) is a compound represented by the following formula (2).
  • R 2 and R 3 independently represent a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31- L 2- R 32- .
  • R 31 represents a hydrocarbon group having 1 to 24 carbon atoms.
  • L 2 is -O (CO) O-, -O (CO)-,-(CO) O-, -O-, or Show
  • R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms.
  • R 5 represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms which may be substituted.
  • Substituents on alkyl groups having 1 to 18 carbon atoms that may be substituted are hydroxyl groups, carboxyl groups, amino groups represented by -NR 45 R 46 , substituted or unsubstituted aryl groups, substituted or unsubstituted heteros.
  • Aryl group a group represented by —O (CO) OR 41 , —O (CO) —R 42 , —— (CO) OR 43 , or —OR 44 .
  • R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms, a substituted or unsubstituted aryl group, and a substituted or unsubstituted heteroaryl group.
  • the substituents on the group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46 , -O (CO) OR 41 , and -O (CO) -R.
  • R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms.
  • e indicates 2 or 3.
  • the definitions of R 2 , R 3 , R 5 , R 7 and R 8 are the same as those in equation (1).
  • R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms and may be substituted with 1 to 18 carbon atoms for R 5.
  • Substituents on the alkyl group of are hydroxyl groups, substituted or unsubstituted aryl groups, —O (CO) OR 41 , —O (CO) —R 42 , ⁇ (CO) OR 43 , or ⁇ . It is a group represented by OR 44 , and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms and are substituted or unsubstituted.
  • Substituents on the aryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, an amino group represented by -NR 45 R 46 , -O (CO) OR 41 , -O (CO)-. It is a group represented by R 42 ,-(CO) OR 43 , or -OR 44 , and R 41 , R 42 , R 43 , R 44 , R 45, and R 46 have 1 carbon atoms, respectively. It shows up to 18 hydrocarbon groups.
  • R 2 and R 3 each independently represent a hydrocarbon group having 3 to 24 carbon atoms or a group represented by R 31- L 2- R 32- , where L 2 is.
  • R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms and may be substituted. Substituents on the alkyl groups of numbers 1-18 are unsubstituted aryl groups, —O (CO) -R 42 , or ⁇ (CO) OR 43 , where R 42 and R 43 are independent, respectively. It shows a hydrocarbon group having 1 to 18 carbon atoms.
  • R 2 and R 3 each independently represent a hydrogen atom or a hydrocarbon group having 3 to 24 carbon atoms
  • R 7 and R 8 each independently represent a hydrogen atom.
  • the substituent on the alkyl group having 1 to 18 carbon atoms and may be substituted is an unsubstituted aryl group, -O (CO) -R 42 , or-(CO).
  • ) is a group represented by O-R 43, R 42, and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , where L 2 is -O (CO)-or-(CO).
  • L 2 is -O (CO)-or-(CO).
  • R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is ,
  • An unsubstituted aryl group, a group represented by -O (CO) -R 42 , or-(CO) O-R 43 , and R 42 and R 43 are independently carbonized with 1 to 18 carbon atoms, respectively. Indicates a hydrogen group.
  • R 2 and R 3 each independently represent a group represented by R 31- L 2- R 32- , where L 2 is -O (CO)-or-(. CO) O—, R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 18 carbon atoms and may be substituted on an alkyl group having 1 to 18 carbon atoms. Is a substituent represented by an unsubstituted aryl group, -O (CO) -R 42 , or-(CO) O-R 43 , and R 42 and R 43 are independently having 1 to 18 carbon atoms, respectively. Indicates a hydrocarbon group.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 is a hydrocarbon having 3 to 24 carbon atoms.
  • L 2 represents -O (CO)-or-(CO) O-
  • R 7 and R 8 each independently have a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.
  • Substituents on alkyl groups with 1-18 carbon atoms that may be shown and substituted are the substituents represented by an unsubstituted aryl group, —O (CO) —R 42 , or ⁇ (CO) OR 43.
  • R 42 and R 43 each independently represent a hydrocarbon group having 1 to 18 carbon atoms.
  • one of R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 is a hydrocarbon having 6 carbon atoms.
  • Group is indicated, L 2 indicates -O (CO)-or-(CO) O-, and R 7 and R 8 each independently indicate a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.
  • Substituents on alkyl groups with 1-18 carbon atoms that may be substituted are the groups represented by —O (CO) —R 42 , or ⁇ (CO) OR 43 , R 42 , and R.
  • Each of 43 independently represents a hydrocarbon group having 1 to 18 carbon atoms.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 is a hydrocarbon having 6 carbon atoms.
  • Group is indicated, L 2 indicates -O (CO)-or-(CO) O-, R 5 indicates a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 indicate a group.
  • Independently indicate a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 is a hydrocarbon having 6 carbon atoms.
  • Group is indicated, L 2 indicates -O (CO)-or-(CO) O-, R 5 indicates a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 indicate a group.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 has 3 to 5 carbon atoms.
  • L 2 indicates -O (CO)-or-(CO) O-
  • R 5 indicates a hydrogen atom or an alkyl group having 1 to 18 carbon atoms
  • R 7 and R independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 has 3 to 5 carbon atoms. It indicates a hydrocarbon group, L 2 indicates -O (CO)-or-(CO) O-, R 5 indicates a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and R 7 and R. 8 represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms independently, and e represents 2.
  • one of R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 is a hydrocarbon having 6 carbon atoms.
  • L 2 indicates -O (CO)-or-(CO) O-
  • R 5 indicates a hydrogen atom or an substituted alkyl group having 1 to 18 carbon atoms
  • R 7 and R 8 independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms
  • the substituted substituent on the alkyl group having 1 to 18 carbon atoms is -O (CO) -R 42
  • -(CO) O-R 43 is a group
  • R 42 and R 43 each independently represent a hydrocarbon group having 1 to 18 carbon atoms.
  • R 2 and R 3 represents a group represented by R 31- L 2- R 32- , and the other of R 2 and R 3 is a hydrocarbon having 6 carbon atoms.
  • Group is indicated, L 2 indicates -O (CO)-or-(CO) O-, R 5 indicates a hydrogen atom or an substituted alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituted substituent on the alkyl group having 1 to 18 carbon atoms is -O (CO) -R 42 , or -(CO) O-R 43 is a group, R 42 and R 43 independently represent a hydrocarbon group having 1 to 18 carbon atoms, and e represents 2.
  • the compound represented by the formula (1) may form a salt.
  • Salts in the basic group include, for example, salts with mineral acids such as hydrochloric acid, hydrobromic acid, nitrate and sulfuric acid; formic acid, acetic acid, citrate, oxalic acid, fumaric acid, maleic acid, succinic acid, malic acid, Salts with organic carboxylic acids such as tartrate, aspartic acid, trichloroacetic acid and trifluoroacetic acid; and salts with sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, mesitylenesulfonic acid and naphthalenesulfonic acid Can be mentioned.
  • Salts in acidic groups include, for example, salts with alkali metals such as sodium and potassium; salts with alkaline earth metals such as calcium and magnesium; ammonium salts; and trimethylamine, triethylamine, tributylamine, pyridine, N, N- Nitrogen-containing organic bases such as dimethylaniline, N-methylpiperidin, N-methylmorpholin, diethylamine, dicyclohexylamine, procaine, dibenzylamine, N-benzyl- ⁇ -phenethylamine, 1-ephenamine and N, N'-dibenzylethylenediamine. And salt etc.
  • preferred salts include pharmacologically acceptable salts.
  • the compound represented by the formula (1) can be produced by combining known methods, and can be produced, for example, according to the production method shown below.
  • R a and R b are leaving groups; R c , R d and Re are amino protecting groups or imino protecting groups; R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 12 have the same meanings as above.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 12 have the same meanings as above.
  • As leaving groups for example, chloro group, fluoro group, bromo group, trichloromethoxy group.
  • Examples of the amino-protecting group or the imino-protecting group include a tert-butoxycarbonyl group, a benzyloxycarbonyl group, a 2-nitrobenzenesulfonyl group, a benzyl group and the like.
  • Known compounds of formula [3] include, for example, 4-nitrophenyl chloroformate, 1,1'-carbonyldiimidazole, triphosgene and phosgene.
  • the compound of formula [4] can be produced by reacting the compound of formula [2] with the compound of formula [3] in the presence of a base.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides and aromatic hydrocarbons. Examples thereof include hydrogens, and these solvents may be mixed and used.
  • Preferred solvents include ethers, with tetrahydrofuran being more preferred.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [2].
  • Examples of the base used in this reaction include an inorganic base and an organic base.
  • the base is preferably an organic base, and specific examples thereof include triethylamine, N, N-diisopropylethylamine, 4-methylmorpholine, pyridine, and N, N-dimethylaminopyridine.
  • the amount of the base used may be 1 to 50 times mol, preferably 1 to 10 times mol, of the compound of the formula [2].
  • the amount of the compound of the formula [3] to be used is not particularly limited, but may be 0.3 to 10 times (v / w) the amount of the compound of the formula [2]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • Known compounds of formula [5] include, for example, (9Z, 12Z) -di ((9Z, 12Z) -octadeca-9,12-dien-1-yl) amines and dihexadecylamines.
  • the compound of formula [6] can be produced by reacting the compound of formula [4] with the compound of formula [5] in the presence of a base.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides and aromatic hydrocarbons. Examples thereof include hydrogens, and these solvents may be mixed and used.
  • Preferred solvents include ethers, with tetrahydrofuran being more preferred.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [4].
  • Examples of the base used in this reaction include an inorganic base and an organic base.
  • the base is preferably an organic base, and specific examples thereof include triethylamine, N, N-diisopropylethylamine, 4-methylmorpholine, pyridine, and N, N-dimethylaminopyridine.
  • the amount of the base used may be 1 to 50 times mol, preferably 1 to 10 times mol, of the compound of the formula [4].
  • the amount of the compound of the formula [5] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [4]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • Compounds of formula [2A] include, for example, tert-butyl (2-((tert-butoxycarbonyl) amino) ethyl) (2-hydroxyethyl) carbamate and tert-butyl (2-((2-hydroxyethyl) (methyl)). ) Amino) ethyl) carbamate and the like are known.
  • the compound of formula [6A] is prepared by reacting the compound of formula [2A] with the compound of formula [3] in the presence of a base, and then combining the compound of formula [4A] with the compound of formula [5] in the presence of a base. It can be produced by reacting with. This reaction may be carried out according to the production methods (1-1) and (1-2).
  • the compound of formula [6] can be produced by deprotecting the compound of formula [6A]. This reaction is, for example, T.I. W. TW Greene et al., Protective Groups in Organic Synthesis, 4th Edition, pp. 696-926, 2007, John Wiley and Sons. Wiley & Sons, INC.) May be followed.
  • R a and R b are leaving groups; R c , R d and Re are amino protecting groups or imino protecting groups; R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 12 have the same meanings as above.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 12 have the same meanings as above.
  • As leaving groups for example, chloro group, fluoro group, bromo group, trichloromethoxy group.
  • Examples of the amino-protecting group or the imino-protecting group include a tert-butoxycarbonyl group, a benzyloxycarbonyl group, a 2-nitrobenzenesulfonyl group, a benzyl group and the like.
  • Known compounds of formula [3] include, for example, 4-nitrophenyl chloroformate, 1,1'-carbonyldiimidazole, triphosgene and phosgene.
  • the compound of formula [8] can be produced by reacting the compound of formula [7] with the compound of formula [3] in the presence of a base. This reaction may be carried out according to the production method (1-1).
  • the compound of formula [9] can be produced by reacting the compound of formula [8] with the compound of formula [2] in the presence of a base.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides and aromatic hydrocarbons. Examples thereof include hydrogens, and these solvents may be mixed and used. Preferred solvents include ethers, with tetrahydrofuran being more preferred.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [8].
  • Examples of the base used in this reaction include an inorganic base and an organic base.
  • the base is preferably an organic base, and specific examples thereof include triethylamine, N, N-diisopropylethylamine, 4-methylmorpholine, pyridine, and N, N-dimethylaminopyridine.
  • the amount of the base used may be 1 to 50 times mol, preferably 1 to 10 times mol, of the compound of the formula [8].
  • the amount of the compound of the formula [2] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [8]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • Compounds of formula [2A] include, for example, tert-butyl (2-((tert-butoxycarbonyl) amino) ethyl) (2-hydroxyethyl) carbamate and tert-butyl (2-((2-hydroxyethyl) (methyl)). ) Amino) ethyl) carbamate and the like are known.
  • the compound of formula [9] is produced by reacting the compound of formula [8] with the compound of formula [2A] in the presence of a base, and then deprotecting the compound of formula [9A] in the presence of a base. can do. This reaction may be carried out according to the production methods (2-2) and (1-4).
  • R a , R b and R g are leaving groups;
  • R f is an alkyl group having 1 to 18 carbon atoms;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 and R 42 have the same meanings as above.
  • As leaving groups for example, chloro group, fluoro group, bromo group, trichloromethoxy.
  • Known compounds of formula [3] include, for example, 4-nitrophenyl chloroformate, 1,1'-carbonyldiimidazole, triphosgene and phosgene.
  • the compound of formula [8] can be produced by reacting the compound of formula [7] with the compound of formula [3] in the presence of a base. This reaction may be carried out according to the production method (1-1).
  • Compounds of formula [2B] include, for example, 2,2'-((2- (diethylamino) ethyl) azandyl) bis (ethane-1-ol) and 2,2'-((3- (diethylamino) propyl) azandyl). ) Bis (ethane-1-all) is known.
  • the compound of formula [9B] can be produced by reacting the compound of formula [8] with the compound of formula [2B] in the presence of a base. This reaction may be carried out according to the production method (2-2).
  • the compound of formula [10A] for example, dodecanoic acid, decanoic acid, nonanoic acid, octanoic acid and the like are known.
  • the compound of formula [9C] can be produced by reacting the compound of formula [9B] with the compound of formula [10A] in the presence of a condensing agent or an acid halide in the presence of a base.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides and aromatic hydrocarbons. Examples thereof include hydrogens, and these solvents may be mixed and used.
  • Preferred solvents include ethers, with tetrahydrofuran being more preferred.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [9B].
  • Examples of the base used in this reaction include an inorganic base and an organic base.
  • the base is preferably an organic base, and specific examples thereof include triethylamine, N, N-diisopropylethylamine, 4-methylmorpholine, pyridine, and N, N-dimethylaminopyridine.
  • the amount of the base used may be 1 to 50 times mol, preferably 1 to 10 times mol, of the compound of the formula [9B].
  • Condensing agents used in this reaction include, for example, carbodiimides such as N, N'-dicyclohexylcarbodiimide and 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide; carbonyls such as carbonyldiimidazole; diphenylphosphoryl.
  • carbodiimides such as N, N'-dicyclohexylcarbodiimide and 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide
  • carbonyls such as carbonyldiimidazole
  • diphenylphosphoryl diphenylphosphoryl.
  • Acid azides such as azides
  • Acid cyanides such as diethylphosphoryl cyanide
  • Examples of the acid halides used in this reaction include carboxylic acid halides such as acetyl chloride and trifluoroacetyl chloride; sulfonic acid halides such as methanesulfonyl chloride and tosyl chloride; ethyl chloroformate and isobutyl chloroformate. Chloroformates and the like can be mentioned.
  • the amount of the compound of the formula [10A] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [9B]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • the compound of the formula [10B] for example, dodecanoic acid chloride, decanoic acid chloride, nonanoic acid chloride, octanoic acid chloride and the like are known.
  • the compound of formula [9C] can be produced by reacting the compound of formula [9B] with the compound of formula [10B] in the presence of a base.
  • the compound of the formula [10B] can be produced by reacting the compound of the formula [10A] with thionyl chloride, oxalyl chloride and the like.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides and aromatic hydrocarbons. Examples thereof include hydrogens, and these solvents may be mixed and used. Preferred solvents include ethers, with tetrahydrofuran being more preferred.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [9B].
  • Examples of the base used in this reaction include an inorganic base and an organic base. The amount of the base used may be 1 to 50 times mol, preferably 1 to 10 times mol, of the compound of the formula [9B].
  • the amount of the compound of the formula [10B] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [2B]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • R h and R i are leaving groups; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 and R 12 have the same meanings as above.
  • the leaving group include a chloro group, a bromo group, an iodo group, a methanesulfonyl group, a 4-toluenesulfonyl group, a chloromethanesulfonyl group, a trifluoromethanesulfonyl group, and the like.
  • Compounds of formula [12] include, for example, 2-chloro-N, N-dimethylethane-1-amine, 4- (2-chloroethyl) morpholine and 2-chloro-N, N-diethylethane-1-amine, 2, -Bromo-N, N-diethylethane-1-amine, 3-chloro-N, N-diethylethane-1-amine and the like are known.
  • the compound of formula [2] can be produced by reacting the compound of formula [11] with the compound of formula [12] in the presence or absence of a base.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, alcohols, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides, etc. Examples include aromatic hydrocarbons and water, and these solvents may be mixed and used.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [11].
  • Examples of the base used in this reaction include an inorganic base and an organic base. The amount of the base used may be 1 to 10000 times mol, preferably 1 to 5000 times mol, of the compound of the formula [11].
  • the amount of the compound of the formula [12] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [11]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • the compound of formula [2] can be produced by reacting the compound of formula [13] with the compound of formula [14] in the presence or absence of a base. This reaction may be carried out according to the production method (4-1).
  • R j is a leaving group
  • R k is an alkyl group having 1 to 18 carbon atoms
  • R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 and R 43 have the same meanings as above.
  • As leaving groups for example, chloro group, bromo group, iodo group, methanesulfonyl group, 4-toluenesulfonyl group, chloromethanesulfonyl group, trifluoromethanesulfonyl. Group, etc.
  • the compound of formula [2] can be produced by reacting the compound of formula [2C] with the compound of formula [15A] in the presence or absence of a base.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, alcohols, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides, etc. Examples include aromatic hydrocarbons and water, and these solvents may be mixed and used.
  • Preferred solvents include ethers or nitriles, with tetrahydrofuran or acetonitrile being more preferred.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [2C].
  • Examples of the base used in this reaction include an inorganic base and an organic base.
  • the amount of the base used may be 1 to 10000 times mol, preferably 1 to 5000 times mol, of the compound of the formula [2C].
  • the amount of the compound of the formula [15A] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [13].
  • This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • R g and R l are leaving groups;
  • R m is an alkyl group having 1 to 18 carbon atoms;
  • R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 and R 42 have the same meanings as above.
  • ”As the leaving group for example, a chloro group, a bromo group, an iodo group, a methanesulfonyl group, a 4-toluenesulfonyl group, a chloromethanesulfonyl group, Trifluoromethanesulfonyl group, trichloromethoxy group, 4-nitro-phenoxy group, 2,4-dinitrophenoxy group, 2,4,6-trichlorophenoxy group, pentafluorophenoxy group, 2,3,5,6-tetrafluorophenoxy Examples thereof include a group, an imidazolyl group, a triazolyl group, a 3,5-dioxo-4-methyl-1,2,4-oxadiazolidyl group, and an N-hydroxysuccinimidyl group.
  • the compound of formula [2] can be produced by reacting the compound of formula [2B] with the compound of formula [10A] in the presence of a condensing agent or an acid halide in the presence of a base. This reaction may be carried out according to the production method (3-3).
  • the compound of formula [10B] for example, dodecanoic acid chloride, decanoic acid chloride, nonanoic acid chloride, octanoic acid chloride and the like are known.
  • the compound of formula [2] can be produced by reacting the compound of formula [2B] with the compound of formula [10B] in the presence of a base. This reaction may be carried out according to the production method (3-4).
  • the compound of formula [2] can be produced by reacting the compound of formula [2C] with the compound of formula [16] in the presence or absence of a base. This reaction may be carried out according to the production method (4-1).
  • R n , Ro and R p are alkyl groups having 1 to 17 carbon atoms; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 , R 42 and R 43 have the same meaning as above. "
  • Known compounds of formula [17A] include, for example, formaldehyde, acetaldehyde, propanal, butanal, pentanal, hexanal, heptanal and octanal.
  • the compound of the formula [2] is such that the compound of the formula [2C] is reacted with the compound of the formula [17A] in the presence of a reducing agent, the presence or absence of a reduction catalyst, and the presence or absence of an acid.
  • the solvent used in this reaction is not particularly limited as long as it does not affect the reaction, but for example, alcohols, halogen hydrocarbons, ethers, esters, amides, nitriles, sulfoxides, etc.
  • Examples include aromatic hydrocarbons and water, and these solvents may be mixed and used.
  • the amount of the solvent used is not particularly limited, but may be 1 to 500 times (v / w) the amount of the compound of the formula [2C].
  • Examples of the acid used in this reaction include inorganic acids and organic acids. The amount of the acid used may be 0.01 to 10000 times mol, preferably 0.05 to 100 times mol, of the compound of the formula [2C].
  • Examples of the reducing agent used in this reaction include sodium triacetoxyborohydride, sodium cyanoborohydride, 2-picoline borane, formic acid and hydrogen.
  • Examples of the reduction catalyst used in this reaction include palladium-carbon, palladium hydroxide-carbon, platinum-carbon, rhodium-carbon and ruthenium-carbon.
  • the amount of the compound of the formula [17A] to be used is not particularly limited, but may be 1 to 10 times (v / w) the amount of the compound of the formula [13]. This reaction may be carried out at ⁇ 30 to 150 ° C., preferably 0 to 100 ° C. for 5 minutes to 48 hours.
  • the compound of the formula [17C] for example, heptyl 3-oxopropanoate and octyl 3-oxopropanoate are known.
  • the compound of the formula [2] is such that the compound of the formula [2C] is reacted with the compound of the formula [17C] in the presence of a reducing agent, the presence or absence of a reduction catalyst, and the presence or absence of an acid. Can be manufactured by This reaction may be carried out according to the production method (7-1).
  • isomers for example, optical isomers, geometric isomers, tautomers, etc.
  • these isomers can also be used.
  • solvates, hydrates and crystals of various shapes are present, these solvates, hydrates and crystals of various shapes can also be used.
  • a compound having an amino group, a hydroxyl group, a carboxyl group or the like is known in advance after the reaction by protecting these groups with ordinary protecting groups. These protecting groups can be removed by the above method.
  • the compound obtained by the above-mentioned production method is subjected to a reaction known per se such as condensation, addition, oxidation, reduction, rearrangement, substitution, halogenation, dehydration or hydrolysis, or a combination of these reactions is appropriately combined. This can lead to other compounds.
  • the content of the lipid represented by the formula (1) or a salt thereof with respect to the total lipid is preferably 40 mol% to 70 mol%, preferably 45 mol% to 65 mol. It is more preferably%, and even more preferably 50 mol% to 60 mol%.
  • the pharmaceutical composition of the present invention comprises a nonionic lipid.
  • sterols are preferable. By containing sterols, the membrane fluidity can be lowered and the effect of stabilizing lipid particles can be obtained.
  • the sterols are not particularly limited, but are cholesterol, phytosterol (citosterol), stigmasterol, fucosterol, spinasterol, brassicasterol, etc.), ergosterol, cholestanol, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl. Ether, cholesteryl-4'-hydroxybutyl ether and the like can be raised. Of these, cholesterol is preferred.
  • the content of the nonionic lipid with respect to the total lipid is preferably 20 mol% to 65 mol%, more preferably 25 mol% to 60 mol%, and 25 mol%. It is more preferably from to 55 mol%, particularly preferably from 30 mol% to 50 mol%.
  • the pharmaceutical composition of the present invention contains a lipid having a nonionic hydrophilic polymer structure.
  • a lipid having a nonionic hydrophilic polymer structure By containing a lipid having a nonionic hydrophilic polymer structure, a dispersion stabilizing effect of lipid particles can be obtained.
  • nonionic hydrophilic polymers are not particularly limited, but are nonionic vinyl polymers, nonionic polyamino acids, nonionic polyesters, nonionic polyethers, nonionic natural polymers, and the like. Examples thereof include nonionic modified natural polymers, block polymers or graft copolymers having two or more of these polymers as constituent units.
  • nonionic hydrophilic polymers preferably nonionic polyethers, nonionic polyesters, nonionic polyamino acids or nonionic synthetic polypeptides, more preferably nonionic polyethers or nonionic polyethers.
  • the lipid having a nonionic hydrophilic polymer structure is preferably a lipid having a polyethylene glycol structure.
  • the lipid having a nonionic hydrophilic polymer is not particularly limited, and examples thereof include PEG-modified phosphoethanolamine, diacylglycerol PEG derivative, dialkylglycerol PEG derivative, cholesterol PEG derivative, and ceramide PEG derivative.
  • diacylglycerol PEG is preferable. That is, the lipid having a polyethylene glycol structure is preferably a lipid having a diacylglycerol structure and a polyethylene glycol structure, and more preferably an acyl group having a diacylglycerol structure having 12 to 22 carbon atoms. ..
  • the weight average molecular weight of the PEG chain of the nonionic hydrophilic polymer derivative is preferably 500 to 5000, more preferably 750 to 3000.
  • the nonionic hydrophilic polymer chain may be branched and may have a substituent such as a hydroxymethyl group.
  • the content of the lipid having a nonionic hydrophilic polymer with respect to the total lipid is preferably 0.5 mol% to 10 mol%, preferably 0.5 mol% to 5 mol%. Is more preferable, and 0.5 mol% to 3 mol% is further preferable.
  • the pharmaceutical composition of the present invention can contain a zwitterionic lipid.
  • a phospholipid is preferable.
  • the phospholipid is not particularly limited, and examples thereof include phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, and phosphatidylcholine and phosphatidylethanolamine are preferable.
  • the phosphatidylcholine is not particularly limited, but is soy lecithin (SPC), hydrogenated soy lecithin (HSPC), egg yolk lecithin (EPC), hydrogenated egg yolk lecithin (EPC), 1,2-dipalmitoyl-sn-glycero-3- Phosphatidyl (DMPC), 1,2-dipalmitoyl-sn-glycero-3-phosphatidyl (DPPC), 1,2-distearoyl-sn-glycero-3-phosphatidyl (DSPC), 1-palmitoyl-2-oleoyl- Examples thereof include sn-glycero-3-phosphatidolin (POPC) and 1,2-dioreoil-sn-glycero-3-phosphatidolin (DOPC).
  • SPC soy lecithin
  • HSPC hydrogenated soy lecithin
  • EPC egg yolk lecithin
  • EPC hydrogenated egg yolk lecithin
  • DSPC distearoylphosphatidylcholine
  • DPPC 1,2-dipalmitoyl-sn-glycero-3-phosphatidyl
  • DMPC 1,2-dimyristoyl-sn-glycero-3-phosphatidyl
  • the phosphatidylethanolamine is not particularly limited, but is limited to 1,2-dimiristoyl-sn-glycero-3-phoethanolamine (DMPE) and 1,2-dipalmitoyl-sn-glycero-3-phoethanolamine (DPPE).
  • DMPE 1,2-dimiristoyl-sn-glycero-3-phoethanolamine
  • DPPE 1,2-dipalmitoyl-sn-glycero-3-phoethanolamine
  • 1,2-Distearoyl-sn-glycero-3-phoethanolamine DSPE
  • 1,2-diore oil-sn-glycero-3-phoethanolamine DOPE
  • 1,2-dilinole oil-sn -Glycero-3-phophoethanolamine DLoPE
  • 1,2-difitanoyl-sn-glycero-3-phophoethanolamine D (Phy) PE
  • 1-palmitoyl-2-oleoyl-sn-glycero- 3-Phosphoethanolamine POPE
  • 1,2-ditetradecyl-sn-glycero-3-phophoethanolamine 1,2-dihexadecyl-sn-glycero-3-phophoethanolamine
  • 1,2-dioctadecyl examples thereof include -sn-glycero-3-phophoethanolamine and 1,2-diphytanyl-sn-glycero-3-phophoethanolamine.
  • the content of the biionic lipid with respect to the total lipid is preferably 0 mol% to 30 mol%, preferably 0 mol% to 20 mol%. It is more preferably mol%, and even more preferably 0 mol% to 15 mol%.
  • the method for producing the pharmaceutical composition of the present invention will be described.
  • the method for producing the pharmaceutical composition is not limited, but is classified into lipids such as lipids which are compounds represented by the formula (1) or salts thereof, nonionic lipids, and lipids having a nonionic hydrophilic polymer structure. All or part of the oil-soluble components are dissolved in an organic solvent or the like to form an oil phase, and water-soluble components such as artificial match-type miRNA are dissolved in water to form an aqueous phase, and the oil phase and the aqueous phase are mixed and produced. be able to.
  • a micromixer may be used for mixing, or an emulsifier such as a homogenizer, an ultrasonic emulsifier, a high-pressure jet emulsifier, or the like may be used for emulsification.
  • an emulsifier such as a homogenizer, an ultrasonic emulsifier, a high-pressure jet emulsifier, or the like may be used for emulsification.
  • a dry mixture containing lipids is prepared by vacuum-drying the solution containing lipids with an evaporator or the like or spray-drying with a spray dryer or the like, adding this mixture to an aqueous solvent, and further emulsifying with the above-mentioned emulsifier or the like. It can also be manufactured by doing so.
  • a component classified as a lipid such as a lipid represented by the formula (1) or a salt thereof, a nonionic lipid, and a lipid having a nonionic hydrophilic polymer structure, is dissolved in an organic solvent to form an oil phase.
  • the step (a) includes dissolving a component classified as a lipid in an organic solvent (alcohol such as ethanol, ester, etc.).
  • the total lipid concentration after dissolution in an organic solvent is not particularly limited, but is generally 1 mmol / L to 100 mmol / L, preferably 5 mmol / L to 50 mmol / L, and more preferably 10 mmol / L to. It is 30 mmol / L.
  • the aqueous phase can be obtained by dissolving the artificial match-type miRNA in water or buffer. Ingredients such as antioxidants can be added as needed.
  • the mixing ratio (mass ratio) of the aqueous phase and the oil phase is preferably 5: 1 to 1: 1 and more preferably 4: 1 to 2: 1.
  • step (d) the method for removing the organic solvent from the dispersion liquid of lipid particles is not particularly limited, and a general method can be used. For example, dialysis using phosphate buffered saline is used. The organic solvent can be removed by performing the above.
  • the concentration of the dispersion liquid obtained in the step (d) can be adjusted.
  • concentration phosphate buffered saline, physiological saline or the like can be used as a diluent to dilute to an appropriate concentration.
  • concentration the dispersion liquid obtained in step (d) can be concentrated by ultrafiltration using an ultrafiltration membrane or the like. It is preferable to use the concentrated dispersion as it is, and it is also preferable to adjust the concentration to a desired concentration by using the above-mentioned diluent after concentration.
  • Aseptic filtration is preferable in order to obtain the dispersion liquid of the lipid particles of the present invention as a pharmaceutical composition.
  • a filtration method a hollow fiber membrane, a reverse osmosis membrane, a membrane filter, or the like can be used to remove unnecessary substances from the dispersion liquid of lipid particles.
  • it is not particularly limited, but it is preferable to filter with a filter having a pore size capable of sterilization (preferably a filtration sterilization filter of 0.2 ⁇ m).
  • aseptic filtration is preferably performed after step (c) or step (d).
  • the dispersion liquid of the lipid particles of the present invention can be freeze-dried.
  • the pharmaceutical composition of the present invention can be added with an additive including a pharmaceutically acceptable medium such as an aqueous solution, a salt, a preservative, and a buffer.
  • a pharmaceutically acceptable medium such as an aqueous solution, a salt, a preservative, and a buffer.
  • the pharmaceutical composition of the present invention can be used as a treatment agent.
  • the pharmaceutical composition of the present invention is administered to a subject to treat a disease selected from fibrosis of tissues including the liver, chronic liver damage, cirrhosis, and non-alcoholic steatohepatitis.
  • the method is provided.
  • the pharmaceutical composition of the present invention is provided for use in the treatment of diseases selected from fibrosis of tissues including the liver, chronic liver damage, cirrhosis, and non-alcoholic steatohepatitis.
  • the use of the pharmaceutical composition of the present invention for producing a therapeutic agent for a disease selected from fibrosis of tissues including the liver, chronic liver damage, cirrhosis, and non-alcoholic steatohepatitis is provided. Will be done.
  • the target of the treatment agent includes humans and non-human mammals.
  • mammals other than humans include monkeys, dogs, cats, cows, horses, mice, rats and the like.
  • Treatment may be any treatment and therapy that achieves the desired therapeutic effect, eg, inhibition or delay of progression of the condition, slowing the rate of progression, pausing the rate of progression, improving the condition, healing the condition. Or remission (whether partial or complete), prevention, delay, alleviation or arrest of one or more symptoms and / or signs of the condition, or treatment of the subject or subject survival Includes being extended beyond what is expected in the absence of. Treatment also includes prevention. For example, treating a subject who is prone to or at risk of developing or recurrenting fibrosis of tissues including the liver can prevent or delay the onset or reoccurrence of fibrosis of tissues including the liver in the subject. ..
  • Target diseases of the therapeutic agent include fibrosis of tissues including the liver, chronic liver damage, cirrhosis, and non-alcoholic steatohepatitis.
  • the administration route when administering the pharmaceutical composition of the present invention is not particularly limited, and can be administered by any method.
  • Oral administration, parenteral administration intra-articular administration, intravenous administration, intra-arterial administration, subcutaneous administration, intradermal administration, intravitreal administration, intravitreal administration, intramuscular administration, intravaginal administration, intravesical administration
  • parenteral administration is preferable.
  • intravenous injection, subcutaneous injection, intradermal injection, intraperitoneal injection or intramuscular injection is preferable.
  • the dose for example, the dose can be selected in the range of 0.01 mg to 100 mg per 1 kg of the body weight of the subject per administration.
  • purification by column chromatography was carried out using an automatic purification device ISOLERA (Biotage) or a medium pressure liquid chromatograph YFLC W-prep 2XY (Yamazen Corporation).
  • the carrier in silica gel column chromatography is Chro [Example matorex Q-Pack SI 50 (Fuji Silysia Chemical Ltd.), High Flash Columns W001, W002, W003, W004 or W005 (Yamazen Corporation). used.
  • NH silica gel Chromatolex Q-Pack NH 60 (Fuji Silysia Chemical Ltd.) was used.
  • the NMR spectrum was measured using Bruker AV300 (manufactured by Bruker) or Bruker AV400 (manufactured by Bruker) using tetramethylsilane as an internal reference, and the total ⁇ value was shown in ppm.
  • the MS spectrum was measured using an ACQUITY SQD LC / MS System (manufactured by Waters).
  • Tetraisopropyl orthotitanium was added to a mixture of methyl 10-oxohexadecane and 2-butyloctane-1-ol, and the mixture was stirred at 110 ° C. for 1 hour. Water was added to the reaction mixture, the mixture was stirred at room temperature for 15 minutes, and then purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 2-butyloctyl 10-oxohexadecanoate as a colorless oil.
  • 4-Nitrophenyl chloroformate was added to a mixture of 2-butyloctyl 10-hydroxyhexadecanoate, triethylamine and tetrahydrofuran, and the mixture was stirred at room temperature for 4 hours. Water and ethyl acetate were added to the reaction mixture, the organic layer was separated, washed with water, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 2-butyloctyl 10- (((4-nitrophenoxy) carbonyl) oxy) hexadecane acid as a colorless oil.
  • the obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel), and the colorless oil 2-butyloctyl 3-ethyl-12-hexyl- 6- (2-Hydroxyethyl) -10-oxo-9,11-dioxa-3,6-diazahenicosan-21-oate was obtained.
  • the obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel), and the colorless oil 2-hexyldecyl 3-ethyl-12-hexyl- 6-Isopropyl-10-oxo-9,11-dioxa-3,6-diazahenicosan-21-oate was obtained.
  • the reaction mixture was poured into a 10% aqueous sulfuric acid solution (330 mL) under ice-cooling, hexane (300 mL) was added, the organic layer was separated, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure.
  • Tetrahydrofuran (200 mL), ethanol (100 mL) and a 10 mol / L potassium hydroxide aqueous solution were added to the obtained residue, and the mixture was stirred at 40 ° C. for 1 hour.
  • Hexane (200 mL) and water (100 mL) were added to the reaction mixture, the organic layer was separated, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure.
  • the obtained residue was purified by silica gel column chromatography (ethyl acetate-hexane) to obtain 7-hydroxytridecane-1,13-diylbis (2-hexyldecanoate) as a colorless oil.
  • 4-Nitrophenyl chloroformate was added to a mixture of 7-hydroxytridecane-1,13-diylbis (2-hexyldecanoate), triethylamine and tetrahydrofuran, and the mixture was stirred at room temperature for 1 hour.
  • the obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and silica gel column chromatography (ethyl acetate-hexane, NH silica gel) to make a colorless oil 7-(((2-((2- (2- (). Diethylamino) ethyl) (ethyl) amino) ethoxy) carbonyl) oxy) tridecane-1,13-diylbis (2-hexyldecanoate) was obtained.
  • RNA amidite (International Publication No. 2013/027843) was used as RNA amidite (hereinafter, the same applies).
  • the deprotection of the amidite was performed according to a conventional method.
  • the synthesized single-stranded nucleic acid molecule was purified by HPLC.
  • PH-0001 having the miR-29b gene sequence represented by the following sequence A was synthesized as described above.
  • P is It is a linker indicated by It was introduced into the oligomer using L-proline diamide amidite shown in.
  • the underlined part is a gene expression-suppressing sequence.
  • PH-0001 array A 5'- UAGCACCAUUUGAAAUCAGUG UU (SEQ ID NO: 1)-P-AACACUGAUUUCAAAUGGUGCUAGA (SEQ ID NO: 2) -3'
  • DSPC 1,2-distearoyl-sn-glycero-3-phosphocholine
  • product name COATSOME MC-8080; NOF Corporation
  • cholesterol product name: Cholesterol HP; Nippon Seika Co., Ltd.
  • DMG-PEG2000 product name: SUNBRIGHT (R) GM-020; NOF corporation
  • HEDC bis (2- (tetradecanoyloxy) ethyl) amino) -N- (2-hydroxyethyl) -N, N-dimethyl-2-oxoethane-ami, which will be described later, is used as the cationic lipid.
  • the HEDC, S104, and DiVA used in the comparative example have the structures shown below, respectively. These were prepared and used with reference to the text of the specification of Japanese Patent No. 5873553.
  • the particle size of the single-stranded nucleic acid molecule-encapsulating lipid particles was measured as it was in the lipid particle dispersion using the particle size measurement system ELS-Z2 (Otsuka Electronics Co., Ltd.).
  • the inclusion rate of the single-stranded nucleic acid molecule was measured by the following method.
  • Quantum-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific) was used and quantified according to the protocol.
  • the 20 ⁇ TE buffer included in the above kit was diluted with water to obtain a 1 ⁇ TE buffer.
  • TE represents Tris / EDTA (ethylenediaminetetraacetic acid).
  • the lipid particle dispersion liquid holding the nucleic acid was diluted 10000 times with 1 ⁇ TE buffer.
  • a RiboGreen reagent (a reagent contained in the above-mentioned Quanti-iT Ribogreen RNA Assay Kit) diluted 2000-fold with a 1 ⁇ TE buffer. was added to the sample, and the nucleic acid concentration in the external aqueous phase was quantified by measuring fluorescence (excitation wavelength: 485 nm, fluorescence wavelength: 535 nm) using a plate reader Infinit EF200 (TECAN).
  • nucleic acid inclusion rate (total nucleic acid concentration-nucleic acid concentration in the outer aqueous phase) ⁇ total nucleic acid concentration x 100 The results are shown in Table 2.
  • the autopsy was performed approximately 24 hours after the final administration of the test substance-administered group, and the control group and the vehicle-administered group were performed on the same day as the test substance-administered group.
  • the liver was perfused with saline. Liver perfusion was performed via the portal vein using a 20 mL disposable syringe equipped with a 23 G needle. After perfusion, the liver lobe was excised and a liver sample for PCR analysis was collected.
  • RNAiso Plus (Takara Bio Inc.) was added to the liver piece of the outer left lobe, homogenized, and chloroform was added and mixed. After allowing to stand at room temperature for 5 minutes, centrifugation was performed at 4 ° C. and 21,000 ⁇ g for 15 minutes. After collecting the supernatant, Total RNA was purified using the SV Total RNA Isolation System (Promega), and the RNA concentration was measured using an absorptiometer (NanoDrop 2000c Spectrophotometer, Thermo Fisher Scientific Co., Ltd.).
  • Total RNA sample (1000 ng / 7 ⁇ L) is a cDNA synthesis reaction solution [4.4 mM MgCl2 (Roche Diagnostics Co., Ltd.), 40 U RNase inhibitor (Toyo Spinning Co., Ltd.), 0.5 mM dNTP (Promega Co., Ltd.), 250 ng Random primers (Promega Co., Ltd.), 5 x first strand buffer (Invitrogen Co., Ltd.), 10 mM dithiothreitol (Invitrogen Co., Ltd.), 200 U MMLV-RT (Invitrogen Co., Ltd.)] After reacting at 37 ° C for 1 hour and at 99 ° C for 5 minutes, the mixture was ice-cooled.
  • the obtained cDNA solution was dispensed into 8-series PCR tubes at 10 ⁇ L each and stored at -20 ° C until use.
  • Quantitative PCR was performed using cDNA equivalent to 5 ng Total RNA per well by real-time PCR using TB Green Premix Ex Taq II (Takara Bio Co., Ltd.) and Real-time PCR thermal cycler DICE (Takara Bio Co., Ltd.). It was.
  • For the PCR reaction after initial denaturation (95 ° C -30 sec), perform 2-Step PCR (95 ° C -5 sec, 60 ° C -45 sec) x 40 cycles, and analyze the amplification curve by the second derivative maximum (SDM) method. Was done.
  • the primer used was designed and synthesized using the Perfect Real Time Support System (Takara Bio Inc.).
  • the expression level of the gene to be analyzed (Col1a1, ⁇ -SMA) was corrected using the expression level of the housekeeping gene 36B4. The results are shown in FIGS. 1 and 2.
  • ⁇ Pharmaceutical efficacy test II> The preparations prepared in Examples 1 and 2 were administered and tested in the same manner as in Drug Efficacy Test I except that the test was performed at a dose of artificial match-type miRNA of 0.3 mg / kg body weight.
  • the pharmaceutical composition of the present invention can efficiently deliver artificial match-type miRNA and is excellent in protein translation inhibitory effect. Therefore, the pharmaceutical composition of the present invention is useful as a pharmaceutical product.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Inorganic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
PCT/JP2020/045874 2019-12-10 2020-12-09 医薬組成物及び処置剤 WO2021117769A1 (ja)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2021564001A JPWO2021117769A1 (tr) 2019-12-10 2020-12-09

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2019-222631 2019-12-10
JP2019222631 2019-12-10

Publications (1)

Publication Number Publication Date
WO2021117769A1 true WO2021117769A1 (ja) 2021-06-17

Family

ID=76329883

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2020/045874 WO2021117769A1 (ja) 2019-12-10 2020-12-09 医薬組成物及び処置剤

Country Status (2)

Country Link
JP (1) JPWO2021117769A1 (tr)
WO (1) WO2021117769A1 (tr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012530059A (ja) * 2009-06-10 2012-11-29 アルニラム・ファーマシューティカルズ・インコーポレーテッド 改善された脂質製剤
WO2015095340A1 (en) * 2013-12-19 2015-06-25 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2015095346A1 (en) * 2013-12-19 2015-06-25 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2018155487A1 (ja) * 2017-02-21 2018-08-30 株式会社ボナック 核酸含有ｄｐｉ用粉末製剤及びその用途

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012530059A (ja) * 2009-06-10 2012-11-29 アルニラム・ファーマシューティカルズ・インコーポレーテッド 改善された脂質製剤
WO2015095340A1 (en) * 2013-12-19 2015-06-25 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2015095346A1 (en) * 2013-12-19 2015-06-25 Novartis Ag Lipids and lipid compositions for the delivery of active agents
WO2018155487A1 (ja) * 2017-02-21 2018-08-30 株式会社ボナック 核酸含有ｄｐｉ用粉末製剤及びその用途

Also Published As

Publication number Publication date
JPWO2021117769A1 (tr) 2021-06-17

Similar Documents

Publication Publication Date Title
JP2023071950A (ja) Ｒｎａ送達のためのイオン化可能なカチオン性脂質
KR102591743B1 (ko) 화합물 또는 그 염 및 지질 입자
JP7389134B2 (ja) 脂質組成物
JP7241869B2 (ja) 脂質組成物
WO2017117530A1 (en) Ionizable cationic lipid
TW201534578A (zh) 新穎脂質
CN112566894A (zh) D-氨基酸氧化酶(daao)的有效抑制剂及其用途
CN116456967A (zh) 可离子化脂质体、其制备及在基因递送中的应用
JP4804923B2 (ja) グリセロール誘導体で修飾された化合物
JPWO2019013255A1 (ja) 核酸送達用組成物及び核酸含有組成物
WO2021117769A1 (ja) 医薬組成物及び処置剤
WO2021117770A1 (ja) 医薬組成物及び処置剤
JP6774965B2 (ja) カチオン性脂質としての化合物
WO2023121975A1 (en) Ionizable amine lipids and lipid nanoparticles
JP6240570B2 (ja) 脂質粒子および核酸送達キャリア
JP7043411B2 (ja) カチオン性脂質としての化合物
KR102669334B1 (ko) 화합물 또는 그 염 및 지질 입자
JP6495995B2 (ja) 脂質粒子および核酸送達キャリア
WO2023176821A1 (ja) 脂質組成物
WO2023121970A1 (en) Ionizable amine and ester lipids and lipid nanoparticles
WO2023121971A1 (en) Nanomaterials comprising tetravalent lipid compounds

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20900565

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2021564001

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20900565

Country of ref document: EP

Kind code of ref document: A1