WO2021076682A1 - Variants of cas12a nucleases and methods of making and use thereof - Google Patents

Variants of cas12a nucleases and methods of making and use thereof Download PDF

Info

Publication number
WO2021076682A1
WO2021076682A1 PCT/US2020/055659 US2020055659W WO2021076682A1 WO 2021076682 A1 WO2021076682 A1 WO 2021076682A1 US 2020055659 W US2020055659 W US 2020055659W WO 2021076682 A1 WO2021076682 A1 WO 2021076682A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
nucleic acid
activity
polypeptide
lbcas12a
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/055659
Other languages
English (en)
French (fr)
Inventor
Joseph Matthew Watts
Sathya Sheela JALI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pairwise Plants Services Inc
Original Assignee
Pairwise Plants Services Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2020366358A priority Critical patent/AU2020366358A1/en
Priority to BR112022007125A priority patent/BR112022007125A2/pt
Priority to CN202080087121.8A priority patent/CN114829595A/zh
Priority to NZ787124A priority patent/NZ787124B2/en
Priority to KR1020227015955A priority patent/KR20220097408A/ko
Priority to IL292117A priority patent/IL292117A/en
Priority to CA3157707A priority patent/CA3157707A1/en
Priority to MX2022004549A priority patent/MX2022004549A/es
Application filed by Pairwise Plants Services Inc filed Critical Pairwise Plants Services Inc
Priority to EP20875763.3A priority patent/EP4045643A4/en
Priority to JP2022523132A priority patent/JP7644755B2/ja
Publication of WO2021076682A1 publication Critical patent/WO2021076682A1/en
Anticipated expiration legal-status Critical
Priority to JP2025030119A priority patent/JP2025087754A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/20Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04004Adenosine deaminase (3.5.4.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04005Cytidine deaminase (3.5.4.5)

Definitions

  • the most widely utilized nuclease for genome modification can introduce mutations at a genomic region upstream of an NGG motif (e.g., a protospacer adjacent motif (PAM)).
  • NGG motif e.g., a protospacer adjacent motif (PAM)
  • Other Cas nucleases have different PAM recognition specificities. When the PAM specificities of these nucleases are particularly stringent, they can reduce the usefulness of the nuclease for genome modification by limiting the number of genomic target sites available for modification by that nuclease.
  • the present invention provides modified CRISPR-Cas nucleases having improved PAM specificity and methods for designing, identifying and selecting such CRISPR-Cas nucleases.
  • LbCas12a Lachnospiraceae bacterium CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Cas12a (LbCas12a) polypeptide
  • the modified LbCas12a polypeptide comprises, consists essentially of, or consists of an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO:1 (LbCas12a) and a mutation at one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more) of the following positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, G532, D535, K538, D541, Y542, L585, K591, M592, K595, V596, S599, K600, K601, Y616, Y646, and/or W649 with reference to the position numbering of S
  • a second aspect of the invention provides a Type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) - associated (Cas) (CRISPR-Cas) system comprising: (a) a fusion protein comprising (i) a modified LbCas12a polypeptide of the invention or a nucleic acid encoding the modified LbCas12a polypeptide of the invention, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA,crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a polypeptide or the fusion protein, and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the modified LbCas12a polypeptide and the polypeptide
  • a third aspect of the invention provides a method of modifying a target nucleic acid, comprising: contacting the target nucleic acid with: (a)(i) a modified LbCas12a polypeptide of the invention, or a fusion protein comprising a modified LbCas12a polypeptide of the invention, and (ii) a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA,crDNA); (b) a complex comprising the modified LbCas12a polypeptide of the invention and a guide nucleic acid; (c) a composition comprising (i) a modified lbCas12a polypeptide of the invention, or a fusion protein of the invention, and (ii) a guide nucleic acid; and/or (d) a system of the invention, thereby modifying the target nucleic acid.
  • a guide nucleic acid e.g., CRISPR RNA, CRISPR DNA, crRNA
  • a fourth aspect of the invention provides a method of modifying a target nucleic acid, comprising contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a modified LbCas12a polypeptide of the invention, or an expression cassette or vector comprising the same, and (ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and/or (b) a nucleic acid construct encoding a (i) complex comprising a modified LbCas12a polypeptide or a fusion protein of the invention, and (ii) a guide nucleic acid, or an expression cassette or vector comprising the same, thereby modifying the target nucleic acid.
  • a fifth aspect of the invention provides a method of editing a target nucleic acid, comprising: contacting the target nucleic acid with: (a)(i) a fusion protein comprising a modified LbCas12a polypeptide of the invention and (a)(ii) a guide nucleic acid; (b) a complex comprising the fusion protein of the invention, and a guide nucleic acid; (c) a composition comprising the fusion protein of the invention and a guide nucleic acid; and/or, (d) a system of the invention, thereby editing the target nucleic acid.
  • a sixth aspect of the invention provides a method of editing a target nucleic acid, comprising contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a fusion protein comprising a modified LbCas12a polypeptide of the invention, or an expression cassette or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette or vector comprising the same; and/or (b) a nucleic acid construct encoding a complex comprising a fusion protein comprising a modified LbCas12a polypeptide of the invention, and a guide nucleic acid, or an expression cassette or vector comprising the same; and/or (c) a system of the invention, thereby editing the target nucleic acid.
  • a seventh aspect of the invention provides a method of constructing a randomized DNA library comprising double stranded nucleic acid molecules for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site at the 5' end of the protospacer, the method comprising: preparing two or more double stranded nucleic acid molecules comprising the following steps: (a) synthesizing a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand for each of the two or more double stranded nucleic acid molecules, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 15 nucleotides, (ii) a second sequence having at least four randomized nucleotides, (iii) a protospacer sequence comprising about 16 to about 25 nucleotides, and
  • An eighth aspect of the invention provides a method of constructing a randomized DNA library comprising double stranded nucleic acid molecules for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site at the 3' end of the protospacer, the method comprising: preparing two or more double stranded nucleic acid molecules comprising the following steps: (a) synthesizing a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand for each of the two or more double stranded nucleic acid molecules, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 20 nucleotides, (ii) a protospacer sequence comprising about 16 to about 25 nucleotides, (iii) a second sequence having at least four randomized nucleotides, and
  • a ninth aspect of the invention provides a randomized DNA library for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site on the 5' end of protospacer, the randomized DNA library comprising two or more double stranded nucleic acid molecules each of which comprises: (a) a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 15 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides, and any range or value therein), (ii) a second sequence having at least four randomized nucleotides (e.g., at least 4, 5, 6, 7, 8, 9, 10, or more, and any range or value therein), (iii) a protospace
  • a tenth aspect of the invention provides a randomized DNA library for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site on the 3' end of protospacer, the randomized DNA library comprising two or more double stranded nucleic acid molecules each of which comprises: (a) a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, and any range or value therein), (ii) a protospacer sequence comprising about 16 to about 25 nucleotides e.g., about 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, (i
  • the invention further provides expression cassettes and/or vectors comprising polynucleotides encoding CRISPR-Cas nucleases and/or fusion proteins of the invention and/or cells comprising polynucleotides, polypeptides and/or fusion proteins of the invention and/or kits comprising the same.
  • CRISPR-Cas nucleases and/or fusion proteins of the invention and/or cells comprising polynucleotides, polypeptides and/or fusion proteins of the invention and/or kits comprising the same.
  • SEQ ID NOs:23-25 and SEQ ID NOs:42-48 are exemplary cytosine deaminases.
  • SEQ ID NO:26 an exemplary nucleotide sequence encoding a uracil-DNA glycosylase inhibitor (UGI).
  • SEQ ID NOs: 27-29 provides an example of a protospacer adjacent motif position for a Type V CRISPR-Cas12a nuclease.
  • SEQ ID NOs:30-39 shows example nucleotide sequences useful for generating a randomized library of this invention for use in, for example, in vitro cleavage assays.
  • SEQ ID NOs:40-41 are exemplary regulatory sequences encoding a promoter and intron.
  • SEQ ID NO:52 provides the nucleotide sequence of an example expression cassette.
  • SEQ ID NO:53 provides the nucleotide sequence of an example vector.
  • SEQ ID NOs:54-61 provide example spacer sequences.
  • SEQ ID NO:62 provides an example CRISPR RNA.
  • BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 shows a diagram of an example PAM Library preparation of the invention. In this method, 5' phosphorylated oligonucleotides are annealed and cloned into an EcoRI and SphI digested pUC19 vector. Sca I is used to linearize the vector (AGTACT sequence is not recognized by Lbcpf1).
  • Fig. 2 shows mean protospacer adjacent motifs (PAMs) per gene for corn (top panel) and soy (bottom panel) within coding sequences.
  • LbCpf1 genes can access far less gene sequences than Cas9 variants.
  • Fig. 3 shows mean accessible cytosines (panels A, B) and adenines (panels C, D) limited by PAMs in corn (panels A, C) and soy (panels B, D). As shown, LbCpf1 cytosines and adenines can access far less cytosines and adenines than Cas9 variants.
  • Fig. 1 shows mean protospacer adjacent motifs per gene for corn (top panel) and soy (bottom panel) within coding sequences.
  • LbCpf1 genes can access far less gene sequences than Cas9 variants.
  • Fig. 3 shows mean accessible cytosines (panels A, B) and adenines (panels C, D) limited by PAMs in corn (panel
  • Top panel top sequence (SEQ ID NO:36), middle sequence (SEQ ID NO:37), bottom sequence (SEQ ID NO:38); middle panel: top sequence (SEQ ID NO:39), bottom sequence (SEQ ID NO:37); bottom panel: top sequence (SEQ ID NO:36), bottom sequence (SEQ ID NO: 37).
  • Fig. 6. Cell sorting results of a negative control containing wtLbCas12a and a crRNA which did not target the plasmid spacers.
  • Fig. 18 shows percentage indel formed in HEK293T cells for each TTTV-containing spacer. Individual indel percentages are shown as circles, squares, or triangles for TTTC, TTTA, and TTTG, respectively. An average line and the value rounded to the nearest whole number is also shown for each spacer.
  • Fig. 19 shows LbCas12a_K595Y HEK293T maximum observed INDEL percentages per PAM tested. Values above 0.1% are outside of the noise of sequencing and represent authentic INDELs. Fig.
  • FIG. 20 shows LbCas12a_T152R HEK293T maximum observed INDEL percentages per PAM tested. Values above 0.1% are outside of the noise of sequencing and represent authentic INDELs.
  • Fig. 21 shows LbCas12a_K538W HEK293T maximum observed INDEL percentages per PAM tested. Values above 0.1% are outside of the noise of sequencing and represent authentic INDELs.
  • Figs. 22A-22B Linear correlation between % INDEL (max) and the normalized bacterial PAM-SCANR score for LbCas12a-T152R (Fig. 22A) and LbCas12a-K595Y (Fig. 22B).
  • any feature or combination of features set forth herein can be excluded or omitted.
  • any feature or combination of features set forth herein can be excluded or omitted.
  • the specification states that a composition comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
  • the singular forms "a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.
  • “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
  • phrases such as "between about X and Y” mean “between about X and about Y” and phrases such as “from about X to Y” mean “from about X to about Y.”
  • Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10 to15 is disclosed, then 11, 12, 13, and 14 are also disclosed.
  • the term “consisting essentially of” when used in a claim of this invention is not intended to be interpreted to be equivalent to “comprising.”
  • the terms “increase,” “increasing,” “enhance,” “enhancing,” “improve” and “improving” describe an elevation of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more as compared to a control.
  • the terms “reduce,” “reduced,” “reducing,” “reduction,” “diminish,” and “decrease” describe, for example, a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control.
  • the reduction can result in no or essentially no (i.e., an insignificant amount, e.g., less than about 10% or even 5%) detectable activity or amount.
  • a “heterologous” or a “recombinant” nucleotide sequence is a nucleotide sequence not naturally associated with a host cell into which it is introduced, including non- naturally occurring multiple copies of a naturally occurring nucleotide sequence.
  • a “native” or “wild type” nucleic acid, nucleotide sequence, polypeptide or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide or amino acid sequence.
  • a “wild type mRNA” is an mRNA that is naturally occurring in or endogenous to the organism.
  • a “homologous" nucleic acid sequence is a nucleotide sequence naturally associated with a host cell into which it is introduced.
  • nucleic acid refers to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids.
  • dsRNA is produced synthetically, less common bases, such as inosine, 5-methylcytosine, 6- methyladenine, hypoxanthine and others can also be used for antisense, dsRNA, and ribozyme pairing.
  • polynucleotides that contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression.
  • Other modifications, such as modification to the phosphodiester backbone, or the 2'-hydroxy in the ribose sugar group of the RNA can also be made.
  • nucleotide sequence refers to a heteropolymer of nucleotides or the sequence of these nucleotides from the 5' to 3' end of a nucleic acid molecule and includes DNA or RNA molecules, including cDNA, a DNA fragment or portion, genomic DNA, synthetic (e.g., chemically synthesized) DNA, plasmid DNA, mRNA, and anti-sense RNA, any of which can be single stranded or double stranded.
  • nucleic acid sequence “nucleic acid,” “nucleic acid molecule,” “nucleic acid construct,” “oligonucleotide” and “polynucleotide” are also used interchangeably herein to refer to a heteropolymer of nucleotides.
  • Nucleic acid molecules and/or nucleotide sequences provided herein are presented herein in the 5' to 3' direction, from left to right and are represented using the standard code for representing the nucleotide characters as set forth in the U.S. sequence rules, 37 CFR ⁇ 1.821 - 1.825 and the World Intellectual Property Organization (WIPO) Standard ST.25.
  • a "5' region” as used herein can mean the region of a polynucleotide that is nearest the 5' end of the polynucleotide.
  • an element in the 5' region of a polynucleotide can be located anywhere from the first nucleotide located at the 5' end of the polynucleotide to the nucleotide located halfway through the polynucleotide.
  • a "3' region” as used herein can mean the region of a polynucleotide that is nearest the 3' end of the polynucleotide.
  • an element in the 3' region of a polynucleotide can be located anywhere from the first nucleotide located at the 3' end of the polynucleotide to the nucleotide located halfway through the polynucleotide.
  • the term "gene” refers to a nucleic acid molecule capable of being used to produce mRNA, antisense RNA, miRNA, anti-microRNA antisense oligodeoxyribonucleotide (AMO) and the like. Genes may or may not be capable of being used to produce a functional protein or gene product.
  • Genes can include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences and/or 5' and 3' untranslated regions).
  • a gene may be "isolated” by which is meant a nucleic acid that is substantially or essentially free from components normally found in association with the nucleic acid in its natural state. Such components include other cellular material, culture medium from recombinant production, and/or various chemicals used in chemically synthesizing the nucleic acid.
  • mutation refers to point mutations (e.g., missense, or nonsense, or insertions or deletions of single base pairs that result in frame shifts), insertions, deletions, and/or truncations.
  • the mutation is typically described by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue.
  • the terms "complementary” or “complementarity,” as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence “A-G-T” (5' to 3') binds to the complementary sequence "T-C-A” (3' to 5').
  • Complementarity between two single-stranded molecules may be "partial,” in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single stranded molecules.
  • the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
  • “Complement” as used herein can mean 100% complementarity with the comparator nucleotide sequence or it can mean less than 100% complementarity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like, complementarity).
  • a "portion" or “fragment” of a nucleotide sequence of the invention will be understood to mean a nucleotide sequence of reduced length relative (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides) to a reference nucleic acid or nucleotide sequence and comprising, consisting essentially of and/or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference nucleic acid or nucleotide sequence.
  • nucleic acid fragment or portion according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent.
  • a repeat sequence of guide nucleic acid of this invention may comprise a portion of a wild type CRISPR-Cas repeat sequence (e.g., a wild type Cas9 repeat, wild type Cas12a repeat, and the like).
  • a wild type CRISPR-Cas repeat sequence e.g., a wild type Cas9 repeat, wild type Cas12a repeat, and the like.
  • homologues includes homologous sequences from the same and other species and orthologous sequences from the same and other species.
  • compositions and methods of the invention further comprise homologues to the nucleotide sequences and polypeptide sequences of this invention.
  • Orthologous refers to homologous nucleotide sequences and/ or amino acid sequences in different species that arose from a common ancestral gene during speciation.
  • a homologue of a nucleotide sequence of this invention has a substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) to said nucleotide sequence of the invention.
  • sequence identity refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. "Identity” can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H.
  • percent sequence identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) polynucleotide molecule (or its complementary strand) as compared to a test (“subject”) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned.
  • percent identity can refer to the percentage of identical amino acids in an amino acid sequence as compared to a reference polypeptide.
  • the phrase “substantially identical,” or “substantial identity” in the context of two nucleic acid molecules, nucleotide sequences or protein sequences refers to two or more sequences or subsequences that have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • the substantial identity exists over a region of consecutive nucleotides of a nucleotide sequence of the invention that is about 10 nucleotides to about 20 nucleotides, about 10 nucleotides to about 25 nucleotides, about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 25 nucleotides, about 30 nucleotides to about 40 nucleotides, about 50 nucleotides to about 60 nucleotides, about 70 nucleotides to about 80 nucleotides, about 90 nucleotides to about 100 nucleotides, or more nucleotides in length, and any range therein, up to the full length of the sequence.
  • the nucleotide sequences can be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides).
  • a substantially identical nucleotide or protein sequence performs substantially the same function as the nucleotide (or encoded protein sequence) to which it is substantially identical.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, CA).
  • identity fraction for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100.
  • the comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence.
  • percent identity may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.
  • Two nucleotide sequences may also be considered substantially complementary when the two sequences hybridize to each other under stringent conditions.
  • two nucleotide sequences considered to be substantially complementary hybridize to each other under highly stringent conditions.
  • Stringent hybridization conditions and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York (1993).
  • highly stringent hybridization and wash conditions are selected to be about 5oC lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • Very stringent conditions are selected to be equal to the T m for a particular probe.
  • An example of stringent hybridization conditions for hybridization of complementary nucleotide sequences which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42oC, with the hybridization being carried out overnight.
  • An example of highly stringent wash conditions is 0.15M NaCl at 72oC for about 15 minutes.
  • An example of stringent wash conditions is a 0.2x SSC wash at 65oC for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example of a medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1x SSC at 45oC for 15 minutes.
  • An example of a low stringency wash for a duplex of, e.g., more than 100 nucleotides is 4-6x SSC at 40oC for 15 minutes.
  • stringent conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30oC.
  • Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.
  • a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleotide sequences that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical.
  • nucleotide sequence, polynucleotide and/or recombinant nucleic acid construct of this invention can be codon optimized for expression in any organism of interest. Codon optimization is well known in the art and involves modification of a nucleotide sequence for codon usage bias using species specific codon usage tables. The codon usage tables are generated based on a sequence analysis of the most highly expressed genes for the organism/species of interest. When the nucleotide sequences are to be expressed in the nucleus, the codon usage tables are generated based on a sequence analysis of highly expressed nuclear genes for the species of interest.
  • the modifications of the nucleotide sequences are determined by comparing the species specific codon usage table with the codons present in the native polynucleotide sequences.
  • codon optimization of a nucleotide sequence results in a nucleotide sequence having less than 100% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%, and any range or value therein) to the native nucleotide sequence but which still encodes a polypeptide having the same function as that encoded by the original, native nucleotide sequence.
  • the polynucleotides, nucleic acid constructs, expression cassettes, and/or vectors of the invention are codon optimized for expression in a particular species of interest, e.g., a particular plant species, a particular bacterial species, a particular animal species, and the like.
  • the codon optimized nucleic acid constructs, polynucleotides, expression cassettes, and/or vectors of the invention have about 70% to about 99.9% (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%.
  • a polynucleotide or nucleic acid construct of the invention may be operatively associated with a variety of promoters and/or other regulatory elements for expression in a plant and/or a cell of a plant.
  • a polynucleotide or nucleic acid construct of this invention may further comprise one or more promoters, introns, enhancers, and/or terminators operably linked to one or more nucleotide sequences.
  • a promoter may be operably associated with an intron (e.g., Ubi1 promoter and intron).
  • a promoter associated with an intron maybe referred to as a "promoter region" (e.g., Ubi1 promoter and intron).
  • promoter region e.g., Ubi1 promoter and intron.
  • a first nucleotide sequence that is operably linked to a second nucleotide sequence means a situation when the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence.
  • a promoter is operably associated with a nucleotide sequence if the promoter effects the transcription or expression of said nucleotide sequence.
  • control sequences e.g., promoter
  • nucleic acid sequences can be present between a promoter and the nucleotide sequence, and the promoter can still be considered “operably linked” to the nucleotide sequence.
  • linked in reference to polypeptides, refers to the attachment of one polypeptide to another.
  • a polypeptide may be linked to another polypeptide (at the N-terminus or the C-terminus) directly (e.g., via a peptide bond) or through a linker.
  • linker refers to a chemical group, or a molecule linking two molecules or moieties, e.g., two domains of a fusion protein, such as, for example, a LbCas12a CRISPR-Cas nuclease domain and a polypeptide of interest (e.g., a nucleic acid-editing domain, a deaminase domain, an adenosine deaminase, a cytosine deaminase).
  • a linker may be comprised of a single linking molecule or may comprise more than one linking molecule.
  • the linker can be an organic molecule, group, polymer, or chemical moiety such as a bivalent organic moiety.
  • the linker may be an amino acid or a peptide.
  • a peptide linker may be about 4 to about 100 or more amino acids in length, for example, about 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
  • a peptide linker may be a GS linker.
  • a "promoter” is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) that is operably associated with the promoter.
  • the coding sequence controlled or regulated by a promoter may encode a polypeptide and/or a functional RNA.
  • a "promoter” refers to a nucleotide sequence that contains a binding site for RNA polymerase II and directs the initiation of transcription. In general, promoters are found 5', or upstream, relative to the start of the coding region of the corresponding coding sequence.
  • a promoter may comprise other elements that act as regulators of gene expression; e.g., a promoter region. These include a TATA box consensus sequence, and often a CAAT box consensus sequence (Breathnach and Chambon, (1981) Annu. Rev. Biochem. 50:349). In plants, the CAAT box may be substituted by the AGGA box (Messing et al., (1983) in Genetic Engineering of Plants, T. Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227).
  • a promoter region may comprise at least one intron (e.g., SEQ ID NO:40 or SEQ ID NO:41).
  • Promoters useful with this invention can include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and/or tissue-specific promoters for use in the preparation of recombinant nucleic acid molecules, e.g., "synthetic nucleic acid constructs" or "protein-RNA complex.” These various types of promoters are known in the art. The choice of promoter may vary depending on the temporal and spatial requirements for expression, and also may vary based on the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge present in the art, the appropriate promoter can be selected for the particular host organism of interest.
  • a promoter functional in a plant may be used with the constructs of this invention.
  • a promoter useful for driving expression in a plant include the promoter of the RubisCo small subunit gene 1 (PrbcS1), the promoter of the actin gene (Pactin), the promoter of the nitrate reductase gene (Pnr) and the promoter of duplicated carbonic anhydrase gene 1 (Pdca1) (See, Walker et al. Plant Cell Rep. 23:727-735 (2005); Li et al.
  • PrbcS1 and Pactin are constitutive promoters and Pnr and Pdca1 are inducible promoters. Pnr is induced by nitrate and repressed by ammonium (Li et al. Gene 403:132- 142 (2007)) and Pdca1 is induced by salt (Li et al. Mol Biol. Rep. 37:1143-1154 (2010)).
  • constitutive promoters useful for plants include, but are not limited to, cestrum virus promoter (cmp) (U.S. Patent No. 7,166,770), the rice actin 1 promoter (Wang et al.
  • Ubiquitin promoters have been cloned from several plant species for use in transgenic plants, for example, sunflower (Binet et al., 1991. Plant Science 79: 87-94), maize (Christensen et al., 1989. Plant Molec. Biol. 12: 619-632), and arabidopsis (Norris et al. 1993. Plant Molec. Biol. 21:895-906).
  • the maize ubiquitin promoter (UbiP) has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342926.
  • the ubiquitin promoter is suitable for the expression of the nucleotide sequences of the invention in transgenic plants, especially monocotyledons.
  • the promoter expression cassettes described by McElroy et al. can be easily modified for the expression of the nucleotide sequences of the invention and are particularly suitable for use in monocotyledonous hosts.
  • tissue specific/tissue preferred promoters can be used for expression of a heterologous polynucleotide in a plant cell.
  • Tissue specific or preferred expression patterns include, but are not limited to, green tissue specific or preferred, root specific or preferred, stem specific or preferred, flower specific or preferred or pollen specific or preferred. Promoters suitable for expression in green tissue include many that regulate genes involved in photosynthesis and many of these have been cloned from both monocotyledons and dicotyledons.
  • a promoter useful with the invention is the maize PEPC promoter from the phosphoenol carboxylase gene (Hudspeth & Grula, Plant Molec. Biol. 12:579-589 (1989)).
  • tissue-specific promoters include those associated with genes encoding the seed storage proteins (such as ⁇ - conglycinin, cruciferin, napin and phaseolin), zein or oil body proteins (such as oleosin), or proteins involved in fatty acid biosynthesis (including acyl carrier protein, stearoyl-ACP desaturase and fatty acid desaturases (fad 2-1)), and other nucleic acids expressed during embryo development (such as Bce4, see, e.g., Kridl et al. (1991) Seed Sci. Res. 1:209-219; as well as EP Patent No. 255378).
  • seed storage proteins such as ⁇ - conglycinin, cruciferin, napin and phaseolin
  • zein or oil body proteins such as oleosin
  • proteins involved in fatty acid biosynthesis including acyl carrier protein, stearoyl-ACP desaturase and fatty acid desaturases (fad 2-1)
  • Tissue-specific or tissue-preferential promoters useful for the expression of the nucleotide sequences of the invention in plants, particularly maize include but are not limited to those that direct expression in root, pith, leaf or pollen. Such promoters are disclosed, for example, in WO 93/07278, herein incorporated by reference in its entirety.
  • tissue specific or tissue preferred promoters useful with the invention the cotton rubisco promoter disclosed in US Patent 6,040,504; the rice sucrose synthase promoter disclosed in US Patent 5,604,121; the root specific promoter described by de Framond (FEBS 290:103-106 (1991); EP 0452269 to Ciba- Geigy); the stem specific promoter described in U.S.
  • Patent 5,625,136 (to Ciba-Geigy) and which drives expression of the maize trpA gene; the cestrum yellow leaf curling virus promoter disclosed in WO 01/73087; and pollen specific or preferred promoters including, but not limited to, ProOsLPS10 and ProOsLPS11 from rice (Nguyen et al. Plant Biotechnol. Reports 9(5):297- 306 (2015)), ZmSTK2_USP from maize (Wang et al. Genome 60(6):485-495 (2017)), LAT52 and LAT59 from tomato (Twell et al. Development 109(3):705-713 (1990)), Zm13 (U.S. Patent No.
  • tissue-specific/tissue preferred promoters include, but are not limited to, the root hair–specific cis-elements (RHEs) (Kim et al. The Plant Cell 18:2958-2970 (2006)), the root-specific promoters RCc3 (Jeong et al. Plant Physiol. 153:185- 197 (2010)) and RB7 (U.S. Patent No. 5459252), the lectin promoter (Lindstrom et al. (1990) Der.
  • RHEs root hair–specific cis-elements
  • RuBP carboxylase promoter (Cashmore, "Nuclear genes encoding the small subunit of ribulose-l,5-bisphosphate carboxylase” pp. 29-39 In: Genetic Engineering of Plants (Hollaender ed., Plenum Press 1983; and Poulsen et al. (1986) Mol. Gen. Genet. 205:193- 200), Ti plasmid mannopine synthase promoter (Langridge et al. (1989) Proc. Natl. Acad. Sci.
  • PEPCase promoter Hudspeth & Grula (1989) Plant Mol. Biol. 12:579-589
  • R gene complex-associated promoters Chandler et al. (1989) Plant Cell 1:1175-1183
  • chalcone synthase promoters Useful for seed-specific expression is the pea vicilin promoter (Czako et al. (1992) Mol. Gen. Genet. 235:33-40; as well as the seed-specific promoters disclosed in U.S. Patent No. 5,625,136.
  • Useful promoters for expression in mature leaves are those that are switched at the onset of senescence, such as the SAG promoter from Arabidopsis (Gan et al. (1995) Science 270:1986-1988).
  • promoters functional in chloroplasts can be used.
  • Non-limiting examples of such promoters include the bacteriophage T3 gene 95' UTR and other promoters disclosed in U.S. Patent No. 7,579,516.
  • Other promoters useful with the invention include but are not limited to the S-E9 small subunit RuBP carboxylase promoter and the Kunitz trypsin inhibitor gene promoter (Kti3).
  • Additional regulatory elements useful with this invention include, but are not limited to, introns, enhancers, termination sequences and/or 5' and 3' untranslated regions.
  • An intron useful with this invention can be an intron identified in and isolated from a plant and then inserted into an expression cassette to be used in transformation of a plant.
  • introns can comprise the sequences required for self-excision and are incorporated into nucleic acid constructs/expression cassettes in frame.
  • An intron can be used either as a spacer to separate multiple protein-coding sequences in one nucleic acid construct, or an intron can be used inside one protein-coding sequence to, for example, stabilize the mRNA.
  • Introns may also be associated with promoters to improve or modify expression.
  • a promoter/intron combination useful with this invention includes but is not limited to that of the maize Ubi1 promoter and intron.
  • Non-limiting examples of introns useful with the present invention include introns from the ADHI gene (e.g., Adh1-S introns 1, 2 and 6), the ubiquitin gene (Ubi1), the RuBisCO small subunit (rbcS) gene, the RuBisCO large subunit (rbcL) gene, the actin gene (e.g., actin-1 intron), the pyruvate dehydrogenase kinase gene (pdk), the nitrate reductase gene (nr), the duplicated carbonic anhydrase gene 1 (Tdca1), the psbA gene, the atpA gene, or any combination thereof.
  • ADHI gene e.g., Adh1-S introns 1, 2 and 6
  • the ubiquitin gene Ubi1
  • rbcS RuBisCO small subunit
  • rbcL RuBisCO large subunit
  • actin gene e.g., actin-1 in
  • a nucleic acid construct of the present invention may encode a base editor comprising an optimized CRISPR-Cas nuclease (e.g., SEQ ID NOs:1-11 or 23-25) and a deaminase, wherein the nucleic acid construct further comprises a promoter comprising/associated with an intron.
  • an optimized CRISPR-Cas nuclease e.g., SEQ ID NOs:1-11 or 23-25
  • a deaminase e.g., SEQ ID NOs:1-11 or 23-25
  • a nucleic acid construct of the present invention may encode a base editor comprising an optimized CRISPR-Cas nuclease (e.g., SEQ ID NOs:1-11 or 23-25) and a deaminase, wherein the nuclease and/or the deaminase comprises one or more introns and optionally, the nucleic acid construct further comprises a promoter comprising/associated with an intron.
  • a polynucleotide and/or a nucleic acid construct of the invention can be an "expression cassette" or can be comprised within an expression cassette.
  • expression cassette means a recombinant nucleic acid molecule comprising, for example, a nucleic acid construct of the invention (e.g., encoding a modified LbCas12a of the invention), wherein the nucleic acid construct is operably associated with at least a control sequence (e.g., a promoter).
  • a control sequence e.g., a promoter
  • some embodiments of the invention provide expression cassettes designed to express, for example, a nucleic acid construct of the invention (e.g., a nucleic acid construct of the invention encoding a modified LbCas12a of the invention).
  • An expression cassette comprising a nucleic acid construct of the invention may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components (e.g., a promoter from the host organism operably linked to a polynucleotide of interest to be expressed in the host organism, wherein the polynucleotide of interest is from a different organism than the host or is not normally found in association with that promoter).
  • An expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • An expression cassette can optionally include a transcriptional and/or translational termination region (i.e., termination region) and/or an enhancer region that is functional in the selected host cell.
  • the termination region and/or the enhancer region may be native to the transcriptional initiation region, may be native to a gene encoding, e.g., a LbCas12a nuclease encoded by a nucleic acid construct of the invention, may be native to a host cell, or may be native to another source (e.g., foreign or heterologous to the promoter, to a gene encoding a LbCas12a nuclease encoded by a nucleic acid construct of the invention, to a host cell, or any combination thereof).
  • the enhancer region may be native to a gene encoding a LbCas12a nuclease encoded by a nucleic acid construct of the invention, may be native to a host cell, or may be from another source (e.g., foreign or heterologous to the promoter, to the gene encoding the LbCas12a nuclease encoded by a nucleic acid construct of the invention, to the host cell, or any combination thereof).
  • An expression cassette of the invention also can include a nucleotide sequence encoding a selectable marker, which can be used to select a transformed host cell.
  • selectable marker means a nucleotide sequence that when expressed imparts a distinct phenotype to the host cell expressing the marker and thus allows such transformed cells to be distinguished from those that do not have the marker.
  • Such a nucleotide sequence may encode either a selectable or screenable marker, depending on whether the marker confers a trait that can be selected for by chemical means, such as by using a selective agent (e.g., an antibiotic and the like), or whether the marker is simply a trait that one can identify through observation or testing, such as by screening (e.g., fluorescence).
  • a selective agent e.g., an antibiotic and the like
  • screening e.g., fluorescence
  • vectors refers to a composition for transferring, delivering or introducing a nucleic acid (or nucleic acids) into a cell.
  • a vector comprises a nucleic acid construct comprising the nucleotide sequence(s) to be transferred, delivered or introduced.
  • Vectors for use in transformation of host organisms are well known in the art.
  • Non-limiting examples of general classes of vectors include viral vectors, plasmid vectors, phage vectors, phagemid vectors, cosmid vectors, fosmid vectors, bacteriophages, artificial chromosomes, minicircles, or Agrobacterium binary vectors in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable.
  • a viral vector can include, but is not limited, to a retroviral, lentiviral, adenoviral, adeno-associated, or herpes simplex viral vector.
  • a vector as defined herein can transform a prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g.
  • shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
  • the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell.
  • the vector may be a bi-functional expression vector which functions in multiple hosts.
  • a nucleic acid construct of this invention and/or expression cassettes comprising the same may be comprised in vectors as described herein and as known in the art.
  • the vector may be a high copy number vector (e.g., a high copy number E. coli vector; e.g., pUC, pBluescript, pGEM and the like).
  • a library of the present invention may be constructed using a high copy number vector.
  • contact refers to placing the components of a desired reaction together under conditions suitable for carrying out the desired reaction (e.g., transformation, transcriptional control, genome editing, nicking, and/or cleavage).
  • a target nucleic acid may be contacted with (a) a polynucleotide and/or nucleic acid construct of the invention encoding a modified LbCas12a nuclease of the invention and (b) a guide nucleic acid, under conditions whereby the polynucleotide/nucleic acid construct is expressed and the modified LbCas12a nuclease is produced, wherein the nuclease forms a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid.
  • a target nucleic acid may be contacted with (a) a modified LbCas12a nuclease of the invention and/or a fusion protein comprising the same (e.g., the modified LbCas12a nuclease of the invention and a polypeptide of interest (e.g., a deaminase)) and (b) a guide nucleic acid, wherein the modified LbCas12a nuclease forms a complex with the guide nucleic acid and the complex hybridizes to the target nucleic acid, thereby modifying the target nucleic acid.
  • a modified LbCas12a nuclease of the invention and/or a fusion protein comprising the same e.g., the modified LbCas12a nuclease of the invention and a polypeptide of interest (e.g., a deaminase)
  • a guide nucleic acid e.g., a guide nucle
  • the target nucleic acid may be contacted with the polynucleotides/nucleic acid constructs/polypeptides of the invention prior to, concurrently with, or after contact with the guide nucleic acid.
  • "modifying" or “modification” in reference to a target nucleic acid includes editing (e.g., mutating), covalent modification, exchanging/substituting nucleic acids/nucleotide bases, deleting, cleaving, nicking, and/or transcriptional control of a target nucleic acid.
  • introducing,” “introduce,” “introduced” in the context of a polynucleotide of interest means presenting a nucleotide sequence of interest (e.g., polynucleotide, a nucleic acid construct, and/or a guide nucleic acid) to a host organism or cell of said organism (e.g., host cell; e.g., a plant cell) in such a manner that the nucleotide sequence gains access to the interior of a cell.
  • a nucleotide sequence of interest e.g., polynucleotide, a nucleic acid construct, and/or a guide nucleic acid
  • a polynucleotide of the invention encoding a modified LbCas12a nuclease as described herein and guide nucleic acid may be introduced into a cell of an organism, thereby transforming the cell with modified LbCas12a nuclease and guide nucleic acid.
  • transformation refers to the introduction of a heterologous nucleic acid into a cell. Transformation of a cell may be stable or transient.
  • a host cell or host organism may be stably transformed with a polynucleotide/nucleic acid molecule of the invention.
  • a host cell or host organism may be transiently transformed with a polynucleotide/nucleic acid construct of the invention.
  • Transient transformation in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell.
  • stably introducing or “stably introduced” in the context of a polynucleotide introduced into a cell is intended that the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide.
  • “Stable transformation” or “stably transformed” as used herein means that a nucleic acid molecule is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid molecule is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations.
  • “Genome” as used herein includes the nuclear and the plastid genome, and therefore includes integration of the nucleic acid into, for example, the chloroplast or mitochondrial genome.
  • Stable transformation as used herein can also refer to a transgene that is maintained extrachromasomally, for example, as a minichromosome or a plasmid.
  • Transient transformation may be detected by, for example, an enzyme-linked immunosorbent assay (ELISA) or Western blot, which can detect the presence of a peptide or polypeptide encoded by one or more transgene introduced into an organism.
  • Stable transformation of a cell can be detected by, for example, a Southern blot hybridization assay of genomic DNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism (e.g., a plant).
  • Stable transformation of a cell can be detected by, for example, a Northern blot hybridization assay of RNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into a host organism.
  • Stable transformation of a cell can also be detected by, e.g., a polymerase chain reaction (PCR) or other amplification reactions as are well known in the art, employing specific primer sequences that hybridize with target sequence(s) of a transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods Transformation can also be detected by direct sequencing and/or hybridization protocols well known in the art.
  • PCR polymerase chain reaction
  • nucleotide sequences, polynucleotides, and/or nucleic acid constructs of the invention and/or expression cassettes and/or vectors comprising the same may be expressed transiently and/or they can be stably incorporated into the genome of the host organism.
  • a nucleic acid construct of the invention (e.g., encoding a modified LbCas12a nuclease of the invention, or a fusion protein thereof; e.g., a fusion protein comprising the modified LbCas12a nuclease linked to e.g., a polynucleotide of interest, e.g., a deaminase domain), wherein the nucleic acid construct encoding the modified LbCas12a nuclease is codon optimized for expression in an organism (e.g., a plant, a mammal, a fungus, a bacterium, and the like) may be transiently introduced into a cell of the organism along with a guide nucleic acid and as such no DNA maintained in the cell.
  • an organism e.g., a plant, a mammal, a fungus, a bacterium, and the like
  • a polynucleotide/nucleic acid construct of the invention can be introduced into a cell by any method known to those of skill in the art.
  • transformation of a cell comprises nuclear transformation.
  • transformation of a cell comprises plastid transformation (e.g., chloroplast transformation).
  • a polynucleotide/nucleic acid construct of the invention can be introduced into a cell via conventional breeding techniques. Procedures for transforming both eukaryotic and prokaryotic organisms are well known and routine in the art and are described throughout the literature (See, for example, Jiang et al. 2013. Nat. Biotechnol. 31:233-239; Ran et al.
  • a nucleotide sequence therefore can be introduced into a host organism or its cell in any number of ways that are well known in the art.
  • the methods of the invention do not depend on a particular method for introducing one or more nucleotide sequences into the organism, only that they gain access to the interior of at least one cell of the organism.
  • they can be assembled as part of a single nucleic acid construct, or as separate nucleic acid constructs, and can be located on the same or different nucleic acid constructs.
  • the nucleotide sequences can be introduced into the cell of interest in a single transformation event, and/or in separate transformation events, or, alternatively, where relevant, a nucleotide sequence may be incorporated into a plant, for example, as part of a breeding protocol.
  • the present invention is directed to Cas12a nucleases modified to include non-natural PAM recognition sites/sequences (e.g., a Cas12a nuclease that comprises non-natural PAM recognition specificity in addition to or instead of the natural PAM recognition specificity for that particular Cas12a nuclease).
  • the present invention is directed to methods for designing, identifying and selecting Cas12a nucleases having desirable characteristics including improved PAM recognition specificity.
  • altered PAM specificity means that the PAM specificity of the nuclease is altered from that of the wild type nuclease (e.g., non-native PAM sequences are recognized in addition to and/or instead of the native PAM sequence.
  • a modified Cas12a nuclease would be altered in its PAM specificity if it recognizes a PAM sequence other than and/or in addition to the native Cas12 a PAM sequence of TTTV, wherein V is A, C or G.
  • the present invention is directed to LbCas12a nucleases having modified PAM recognition specificities.
  • the present invention provides a modified Lachnospiraceae bacterium CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) Cas12a (LbCas12a) polypeptide, wherein the modified LbCas12a polypeptide comprises an amino acid sequence having at least 80% identity (e.g., about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% identity; e.g., about 80% to about 100%, about 85% to about 100%, about 90% to about 100% about 95% to about 100%) to the amino acid sequence of SEQ ID NO:1 (LbCas12a) and a mutation at one or more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more ) of the following positions of K116, K120, K121, D122, E125, T
  • a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of, or consists of a mutation at one or more than one of the following positions of K116, K120, K121, D122, E125, T152, D156, E159, G532, D535, K538, D541, and/or K595 with reference to the position numbering of SEQ ID NO:1 in any combination.
  • a modified LbCas12a polypeptide of this invention may comprise a single mutation at any one of the positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, G532, D535, K538, D541, Y542, L585, K591, M592, K595, V596, S599, K600, K601, Y616, Y646, and/or W649 with reference to the position numbering of SEQ ID NO:1 or may comprise a combination of mutations any two or more positions of K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, G532, D535, K538, D541, Y542, L585, K591, M592, K595, V596, S599, K600, K601, Y616, Y646, and/or W649 with reference to the position numbering of SEQ ID NO:1.
  • a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of or consists of one or more than one of the following mutations of K116N, K116R, K120H, K120N, K120Q, K120R, K120T, K121D, K121G, K121H, K121Q, K121R, K121S, K121T, D122H, D122K, D122N, D122R, E125K, E125Q, E125R, E125Y, T148A, T148C, T148H, T148S, T149C, T149F, T149G, T149H, T149N, T149P, T149S, T149V, T152E, T152F, T152H, T152K, T152L, T152Q, T152R, T152W, T152Y, D156E, D156H, D156I, D156K, D156L, D156Q, D156R, D156W, D156
  • any single Cas12a polypeptide having two or more mutations would comprise only a single mutation at any given position.
  • a polypeptide may have mutation at position D535 of any one of D535A, D535H, D535K, D535N, D535S, D535T, or D535V, but the same polypeptide may further comprise a mutation at one or more than one of any of the other positions as described herein.
  • a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of or consists of one or more than one mutation of K116N, K116R, K120H, K120N, K120Q, K120R, K120T, K121D, K121G, K121H, K121Q, K121R, K121S, K121T, D122H, D122K, D122N, D122R, E125K, E125Q, E125R, E125Y, T152E, T152F, T152H, T152K, T152L, T152Q, T152R, T152W, T152Y, D156E, D156H, D156I, D156K, D156L, D156Q, D156R, D156W, D156Y, E159K, E159Q, E159R, E159Y, G532A, G532C, G532D, G532F, G532H, G532K, G532L, G532
  • a mutation of a Cas12a (LbCas12a) polypeptide comprises, consists essentially of or consists of one or more than one mutation of K116R, K116N, K120Y, K121S, K121R, D122H, D122N, E125K, T152R, T152K, T152Y, T152Q, T152E, T152F, D156R, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, G532N, G532S, G532H, G532K, G532R, G532L, D535N, D535H, D535T, D535,S D535A, D535W, K538R K538V, K538Q, K538W, K538Y, K538F, K538H, K538L, K538M, K538C, K538G, K538G,
  • any single Cas12a polypeptide having two or more mutations would comprise a single mutation at any given position.
  • a polypeptide may have a mutation at position D535 of any one of D535A, D535H, D535K, D535N, D535S, D535T, or D535V, and may further comprise a mutation at one or more than one at any other position as described herein.
  • the mutation does not comprise, consist essentially of or consist of a mutation of D156R, G532R, K538R, K538V, Y542R or K595R with reference to position numbering of SEQ ID NO:1.
  • the mutation of the Cas12a (LbCas12a) polypeptide does not comprise, consist essentially of or consist of the combination of mutations of G532R and K595R, of G532R, K538V and Y542R, or of D156R, G532R and K532R with reference to position numbering of SEQ ID NO:1.
  • the modified LbCas12a polypeptide may comprise one or more amino acid mutations of SEQ ID NO:1 as set forth in Table 2 (in Example 2).
  • the modified LbCas12a polypeptide may comprise an altered protospacer adjacent motif (PAM) specificity as compared to wild type LbCas12a (e.g., SEQ ID NO:1).
  • a modified LbCas12a polypeptide of the present invention may comprise an altered PAM specificity, wherein the altered PAM specificity includes, but is not limited to, NNNG, NNNT, NNNA, NNNC, NNG, NNT, NNC, NNA, NG, NT, NC, NA, NN, NNN, NNNN, wherein each N of each sequence is independently selected from any of T, C, G, or A.
  • the altered PAM specificity may include, but is not limited to, TTTA, TTTC, TTTG, TTTT, TTCA, TTCC, TTCG, TTCT, ATTC, CTTA, CTTC, CTTG, GTTC, TATA, TATC, CTCC, TCCG, TACA, TCCG, TACA, TCCG, TCCC, TCCA, and/or TATG.
  • the altered PAM specificity may be NNNN, wherein each N of each sequence is independently selected from any of T, C, G, or A.
  • a modified LbCas12a nuclease may further comprise a mutation in the nuclease active site (e.g., RuvC domain) (e.g., deadLbCas12a, dLbCas12a). Such modifications may result in the LbCas12a polypeptide having reduced nuclease activity (e.g., nickase activity) or no nuclease activity.
  • a Type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) - associated (Cas) (CRISPR-Cas) system comprising: (a) a fusion protein comprising (i) a modified LbCas12a nuclease of the invention or a nucleic acid encoding the modified LbCas12a nuclease of the invention, and (ii) a polypeptide of interest or a nucleic acid encoding the polypeptide of interest; and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA,crDNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is capable of forming a complex with the modified LbCas12a nuclease or the fusion protein and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding modified LbCas12a nucle
  • the system comprises a polypeptide of interest linked to the C-terminus and/or the N-terminus of the modified LbCas12a nuclease (e.g., a fusion protein), optionally via a peptide linker.
  • a polypeptide of interest linked to the C-terminus and/or the N-terminus of the modified LbCas12a nuclease e.g., a fusion protein
  • the fusion protein may comprise a polypeptide of interest linked to the C-terminus and/or to the N-terminus of the modified LbCas12a.
  • the present invention provides a fusion protein comprising a modified LbCas12a and an optional intervening linker linking the polypeptide of interest.
  • a linker that does not "interfere" with the activity of a fusion protein is a linker that does not reduce or eliminate the activity of the polypeptides of the fusion protein (e.g., the nuclease and/or the polypeptide of interest); that is, the nuclease activity, nucleic acid binding activity, editing activity, and/or any other activity of the nuclease or peptide of interest is maintained in a fusion protein in which the nuclease and the polypeptide of interest are tethered to one another via the linker.
  • the polypeptides of the fusion protein e.g., the nuclease and/or the polypeptide of interest
  • a peptide linker may be linked (e.g., at its N-terminus) to the C-terminus of a modified LbCas12a, optionally wherein the fusion protein may further comprise a polypeptide of interest linked to the C-terminus of the linker.
  • a peptide linker may be linked (e.g., at its C-terminus) to the N-terminus of a modified LbCas12a, optionally wherein the fusion protein may further comprise a polypeptide of interest linked to the N-terminus of the linker.
  • a modified LbCas12a of the invention may be linked at both its C-terminus and N-terminus to a linker and/or a polypeptide of interest (directly or via a linker).
  • a linker useful with the invention may be an amino acid or a peptide.
  • a peptide linker useful with this invention may be about 4 to about 100 or more amino acids in length, for example, about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more amino acids in length (e.g., about 4 to about 40, about 4 to about 50,
  • a peptide linker may be a GS linker.
  • a polypeptide of interest useful with this invention can include, but is not limited to, a polypeptide or protein domain having deaminase (deamination) activity, nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitor activity (e.g., uracil-DNA glycosylase inhibitor (UGI)).
  • demethylase activity demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nuclease activity, single-strand RNA cleavage activity, double-strand RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and/or photolyase activity.
  • restriction endonuclease activity e.g., Fok1
  • nucleic acid binding activity methyltransferase activity
  • DNA repair activity DNA damage activity
  • dismutase activity alkylation activity
  • depurination activity oxidation activity
  • a polypeptide of interest may comprise at least one polypeptide or protein domain having deaminase activity.
  • the at least one polypeptide or protein domain may be an adenine deaminase domain.
  • An adenine deaminase (or adenosine deaminase) useful with this invention may be any known or later identified adenine deaminase from any organism (see, e.g., U.S. Patent No. 10,113,163, which is incorporated by reference herein for its disclosure of adenine deaminases).
  • An adenine deaminase can catalyze the hydrolytic deamination of adenine or adenosine.
  • the adenine deaminase may catalyze the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, the adenosine deaminase may catalyze the hydrolytic deamination of adenine or adenosine in DNA.
  • an adenine deaminase encoded by a nucleic acid construct of the invention may generate an A ⁇ G conversion in the sense (e.g., "+”; template) strand of the target nucleic acid or a T ⁇ C conversion in the antisense (e.g., " ⁇ ", complementary) strand of the target nucleic acid.
  • an adenosine deaminase may be a variant of a naturally- occurring adenine deaminase.
  • an adenosine deaminase useful with the invention may be about 70% to 100% identical to a wild type adenine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, and any range or value therein, to a naturally occurring adenine deaminase).
  • a wild type adenine deaminase e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%
  • the deaminase or deaminase does not occur in nature and may be referred to as an engineered, mutated or evolved adenosine deaminase.
  • an engineered, mutated or evolved adenine deaminase polypeptide or an adenine deaminase domain may be about 70% to 99.9% identical to a naturally occurring adenine deaminase polypeptide/domain (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical, and
  • the adenosine deaminase may be from a bacterium, (e.g., Escherichia coli, Staphylococcus aureus, Haemophilus influenzae, Caulobacter crescentus, and the like).
  • a polynucleotide encoding an adenine deaminase polypeptide/domain may be codon optimized for expression in an organism.
  • an adenine deaminase domain may be a wild type tRNA- specific adenosine deaminase domain, e.g., a tRNA-specific adenosine deaminase (TadA) and/or a mutated/evolved adenosine deaminase domain, e.g., mutated/evolved tRNA-specific adenosine deaminase domain (TadA*).
  • a TadA domain may be from E. coli.
  • the TadA may be modified, e.g., truncated, missing one or more N-terminal and/or C-terminal amino acids relative to a full-length TadA (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 N-terminal and/or C terminal amino acid residues may be missing relative to a full length TadA.
  • a TadA polypeptide or TadA domain does not comprise an N-terminal methionine.
  • a wild type E. coli TadA comprises the amino acid sequence of SEQ ID NO:18.
  • coli TadA* comprises the amino acid sequence of SEQ ID NOs:19-22.
  • a polynucleotide encoding a TadA/TadA* may be codon optimized for expression in an organism.
  • a cytosine deaminase (or cytidine deaminase) useful with this invention may be any known or later identified cytosine deaminase from any organism (see, e.g., U.S. Patent No. 10,167,457, which is incorporated by reference herein for its disclosure of cytosine deaminases).
  • the at least one polypeptide or protein domain may be a cytosine deaminase polypeptide or domain.
  • a cytosine deaminase polypeptide/domain may be an apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) domain.
  • APOBEC apolipoprotein B mRNA editing catalytic polypeptide-like domain.
  • a polypeptide of interest may comprise at least one polypeptide or protein domain having glycosylase inhibitor activity.
  • the polypeptide of interest may be a uracil-DNA glycosylase inhibitor (UGI) polypeptide/domain.
  • a nucleic acid construct encoding a modified LbCas12a nuclease of this invention and a cytosine deaminase domain may further encode a uracil-DNA glycosylase inhibitor (UGI), wherein the UGI is codon optimized for expression in an organism.
  • UGI uracil-DNA glycosylase inhibitor
  • the invention provides a fusion protein comprising a modified LbCas12a nuclease, a cytosine deaminase domain, and a UGI and/or one or more polynucleotides encoding the same, optionally wherein the one or more polynucleotides may be codon optimized for expression in an organism.
  • a cytosine deaminase catalyzes the hydrolytic deamination of cytidine or deoxycytidine to uridine or deoxyuridine, respectively.
  • a deaminase or deaminase domain may be a cytidine deaminase domain, catalyzing the hydrolytic deamination of cytosine to uracil.
  • a cytosine deaminase may be a variant of a naturally-occurring cytosine deaminase, including but not limited to a primate (e.g., a human, monkey, chimpanzee, gorilla), a dog, a cow, a rat or a mouse.
  • an cytosine deaminase useful with the invention may be about 70% to about 100% identical to a wild type cytosine deaminase (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, and any range or value therein, to a naturally occurring cytosine deaminase).
  • a wild type cytosine deaminase e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
  • a polynucleotide encoding a cytosine deaminase polypeptide/domain may be codon optimized for expression in an organism.
  • a cytosine deaminase useful with the invention may be an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase.
  • APOBEC apolipoprotein B mRNA-editing complex
  • the cytosine deaminase may be an APOBEC1 deaminase, an APOBEC2 deaminase, an APOBEC3A deaminase, an APOBEC3B deaminase, an APOBEC3C deaminase, an APOBEC3D deaminase, an APOBEC3F deaminase, an APOBEC3G deaminase, an APOBEC3H deaminase, an APOBEC4 deaminase, a human activation induced deaminase (hAID), an rAPOBEC1, FERNY, and/or a CDA1, optionally a pmCDA1, an atCDA1 (e.g., At2g19570), and evolved versions of the same.
  • hAID human activation induced deaminase
  • rAPOBEC1 FERNY and/or a CDA1, optional
  • the cytosine deaminase may be an APOBEC1 deaminase having the amino acid sequence of SEQ ID NO:23, SEQ ID NO:44 or SEQ ID NO:46. In some embodiments, the cytosine deaminase may be an APOBEC3A deaminase having the amino acid sequence of SEQ ID NO:24. In some embodiments, the cytosine deaminase may be an CDA1 deaminase, optionally a CDA1 having the amino acid sequence of SEQ ID NO:25 or SEQ ID NO:43.
  • the cytosine deaminase may be a FERNY deaminase, optionally a FERNY having the amino acid sequence of SEQ ID NO:42 or SEQ ID NO:45.
  • the cytosine deaminase may be a human activation induced deaminase (hAID) having the amino acid sequence of SEQ ID NO:47 or SEQ ID NO:48.
  • a cytosine deaminase useful with the invention may be about 70% to about 100% identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical) to the amino acid sequence of a naturally occurring cytosine deaminase (e.g., an evolved deaminase).
  • a naturally occurring cytosine deaminase e.g., an evolved deaminase
  • a cytosine deaminase useful with the invention may be about 70% to about 99.5% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical) to the amino acid sequence of SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NOs:42-48 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 or SEQ ID NOs:42
  • a polynucleotide encoding a cytosine deaminase may be codon optimized for expression in an organism and the codon optimized polypeptide may be about 70% to 99.5% identical to the reference polynucleotide.
  • a "uracil glycosylase inhibitor" (UGI) useful with the invention may be any protein that is capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme.
  • a UGI domain comprises a wild type UGI or a fragment thereof.
  • a UGI domain useful with the invention may be about 70% to about 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical and any range or value therein) to the amino acid sequence of a naturally occurring UGI domain.
  • a UGI domain may comprise the amino acid sequence of SEQ ID NO:26 or a polypeptide having about 70% to about 99.5% identity to the amino acid sequence of SEQ ID NO:26 (e.g., at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the amino acid sequence of SEQ ID NO:26).
  • a UGI domain may comprise a fragment of the amino acid sequence of SEQ ID NO:26 that is 100% identical to a portion of consecutive nucleotides (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides; e.g., about 10, 15, 20, 25, 30, 35, 40, 45, to about 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides) of the amino acid sequence of SEQ ID NO:26.
  • consecutive nucleotides e.g., about 10, 15, 20, 25, 30, 35, 40, 45, to about 50, 55, 60, 65, 70, 75, 80 consecutive nucleotides
  • a UGI domain may be a variant of a known UGI (e.g., SEQ ID NO:26) having 70% to about 99.5% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity, and any range or value therein) to the known UGI.
  • a known UGI e.g., SEQ ID NO:26 having 70% to about 99.5% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%
  • a polynucleotide encoding a UGA may be codon optimized for expression in an organism and the codon optimized polypeptide may be about 70% to about 99.5% identical to the reference polynucleotide.
  • a modified LbCas12a nuclease may comprise a mutation in its nuclease active site (e.g., RuvC).
  • a modified LbCas12a nuclease having a mutation in its nuclease active site(s) and no longer comprising nuclease activity are commonly referred to as "dead," e.g., dLbCas12a.
  • a modified LbCas12a domain or polypeptide having a mutation in its nuclease active site(s) may have impaired activity or reduced activity (e.g., nickase activity) as compared to the same LbCas12a nuclease without the mutation.
  • the modified LbCas12a nucleases of the invention may be used in combination with a guide RNA (gRNA, CRISPR array, CRISPR RNA, crRNA), designed to function with the modified LbCas12a nuclease, to modify a target nucleic acid.
  • a guide nucleic acid useful with this invention comprises at least a spacer sequence and a repeat sequence.
  • the guide nucleic acid is capable of forming a complex with the LbCas12a nuclease domain encoded and expressed by a polynucleotide/nucleic acid construct of the invention encoding a modified LbCas12a nuclease and the spacer sequence is capable of hybridizing to a target nucleic acid, thereby guiding the nucleic acid construct (e.g., the modified LbCas12a nuclease (and/or a polypeptide of interest)) to the target nucleic acid, wherein the target nucleic acid may be modified (e.g., cleaved or edited) or modulated (e.g., modulating transcription) by the modified LbCas12a nuclease (and/or an encoded deaminase domain and/or polypeptide of interest).
  • the target nucleic acid may be modified (e.g., cleaved or edited) or modulated (e.g., modulating transcription
  • a nucleic acid construct encoding an LbCas12a domain linked to a cytosine deaminase domain may be used in combination with an LbCas12a guide nucleic acid to modify a target nucleic acid, wherein the cytosine deaminase domain of the fusion protein deaminates a cytosine base in the target nucleic acid, thereby editing the target nucleic acid.
  • a nucleic acid construct encoding an LbCas12a domain linked to an adenine deaminase domain may be used in combination with an LbCas12a guide nucleic acid to modify a target nucleic acid, wherein the adenine deaminase domain of the fusion protein deaminates an adenosine base in the target nucleic acid, thereby editing the target nucleic acid.
  • a “guide nucleic acid,” “guide RNA,” “gRNA,” “CRISPR RNA/DNA” “crRNA” or “crDNA” as used herein means a nucleic acid that comprises at least one spacer sequence, which is complementary to (and hybridizes to) a target nucleic acid (e.g., protospacer), and at least one repeat sequence (e.g., a repeat of a Type V Cas12a CRISPR-Cas system, or a fragment or portion thereof), wherein the repeat sequence may be linked to the 5' end and/or the 3' end of the spacer sequence.
  • the design of a gRNA of this invention may be based on a Type V Cas12a system.
  • a Cas12a gRNA may comprise, from 5' to 3', a repeat sequence (full length or portion thereof ("handle”); e.g., pseudoknot-like structure) and a spacer sequence.
  • a guide nucleic acid may comprise more than one "repeat sequence-spacer" sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more repeat-spacer sequences) (e.g., repeat-spacer-repeat, e.g., repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer-repeat-spacer- repeat-spacer, and the like).
  • the guide nucleic acids of this invention are synthetic, human- made and not found in nature.
  • a gRNA can be quite long and may be used as an aptamer (like in the MS2 recruitment strategy) or other RNA structures hanging off the spacer.
  • a "repeat sequence” as used herein, refers to, for example, any repeat sequence of a wild-type Cas12a locus (e.g., a LbCas12a locu.) or a repeat sequence of a synthetic crRNA that is functional with the LbCas12a nuclease encoded by the nucleic acid constructs of the invention.
  • a repeat sequence useful with this invention can be any known or later identified repeat sequence of a Cas12a locus or it can be a synthetic repeat designed to function in a Cas12a Type V CRISPR-Cas system.
  • a repeat sequence may comprise a hairpin structure and/or a stem loop structure.
  • a repeat sequence may form a pseudoknot-like structure at its 5' end (i.e., "handle").
  • a repeat sequence can be identical to or substantially identical to a repeat sequence from a wild-type V CRISPR-Cas locus (e.g., a wild type Cas12a locus).
  • a repeat sequence from a wild-type Cas12a locus may be determined through established algorithms, such as using the CRISPRfinder offered through CRISPRdb (see, Grissa et al. Nucleic Acids Res. 35(Web Server issue):W52-7).
  • a repeat sequence or portion thereof is linked at its 3' end to the 5' end of a spacer sequence, thereby forming a repeat-spacer sequence (e.g., guide RNA, crRNA).
  • a repeat sequence comprises, consists essentially of, or consists of at least 10 nucleotides depending on the particular repeat and whether the guide RNA comprising the repeat is processed or unprocessed (e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 to 100 or more nucleotides, or any range or value therein; e.g., about).
  • a repeat sequence comprises, consists essentially of, or consists of about 10 to about 20, about 10 to about 30, about 10 to about 45, about 10 to about 50, about 15 to about 30, about 15 to about 40, about 15 to about 45, about 15 to about 50, about 20 to about 30, about 20 to about 40, about 20 to about 50, about 30 to about 40, about 40 to about 80, about 50 to about 100, or more nucleotides.
  • a repeat sequence linked to the 5' end of a spacer sequence can comprise a portion of a repeat sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more consecutive nucleotides of a wild type repeat sequence).
  • a portion of a repeat sequence linked to the 5' end of a spacer sequence can be about five to about ten consecutive nucleotides in length (e.g., about 5, 6, 7, 8, 9, 10 nucleotides) and have at least 90% identity (e.g., at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the same region (e.g., 5' end) of a wild type CRISPR Cas repeat nucleotide sequence.
  • a portion of a repeat sequence may comprise a pseudoknot-like structure at its 5' end (e.g., "handle").
  • a "spacer sequence” as used herein is a nucleotide sequence that is complementary to a target nucleic acid (e.g., target DNA) (e.g, protospacer).
  • the spacer sequence can be fully complementary or substantially complementary (e.g., at least about 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, and any range or value therein)) to a target nucleic acid.
  • 70% complementary e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%
  • the spacer sequence can have one, two, three, four, or five mismatches as compared to the target nucleic acid, which mismatches can be contiguous or noncontiguous.
  • the spacer sequence can have about 70% complementarity to a target nucleic acid.
  • the spacer nucleotide sequence can have about 80% complementarity to a target nucleic acid.
  • the spacer nucleotide sequence can have about 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% complementarity, and the like, to the target nucleic acid (protospacer).
  • the spacer sequence is 100% complementary to the target nucleic acid.
  • a spacer sequence may have a length from about 15 nucleotides to about 30 nucleotides (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or any range or value therein).
  • a spacer sequence may have complete complementarity or substantial complementarity over a region of a target nucleic acid (e.g., protospacer) that may be at least about 15 nucleotides to about 30 nucleotides in length.
  • the spacer may be about 20, 21, 22, 23, 24, or 25 nucleotides in length.
  • the spacer may be 23 nucleotides in length.
  • the 5' region of a spacer sequence of a guide RNA may be identical to a target nucleic acid, while the 3' region of the spacer may be substantially complementary to the target nucleic acid (e.g., Type V CRISPR-Cas), or the 3' region of a spacer sequence of a guide RNA may be identical to a target nucleic acid, while the 5' region of the spacer may be substantially complementary to the target nucleic acid (e.g., Type II CRISPR-Cas), and therefore, the overall complementarity of the spacer sequence to the target nucleic acid may be less than 100%.
  • the target nucleic acid e.g., Type V CRISPR-Cas
  • the first 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides in the 5' region (i.e., seed region) of, for example, a 20 nucleotide spacer sequence may be 100% complementary to the target nucleic acid, while the remaining nucleotides in the 3' region of the spacer sequence may be substantially complementary (e.g., at least about 70% complementary) to the target nucleic acid.
  • the first 1 to 8 nucleotides (e.g., the first 1, 2, 3, 4, 5, 6, 7, 8, nucleotides, and any range therein) of a 5' end of the spacer sequence may be 100% complementary to the target nucleic acid, while the remaining nucleotides in the 3' region of the spacer sequence may be substantially complementary (e.g., at least about 50% complementary (e.g., about 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more)) to the target nucleic acid.
  • a seed region of a spacer may be about 8 to about 10 nucleotides in length, about 5 to about 6 nucleotides in length, or about 6 nucleotides in length.
  • a "target nucleic acid”, “target DNA,” “target nucleotide sequence,” “target region,” or a “target region in the genome” refer to a region of an organism's genome that is fully complementary (100% complementary) or substantially complementary (e.g., at least 70% complementary (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, and any range or value therein)) to a spacer sequence in a guide RNA of this invention.
  • a target region useful for a Type V CRISPR-Cas system is located immediately 3' to a PAM sequence in the genome of the organism (e.g., a plant genome, an animal genome, a bacterial genome).
  • a target region may be selected from any at least 15 consecutive nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides, and any range or value therein; e.g., about 19 to about 25 nucleotides, about 20 to about 24 nucleotides in length, and the like) located immediately adjacent to a PAM sequence.
  • a “protospacer sequence” refers to the target nucleic acid and specifically to the portion of the target nucleic acid (e.g., or target region in the genome) that is fully or substantially complementary (and hybridizes) to the spacer sequence of the CRISPR repeat- spacer sequences (e.g., guide RNAs, CRISPR arrays, crRNAs).
  • the protospacer sequence is flanked (immediately adjacent to) a protospacer adjacent motif (PAM).
  • the PAM is located at the 5' end on the non-target strand and at the 3' end of the target strand (see below, as an example).
  • RNA Spacer (SEQ ID NO:27)
  • 3'AAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-5' Target strand (SEQ ID NO:28)
  • 5'TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-3' Non-target strand (SEQ ID NO:29)
  • Canonical Cas12a PAMs are T rich.
  • a canonical Cas12a PAM sequence may be 5'-TTN, 5'-TTTN, or 5'-TTTV.
  • the polypeptides, fusion proteins and/or systems of the invention may be encoded by polynucleotides or nucleic acid constructs.
  • a polynucleotide/nucleic acid construct encoding the polypeptides, fusion proteins and/or systems of the invention may be operably associated with regulatory elements (e.g., promotors, terminators and the like) for expression in an organism of interest and/or a cell of an organism of interest as described herein.
  • regulatory elements e.g., promotors, terminators and the like
  • a polynucleotide/nucleic acid construct encoding a polypeptide, fusion protein and/or system of the invention may be codon optimized for expression in an organism.
  • the present invention provides a complex comprising (a) a modified LbCas12a polypeptide of the invention or a fusion protein of the invention and (b) a guide nucleic acid (e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA).
  • a guide nucleic acid e.g., CRISPR RNA, CRISPR DNA, crRNA, crDNA.
  • the present invention provides a composition comprising (a) a modified LbCas12a polypeptide of the invention or a fusion protein of the invention and (b) a guide nucleic acid.
  • the present invention provides expression cassettes and/or vectors comprising the polynucleotides/nucleic acid constructs of the invention.
  • expression cassettes and/or vectors comprising the polynucleotides/nucleic acid constructs of the invention and/or one or more guide nucleic acids may be provided.
  • a nucleic acid construct encoding a modified CRISPR-Cas nuclease and/or a fusion protein comprising a modified CRISPR-Cas nuclease of the invention may be comprised in the same or a separate expression cassette or vector from that comprising the guide nucleic acid.
  • a target nucleic acid may be contacted with (e.g., provided with) the expression cassette or vector comprising the nucleic acid construct of the invention prior to, concurrently with, or after the expression cassette comprising the guide nucleic acid is provided (e.g., contacted with the target nucleic acid).
  • the present invention provides expression cassettes and/or vectors encoding compositions and/or complexes of the invention or comprising systems of the invention.
  • the polynucleotides, nucleic acid constructs, expression cassettes and/or vectors of the invention that are optimized for expression in an organism may be about 70% to about 100% identical (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%, and any value or range therein) to the polynucleotides, nucleic acid constructs, expression cassettes and/or vectors encoding the same modified CRISPR-Cas nuclease or fusion protein of the invention but which has not been codon optimized for expression in an organism.
  • An organism for which a polynucleotide or nucleic acid construct may be optimized may include but is not limited to, an animal, a plant, a fungus, an archaeon, or a bacterium.
  • a polynucleotide or nucleic acid construct of the invention is codon optimized for expression in a plant.
  • the invention provides cells comprising one or more polynucleotides, guide nucleic acids, nucleic acid constructs, systems, expression cassettes and/or vectors of the invention.
  • the nucleic acid constructs of the invention e.g., encoding a modified CRISPR-Cas nuclease of the invention and/or a fusion protein comprising a modified CRISPR-Cas nuclease of the invention
  • expression cassettes/vectors comprising the same may be used for modifying target nucleic acids and/or their expression in vivo (e.g., in an organism or the cell of an organism; e.g., a plant) and in vitro (e.g., in a cell or a cell free system).
  • the present invention further provides methods for altering the PAM specificity of a Cas12a polypeptide.
  • a method for altering PAM specificity comprises introducing a mutation into the Cas12a polypeptide wherein the mutation is at amino acid residue K116, K120, K121, D122, E125, T148, T149, T152, D156, E159, Q529, D535, K538, D541, Y542, L585, K591, M592, K595, V596, S599, K600, K601, Y616, Y646, W649 with reference to the position numbering of SEQ ID NO:1.
  • the mutation that is introduced into the Cas12a polypeptide is K116R, K116N, K120R, K120H, K120N, K120T, K120Y, K120Q, K121S, K121T, K121H, K121R, K121G, K121D, K121Q, D122R, D122K, D122H, D122E, D122N, E125R, E125K, E125Q, E125Y, T148H, T148S, T148A, T148C, T149A, T149C, T149S, T149G, T149H, T149P, T149F, T149N, T149D, T149V, T152R, T152K, T152W, T152Y, T152H, T152Q, T152E, T152L, T152F, D156R, D156K, D156Y, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R
  • the mutation that is introduced into the Cas12a polypeptide is at amino acid residue position K116, K120, K121, D122, E125, T152, D156, E159, G532, D535, K538, D541, and/or K595 with reference to position numbering of SEQ ID NO:1, optionally wherein the mutation is K116R, K116N, K120Y, K121S, K121R, D122H, D122N, E125K, T152R, T152K, T152Y, T152Q, T152E, T152F, D156R, D156W, D156Q, D156H, D156I, D156V, D156L, D156E, E159K, E159R, G532N, G532S, G532H, G532K, G532R, G532L, D535N, D535H, D535T, D535,S D535A, D535W, K538R K538V, K538Q
  • the mutation that is introduced may be a single mutation or it may be a combination of two or more mutations.
  • any single Cas12a polypeptide having two or more mutations would comprise only a single mutation at any given position.
  • the Cas12a polypeptide that is altered in PAM specificity by the methods of this invention is a LbCas12a polypeptide (Lachnospiraceae bacterium).
  • Modified Cas12a polypeptides or nucleases may be used for modifying a target nucleic acid in a cell or a cell free system (e.g., altering the target nucleic acid, altering the genome of the cell/organism).
  • a method of modifying a target nucleic acid comprising: contacting the target nucleic acid with: (a)(i) a modified LbCas12a polypeptide of the invention, or a fusion protein of the invention (e.g., a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), and (ii) a guide nucleic acid; (b) a complex of the invention comprising (i) a modified LbCas12a polypeptide or a fusion protein of the invention, and (ii) a guide nucleic acid; (c) a composition comprising (i) a modified LbCas12a polypeptide of the invention, or a fusion protein of the invention, and (ii) a guide nucleic acid; and/or (d) a system of the invention, thereby modifying the target nucleic acid.
  • a method of modifying/altering the genome of a cell or organism comprising: contacting a target nucleic acid in the genome of the cell/organism with: (a)(i) a modified LbCas12a polypeptide of the invention, or a fusion protein of the invention (e.g., a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), and (ii) a guide nucleic acid; (b) a complex of the invention comprising (i) a modified LbCas12a polypeptide or a fusion protein of the invention, and (ii) a guide nucleic acid; (c) a composition comprising (i) a modified CRISPR- Cas nuclease (e.g., a modified LbCas12a polypeptide) of the invention, or a fusion protein of the invention, and (ii
  • the cell or organism is a plant cell or a plant.
  • a method of modifying a target nucleic acid comprising: contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide of the invention (e.g., encoding a modified LbCas12a polypeptide of the invention, or encoding fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), or an expression cassette or vector comprising the same, and (ii) a guide nucleic acid, or an expression cassette and/or vector comprising the same; and/or (b) a nucleic acid construct encoding a complex of the invention comprising a modified LbCas12a polypeptide of the invention, or fusion protein comprising a modified LbCas12a polypeptid
  • a method of modifying/altering the genome of a cell and/or organism comprising: contacting a cell and/or cell in an organism comprising the target nucleic acid with: (a)(i) a polynucleotide of the invention (e.g., encoding a modified LbCas12a polypeptide of the invention, or encoding fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase)), or an expression cassette or vector comprising the same, and (ii) a guide nucleic acid, or an expression cassette and/or vector comprising the same; and/or (b) a nucleic acid construct encoding a complex of the invention comprising a modified LbCas12a polypeptide of the invention, or fusion protein comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest
  • the present invention provides a method of editing a target nucleic acid, the method comprising: contacting the target nucleic acid with: (a)(i) a fusion protein of the present invention (comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase), and (a)(ii) a guide nucleic acid; (b) a complex comprising a fusion protein of the present invention, and a guide nucleic acid; (c) a composition comprising the fusion protein of the present invention and a guide nucleic acid; and/or (d) a system of the invention, thereby editing the target nucleic acid.
  • a fusion protein of the present invention comprising a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g., a deaminase), and (a)(ii) a guide nucleic acid
  • a complex
  • the present invention provides a method of editing a target nucleic acid, the method comprising: contacting a cell or a cell free system comprising the target nucleic acid with: (a)(i) a polynucleotide encoding a fusion protein of the invention (e.g., a modified LbCas12a polypeptide of the invention and a polypeptide of interest (e.g.
  • a deaminase ) or an expression cassette and/or vector comprising the same, and (a)(ii) a guide nucleic acid, or an expression cassette and/or vector comprising the same; (b) a nucleic acid construct encoding a complex comprising a fusion protein of the present invention, and a guide nucleic acid, or an expression cassette and/or vector comprising the same; and/or (c) a system of the present invention wherein the contacting is carried out under conditions whereby the polynucleotide and/or nucleic acid construct is/are expressed and the modified CRISPR-Cas nuclease and/or fusion protein is/are produced, which form(s) a complex with the guide nucleic acid, thereby editing the target nucleic acid.
  • the CRISPR-Cas nucleases having modified PAM recognition specificities may be utilized in many ways including, but not limited to, creating indels (NHEJ), in homology directed repair, as a genome recognition element without a nuclease function (dead Cpf1), as a genome recognition element with a partially functional nuclease (nickase Cpf1), in fusion proteins for catalytic editing of genomic DNA (DNA base editors), in fusions proteins for catalytic editing of RNA (RNA base editors), for targeting of other macromolecules to specific genomic regions; for targeting of small chemicals to specific genomic regions, for labeling of specific genomic regions and/or for CRISPR-directed genomic recombination strategies.
  • NHEJ creating indels
  • DNA base editors DNA base editors
  • RNA base editors fusions proteins for catalytic editing of RNA
  • a nucleic acid construct of the invention may be contacted with a target nucleic acid prior to, concurrently with or after contacting the target nucleic acid with a guide nucleic acid.
  • the modified CRISPR-Cas nucleases of the invention and polypeptides and nucleic acid constructs encoding the same may be used for modifying a target nucleic acid in any organism, including but not limited to, an animal, a plant, a fungus, an archaeon, or a bacterium.
  • An animal can include, but is not limited to, a mammal, an insect, a fish, a bird, and the like.
  • Exemplary mammals for which this invention may be useful include, but are not limited to, primates (human and non-human (e.g., a chimpanzee, baboon, monkey, gorilla, etc.)), cats, dogs, mice, rats, ferrets, gerbils, hamsters, cows, pigs, horses, goats, donkeys, or sheep.
  • a target nucleic acid of any plant or plant part may be modified and/or edited (e.g., mutated, e.g., base edited, cleaved, nicked, and the like) using the nucleic acid constructs of the invention.
  • Any plant (or groupings of plants, for example, into a genus or higher order classification) may be modified using the nucleic acid constructs of this invention including an angiosperm, a gymnosperm, a monocot, a dicot, a C3, C4, CAM plant, a bryophyte, a fern and/or fern ally, a microalgae, and/or a macroalgae.
  • a plant and/or plant part useful with this invention may be a plant and/or plant part of any plant species/variety/cultivar.
  • plant part includes but is not limited to, embryos, pollen, ovules, seeds, leaves, stems, shoots, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, plant cells including plant cells that are intact in plants and/or parts of plants, plant protoplasts, plant tissues, plant cell tissue cultures, plant calli, plant clumps, and the like.
  • shoot refers to the above ground parts including the leaves and stems.
  • plant cell refers to a structural and physiological unit of the plant, which comprises a cell wall and also may refer to a protoplast.
  • a plant cell can be in the form of an isolated single cell or can be a cultured cell or can be a part of a higher-organized unit such as, for example, a plant tissue or a plant organ.
  • plants useful with the present invention include turf grasses (e.g., bluegrass, bentgrass, ryegrass, fescue), feather reed grass, tufted hair grass, miscanthus, arundo, switchgrass, vegetable crops, including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head, leaf, romaine), malanga, melons (e.g., muskmelon, watermelon, crenshaw, honeydew, cantaloupe), cole crops (e.g., brussels sprouts, cabbage, cauliflower, broccoli, collards, kale, chinese cabbage, bok choy), cardoni, carrots, napa, okra, onions, celery, parsley, chick pea
  • the nucleic acid constructs of the invention and/or expression cassettes and/or vectors encoding the same may be used to modify maize, soybean, wheat, canola, rice, tomato, pepper, sunflower, raspberry, blackberry, black raspberry and/or cherry.
  • the present invention further comprises a kit to carry out methods of this invention.
  • a kit of this invention can comprise reagents, buffers, and/or apparatus for mixing, measuring, sorting, labeling, etc, as well as instructions and the like as would be appropriate for modifying a target nucleic acid.
  • the invention provides a kit comprising one or more polynucleotides and/or nucleic acid constructs of the invention, and/or expression cassettes and/or vectors comprising the same, with optional instructions for the use thereof.
  • a kit may further comprise a polypeptide of interest and/or polynucleotide encoding the same and expression cassette and/or vector comprising the same.
  • a guide nucleic acid may be provided on the same expression cassette and/or vector as a nucleic acid construct of the invention.
  • a guide nucleic acid may be provided on a separate expression cassette or vector from that comprising the nucleic acid construct of the invention.
  • kits comprising a nucleic acid construct comprising (a) a polynucleotide encoding a modified CRISPR-Cas nuclease as provided herein and (b) a promoter that drives expression of the polynucleotide of (a).
  • the kit may further comprise a nucleic acid construct encoding a guide nucleic acid, wherein the construct comprises a cloning site for cloning into the backbone of the guide nucleic acid a nucleic acid sequence that is identical or complementary to a target nucleic acid sequence.
  • the kit may comprise a nucleic acid construct comprising/encoding one or more nuclear localization signals, wherein the nuclear localization signals are fused to the CRISPR-Cas nuclease.
  • kits are provided comprising a nucleic acid construct of the invention encoding a modified CRISPR- Cas nuclease of the invention or, and/or an expression cassette and/or vector comprising the same, wherein the nucleic acid constructs, expression cassettes and/or vectors may further encode one or more selectable markers useful for identifying transformants (e.g., a nucleic acid encoding an antibiotic resistance gene, herbicide resistance gene, and the like).
  • CRISPR-Cas nucleases have different PAM sequence requirements, such as NGG for SpCas9 or TTTV (where V is any non-thymidine nucleotide) for LbCas12a (Cpf1). Screening new CRISPR nucleases or mutants thereof for their PAM requirements can be complicated and unpredictable because so many iterations are possible.
  • PAMDA PAM Determination Assays
  • PAMDA PAM Determination Assays
  • Guide RNAs can be designed to target the known protospacer sequence and if the randomized PAM region contains the appropriate DNA sequence (e.g., recognized by the CRISPR nuclease or mutants thereof), then the CRISPR nuclease can bind and cut the target.
  • the PAM recognition sites for CRISPR-Cas nucleases may be assessed using PAM site-depletion assays (e.g., PAM depletion assays) or PAM Determination Assays (PAMDA) (Kleinstiver et al. Nat Biotechnol 37: 276–282 (2019)).
  • a library of plasmids bearing randomized nucleotides (base pairs) adjacent to a protospacer is tested for cleavage by a CRISPR nuclease in a bacterium (e.g., E. coli).
  • the plasmids may comprise, for example, polynucleotides conferring antibiotic resistance that are adjacent to randomized PAM sequences. Those sequences which are not cut upon exposure to a CRISPR-Cas nuclease enable a cell to survive in the presence of an antibiotic due to the presence of the antibiotic resistance gene, whereas plasmids bearing targetable PAMs are cleaved and depleted from the library due to cell death.
  • Sequencing of the surviving (uncleaved) population of plasmids enables the calculation of a post-selection PAM depletion value, which is compared to a library that has not been exposed to the CRISPR-Cas nuclease. Those sequences which are depleted from the pool of sequences in the experimental library contain the PAM sequence(s) recognized by the CRISPR-Cas nuclease.
  • PAMDA PAM Determination Assay
  • a single DNA strand is synthesized with a randomized portion of nucleotides next to a defined protospacer sequence.
  • An oligonucleotide is annealed to the 3'end of the synthesized DNA strand and extended using an exonuclease minus (-exo) Klenow fragment, polymerizing over the defined and random sequences.
  • This generates a duplex library that is then cut with restriction endonucleases and cloned into bacteria in order to amplify the total DNA.
  • the plasmids are extracted and linearized with another restriction endonuclease to make a linear template.
  • the template is contacted with a CRISPR-Cas nuclease-guide RNA complex.
  • the PAM sequences that are present in the control (not exposed to CRISPR-Cas nuclease) library but not in the experimental library are the PAM sequences that are recognized by the CRISPR-Cas nuclease (thereby, allowing the protospacer to be cleaved).
  • a randomized PAM library is prepared for the assessment of nuclease requirements in vitro.
  • Steps described for this method involve preparation of an unbiased randomized DNA library containing all PAM sequences to be evaluated, cloning into a plasmid, introduction of the library into bacteria to increase the total amount of starting DNA, extraction of the plasmids, linearization of the plasmids with a restriction enzyme to remove supercoiling, exposing the linearized molecules to the CRIPSR-Cas nuclease, amplifying the fragments (e.g., PCR), and finally sequencing analysis (e.g., next generation sequencing, NGS).
  • the initial steps of generating an unbiased library and restriction digests require at least two restriction enzymes, Klenow extension, and cleaning of the products before ligating into a vector.
  • the present invention provides a new method for generating randomized PAM libraries using overlapping solid-state synthesized oligonucleotides (e.g., annealed oligonucleotides) with overhangs (see, e.g., Fig. 1b) instead of restriction endonucleases and Klenow extension.
  • overlapping solid-state synthesized oligonucleotides e.g., annealed oligonucleotides
  • overhangs see, e.g., Fig. 1b
  • the present invention provides a method of constructing a randomized DNA library comprising double stranded nucleic acid molecules for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site at the 5' end of the protospacer, the method comprising: preparing two or more double stranded nucleic acid molecules comprising the following steps: (a) synthesizing a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand for each of the two or more double stranded nucleic acid molecules, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5
  • the target strand and/or the non-target strand may be 5' phosphorylated.
  • the present invention provides a method of constructing a randomized DNA library comprising double stranded nucleic acid molecules for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site at the 3' end of the protospacer, the method comprising: preparing two or more double stranded nucleic acid molecules comprising the following steps: (a) synthesizing a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand for each of the two or more double stranded nucleic acid molecules, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
  • the target strand and/or the non-target strand may be 5' phosphorylated.
  • the double stranded nucleic acid molecules may be ligated into a vector to produce a vector comprising the randomized DNA library.
  • the vector may be a high copy number vector.
  • the randomized DNA library may be amplified by, for example, introducing the vector comprising the randomized DNA library into one or more bacterial cells and culturing the one or more bacterial cells.
  • the vector comprising the randomized DNA library may be isolated from the one or more bacterial cells after culturing.
  • the isolated vector may then be linearized (e.g., by contacting the vector with one or more restriction enzymes; e.g., ScaI or PfoI) for use in, for example, the analysis of the PAM recognition specificity of a CRISPR-Cas nuclease.
  • Pfo1 may be used to linearize the isolated vector.
  • a randomized DNA library may be provided for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site on the 5' end of protospacer, the randomized DNA library comprising two or more double stranded nucleic acid molecules each of which comprises: (a) a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 15 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides, and any range therein), (ii) a second sequence having at least four randomized nucleotides (e.g., at least 4, 5, 6, 7, 8, 9, 10, or more, and any range therein), (iii) a protospacer sequence comprising
  • the target strand and/or the non-target strand may be 5' phosphorylated.
  • a randomized DNA library may be provided for determining protospacer adjacent motif (PAM) requirements/specificity of a CRISPR-Cas nuclease having a PAM recognition site on the 3' end of protospacer, the randomized DNA library comprising two or more double stranded nucleic acid molecules each of which comprises: (a) a non-target oligonucleotide (first) strand and a target oligonucleotide (second) strand, wherein the non-target oligonucleotide strand comprises, 5' to 3': (i) a first sequence having about 5 to about 20 nucleotides (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides, and any range therein), (ii) a protospacer sequence comprising about 16 to about 25 nucleotides (e.
  • PAM protospacer
  • the target strand and/or the non-target strand may be 5' phosphorylated.
  • the present invention provides a method of determining protospacer adjacent motif (PAM) specificity of a CRISPR-Cas nuclease, the method comprising: contacting the CRISPR-Cas nuclease with a randomized DNA library of the present invention; and sequencing the double stranded nucleic acid molecules of the randomized DNA library before (e.g., the control) and after contact with the CRISPR-Cas nuclease, wherein double stranded nucleic acid molecules present in the randomized DNA library prior to contact with the CRISPR-Cas nuclease but absent in the randomized DNA library after contact with the CRISPR-Cas nuclease identifies the PAM recognition sequence of the CRISPR-Cas nuclease, thereby determining the PAM specificity of the CRISPR-Cas nuclease.
  • PAM protospacer
  • a method of determining protospacer adjacent motif (PAM) specificity of a CRISPR-Cas nuclease comprises: contacting the CRISPR-Cas nuclease with a randomized DNA library of the present invention; sequencing the double stranded nucleic acid molecules of the randomized DNA library before (e.g., the control) and after contact with the CRISPR-Cas nuclease, and identifying the PAM recognition sequence of the nuclease, wherein identifying comprises comparing the double stranded nucleic acid molecules present in the library before contact with the CRISPR-Cas nuclease to the double stranded nucleic acid molecules present in the library after contact with the CRISPR-Cas nuclease and wherein the double stranded nucleic acid molecules present in the randomized DNA library before contact with the CRISPR-Cas nuclease but absent from the randomized DNA library after contact with the CRISPR-Cas
  • determining the PAM specificity of a CRISPR-Cas nuclease may comprise performing nucleic acid sequencing.
  • the sequence may comprise next generation sequencing (NGS). Any CRISPR-Cas nuclease may be used with the methods of this invention for modifying PAM recognition specificity.
  • a CRISPR-Cas nuclease that may be modified to have a different PAM specificity as compared to wild type can include, but is not limited, to a Cas9, C2c1, C2c3, Cas12a (also referred to as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Casl, CaslB, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6,
  • Cas12a is a Type V Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas nuclease originally identified in Prevotella spp. and Francisella spp. Cas12a (previously referred to as Cpf1) differs in several respects from the more well-known Type II CRISPR Cas9 nuclease.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Cas9 recognizes a G-rich protospacer adjacent motif (PAM) that is 3' to its guide RNA (gRNA, sgRNA) binding site (protospacer, target nucleic acid, target DNA) (3'-NGG), while Cas12a recognizes a T-rich PAM that is located 5' to the binding site (protospacer, target nucleic acid, target DNA) (5'-TTN, 5'-TTTN).
  • PAM G-rich protospacer adjacent motif
  • Cas12a enzymes use a single guide RNA (gRNA, CRISPR array, crRNA) rather than the dual guide RNA (sgRNA (e.g., crRNA and tracrRNA)) found in natural Cas9 systems, and Cas12a processes its own gRNAs.
  • gRNA single guide RNA
  • sgRNA e.g., crRNA and tracrRNA
  • Cas12a nuclease activity produces staggered DNA double stranded breaks instead of blunt ends produced by Cas9 nuclease activity, and Cas12a relies on a single RuvC domain to cleave both DNA strands, whereas Cas9 utilizes an HNH domain and a RuvC domain for cleavage.
  • a CRISPR Cas12a polypeptide or CRISPR Cas12a domain useful with this invention may be any known or later identified Cas12a nuclease (see, e.g., U.S. Patent No. 9,790,490, which is incorporated by reference for its disclosures of Cpf1 (Cas12a) sequences).
  • the term "Cas12a”, “Cas12a polypeptide” or “Cas12a domain” refers to an RNA-guided nuclease comprising a Cas12a polypeptide, or a fragment thereof, which comprises the guide nucleic acid binding domain of Cas12a and/or an active, inactive, or partially active DNA cleavage domain of Cas12a.
  • a Cas12a useful with the invention may comprise a mutation in the nuclease active site (e.g., RuvC site of the Cas12a domain).
  • a Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site, and therefore, no longer comprising nuclease activity, is commonly referred to as deadCas12a (e.g., dCas12a).
  • a Cas12a domain or Cas12a polypeptide having a mutation in its nuclease active site may have impaired/reduced activity as compared to the same Cas12a polypeptide without the same mutation (e.g., nickase activity).
  • a Cas12a domain can include, but is not limited to, the amino acid sequence of any one of SEQ ID NOs:1-17 (e.g., SEQ ID NOs:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 and/or 17) or a polynucleotide encoding the same.
  • a fusion protein of the invention may comprise a Cas12a domain from Lachnospiraceae bacterium ND2006 Cas12a (LbCas12a) (e.g., SEQ ID NO:1).
  • a CRISPR Cas9 polypeptide or CRISPR Cas9 domain useful with this invention may be any known or later identified Cas9 nuclease.
  • a Cas9 polypeptide useful with this invention comprises at least 70% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like) to an amino acid sequence of any known Cas9.
  • CRISPR-Cas9 systems are well known in the art and include, but are not limited to, Cas9 polypeptides from Legionella pneumophila str.
  • nucleases that may be useful with this invention for identifying novel PAM recognition sequence include but are not limited to, C2c1, C2c3, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Casl, CaslB, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, C
  • the oligonucleotides for protospacer 1 (PM0518, PM0519) and for protospacer 2 (PM0520, PM0521) were annealed by placing the mixture in a thermal cycler at 95°C for 5 mins with a cool down for 0.1°C/sec to 25°C/room temperature.
  • Table 1 The annealed double stranded fragments were ligated directly to a SphI and EcoRI digested pUC19 vector.
  • the ligated protospacer constructs were used to transform XL1-blue Electro competent E. coli cells (Agilent) and recovered in 1 ml SOC media at 37°C for 1hr. Carbenicillin plates were used to check for the presence of the ligated products in the E.
  • the transformed E. coli cells were grown in LB broth supplemented (200 ml) with carbenicillin (50 mg/mL) for 16 hrs.
  • the plasmids comprising the protospacer constructs were purified using Zymo midiprep kit.
  • the plasmids/vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each PAM position using an Illumina Miseq.
  • This method can be used to generate libraries for PAM determination using any protospacer oligonucleotide(s) of choice wherein the annealed oligonucleotides may comprise any appropriate restriction site selected so as to retain the full complement of PAM sequences in the library.
  • Lachnospiraceae bacterium ND2006 Cpf1 requires a highly specific protospacer adjacent motif (PAM).
  • the 'TTTV' sequence occurs only about 1 in 85 bases in comparison to random nucleotides. This is contrast to the relative promiscuity of NGG for SpCas9 which occurs about 1 in 16 bases in random DNA, TTN for AaC2c1 which occurs about 1 in 16 bases in random DNA, and xCas9/Cas9-NG whose NG PAM requirements occur about 1in 4 bases.
  • Cpf1 PAMs are far less abundant in corn and soy genes than Cas9 PAMs (Fig. 2).
  • adenines and cytosines are far less accessible to LbCpf1 based on its strict PAM requirement (Fig. 3).
  • Such stringency as that shown in Fig. 3 for the CRISPR-Cas nucleases greatly reduces the potential targets and generation of new traits.
  • the present invention is directed to generation of CRISPR-Cas nucleases, in particular, LbCpf1 (Cas12a) nucleases having an improved ratio of accessible PAM sequences (e.g., nucleases that has a PAM recognition site that occurs at a ratio of about 1:4 or better).
  • Such engineered Cas12a PAM mutants may be used as nucleases (for NHEJ or HDR applications) or inactivated versions can be used as genomic recognition element in genome editing tools.
  • PAMDA Assay PAM Determination Assays are useful for testing PAM requirements for CRISPR enzymes with unknown PAM recognition. These are in vitro assays which take advantage of the ability of CRISPR-Cas nucleases to cleave target sequences only after successful PAM binding. Briefly, a library of DNA substrates with randomized PAM sequences are incubated with the CRISPR nuclease and then DNA is amplified via PCR.
  • LbCpf1 mutagenesis One hundred and eighty six (186) point mutations (Table 2) were designed and individually tested in a PAMDA assay as described herein. Successful engineering may change the PAM recognition sequence generating novel PAM recognizing LbCpf1s or may relax PAM stringency resulting in a more promiscuous LbCpf1. Table 2. Residues for substitution in SEO ID NO:l
  • the CRISPR enzyme needs to be expressed and stable in the cell
  • the crRNA needs to be expressed and correctly processed
  • the protein:RNA complex needs to form
  • the complex needs to be stable
  • the complex needs to translocate in sufficient quantities into the nucleus
  • the target DNA needs to be accessible
  • the DNA has to be well-targeted by the particular guide-RNA design
  • double-stranded breaks need to occur at a rate high enough to yield the occasional DNA repair mistake via an insertion or deletion (INDEL).
  • PAM binding and cleavage in vitro Building a PAM plasmid-based library A DNA library consisting of 5 random nucleotides directly 5′ to a 23 nucleotide spacer sequence was prepared. LbCas12a is known to have a 4 nucleotide Protospacer Adjacent Motif (PAM), however we chose to use 5 random nucleotides rather than 4 to allow for replication within the experiment.
  • PAM Protospacer Adjacent Motif
  • the spacer sequence used was 5′- GGAATCCCTTCTGCAGCACCTGG (SEQ ID NO:30).
  • the library contained the sequence 5′-NNNNNGGAATCCCTTCTGCAGCACCTGG (SEQ ID NO:36). Having 5 random nucleotides yield 1024 possible PAMs assayed in this library.
  • the two oligonucleotides were annealed at an equal molar ratio in a thermal cycler at 95°C for 5 min, and cooled for 0.1°C/sec to 25°C/room temperature.
  • the annealed double stranded fragments were ligated directly to SphI and EcoRI digested pUC19 vector.
  • the ligated spacer constructs were used to transform XL1- blue Electro competent E. coli cells (Agilent) and recovered in 1 ml Super Optimal broth with glucose (SOC) media at 37° degree for 1hr. A proportion of aliquot was plated on carbenicillin plates to check for the presence of the ligated products.
  • the remaining transformed cells were grown in 200 ml Luria broth (LB) supplemented with 50 mg/mL carbenicillin for 16 hrs.
  • the spacer plasmids were purified using plasmid midiprep kit (Zymo Research). Verification of PAM library
  • the spacer vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each position of PAM using an Illumina MiSeq according to manufacturer’s protocols. Briefly, 10 ng of DNA was used as template for PCR. Phasing gene specific forward and reverse PCR primers were designed to amplify across the target site.
  • Amplicon libraries were generated using a two-step PCR method, where primary PCR with 5′ tails allow a secondary PCR to add Illumina i5 and i7 adapter sequences and barcodes for sorting multiplexed samples.
  • PCR amplifications were performed using the following parameters: 98°C for 30 s; 25 cycles for PCR1 and 8 cycles for PCR2 (98°C 10 s, 55°C 20 s, 72°C 30 s); 72°C for 5 min; hold at 12°C.
  • the PCR reactions were performed with Q5 High- Fidelity DNA Polymerase (New England BioLabs, Beverly, MA, United States).
  • the secondary PCR amplicon samples were individually purified using AMPure XP beads according to manufacturer’s instruction (Beckman Coulter, Brea, CA, United States); all purified samples were quantified using a plate reader, pooled with an equal molar ratio, and run on AATI fragment analyzer (Agilent Technologies, Palo Alto, CA, United States).
  • the pooled amplicon libraries were sequenced on an Illumina MiSeq (2 X 250 paired end) using a MiSeq Reagent kit v2 (Illumina, San Diego, CA, United States). Three separate reads were generated for the library and averaged. The resulting 1024 library members had an average read count of 39 reads and a standard deviation of 11.9 reads.
  • a lysis buffer comprising non-ionic detergents, lysing agents, reducing agents, protease inhibitors, buffers, and salts. This solution was able to lyse bacteria, reduce viscosity, and allow for downstream purification of enzymes free from interfering nucleases.
  • Buffer A composed of 20 mM Hepes-KOH pH 7.5, 0.5 M NaCl, 10% glycerol, 2 mM TCEP and 10 mM Imidazole pH 7.5.
  • Buffer B was the same as buffer A but also included Imidazole at 20 mM.
  • Buffer C contained 20 mM Hepes-KOH pH 7.5, 150 mM NaCl, 10% glycerol, 0.5 mM TCEP, and 200 mM Imidazole pH 7.5. Purification was performed using a multi-well format. Two stainless steel 5/32” BBs were added to all wells containing cell pellets. Pellets were resuspended in 0.5 mL cold lysis buffer and incubated at room temperature for 30 minutes with orbital mixing. The crude lysates, 0.5 mL, were added to pre-equilibrated His MultiTrap TM plates (Cytiva LifeSciences).
  • Test cleavage of PAM library by wtLbCas12a A pre-test was performed to assess three aspects of the experiment: ensure the experiment was free from non-specific nucleases, ensure that there was depletion at NTTTV PAMs from the library upon addition of crRNA guides, and to see the extent of depletion at 15 minutes for a spiked sample of CTTTA.
  • Reaction conditions for the test depletions were: 27 ⁇ L total volume of containing nuclease-free water, 3 ⁇ L NEB buffer 2.1 (New England Biolabs), 3 ⁇ L stock of the crRNA at 300 nM (5′-AAUUUCUACUAAGUGUAGAUGGAAUCCCUUCUGCAGCACCUGG-3′ (SEQ ID NO:62), Synthego Corporation), and 1 ⁇ L of the purified wtLbCas12a at 1 ⁇ M stock were incubated at room temperature for 10 minutes. 3 ⁇ L of a 10 ng/ ⁇ L stock was added to start the reaction.
  • the library was either added as-is or 1 ⁇ L of the CTTTA- containing plasmid was added first at 0.75 ng/ ⁇ L. Total volumes were all 30 ⁇ L. The reaction was incubated at 37°C for 15 minutes. Table 3 provides the results of the experiment.
  • the library counts for TTTV sequences were between 219 and 515 counts (column 2), adding the wildtype protein which was purified as described in the absence of a crRNA did not result in depletion of the library members (column 3), addition of a crRNA and the protein resulted in depletion of all the NTTTV containing PAMs (column 4), spiking the library with CTTTA resulted in approximately 35 times as many CTTTA NGS counts (column 5), addition of wtLbCas12a and the crRNA resulted in a depletion of all library members, including CTTTA decreasing from 10,776 to 193 counts.
  • NACGA PAM-containing library members which show no depletion under the conditions tested, as is expected since ACGA is not a PAM recognized by LbCas12a.
  • NTTTV PAM library members are efficiently cleaved and depleted by wtLbCas12a, whereas PAMs not recognized by wtLbCas12a (NACGA) are not.
  • Table 3 PAM library cleavage and depletion.
  • the depletion score for wildtype LbCas12a was 9.2 for TTTV sequences, so any mutant which cleaved a PAM at or better than this 9.2 score was considered efficacious using wild type as a benchmark.
  • Table 4 shows the mutant LbCas12a-K595Y depleting in vitro 45 different PAM 4mers from the library at or better than wtLbCas12a cleaves TTTV-containing sequences. This analysis was used to score each of the 186 mutations to determine in vitro PAM recognition and cleavage by each of the mutants.
  • the data containing recognition sequences are shown in Table 4, which shows LbCas12a-K595Y PAMDA depletion scores at or better than wtLbCas12a scores against TTTV-containing sequences of 9.2.
  • a depletion score of 4 indicated four times as much of that particular PAM-containing library member was cleaved as compared to the median for wildtype. For example if 100 NGS counts were remaining for a PAM with GCGC for wildtype and 25 counts remained for a particular mutant-time point, then a score of 4 was calculated.
  • a summary of each of the 186 mutations is shown below in Table 6. Mutations provided in bold lettering indicates that the mutation recognized and cleaved more than 3 new PAM sequences as compared to wildtype with a score above 4.
  • Mutations provided in italics indicates the mutant acquired between 1 and 3 or new PAM sequences as compared to wildtype with a score above 4. Mutations in regular font (not bolded or italicized) indicates the point mutation did not cleave new PAM sequences as compared to wildtype with a score above 4. Certain amino acids, such as T149 did not acquire new PAM recognitions despite being near the PAM-recognition domain of the protein and testing 10 new amino acids. Other amino acids, such as D156, appeared to be a hot-spot for engineering new PAM recognition motifs.
  • the plasmid contains Spectinomycin resistance, ColE1 origin of replication, LacI, and eGFP under control of the lac promoter.
  • 256 gene blocks containing the fragment between the NotI and SmaI restriction site were synthesized by Twist Bioscience. Each fragment contained a different 4-mer PAM directly 5′ of the lacI promoter.
  • Each gene block was cloned into the pWISE1963 via restriction and ligation. Clones were selected for each variant and the identity of the PAM was verified by Sanger sequencing.
  • CRISPR-Cas Plasmid Plasmid pWISE2031 was used as the base vector for generating all CRISPR-Cas plasmids.
  • the plasmid contains Chloramphenicol resistance, a CloDF13 origin of replication, dLbCas12a driven by promoter BbaJ23108, and the LbCas12a with a crRNA targeting the lacI promoter driven by the BbaJ23119 promoter.
  • the negative control plasmid, pWISE1961 contains the same components as pWISE2031 with the exception that a non-targeting crRNA was used.
  • Each point and combinatorial mutant (pWISE2984 – pWISE3007) was constructed via site-directed mutagenesis of pWISE2031 at Genewiz. Cell Line An E.
  • coli cell line containing a chromosomal deletion of the lacI gene, JW0336 was obtained from Dharmacon Horizon Discovery. Electrocompetent cells were prepared according to the protocol described (Sambrook, J., and Russell, D.W. (2006). Transformation of E. coli by Electroporation. Cold Spring Harb Protoc 2006, pdb.prot3933). E. coli JW0336 was used in all library transformation and cell sorting experiments. Preparation of Reporter Library 10 ng of each reporter plasmid described in the section above was pooled into a single tube to generate a library for transformation and amplification.
  • Samples were sorted on single-cell purity mode, with voltage 425, ssc voltage 535, fsc voltage (gain) of 4.0.
  • the typical rate of sorting was about 4000 events/second. Each sample had a minimum of 1.0x10 6 events; cell sorting was performed until 50,000 GFP- positive events were collected or the sample was depleted. In cases where the sample was depleted, a minimum of 200 GFP positive events were collected. GFP-positive events were collected into tubes containing 2-mL of LB with Spectinomycin and Chloramphenicol. Post- sort, the samples were diluted to 6-mL with additional LB with Spectinomycin and Chloramphenicol, and then grown overnight at 37 0 C with shaking at 225 rpm.
  • Example sorts are provided in Figures 6-11.
  • Fig. 6 shows the cell sorting results of a negative control containing wtLbCas12a and a crRNA, which did not target the plasmid spacers.
  • Sorted cells from the GFP high samples show no cells in the sorted fraction (left panel) and a single population of GFP signal, indicated by a single peak (right panel).
  • Fig. 7 shows cell sorting results of wtLbCas12a and a crRNA targeting the plasmid spacers. Sorted cells from the GFP high samples show cells in the sorted fraction (left panel, GFP hi) and a two populations of GFP signal, indicated by two predominant peaks (right panel, GFP neg and GFP High).
  • FIG. 8 shows cell sorting results of LbCas12a-K595Y and a crRNA targeting the plasmid spacers. Sorted cells from the GFP high samples show cells in the sorted fraction (left panel, GFP hi) and a population indicated by two predominant peaks (right panel, GFP neg and GFP high).
  • Fig. 9 shows the cell sorting results of LbCas12a-G532R-K595R double mutation control (Gao et al. Nat Biotechnol 35, nbt.3900 (2017)) and a crRNA targeting the plasmid spacers.
  • Sorted cells from the GFP high samples show cells in the sorted fraction (left panel , GFP hi) and a population indicated by two predominant peaks (right panel).
  • Fig. 10 shows cell sorting results of LbCas12a-T152R-K595Ydouble mutation, a combination of two of the point mutations used with a crRNA targeting the plasmid spacers. Sorted cells from the GFP high samples show cells in the sorted fraction (left panel, GFP hi) and a population indicated by two predominant peaks (right panel).
  • Fig. 10 shows cell sorting results of LbCas12a-T152R-K595Ydouble mutation, a combination of two of the point mutations used with a crRNA targeting the plasmid spacers.
  • Sorted cells from the GFP high samples show cells in the sorted fraction (left panel, GFP hi) and a population indicated by two predominant peaks (right panel).
  • FIG. 11 shows cell sorting results of LbCas12a-T152R- K538W-K595Ytriple mutation, a combination of three of the point mutations used with a crRNA targeting the plasmid spacers. Sorted cells from the GFP high samples show cells in the sorted fraction (left, GFP hi) and a population indicated (right, green lines). Next Generation Sequencing The following morning after sorting glycerol stocks of each overnight culture were prepared and stored at -80C. The remaining amount of each 6-mL culture was miniprepped with a Qiagen miniprep kit according to manufacturer’s instructions. These minipreps were labeled “post-sort” and were stored at 4 0 C.
  • Pre-sort and post-sort minipreps were quantified by nanodrop, diluted 10-fold and handed off for sequencing on an Illumina Mi-Seq.
  • the spacer vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each position of PAM using an Illumina MiSeq according to manufacturer’s protocols. Briefly, 10 ng of DNA was used as template for PCR. Phasing gene specific forward and reverse PCR primers were designed to amplify across the target site. Amplicon libraries were generated using a two-step PCR method, where primary PCR with 5′ tails allow a secondary PCR to add Illumina i5 and i7 adapter sequences and barcodes for sorting multiplexed samples.
  • PCR amplifications were performed using the following parameters: 98°C for 30 s; 25 cycles for PCR1 and 8 cycles for PCR2 (98°C 10 s, 55°C 20 s, 72°C 30 s); 72°C for 5 min; hold at 12°C.
  • the PCR reactions were performed with Q5 High- Fidelity DNA Polymerase (New England BioLabs, Beverly, MA, United States).
  • the secondary PCR amplicon samples were individually purified using AMPure XP beads according to manufacturer’s instruction (Beckman Coulter, Brea, CA, United States); all purified samples were quantified using a plate reader, pooled with an equal molar ratio, and run on AATI fragment analyzer (Agilent Technologies, Palo Alto, CA, United States).
  • the pooled amplicon libraries were sequenced on an Illumina MiSeq (2 X 250 paired end) using a MiSeq Reagent kit v2 (Illumina, San Diego, CA, United States).
  • RR have been described as being able to cause INDELs in TYCV+CCCC sequences in AsCas12a and subsequently LbCas12a.
  • the same methodology was applied to score the combinatorial mutations.
  • Pre and post-sorted pools were sequenced each having an average of about 250-500 MiSeq NGS reads per PAM library member.
  • the pre and post-sort pools were normalized and subtracted, the difference being normalized to 1.0.
  • Many PAM sequences were bound by the combinations above the 1.67 cutoff (Fig. 14, Table 8).
  • Table 8 Ability of combinatorial mutations to bind PAMs above the 1.67 threshold, sorted by normalized score. TTTV sequences for wildtype are in bold.
  • TYCV+CCCC sequences for the G532R+K595R control are underlined.
  • Overall analysis of PAM-SCANR data Wildtype LbCas12a showed strong TTTV binding the LbCas12a-G532R-K595R control showed strong TYCV and CCCC binding.
  • This mutation, called ‘RR’ was developed in AsCas12a and shown to bind TYCV and CCCC (Gao et al. Nat Biotechnol 35(8):789-792 (2017)).
  • CCCC is neither recognized by K538W nor K595Y, yet the double mutant binds it with high affinity.
  • the combination of mutations results in a more than linear expansion of PAM recognition.
  • K538W recognizes 6 PAM sequences
  • K595Y recognizes 13, but together they recognize 32 sequences (Fig. 15).
  • a simple additive effect would result in 19 PAMs for the double mutant, rather than the 32 we observe.
  • only 11 of the 32 sequences recognized by the double mutant are recognized by either of the two single mutations.
  • a similar pattern is observed when combining three mutations (Fig. 16).
  • the combination of T152R, K538W, and K595Y result in a triple mutation with different PAM recognitions than any of the three individual mutations alone.
  • GGCA, GGCC, GGGC, and GGGG only are recognized when all three mutations are made on LbCas12a. None of these PAMs are bound by any of the single or double mutations, but only when T152R, K538W, and K595Y are all mutated together. Comparing point mutations PAM recognition in PAM-SCANR versus in vitro PAMDA Taken as a whole for the 12 point mutations tested, PAM-SCANR hits above 1.67 were well represented in the in vitro PAMDA depletion assay. K595Y and T152R examples are shown (Fig. 17). Fig.
  • the CRISPR enzyme needs to be expressed and stable in the cell
  • the crRNA needs to be expressed and correctly processed
  • the protein:RNA complex needs to form
  • the complex needs to be stable
  • the complex needs to translocate in sufficient quantities into the nucleus
  • the target DNA needs to be accessible
  • the DNA has to be well-targeted by the particular guide-RNA design
  • double-stranded breaks need to occur at a rate high enough to yield the occasional DNA repair mistake via an insertion or deletion (INDEL).
  • HEK293T Cell Testing Eukaryotic HEK293T (ATCC CRL-3216) cells were cultured in Dulbecco’s Modified Eagle’s Medium plus GlutaMax (ThermoFisher) supplemented with 10% (v/v) FBS (FBS), at 37 °C with 5% CO2.
  • Wildtype and mutant LbCas12 were synthesized using solid-state synthesis and subsequently cloned into plasmids behind a CMV promoter.
  • CRISPR RNAs crRNAs
  • HEK293T cells were seeded on 48-well collagen-coated BioCoat plates (Corning). Cells were transfected at about 70% confluency. 750 ng of protein plasmid and 250 ng of crRNA expression plasmids were transfected using 1.5 ⁇ l of Lipofectamine 3000 (ThermoFisher Scientific) per well according to the manufacturer’s protocol.
  • Genomic DNA from transfected cells were obtained after 3 days and indels were detected and quantified using high-throughput Illumina amplicon sequencing.
  • the spacer vectors were subjected to deep sequencing analysis to calculate the frequency of A/T/G/C at each position of PAM using an Illumina MiSeq according to manufacturer’s protocols. Briefly, 10 ng of DNA was used as template for PCR. Phasing gene specific forward and reverse PCR primers were designed to amplify across the target site. Amplicon libraries were generated using a two-step PCR method, where primary PCR with 5′ tails allow a secondary PCR to add Illumina i5 and i7 adapter sequences and barcodes for sorting multiplexed samples.
  • PCR amplifications were performed using the following parameters: 98°C for 30 s; 25 cycles for PCR1 and 8 cycles for PCR2 (98°C 10 s, 55°C 20 s, 72°C 30 s); 72°C for 5 min; hold at 12°C.
  • the PCR reactions were performed with Q5 High- Fidelity DNA Polymerase (New England BioLabs, Beverly, MA, United States).
  • the secondary PCR amplicon samples were individually purified using AMPure XP beads according to manufacturer’s instruction (Beckman Coulter, Brea, CA, United States); all purified samples were quantified using a plate reader, pooled with an equal molar ratio, and run on AATI fragment analyzer (Agilent Technologies, Palo Alto, CA, United States).
  • the pooled amplicon libraries were sequenced on an Illumina MiSeq (2 X 250 paired end) using a MiSeq Reagent kit v2 (Illumina, San Diego, CA, United States). Wildtype Control Wildtype LbCas12a (wtLbCas12a) recognizes TTTV (TTTA, TTTC, and TTTG).
  • Genomic targets in 293T cells were chosen based on their PAM sequences. Genomic targets for the three point mutations were chosen at random using no particular rules other than having the appropriate 4 nt PAM and selecting 23 nucleotides downstream from that PAM. Three different spacers were chosen to assay each PAM. This is to account for the observation that activities of CRISPR enzymes is target-specific and often cannot be predicted. On average, we have observed that about half of 23 nucleotide wtLbCas12a spacers tested are ineffective despite having correct PAM TTTV sequences.
  • Cas12a proteins recognize T-rich PAMs (Zetsche et al. Cell 163:759–771 (2015)). This limits their utility in genome editing technologies.
  • K595Y clearly prefers C and G-rich PAMs, which will expand Cas2a utility to targets previously predominantly targets of Cas9 CRISPR enzymes which utilize G-rich PAMs (Jinek et al. Science 337, 816–821 (2012)). Only 31 of the total 256 possible four nucleotide PAMs were tested in 293T cells (or 12%) for K595Y. There are likely many other PAMs which could be recognized by K595Y and cause INDELs in eukaryotic cells.
  • T152R was able to cause INDELs at CCTC at 11.5%, CCTG at 10.0%, CCCA at 9.6%, GCCA at 8.4%, GCCC at 7.2%, CTGC at 5.1%, and others (Fig. 20).
  • T152R retained the TTTV recognition of wtLbCas12a by causing INDELs at TTTC at 34.9%, TTTA at 10.2%, and TTTG at 6.2%. It also picked up a TTTT recognition, causing INDELs at 8.3%. Only 22 of the total 256 possible four nucleotide PAMs were tested in 293T cells (or 9%) for T152R.
  • PAM sequences with over 1% INDEL formation included ATTA (3.5%), TTTT (3.2%), TGTC (1.8%), AGCG (1.8%), AGTC (1.6%), AGCA (1.4%), and GGTC (1.1%).
  • This point mutation was used in combination with T152R and/or K595Y in the PAM- SCANR experiments to generate a wide variety of PAM recognition, however, on its own it bound relatively few PAMs using that assay. It may be an excellent choice to use in future double mutations rather than alone to generate INDELs in HEK293T cells.
  • Figs. 22A-22B shows the linear correlation between % INDEL (max) and the normalized bacterial PAM-SCANR score for LbCas12a-T152R (Fig. 22A) and LbCas12a-K595Y (Fig. 22B).
  • any point mutation with a PAM-SCANR score over 1.5 tested generated INDELs in 293T cells at rates greater than 5%.
  • any of the mutations tested in the PAM-SCANR experiment with a normalized score greater than 1.5 is likely to be able to generate INDELs at rates useful for most eukaryotic applications.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2020/055659 2019-10-17 2020-10-15 Variants of cas12a nucleases and methods of making and use thereof Ceased WO2021076682A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
CA3157707A CA3157707A1 (en) 2019-10-17 2020-10-15 Variants of cas12a nucleases and methods of making and use thereof
CN202080087121.8A CN114829595A (zh) 2019-10-17 2020-10-15 Cas12a核酸酶的变体及其制备方法和用途
NZ787124A NZ787124B2 (en) 2020-10-15 Variants of cas12a nucleases and methods of making and use thereof
KR1020227015955A KR20220097408A (ko) 2019-10-17 2020-10-15 Cas12a 뉴클레아제의 변이체 및 그의 제조 방법 및 용도
IL292117A IL292117A (en) 2019-10-17 2020-10-15 Variants of cas12a nuclei and methods of production and use thereof
AU2020366358A AU2020366358A1 (en) 2019-10-17 2020-10-15 Variants of Cas12a nucleases and methods of making and use thereof
JP2022523132A JP7644755B2 (ja) 2019-10-17 2020-10-15 Cas12aヌクレアーゼの変異体ならびにその作製方法および使用方法
MX2022004549A MX2022004549A (es) 2019-10-17 2020-10-15 Variantes de nucleasas cas12a, metodos de fabricacion y uso de las mismas.
EP20875763.3A EP4045643A4 (en) 2019-10-17 2020-10-15 CAS12A NUCLEASE VARIANTS AND METHODS OF MAKING AND USING THE SAME
BR112022007125A BR112022007125A2 (pt) 2019-10-17 2020-10-15 Variantes de nucleases cas12a e métodos de produção e uso das mesmas
JP2025030119A JP2025087754A (ja) 2019-10-17 2025-02-27 Cas12aヌクレアーゼの変異体ならびにその作製方法および使用方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962916392P 2019-10-17 2019-10-17
US62/916,392 2019-10-17

Publications (1)

Publication Number Publication Date
WO2021076682A1 true WO2021076682A1 (en) 2021-04-22

Family

ID=75492833

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/055659 Ceased WO2021076682A1 (en) 2019-10-17 2020-10-15 Variants of cas12a nucleases and methods of making and use thereof

Country Status (12)

Country Link
US (3) US11866745B2 (https=)
EP (1) EP4045643A4 (https=)
JP (2) JP7644755B2 (https=)
KR (1) KR20220097408A (https=)
CN (1) CN114829595A (https=)
AU (1) AU2020366358A1 (https=)
BR (1) BR112022007125A2 (https=)
CA (1) CA3157707A1 (https=)
CL (4) CL2022000937A1 (https=)
IL (1) IL292117A (https=)
MX (1) MX2022004549A (https=)
WO (1) WO2021076682A1 (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114214348A (zh) * 2021-11-16 2022-03-22 河南农业大学 应用于核酸检测的Crispr/LbCas12a突变体蛋白及其制备方法和应用
WO2023104185A1 (en) * 2021-12-09 2023-06-15 Beijing Institute For Stem Cell And Regenerative Medicine Engineered cas12b effector proteins and methods of use thereof
CN116286734A (zh) * 2022-11-29 2023-06-23 武汉大学 野生型LbCas12a蛋白的突变体及SNP检测用途
WO2023131870A3 (en) * 2022-01-06 2023-08-17 Twelve Bio Aps Cas12a endonculease variants and methods of use
WO2024182746A1 (en) * 2023-03-01 2024-09-06 Pairwise Plants Services, Inc. Engineered proteins and methods of use thereof
EP4399310A4 (en) * 2021-09-08 2025-07-16 Arbor Biotechnologies Inc COMPOSITIONS COMPRISING A CRISPR NUCLEASE AND USES THEREOF
US12428636B1 (en) 2024-07-08 2025-09-30 Pairwise Plants Services, Inc. Methods and compositions for modification of protospacer adjacent motif specificity of CAS12A
EP4291644A4 (en) * 2021-02-12 2026-02-18 Univ Leland Stanford Junior CAS12A SYNTHETIC FOR IMPROVED MULTIPLEX GENE CONTROL AND EDITING
KR102935503B1 (ko) 2023-09-20 2026-03-09 주식회사 엔세이지 신규 Cas12a 단백질, 신규 Cas12a 단백질의 변형체 및 이들의 진핵세포 유전체 편집 용도

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2015330699B2 (en) 2014-10-10 2021-12-02 Editas Medicine, Inc. Compositions and methods for promoting homology directed repair
GB201506509D0 (en) 2015-04-16 2015-06-03 Univ Wageningen Nuclease-mediated genome editing
KR20260004568A (ko) * 2016-04-19 2026-01-08 더 브로드 인스티튜트, 인코퍼레이티드 신규한 crispr 효소 및 시스템
CN109790527A (zh) 2016-07-26 2019-05-21 通用医疗公司 普氏菌属和弗朗西斯氏菌属的CRISPR1(Cpf1)的变体
CN113136376B (zh) * 2021-05-26 2022-10-21 武汉大学 一种Cas12a变体及其在基因编辑中的应用
JP2025512041A (ja) * 2022-04-12 2025-04-16 ジョン イネス センター ゲノム編集効率を高めるための組成物および方法
WO2023232109A1 (zh) * 2022-06-01 2023-12-07 中国科学院遗传与发育生物学研究所 新的crispr基因编辑系统
CN116144631B (zh) * 2023-01-17 2023-09-15 华中农业大学 耐热型核酸内切酶及其介导的基因编辑系统
CN116410955B (zh) * 2023-03-10 2023-12-19 华中农业大学 两种新型核酸内切酶及其在核酸检测中的应用
CN116179512B (zh) * 2023-03-16 2023-09-15 华中农业大学 靶标识别范围广的核酸内切酶及其应用
US20250001010A1 (en) 2023-06-30 2025-01-02 Christiana Care Gene Editing Institute, Inc. Nras gene knockout for treatment of cancer
CN119432813A (zh) * 2023-12-29 2025-02-14 武汉艾迪晶生物科技有限公司 Cas蛋白、组合蛋白、核酸分子、核糖核蛋白复合物、重组载体、转基因细胞及其应用
CN117844782B (zh) * 2024-03-06 2024-05-31 崖州湾国家实验室 靶向范围广的基因编辑核酸酶及其在核酸检测中的应用
US20250319206A1 (en) 2024-04-04 2025-10-16 Christina Care Gene Editing Institute, Inc. Crispr/cas gene editing of neh4 and/or neh5 domains in nrf2
WO2025226816A1 (en) 2024-04-23 2025-10-30 Christiana Care Gene Editing Institute, Inc. Methods of identifying and correlating crispr-induced exon skipping to phenotypic outcomes
WO2025244732A1 (en) * 2024-05-24 2025-11-27 The Regents Of The University Of California Variant cas12a protein compositions and methods
US20260009010A1 (en) 2024-07-08 2026-01-08 Pairwise Plants Services, Inc. Methods and compositions for modification of protospacer adjacent motif specificity of cas12a
CN119506250B (zh) * 2024-11-29 2025-09-09 大连理工大学 一种多PAM选择的基因编辑系统NovaCas-2及其应用
CN119876148B (zh) * 2025-01-23 2025-10-17 中国科学技术大学 Crispr rna突变体及其在基因编辑和核酸检测中的应用
CN121653102A (zh) * 2026-02-09 2026-03-13 武汉艾迪晶生物科技有限公司 一种Cas酶突变体及组合蛋白、核酸分子、重组载体、转基因细胞及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180155716A1 (en) * 2015-06-18 2018-06-07 The Broad Institute, Inc. Novel crispr enzymes and systems
US20190010481A1 (en) * 2017-04-21 2019-01-10 The General Hospital Corporation Variants of CPF1 (CAS12a) With Altered PAM Specificity

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12110490B2 (en) * 2015-12-18 2024-10-08 The Broad Institute, Inc. CRISPR enzymes and systems
JP6914274B2 (ja) * 2016-01-22 2021-08-04 ザ・ブロード・インスティテュート・インコーポレイテッド Crisprcpf1の結晶構造
KR20260004568A (ko) 2016-04-19 2026-01-08 더 브로드 인스티튜트, 인코퍼레이티드 신규한 crispr 효소 및 시스템
CN117925730A (zh) * 2016-04-21 2024-04-26 国立大学法人神户大学 提高基因组序列修饰技术中的突变导入效率的方法、及其使用的分子复合体
MX2019003674A (es) * 2016-09-30 2021-01-08 Univ California Enzimas modificadoras de ácido nucleico guiadas por arn y métodos de uso de estas.
KR20240116572A (ko) 2017-03-23 2024-07-29 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 핵산 프로그램가능한 dna 결합 단백질을 포함하는 핵염기 편집제
WO2018213726A1 (en) 2017-05-18 2018-11-22 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
US11866697B2 (en) * 2017-05-18 2024-01-09 The Broad Institute, Inc. Systems, methods, and compositions for targeted nucleic acid editing
JP2019016859A (ja) 2017-07-04 2019-01-31 オリンパス株式会社 観察装置および観察方法
CN109957569B (zh) * 2017-12-22 2022-10-25 苏州齐禾生科生物科技有限公司 基于cpf1蛋白的碱基编辑系统和方法
AR113728A1 (es) 2018-01-11 2020-06-03 Kws Saat Se & Co Kgaa Sistemas crispr / cpf1 optimizados en planta
CN108486146B (zh) * 2018-03-16 2021-02-19 中国农业科学院作物科学研究所 LbCpf1-RR突变体用于CRISPR/Cpf1系统在植物基因编辑中的应用

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180155716A1 (en) * 2015-06-18 2018-06-07 The Broad Institute, Inc. Novel crispr enzymes and systems
US20190010481A1 (en) * 2017-04-21 2019-01-10 The General Hospital Corporation Variants of CPF1 (CAS12a) With Altered PAM Specificity

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4045643A4 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4291644A4 (en) * 2021-02-12 2026-02-18 Univ Leland Stanford Junior CAS12A SYNTHETIC FOR IMPROVED MULTIPLEX GENE CONTROL AND EDITING
EP4399310A4 (en) * 2021-09-08 2025-07-16 Arbor Biotechnologies Inc COMPOSITIONS COMPRISING A CRISPR NUCLEASE AND USES THEREOF
CN114214348A (zh) * 2021-11-16 2022-03-22 河南农业大学 应用于核酸检测的Crispr/LbCas12a突变体蛋白及其制备方法和应用
WO2023104185A1 (en) * 2021-12-09 2023-06-15 Beijing Institute For Stem Cell And Regenerative Medicine Engineered cas12b effector proteins and methods of use thereof
WO2023131870A3 (en) * 2022-01-06 2023-08-17 Twelve Bio Aps Cas12a endonculease variants and methods of use
CN116286734A (zh) * 2022-11-29 2023-06-23 武汉大学 野生型LbCas12a蛋白的突变体及SNP检测用途
CN116286734B (zh) * 2022-11-29 2024-04-02 武汉大学 野生型LbCas12a蛋白的突变体及SNP检测用途
WO2024182746A1 (en) * 2023-03-01 2024-09-06 Pairwise Plants Services, Inc. Engineered proteins and methods of use thereof
KR102935503B1 (ko) 2023-09-20 2026-03-09 주식회사 엔세이지 신규 Cas12a 단백질, 신규 Cas12a 단백질의 변형체 및 이들의 진핵세포 유전체 편집 용도
US12428636B1 (en) 2024-07-08 2025-09-30 Pairwise Plants Services, Inc. Methods and compositions for modification of protospacer adjacent motif specificity of CAS12A
WO2026015423A3 (en) * 2024-07-08 2026-02-12 Pairwise Plants Services, Inc. Methods and compositions for modification of protospacer adjacent motif specificity of cas12a

Also Published As

Publication number Publication date
CL2022000937A1 (es) 2023-01-20
US20240076639A1 (en) 2024-03-07
JP2022552409A (ja) 2022-12-15
NZ787124A (en) 2025-09-26
CL2024001733A1 (es) 2024-11-15
JP7644755B2 (ja) 2025-03-12
KR20220097408A (ko) 2022-07-07
CA3157707A1 (en) 2021-04-22
CL2024001737A1 (es) 2024-11-15
CN114829595A (zh) 2022-07-29
US20240076640A1 (en) 2024-03-07
US11866745B2 (en) 2024-01-09
EP4045643A1 (en) 2022-08-24
JP2025087754A (ja) 2025-06-10
IL292117A (en) 2022-06-01
MX2022004549A (es) 2022-07-21
US20210115421A1 (en) 2021-04-22
AU2020366358A1 (en) 2022-04-28
BR112022007125A2 (pt) 2022-07-05
EP4045643A4 (en) 2023-11-08
CL2024001734A1 (es) 2024-11-15

Similar Documents

Publication Publication Date Title
US20240076640A1 (en) Variants of cas12a nucleases and methods of making and use thereof
US12084671B2 (en) Optimized CRISPR-Cas nucleases and base editors and methods of use thereof
EP4471149A2 (en) Type v crispr-cas base editors and methods of use thereof
US20210238598A1 (en) Compositions, systems, and methods for base diversification
US12043827B2 (en) Compositions, systems, and methods for base diversification
US20260078360A1 (en) Engineered proteins and methods of use thereof
US20240327811A1 (en) Engineered proteins and methods of use thereof
US20240200102A1 (en) Fusion proteins comprising an intein polypeptide and methods of use thereof
US12428636B1 (en) Methods and compositions for modification of protospacer adjacent motif specificity of CAS12A
US20260022361A1 (en) Engineered proteins and methods of use thereof
US20230295646A1 (en) Model editing systems and methods relating to the same
US20260117237A1 (en) Engineered proteins and methods of use thereof
US20260022365A1 (en) Engineered cytidine deaminases
WO2026096573A1 (en) Engineered proteins and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20875763

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3157707

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022523132

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022007125

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2020366358

Country of ref document: AU

Date of ref document: 20201015

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20227015955

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020875763

Country of ref document: EP

Effective date: 20220517

ENP Entry into the national phase

Ref document number: 112022007125

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220413

WWW Wipo information: withdrawn in national office

Ref document number: 1020227015955

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 787124

Country of ref document: NZ