WO2021010728A1 - 골질환 예방 또는 치료용 약학 조성물 - Google Patents

골질환 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2021010728A1
WO2021010728A1 PCT/KR2020/009246 KR2020009246W WO2021010728A1 WO 2021010728 A1 WO2021010728 A1 WO 2021010728A1 KR 2020009246 W KR2020009246 W KR 2020009246W WO 2021010728 A1 WO2021010728 A1 WO 2021010728A1
Authority
WO
WIPO (PCT)
Prior art keywords
formula
bone
preventing
pharmaceutical composition
phenyl
Prior art date
Application number
PCT/KR2020/009246
Other languages
English (en)
French (fr)
Inventor
이태훈
이선우
김근중
조은진
첸지하오
딩미나
민상현
최동규
Original Assignee
전남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190084955A external-priority patent/KR102096793B1/ko
Priority claimed from KR1020200086332A external-priority patent/KR102466565B1/ko
Application filed by 전남대학교산학협력단 filed Critical 전남대학교산학협력단
Priority to US17/627,912 priority Critical patent/US20220274935A1/en
Priority to EP20841440.9A priority patent/EP4000622A4/en
Publication of WO2021010728A1 publication Critical patent/WO2021010728A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
    • C07D241/02—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings
    • C07D241/04—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/40—Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs

Definitions

  • the present invention relates to a pharmaceutical composition and health functional food for preventing or treating bone disease.
  • Bone tissue is a tissue in which bone resorption by osteoclasts and bone formation by osteoblasts are continuously maintained. Differentiation of osteoblasts is promoted by signal factors such as Bone Morphogenetic Protein 2 (BMP2). Differentiation of osteoclasts is promoted by RANKL (Receptor Activator of Nuclear Factor Kappa- ⁇ Ligand) signaling material produced in the osteoblast differentiation stage, and apoptosis occurs when the differentiation is complete. Therefore, it is important to harmonize the differentiation and activity of osteoblasts and osteoclasts during normal bone regeneration.
  • BMP2 Bone Morphogenetic Protein 2
  • RANKL Receptor Activator of Nuclear Factor Kappa- ⁇ Ligand
  • Periodontal inflammation is an inflammatory response by the defense of immune cells against apical bacterial infection.
  • Neutrophils which are mainly involved in periodontal inflammation, secrete prostaglandins, an inflammatory mediator.
  • Cellular signaling substances such as prostaglandin and RANKL can activate osteoclasts that absorb bone tissue and cause resorption of alveolar bone around the inflamed area.
  • it is required to develop a bone regeneration promoting agent or a bone resorption inhibitor.
  • the development of osteoclast differentiation inhibitors is required to control abnormal bone resorption and restore normal bone regeneration processes.
  • An object of the present invention is to provide a pharmaceutical composition for preventing or treating bone diseases.
  • An object of the present invention is to provide a health functional food for preventing or improving bone disease.
  • a pharmaceutical composition for preventing or treating bone diseases caused by hyperdifferentiation of osteoclasts comprising a compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof:
  • R 1 is C1 to C3 alkyl or phenyl
  • R 2 and R 3 are each independently H or halo.
  • R 1 is methyl, ethyl or phenyl
  • a pharmaceutical composition for preventing or treating bone disease is a pharmaceutical composition for preventing or treating bone disease.
  • R 1 is C1 to C3 alkyl, R 2 is halo, and R 3 is H; R 1 is phenyl, R 2 is H, and R 3 is haloin, a pharmaceutical composition for preventing or treating bone disease.
  • the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular femoral necrosis, preventing bone disease or Pharmaceutical composition for treatment.
  • R 1 is C1 to C3 alkyl or phenyl
  • R 2 and R 3 are each independently H or halo.
  • R 1 is methyl, ethyl or phenyl
  • R 1 is C1 to C3 alkyl, R 2 is halo, and R 3 is H; R 1 is phenyl, R 2 is H, and R 3 is haloin, a health functional food for preventing or improving bone disease.
  • the bone disease is at least one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis and avascular femoral necrosis, bone disease prevention or Health functional food for improvement.
  • the pharmaceutical composition of the present invention may exhibit excellent prophylactic or therapeutic effects for various bone diseases including periodontitis by inhibiting the differentiation and/or production of osteoclasts.
  • the health functional food of the present invention can exhibit excellent preventive or improved effects on various bone diseases including periodontitis by inhibiting the differentiation and/or production of osteoclasts.
  • Figure 2 is a graph showing the osteoclast fractionation area ratio and the number of differentiated osteoclasts per total area confirmed after TRAP staining.
  • Figure 3 shows the results of the cytotoxicity test of the 35D35 compound through MTT analysis.
  • Figure 5 shows the results confirming the F-actin formation inhibitory ability of the 35D35, 35D5, 35D3 compounds.
  • FIG. 9 shows the results of comparing the amount of CtsK expression in osteoclasts treated with 35D35 compound (1 ⁇ M) and 35D3 compound (6 ⁇ M) through RT-PCR.
  • V total bone volume
  • BMD Trabecular bone mineral density
  • Ct. V cortical volume
  • FIG. 16 shows the results of confirming the effect of the 35D3 compound on osteoclast differentiation ability using a Tartrate-resistant acid phosphatase (TRAP) activity assay kit (Sigma-Aldrich, 387A-1kt).
  • TRIP Tartrate-resistant acid phosphatase
  • the present invention provides a pharmaceutical composition for preventing or treating bone diseases comprising a compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof:
  • R 1 is C1 to C3 alkyl or phenyl
  • R 2 and R 3 may each independently be H or halo.
  • alkyl refers to a linear or branched saturated hydrocarbon group, such as methyl, ethyl, propyl, isopropyl, isobutyl, sec butyl, tert butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl , Tridecyl, pentadecyl and heptadecyl, and the like.
  • C1 to C10 alkyl means alkyl having 1 to 10 carbon atoms.
  • aryl refers to a wholly or partially unsaturated substituted or unsubstituted monocyclic or polycyclic carbon ring, and may be, for example, substituted or unsubstituted phenyl.
  • halo refers to a monovalent functional group of elements belonging to group 17 in the periodic table, and may be, for example, fluoro, chloro, bromo or iodo.
  • R 1 may be C1 to C3 alkyl or phenyl.
  • R 1 may be methyl, ethyl or phenyl.
  • R 2 and R 3 may each independently be H or halo.
  • R 2 and R 3 may each independently be H or chloro.
  • R 1 may be C1 to C3 alkyl
  • R 2 may be halo
  • R 3 may be H.
  • R 1 may be ethyl
  • R 2-- may be chloro
  • R 3 may be H.
  • R 1 may be methyl
  • R 2-- may be chloro
  • R 3 may be H.
  • R 1 may be phenyl
  • R 2 may be H
  • R 3 may be halo
  • R 1 may be phenyl
  • R 2-- may be H
  • R 3 may be chloro
  • the compound represented by Formula 1 may be selected from the group consisting of compounds represented by Formulas 2 to 4 below.
  • a pharmaceutical composition for preventing or treating bone diseases including a compound represented by Chemical Formulas 2 to 4 or a pharmaceutically acceptable salt thereof.
  • pharmaceutically acceptable refers to a property that does not cause serious irritation to an individual, cells, tissues, etc. to which the compound or composition is administered, and does not impair the biological activity and physical properties of the compound.
  • Pharmaceutically acceptable salts may be, for example, acid addition salts, base addition salts or metal salts.
  • Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous or phosphorous acid, and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. It can be formed from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids.
  • These pharmaceutically non-toxic salts are sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, ioda Id, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propyrate, oxalate, malonate, succinate, suberate, Sebacate, fumarate, maleate, butine-1,4-dioate, nucleic acid-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, methoxy Benzoate, phthalate, terephthalate, benzenesulfonate, eluenesulfonate
  • the acid addition salt of the compound represented by Formula 1 can be obtained by dissolving the compound in an excess acid aqueous solution and precipitating the salt using a hydrated organic solvent such as methanol, ethanol, acetone or acetonitrile. .
  • the metal salt can be a sodium, potassium or calcium salt.
  • Metal salts can be prepared using a base, for example, alkali metal or alkaline earth metal salts dissolve the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filter the non-dissolved compound salt, and evaporate the filtrate and/or Or it can be obtained by drying.
  • the compound represented by Formula 1 and a pharmaceutically acceptable salt thereof may exhibit an osteoclast differentiation inhibitory effect.
  • the compounds represented by Chemical Formulas 2 to 2, and pharmaceutically acceptable salts thereof, may exhibit an osteoclast differentiation inhibitory effect.
  • prevention refers to any action that inhibits or delays bone disease.
  • treatment refers to any action in which symptoms of an individual suspected of and developed bone disease are improved or beneficially altered.
  • the compounds represented by Chemical Formulas 1 to 4 included in the composition of the present invention may be derived from nature or may be synthesized using a known chemical synthesis method.
  • Bone diseases that can be prevented or treated by the pharmaceutical composition of the present invention may be caused by an imbalance of activity between osteoblasts and osteoclasts.
  • osteoclasts destroy old and unnecessary bone tissue, and calcium is released into the bloodstream to help maintain body functions, and osteoblasts play a role of regenerating the destroyed bone. This action continues 24 hours a day, and about 10% to 30% of adult bones are rebuilt in this way per year. Therefore, the balance between osteoclasts and osteoblasts is very important, and this balance is regulated by various hormones and other body chemicals.
  • the bone disease may be due to osteoclast hyperdifferentiation or osteoblast activity decrease, and specifically, the bone disease may be due to osteoclast hyperdifferentiation.
  • osteoclasts When osteoclasts are hyperdifferentiated, osteoclasts increase abnormally, resulting in excessive bone resorption, resulting in lower bone density, and various diseases such as osteoporosis, osteomalacia, osteopenia, bone atrophy, and periodontitis may appear.
  • Bone diseases include fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis or avascular femoral necrosis, bone defects, fracture osteoporotic fractures, diabetic fractures, nonunion fractures, bone insufficiency, osteomalacia Sex fracture, bone dysplasia, degenerative bone disease, malocclusion, bone union disorder, arthrosis, bone necrosis, osteoarthritis, bone tumor, bone cancer, etc., but is not limited thereto.
  • the bone disease may be fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis or avascular femoral necrosis, but is not limited thereto.
  • Periodontitis is an inflammatory reaction caused by the defense of immune cells against apical bacterial infection.
  • Neutrophils which are mainly involved in periodontitis, secrete prostaglandins, an inflammatory mediator.
  • the osteoclasts that absorb bone tissue are activated by cellular signaling substances such as prostaglandin, and the alveolar bone loss around the inflamed area is observed.
  • chronic periodontitis shows persistent inflammation of the apical region of the periodontal bone and erosion of the alveolar bone. If periodontitis worsens and the teeth cannot be saved, tooth extraction and implantation are performed.
  • the pharmaceutical composition for preventing or treating bone diseases of the present invention can be used for the prevention or treatment of periodontitis through the effect of inhibiting bone resorption.
  • the pharmaceutical composition of the present invention may be provided by mixing with known bone disease treatment substances.
  • the pharmaceutical composition of the present invention may be administered in combination with known substances for preventing or treating bone diseases.
  • administration refers to introducing a predetermined substance to an individual by an appropriate method
  • subject refers to all animals such as mice, mice, livestock, including humans who have or may develop bone disease. As a specific example, it may be a mammal including a human.
  • the pharmaceutical composition of the present invention may additionally contain a known anti-bone disease compound.
  • anti-bone disease compounds examples include cinchonin, extracts of brown mealworm, aloe-imidine and omega-3 fatty acids, artagnein B, indole-2-carboxylate derivatives, euphobia factor L1, scalcapflavone derivatives, and praxinelone. However, it is not limited thereto.
  • the pharmaceutical composition of the present invention may be in the form of a capsule, tablet, granule, injection, ointment, powder or beverage.
  • the pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories and injections.
  • the pharmaceutical composition of the present invention may contain an active ingredient alone, or may further include one or more pharmaceutically acceptable carriers, excipients, or diluents.
  • the pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may be binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, flavoring agents, etc. for oral administration, and buffering agents, preservatives, painless agents, and
  • a solubilizing agent, an isotonic agent, a stabilizer, etc. can be mixed and used, and for topical administration, a base agent, an excipient, a lubricant, a preservative, and the like can be used.
  • the formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier. For example, when administered orally, tablets, troches, capsules, elixir, suspension, syrup, wafers, etc. It may be prepared in a form, and in the case of an injection, it may be prepared in a unit dosage ampoule or a multiple dosage form. In addition, the formulation of the pharmaceutical composition of the present invention may be prepared as a solution, suspension, tablet, capsule, sustained release formulation, or the like.
  • Carriers, excipients and diluents for formulation are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, filler, anti-coagulant, lubricant, wetting agent, fragrance, emulsifier or preservative.
  • the route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal. Not limited.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally, and when administered parenterally, external or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection injection method may be selected.
  • the dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the degree of the disease, the form of the drug, the route and duration of administration, but may be appropriately selected by those skilled in the art.
  • the pharmaceutical composition of the present invention may be administered at 0.0001 mg to 1000 mg/kg or 0.001 mg to 500 mg/kg per day.
  • Administration of the pharmaceutical composition of the present invention may be administered once a day, or may be divided several times.
  • the present invention provides a health functional food for preventing or improving bone diseases, including a compound represented by the following formula (1) or a food wise acceptable salt thereof:
  • R 1 is C1 to C3 alkyl or phenyl
  • R 2 and R 3 may each independently be H or halo.
  • a health functional food for preventing or improving bone disease including a compound represented by Chemical Formulas 2 to 4 or a food pharmaceutically acceptable salt thereof.
  • the health functional food of the present invention may be formulated as one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further including at least one of carriers, diluents, excipients and additives.
  • the health functional food may be, for example, various foods, powders, granules, tablets, capsules, syrup, beverages, gums, teas, vitamin complexes, or health functional foods.
  • Additives that can be included in health functional foods include natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), lactic acid and It may be selected from the group consisting of salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, antioxidants, glycerin, alcohols, carbonation agents and pulp.
  • Natural carbohydrates include, for example, monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents tacrine, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.
  • Health functional foods include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavors, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, and organic acids.
  • Carriers, excipients, diluents and additives are not limited thereto, but lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, fine Crystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil It may be selected from the group consisting of.
  • the health functional food of the present invention may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • 35D35 in the example below is a compound represented by Formula 2 (2-(2-chlorophenoxy)-N-[2-(4-propionyl-1-piperazinyl)phenyl]acetamide), and 35D5 is a compound represented by Formula 3 , 35D3 is N-(2-(4-acetylpiperazin-1-yl)phenyl)-2-(2-chlorophenoxy)acetamide, and 35D8 is 2-(4-chlorophenoxy)-N-(2-(4-methylpiperazin) -1-yl)phenyl)acetamide, and 35D3 (or PPOA) is a compound represented by Chemical Formula 4.
  • the bone marrow of a 10-week-old female mouse was isolated from the hip bone, femur, and tibia and macrophage colony stimulating factor (M-CSF, PeproTech, 315). -02, 30ng/ml) containing ⁇ -MEM medium (Gibco, 12561-056, 10% fetal bovine serum, 1% penicillin/streptomycin) for 3 days incubated for 3 days to isolate only mononuclear cells.
  • the isolated mononuclear cells were treated with RANKL (Receptor Activator of Nuclear factor kappa B ligand, PeproTech, 315-11, 50ng/ml) to induce osteoclast differentiation.
  • RANKL Receptor Activator of Nuclear factor kappa B ligand
  • each compound 35D35, 35D5, 35D3, 35D8 was treated and cultured for 3 or 5 days to confirm the degree of osteoclast differentiation.
  • Mononuclear cells lx 10 4 isolated from mouse bone marrow were placed in a 96 well plate and treated with RANKL and each compound (35D35, 35D5, 35D3, 35D8) to confirm the effect of each compound on osteoclast differentiation ability.
  • TRAP activity assay kit Cosmo Bio, PMC-AK04F-COS
  • the activity of Tartrate-resistant acid phosphatase (TRAP) which increases its expression during osteoclast differentiation, was confirmed.
  • the compounds 35D35, 35D5 and 35D3 exhibited superior osteoclast differentiation inhibitory effect compared to other derivatives (see FIG. 1).
  • the 35D35 compound showed an effective osteoclast differentiation inhibitory ability at a concentration of 0.5uM (see FIG. 2).
  • BMM was divided into 5 groups (Ctrl, Period I to IV), and cultured for 4 days in a culture medium containing 30ng/mL M-CSF and 50ng/mL RANKL. BMMs in Period I through IV groups were exposed to 1 ⁇ M 35D35 for 24 hours on different days, respectively. After 4 days, the cells of each group were fixed, and the presence of osteoclasts was confirmed after performing TRAP staining. As a result, it was confirmed that osteoclast differentiation was inhibited for the initial 24 hours in the group treated with the 35D35 compound (see FIG. 4, "M+R" means M-CSF+RANKL treatment).
  • the F-actin ring formation ability was measured. Specifically, BMM was seeded on a 12mm cover glass with or without compounds (35D3: 6 ⁇ M, 35D5 and 35D35: 2 ⁇ M), and M-CSF and LANKL were treated. After the osteoclasts were formed in the control group, the osteoclasts were fixed in 4.0% paraformaldehyde for 15 minutes, and then incubated in 5% FBS and blocked for about 60 minutes. After washing with PBS, rhodamine-conjugated phalloidin (1:40) was added to each well to visualize the F-actin belt.
  • RNA expression level was measured by RT-PCR in cells treated with 35D35 (1 ⁇ M) and 35D3 (6 ⁇ M) compounds.
  • RNA was isolated from cells differentiated into osteoclasts using an RNA extraction kit, and cDNA was synthesized using a reverse transcriptase (Takara, RR037 A) of 0.5 ug of RNA quantified by a spectrophotometer.
  • QRT-PCR was performed using cDNA synthesized by QuantStudio 3 real-time PCR system (Applied Biosystems). After treatment with cell lysates, immunoblotting was performed with an anti-Ctsk antibody. ⁇ -actin was used as a loading control.
  • the amount of mRNA expression of the osteoclast-specific genes AcP5 (TRAP), NFATc1, DC-STAMP, ATP6v0d2, MMP9 and CTSK in the group treated with 35D35 compared to the control group not treated with 35D35 (Ctrl). Decreased (see Fig. 8, "M” M-CSF treatment group).
  • the graph of FIG. 8 is the normalization of the transcription level with the expression level of the control on Day 0.
  • the 35D35 compound was treated compared to the case where the 35D3 compound was treated, the Ctsk protein expression was strongly inhibited even at a low concentration (see FIG. 9).
  • 35D35 can function as an effective bone metabolism inhibitor by inhibiting the differentiation of osteoclasts even in a smaller amount.
  • the bone marrow of a 12-week-old female mouse was isolated from the hip bone, femur, and tibia and macrophage colony stimulating factor (M-CSF, PeproTech, cat). #315-02, 30ng/ml) containing ⁇ -MEM medium (Gibco, 12561-056, 10% fetal bovine serum, 1% penicillin/streptomycin) was cultured for 3 days to isolate only mononuclear cells.
  • the isolated mononuclear cells were treated with RANKL (PeproTech, cat# 315-11, 50ng/ml) to induce osteoclast differentiation.
  • 35D3 PPOA was treated together and incubated for 3 or 5 days.
  • the number of differentiated osteoclasts was counted and confirmed, and this was shown in FIG. 17B, and the number of cell nuclei contained in the differentiated osteoclasts was 3-5, 6-10, 11-20, 21 or more. Cells were classified and shown in Fig. 17C.
  • the F-actin antibody (Thermo Fisher Scientific, A12379) was reacted for 1 hour and then washed. Cell nuclei were stained through DAPI (4',6-Diamidino-2-Phenylindole, Dilactate, Thermo Fisher Scientific, D3571) staining and then photographed under a microscope. As a result, it was confirmed that the size of F-actin was different depending on the presence or absence of 35D3 (PPOA) treatment (see FIG. 18). Through this, it was found that 35D3 (PPOA) can inhibit differentiation into multinuclear cells.
  • DAPI 3',6-Diamidino-2-Phenylindole, Dilactate, Thermo Fisher Scientific, D3571
  • bone resorption ability was confirmed using a bone resorption assay kit (Cosmo Bio, CSR-BRA).
  • Mouse bone marrow cells were seeded in bone resorption assay plate 48 (2 ⁇ 10 4 cells/well) containing 30 ng/Ml of M-CSF. After 24 hours, mouse bone marrow cells were treated with or without 6 ⁇ M 35D3 (PPOA) under stimulation of 30 ng/mL of M-CSF and 100 ng/mL of RANKL until mature osteoclasts were formed. The next day, the culture supernatant from the cells was collected on a 96-well black polypropylene micro-well plate (Thermo Fisher Scientific Nunc, Waltham, MD, USA).
  • 19A shows the visualization of the bone resorption area using an optical microscope.
  • 19B shows the fluorescence intensity measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.
  • 19C shows the results of calculating the bone resorption pits area. The proportion of bone resorption area showed a significant decrease after exposure to 3, 6, and 10 ⁇ M of 35D3 (PPOA).
  • HBMP2 (Bone morphogenic protein 2, Sino biological, 10426-HNAE, 100 ng/ml) was treated on precursor cells isolated from the skull of a mouse to induce differentiation into osteoblasts. Differentiated osteoblasts can be differentiated through alkaline phosphatase (ALP) staining, an osteoblast-specific protein.
  • ALP alkaline phosphatase
  • ALP alkaine phosphatase
  • FIG. 10 shows the results of confirming the osteoblast differentiation ability by the 35D35 compound through ALP staining.
  • Figure 10A shows the results of confirming differentiated osteoblasts through ALP staining
  • Ovariectomized mouse models (OVX, ovariectomized mouse) due to estrogen deficiency were produced by performing ovariectomy in 8-week-old female mice.
  • Compounds (35D35, 35D5, 35D3) were injected intraperitoneally once every two days to an osteoporotic mouse model. After 4 weeks, the tibia of the mouse was analyzed for bone density by microcomputer tomography.
  • the OVX model injected with the 35D3 compound did not observe higher bone density and bone volume than the control (OVX), whereas the OVX model injected with the 35D35 and 35D5 compounds had higher bone density and bone volume than the control (OVX).
  • Figs. 11 to 14 was observed (see Figs. 11 to 14).
  • 11 to 14 show graphs analyzing the results of micro-computed tomography (Sham: control in which the ovaries were not removed) and micro-computed tomography results of the tibia of a mouse model (* P ⁇ 0.05, ** P ⁇ 0.01 , and *** P ⁇ 0.001 vs. the control group, OVX.BMD: trabecular bone mineral density).
  • the compounds of the present invention could exhibit excellent osteoclast differentiation inhibitory effects, but did not affect osteoblast differentiation.
  • the compound inhibited the expression of osteoclast-related genes by inhibiting the expression of osteoclast-related genes including NFATc1 through molecular biological experiments.
  • the compound when the compound was treated (35D35, 35D5) in a mouse model of ovariectomized osteoporosis, it showed excellent inhibition of bone resorption ability.
  • the compound of the present invention may function as an effective bone metabolism inhibitor by exhibiting an excellent osteoclast differentiation inhibitory effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Mycology (AREA)
  • Pediatric Medicine (AREA)
  • Epidemiology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 골질환 예방 또는 치료용 약학 조성물에 관한 것으로, 보다 상세하게는 특정 화학식의 화합물을 포함함으로써 파골세포 분화 및/또는 생성을 억제하고 치주염 등을 포함하는 다양한 골질환에 대해 우수한 예방 또는 치료 효과를 나타낼 수 있다.

Description

골질환 예방 또는 치료용 약학 조성물
본 발명은 골질환 예방 또는 치료용 약학 조성물 및 건강기능식품에 관한 것이다.
골조직은 파골세포(osteoclast)에 의한 골흡수와 조골세포(osteoblast)에 의한 골형성 과정이 지속적으로 유지되는 조직이다. 조골세포는 골 형태 발생 단백질 2 (Bone Morphogenetic Protein 2, BMP2) 등의 신호인자에 의해 분화가 촉진된다. 조골세포 분화단계에서 생성되는 RANKL(Receptor Activator of Nuclear factor Kappa-β Ligand) 신호전달물질에 의해 파골세포의 분화가 촉진되며, 분화가 완료되면 세포사멸(apoptosis)이 일어난다. 따라서, 정상적인 골 재생 과정에서 조골세포와 파골세포의 분화 및 활성이 조화롭게 이루어지는 것이 중요하다.
치주염증은 치근단 세균감염에 대한 면역세포의 방어작용에 의한 염증반응으로, 치주염증에 주로 관여하는 호중구는 염증매개물질인 프로스타글란딘을 분비한다. 프로스타글란딘, RANKL 등의 세포신호전달 물질은 골조직을 흡수하는 파골세포를 활성화시켜 염증부위 주변의 치조골의 재흡수를 일으킬 수 있다. 만성치주염 치료를 위해 골재생 촉진제 또는 골흡수 억제제 개발이 요구된다. 뿐만 아니라, 비정상적인 뼈의 흡수를 조절하고, 정상적인 골재생 과정을 회복하기 위해 파골세포 분화 억제제 개발이 요구된다.
본 발명은 골질환 예방 또는 치료용 약학 조성물을 제공하는 것을 목적으로 한다.
본 발명은 골질환 예방 또는 개선용 건강기능식품을 제공하는 것을 목적으로 한다.
1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 포함하는 파골세포 과분화로 유발되는 골질환 예방 또는 치료용 약학 조성물:
[화학식 1]
Figure PCTKR2020009246-appb-img-000001
상기 화학식 1에서,
R 1은 C1 내지 C3의 알킬 또는 페닐이고;
R 2 및 R 3는 각각 독립적으로 H 또는 할로임.
2. 위 1에 있어서, 상기 R 1은 메틸, 에틸 또는 페닐인, 골질환 예방 또는 치료용 약학 조성물.
3. 위 1에 있어서, 상기 R 1은 C1 내지 C3의 알킬이고, 상기 R 2는 할로이고, 상기 R 3은 H이거나; R 1은 페닐이고, 상기 R 2는 H 이고, 상기 R 3은 할로인, 골질환 예방 또는 치료용 약학 조성물.
4. 위 1에 있어서, 상기 화학식 1로 표시되는 화합물은 하기 화학식 2 내지 화학식 4로 표시되는 화합물로 이루어진 군에서 선택된 것인, 골질환 예방 또는 치료용 약학 조성물:
[화학식 2]
Figure PCTKR2020009246-appb-img-000002
[화학식 3]
Figure PCTKR2020009246-appb-img-000003
[화학식 4]
Figure PCTKR2020009246-appb-img-000004
5. 위 1에 있어서, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택된 적어도 하나인, 골질환 예방 또는 치료용 약학 조성물.
6. 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 포함하는 파골세포 과분화로 유발되는 골질환 예방 또는 개선용 건강기능식품:
[화학식 1]
Figure PCTKR2020009246-appb-img-000005
상기 화학식 1에서,
R 1은 C1 내지 C3의 알킬 또는 페닐이고;
R 2 및 R 3는 각각 독립적으로 H 또는 할로임.
7. 위 6에 있어서, 상기 R 1은 메틸, 에틸 또는 페닐인, 골질환 예방 또는 개선용 건강기능식품.
8. 위 6에 있어서, 상기 R 1은 C1 내지 C3의 알킬이고, 상기 R 2는 할로이고, 상기 R 3은 H이거나; R 1은 페닐이고, 상기 R 2는 H 이고, 상기 R 3은 할로인, 골질환 예방 또는 개선용 건강기능식품.
9. 위 6에 있어서, 상기 화학식 1로 표시되는 화합물은 하기 화학식 2 내지 화학식 4으로 표시되는 화합물로 이루어진 군에서 선택된 것인, 골질환 예방 또는 개선용 건강기능식품:
[화학식 2]
Figure PCTKR2020009246-appb-img-000006
[화학식 3]
Figure PCTKR2020009246-appb-img-000007
[화학식 4]
Figure PCTKR2020009246-appb-img-000008
.
10. 위 6에 있어서, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택된 적어도 하나인, 골질환 예방 또는 개선용 건강기능식품.
본 발명 약학 조성물은 파골세포 분화 및/또는 생성을 억제함으로써 치주염 등을 포함하는 다양한 골질환에 대해 우수한 예방 또는 치료 효과를 나타낼 수 있다.
본 발명 건강기능식품은 파골세포 분화 및/또는 생성을 억제함으로써 치주염 등을 포함하는 다양한 골질환에 대해 우수한 예방 또는 개선 효과를 나타낼 수 있다.
도 1은 Tartrate-resistant acid phosphatase(TRAP) 염색을 통해 화합물이 파골세포 분화능에 미치는 영향을 확인한 결과를 나타낸다.
도 2는 TRAP 염색 후 확인한 전체 면적당 파골세포 분화면적비율, 분화된 파골세포 수를 나타낸 그래프이다.
도 3은 MTT 분석을 통한 35D35 화합물의 세포독성 실험결과를 나타낸다.
도 4는 TRAP 염색을 통해 파골세포 분화 시기에 따라 35D35 화합물이 영향을 미치는지 여부를 확인한 결과를 나타낸다.
도 5는 35D35, 35D5, 35D3 화합물의 F-actin 형성 억제능을 확인 결과를 나타낸다.
도 6은 35D35 화합물의 처리 농도별 F-actin 형성 억제능을 측정한 결과를 나타낸다.
도 7은 Bone resorption assay kit를 사용하여 35D35의 골 흡수능을 측정한 결과를 나타낸다.
도 8은 RT-PCR을 통해 파골세포 특이적 유전자의 발현양을 확인한 결과를 나타낸다.
도 9는 RT-PCR을 통해 35D35 화합물(1μM) 및 35D3 화합물(6μM) 처리시 파골세포에서 CtsK의 발현양을 비교한 결과를 나타낸다.
도 10은 35D35 화합물이 조골세포 분화에 영향을 미치는지 확인한 ALP 염색 결과를 나타낸다.
도 11은 OVX 마우스에서 35D35, 35D5 및 35D3 화합물의 골밀도 증가 효과를 확인한 결과를 나타낸다.
도 12는 35D35, 35D5 및 35D3 화합물 처리된 OVX 마우스의 BMD(trabecular bone mineral density 값을 나타낸다.
도 13은 OVX 마우스에서 35D35 화합물의 골밀도 증가 효과를 확인한 결과를 나타낸다.
도 14는 35D35 화합물 처리된 OVX 마우스의 TV(total bone volume), BV(bone volume), Th. V(trabecular volume), Th. BMD(trabecular bone mineral density), Ct. V(cortical volume), Ct. BMD(cortical bone mineral density) 값을 나타낸다.
도 15는 마우스 골수에서 분리한 단핵세포에 35D3 화합물을 농도별로 처리했을 때 세포생존능을 평가한 결과를 나타낸다.
도 16은 35D3 화합물이 파골세포 분화능에 미치는 영향을 Tartrate-resistant acid phosphatase(TRAP) activity assay kit(Sigma-Aldrich, 387A-1kt)를 사용하여 확인한 결과를 나타낸다.
도 17은 TRAP 염색 후 확인한 전체 면적당 분화면적비율, 분화된 파골세포 수를 나타낸다.
도 18은 다핵세포로의 분화능을 F-actin 형성 정도로 확인한 결과를 나타낸다.
도 19는 파골세포의 골 흡수능을 확인한 결과를 나타낸다.
이하, 본 발명을 상세히 설명한다.
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 포함하는 골질환 예방 또는 치료용 약학 조성물을 제공한다:
[화학식 1]
Figure PCTKR2020009246-appb-img-000009
상기 화학식 1에서,
R 1은 C1 내지 C3의 알킬 또는 페닐이고;
R 2 및 R 3는 각각 독립적으로 H 또는 할로일 수 있다.
용어 “알킬”은 직쇄 또는 분지쇄의 포화 탄화수소기를 의미하며, 예컨대, 메틸, 에틸, 프로필, 이소프로필, 이소부틸, sec 부틸, tert 부틸, 펜틸, 헥실, 헵틸, 옥틸, 노닐, 데실, 운데실, 트리데실, 펜타데실 및 헵타데실 등을 포함한다. C1 내지 C10의 알킬은 1개 내지 10개의 탄소수를 가지는 알킬을 의미한다.
용어 “아릴”은 전체적으로 또는 부분적으로 불포화된 치환 또는 비치환된 모노사이클릭 또는 폴리사이클릭 탄소 고리를 의하며, 예컨대, 치환 또는 비치환된 페닐일 수 있다.
용어 "할로"는 주기율표에서 17족에 속하는 원소들의 1가 작용기를 의미하며, 예컨대 플루오로, 클로로, 브로모 또는 아이오도일 수 있다.
화학식 1에서 R 1은 C1 내지 C3의 알킬 또는 페닐일 수 있다.
화학식 1에서 R 1은 메틸, 에틸 또는 페닐일 수 있다.
화학식 1에서 R 2 및 R 3은 각각 독립적으로 H 또는 할로일 수 있다.
화학식 1에서 R 2 및 R 3은 각각 독립적으로 H 또는 클로로일 수 있다.
화학식 1에서 R 1은 C1 내지 C3의 알킬이고, 상기 R 2는 할로이고, 상기 R 3은 H일 수 있다.
일 구현예에 따르면, 화학식 1에서 R 1은 에틸이고, R 2--는 클로로이고, R 3은 H일 수 있다.
일 구현예에 따르면, 화학식 1에서 R 1은 메틸이고, R 2--는 클로로이고, R 3은 H일 수 있다.
화학식 1에서 R 1은 페닐이고, 상기 R 2는 H 이고, 상기 R 3은 할로일 수 있다.
일 구현예에 따르면, 화학식 1에서 R 1은 페닐이고, R 2--는 H이고, R 3은 클로로일 수 있다.
화학식 1로 표시되는 화합물은 하기 화학식 2 내지 화학식 4로 표시되는 화합물로 이루어진 군에서 선택된 것일 수 있다.
[화학식 2]
Figure PCTKR2020009246-appb-img-000010
[화학식 3]
Figure PCTKR2020009246-appb-img-000011
[화학식 4]
Figure PCTKR2020009246-appb-img-000012
.
일 구현예에 따르면, 화학식 2 내지 화학식 4로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 포함하는 포함하는 골질환 예방 또는 치료용 약학 조성물을 제공할 수 있다.
용어 "약학적으로 허용 가능한"은 화합물 또는 조성물이 투여되는 개체, 세포, 조직 등에 심각한 자극을 유발하지 않고 화합물의 생물학적 활성과 물성들을 손상시키지 않는 특성을 나타내는 것을 의미한다.
약학적으로 허용 가능한 염은 예를 들어 산 부가염, 염기 부가염 또는 금속염일 수 있다.
산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 형성될 수 있다. 이러한 약학적으로 무독한 염은 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트, 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피을레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴- 1,4-디오에이트, 핵산-1，6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 를투엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β_하이드톡시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함할 수 있다. 예를 들어, 화학식 1로 표시되는 화합물의 산 부가염은 화합물을 과량의 산 수용액 중에 용해시키고, 염을 수화성 유기 용매, 예컨대 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜 수득할 수 있다.
금속염은 나트륨, 칼륨 또는 칼슘염일 수 있다. 금속염은 염기를 사용하여 제조할 수 있으며, 예를 들어, 알칼리 금속 또는 알칼리 토금속 염은 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고 여액을 증발 및/또는 건조시켜 수득할 수 있다.
화학식 1 로 표시되는 화합물 및 이의 약학적으로 허용 가능한 염은 파골세포 분화 억제 효과를 나타낼 수 있다.
화학식 2 내지 로 표시되는 화합물, 및 이들의 약학적으로 허용 가능한 염은 파골세포 분화 억제 효과를 나타낼 수 있다.
용어 "예방"은 골질환을 억제시키거나 또는 지연시키는 모든 행위를 말한다.
용어 "치료"는 골질환의 의심 및 발병 개체의 증상이 호전 되거나 이롭게 변경되는 모든 행위를 말한다.
본 발명 조성물에 포함되는 화학식 1 내지 화학식 4로 표시되는 화합물은 천연으로부터 유래될 수도 있고, 공지의 화학적 합성 방법을 이용하여 합성될 수도 있다.
본 발명의 약학 조성물에 의해 예방 또는 치료될 수 있는 골질환은 조골세포와 파골세포의 활성 불균형에 의해 유발되는 것 일 수 있다.
뼈는 살아 있는 조직이기 때문에 오래된 뼈는 일정하게 파괴되고 다시 새로운 뼈를 만들어내는 재형성 과정을 거친다. 이러한 과정 중에서 파골세포는 오래되어 불필요하게 된 뼈 조직을 파괴하여 칼슘이 혈류로 방출되어 신체기능을 유지할 수 있도록 도와주고, 조골세포는 파괴된 뼈를 다시 재생시키는 역할을 한다. 이 작용은 하루 24시간 계속 일어나며 1년에 성인의 뼈의 약 10 % 내지 30%가 이런 식으로 다시 만들어진다. 따라서 파골세포와 조골세포 간의 균형은 매우 중요하며, 이러한 균형은 여러 호르몬과 기타 몸의 화학 성분 등에 의해 조절된다.
구체적으로, 골질환은 파골세포 과분화 또는 조골세포 활성 감소에 의한 것일 수 있으며, 구체적으로는 골질환은 파골세포 과분화에 의한 것일 수 있다.
파골세포가 과분화되면 파골세포가 비정상적으로 증가하여 과도한 골 흡수가 나타나, 골 밀도가 낮아질 수 있으며, 예를 들어, 골다공증, 골연화증, 골감소증, 골위축, 치주염 등 다양한 질환이 나타날 수 있다.
골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 또는 무혈성대퇴골괴사, 골결손, 골절 골다공증성 골절, 당뇨병성 골절, 불유합골절, 골형성 부전증, 골연화증성 골절, 골형성 장애, 퇴행성 골질환, 부정교합, 골 유합장애, 가관절증, 골 괴사, 골 관절염, 골종양, 골암 등일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 또는 무혈성대퇴골괴사 일 수 있으나, 이에 제한되지 않는다.
치주염은 치근단 세균감염에 대한 면역세포의 방어작용에 의한 염증반응이다. 치주염에 주로 관여하는 호중구는 염증매개물질인 프로스타글란딘을 분비한다. 프로스타글란딘 등의 세포신호전달 물질에 의해 골조직을 흡수하는 파골세포가 활성화되어 염증부위 주변의 치조골 소실이 관찰된다. 또한, 만성 치주염은 지속적인 치주근단 부분의 염증 및 치조골 부식을 나타내는 데, 치주염이 악화되어 치아를 살릴 수 없는 경우 발치를 하고 임플란트를 시행한다. 이를 예방하기 위해 치주염 초기단계에서 감염을 일으키는 세포수 감소를 위한 항생제 투여 및 염증매개물질에 의한 파골세포 활성화를 극복할 수 있는 파골세포 억제제를 투여하여 만성치주염의 완화 및 치료를 기대할 수 있다. 본 발명 골질환의 예방 또는 치료용 약학 조성물은 골흡수 억제의 효과를 통해 치주염의 예방 또는 치료에 이용될 수 있다.
본 발명 약학 조성물은 공지된 골질환 치료 물질과 함께 혼합하여 제공될 수도 있다.
본 발명 약학 조성물은 공지된 골질환의 예방 또는 치료 물질과 병용 투여될 수 있다.
용어 "투여"란 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미하며, 용어 "개체"란 골질환이 발병하였거나 발병할 수 있는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 동물을 의미한다. 구체적인 예로, 인간을 포함한 포유동물일 수 있다.
필요에 따라, 본 발명 약학 조성물은 공지의 항골질환 화합물을 추가적으로 포함할 수 있다.
이러한 항골질환 화합물로는 신코닌, 갈색거저리 추출물, 알로에-이모딘 및 오메가-3 지방산, 아르테아뉴인 B, 인돌-2-카르복실레이트 유도체, 유포비아 인자 L1, 스컬캅플라본 유도체, 프락시넬론 등을 들 수 있으나, 이에 제한되는 것은 아니다.
본 발명 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태일 수 있다.
본 발명 약학 조성물은 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 주사제의 형태로 제형화하여 사용될 수 있다.
본 발명 약학 조성물은 유효성분을 단독으로 포함하거나, 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 더 포함할 수 있다.
본 발명 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용 가능한 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등일 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다.
본 발명 약학 조성물의 제형은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있으며, 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조될 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조될 수 있다. 또한, 본 발명 약학 조성물의 제형은 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제조될 수 있다.
제제화를 위한 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 또는 방부제 등일 수 있다.
본 발명 약학 조성물의 투여 경로는 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장일 수 있으며, 이에 제한되지 않는다.
본 발명 약학 조성물은 경구 또는 비경구로 투여될 수 있으며, 비경구 투여 시 피부 외용 또는 복강내주사, 직장내주사, 피하주사, 정맥주사, 근육내 주사 또는 흉부내 주사 주입방식이 선택될 수 있다.
본 발명의 약학 조성물의 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
예를 들어, 본 발명 약학 조성물은 1일 0.0001 mg 내지 1000mg/kg 또는 0.001mg 내지 500mg/kg으로 투여될 수 있다. 본 발명 약학 조성물의 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다.
또한, 본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 포함하는 골질환 예방 또는 개선용 건강기능식품을 제공한다:
[화학식 1]
Figure PCTKR2020009246-appb-img-000013
상기 화학식 1에서,
R 1은 C1 내지 C3의 알킬 또는 페닐이고;
R 2 및 R 3는 각각 독립적으로 H 또는 할로일 수 있다.
일 구현예에 따르면, 화학식 2 내지 4로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 포함하는 골질환 예방 또는 개선용 건강기능식품을 제공할 수 있다.
화학식 1 내지 4로 표시되는 화합물 및 골질환에 대해서는 전술한 바 있어 구체적인 설명은 생략한다.
본 발명 건강기능식품은 담체, 희석제, 부형제 및 첨가제 중 하나 이상을 더 포함하여 정제, 환제, 산제, 과립제, 분말제, 캡슐제 및 액제 제형으로 이루어진 군에서 선택된 하나로 제형될 수 있다.
건강기능식품은 예컨대, 각종 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차, 비타민 복합제, 또는 건강기능성 식품류일 수 있다.
건강기능식품에 포함될 수 있는 첨가제는 천연 탄수화물, 향미제, 영양제, 비타민, 광물(전해질), 풍미제(합성 풍미제, 천연 풍미제 등), 착색제, 충진제(치즈, 초콜렛 등), 팩트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH조절제, 안정화제, 방부제, 산화 방지제, 글리세린, 알콜, 탄산화제 및 과육으로 이루어진 군으로부터 선택될 수 있다.
천연 탄수화물은 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상기 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다.
건강기능식품은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제, 천연 과일 쥬스 및 야채 음료의 제조를 위한 과육을 등을 더 포함할 수 있다.
담체, 부형제, 희석제 및 첨가제는 이에 한정되는 것은 아니나, 락토즈, 덱스트로즈, 슈크로즈, 솔비톨, 만니톨, 에리스리톨, 전분, 아카시아 고무, 인산칼슘, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리 케이트, 미세결정성 셀룰로즈, 폴리비닐피롤리돈, 셀룰로즈, 폴리비닐피롤리돈, 메틸셀룰로즈, 물, 설탕시럽, 메틸셀룰로즈, 메틸 하이드록시 벤조에이트, 프로필하이드록시 벤조에이트, 활석, 스테아트산 마그네슘 및 미네랄 오일로 이루어진 군에서 선택될 수 있다.
본 발명 건강기능식품을 제제화할 경우에는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
이하, 본 발명을 구체적으로 설명하기 위해 아래 실시예로 보다 상세하게 설명한다.
아래 실시예의 35D35는 상기 화학식 2(2-(2-chlorophenoxy)-N-[2-(4-propionyl-1-piperazinyl)phenyl]acetamide)로 표시되는 화합물이고, 35D5는 상기 화학식 3으로 표시되는 화합물이고, 35D3은 N-(2-(4-acetylpiperazin-1-yl)phenyl)-2-(2-chlorophenoxy)acetamide이고, 35D8은 2-(4-chlorophenoxy)-N-(2-(4-methylpiperazin-1-yl)phenyl)acetamide이고, 35D3(또는 PPOA)은 상기 화학식 4로 표시되는 화합물이다.
세포독성 평가를 위한 MTT 분석
전구파골세포(preosteoclast)에 35D35 또는 35D3(=PPOA)(1~10uM)를 처리한 후 세포생존능을 평가했다. 96 well plate에 well당 1x10 4개의 세포를 넣고, 오직 MCSF(30ng/mL)와 PPOA만을 제시된 농도 조건하에서 날짜별로 배양했다. 이 후 세포생존능 분석 시약(DoGen, EZ-3000)을 배지 용량의 1/10 로 처리한 후 37℃에 30분간 배양하고 450nM에서 확인했다. 35D35 화합물 및 PPOA를 이용해 세포독성을 확인한 결과, 10uM 농도를 처리한 경우에도 세포사멸 효과를 나타내지 않았다(도 3 및 도 15참조). 즉, 세포독성은 없는 것으로 확인되었다.
파골세포 분화억제 효과 확인
1. 화학식 2 및 3으로 표시되는 화합물의 파골세포 분화억제 효과
1) 마우스 골수세포의 분리 및 파골세포의 분화
10주령 암컷 마우스의 골수(bone marrow)를 관골(hip bone), 넙다리뼈 (femur) 및 정강뼈(tibia)에서 분리하여 대식세포콜로니자극인자 (Macrophage Colony Stimulating Factor, M-CSF, PeproTech, 315-02, 30ng/ml)가 포함된 α-MEM 배지 (Gibco, 12561-056, 10% fetal bovine serum, 1% penicillin/streptomycin)에서 3 일 동안 배양하여 단핵세포(monocyte)만을 분리하였다. 분리한 단핵세포에 RANKL(Receptor Activator of Nuclear factor kappa B ligand, PeproTech, 315-11, 50ng/ml)을 처리하여 파골세포 분화를 유도하였다. RANKL 처리시 각 화합물(35D35, 35D5, 35D3, 35D8)들을 처리하여 3일 또는 5일 동안 배양해 파골세포 분화 정도를 확인하였다.
2) TRAP 염색 및 분석을 통한 파골세포 분화억제능 확인
마우스 골수에서 분리한 단핵세포 l x 10 4개를 96 well plate에 넣고 RANKL과 각 화합물(35D35, 35D5, 35D3, 35D8)을 함께 처리하여 각 화합물이 파골세포 분화능에 미치는 영향을 확인하였다. TRAP activity assay kit (Cosmo Bio, PMC-AK04F-COS)를 사용하여 파골세포 분화시 발현이 증가하는 Tartrate-resistant acid phosphatase(TRAP)의 활성을 확인하였다. TRAP staining으로 파골세포 분화 정도를 확인한 결과, 다른 유도체 대비 35D35, 35D5 및 35D3 화합물이 보다 우수한 파골세포 분화억제 효과를 나타내었다(도 1 참조). 염색 후 현미경으로 파골세포 분화 시 형성되는 다핵 세포를 확인하였으며, 각 well을 사진으로 찍어 이를 Image J software를 이용하여 전체 면적당 분화면적비율을 나타내었다. 그 결과 35D35 화합물은 0.5uM의 농도에서 효과적인 파골세포 분화 억제능을 나타내었다(도 2 참조).
또한, 파골세포 생성억제능이 우수한 35D35 화합물이 파골세포 분화 시기 별 미치는 영향을 확인하였다. 구체적으로, BMM을 5개 그룹(Ctrl, Period I 내지 IV)으로 나누었고, 30ng/mL M-CSF 와 50ng/mL RANKL를 함유하는 배양배지에서 4일동안 배양하였다. Period I 내지 IV 그룹의 BMM을 각각 다른 날짜에 24시간 동안 1 μM 35D35 에 노출시켰다. 4일 후 각 그룹의 셀을 고정하였고, TRAP 염색을 수행한 후 파골세포 존재를 확인하였다. 그 결과, 35D35 화합물을 처리한 그룹에서 초기 24시간 동안 파골세포 분화가 억제됨을 확인할 수 있었다(도 4 참조, "M+R"은 M-CSF+RANKL 처리를 의미한다.).
위 결과들로부터, 35D35, 35D5, D35D3 화합물은 우수한 파골세포 분화 억제효과를 나타내며, 특히 파골세포의 분화 초기에 영향을 미친다는 것을 확인하였다.
3) 골흡수 저해능 평가
분화된 파골세포의 활성을 확인하기 위해 F-actin ring 형성능 (formation)을 측정하였다. 구체적으로, 화합물을 포함(35D3: 6μM, 35D5 및 35D35: 2μM)하거나 포함하지 않은 12mm 커버 글라스에 BMM을 시딩하고, M-CSF와 LANKL를 처리하였다. 대조군에서 파골세포가 형성된 후, 4.0% 파라포름알데히드에서 15분간 파골세포를 고정한 후, 5% FBS에서 배양하여 약 60분 동안 블로킹하였다. PBS를 사용하여 세척한 후 각 웰에 로다민이 컨쥬게이션된 팔로이딘(rhodamine-conjugated phalloidin)(1:40)을 첨가하여 F-액틴 벨트를 시각화하였다. 20분 후, DAPI(1:5000) 용액을 5분 동안 세포와 함께 배양하였다. PBS로 3회 세척한 후 형광 현미경을 사용하여 세포들을 관찰하였다. 그 결과, 35D35, 35D5 및 35D3은 우수한 RANKL-유도 F-actin 벨트 형성 억제 효과를 나타내었다(도 5 참조, scale bar=200μm, "Con" = M-CSF+RANKL 처리군).
또한, 우수한 F-actin 벨트 형성 억제 효과를 나타내는 35D35 화합물을 다양한 농도로 처리하여 F-actin ring 형성능을 확인한 결과, 35D35 0.5uM을 처리한 세포에서 F-actin ring 형성능이 50%이상 감소하는 것을 확인하였다(도 6 참조, scale bar=200μm, "Con" = M-CSF+RANKL 처리군, "M" = M-CSF 처리군). F-actin 크기는 Image J를 이용하여 측정하였다.
아울러, Bone resorption assay kit(Cosmo Bio,CSR-BRA)를 사용하여 35D35의 골 흡수능을 측정하였다. 구체적으로, BMM을 플루오레세아민(fluoresceinamine) 표지된 칼슘인산염 플레이트에 시딩하고 35D35를 다양한 용량으로 처리하였다. 6일 후, 형광판독기를 사용하여 485nm와 535nm의 흡수 파장과 방출 파장에서 형광 강도를 측정하였다. Image J를 이용하여 재흡수 Pit area를 계산하였다. 그 결과, 화합물을 처리하지 않은 대조군 세포(Ctrl)에 비해 35D35 0.5uM을 처리한 세포에서 골 흡수능이 대략 10% 저하 되는 것을 확인할 수 있었다(도 7 참조, scale bar=200μm, "Con" = M-CSF+RANKL 처리군, "M" = M-CSF 처리군).
4) 파골세포 분화 관련 전사인자의 발현감소 확인
파골세포 특이적 유전자의 발현 정도를 확인하기 위해, 35D35(1μM) 및 35D3(6μM) 화합물이 처리된 세포에서 RT-PCR로 mRNA 발현량을 측정하였다. RNA extraction kit를 이용해 파골세포로 분화한 세포로부터 RNA를 분리하고 spectrophotometer로 정량한 0.5ug의 RNA를 역전사 효소(Takara, RR037 A)를 이용해 cDNA를 합성하였다. QuantStudio 3 real- time PCR system(Applied Biosystems)으로 합성된 cDNA를 이용해 qRT-PCR을 수행하였다. cell lysates를 처리한 후, 항-Ctsk 항체로 면역블롯팅을 수행하였다. 로딩 컨트롤로 β-actin을 사용하였다.
qRT-PCR에 사용된 프라이머는 하기 표 1과 같다:
프라이머 명칭 서열 서열번호
NFATc1 Forward primer CCCGTCACATTCTGGTCCAT 서열번호 1
NFATc1 Reverse primer CAAGTAACCGTGTAGCTCCACAA 서열번호 2
CatK Forward primer GGACGCAGCGATGCTAACTAA 서열번호 3
CatK Reverse primer CAGAGAGAAGGGAAGTAGAGTTGTCACT 서열번호 4
c-Fos Forward primer CGAAGGGAACGGAATAAGATG 서열번호 5
c- Fos Reverse primer GCTGCCAAAATAAACTCCAG 서열번호 6
DC-STAMP Forward primer GGGAGTCCTGCACCATATGG 서열번호 7
DC-STAMP Reverse primer AGGCCAGTGCTGACTAGGATGA 서열번호 8
OC-STAMP Forward primer CAGAGTGACCACCTGAACAAACA 서열번호 9
OC-STAMP Reverse primer TGCCTGAGGTCCCTGTGACT 서열번호 10
TRAF6 Forward primer AAAGCGAGAGATTCTTTCCCTG 서열번호 11
TRAF6 Reverse primer ACTGGGGACAATTCACTAGAGC 서열번호 12
RT-PCR 수행결과, 35D35를 처리하지 않은 대조군(Ctrl)에 비해 35D35를 처리한 그룹에서 파골세포 특이적 유전자인 AcP5(TRAP), NFATc1, DC-STAMP, ATP6v0d2, MMP9 및 CTSK의 mRNA 발현양이 감소하였다(도 8 참조, "M" = M-CSF 처리군). 도 8의 그래프는 Day 0에서 컨트롤의 발현량으로 전사 정도를 정규화한 것이다. 특히, 35D3 화합물을 처리한 경우에 비해 35D35 화합물을 처리한 경우 Ctsk 단백질 발현을 낮은 농도에서도 강하게 억제하는 것을 확인하였다(도 9 참조,). 이를 통해 35D3 화합물에 비해 35D35는 보다 적은 양으로도 파골세포의 분화를 억제함으로써 효과적인 골 대사 억제제로서 기능할 수 있을 것이다.
2. 화학식 4로 표시되는 화합물의 파골세포 분화억제 효과
1) 마우스 골수 세포의 분리 및 파골세포의 분화
12주령 암컷 마우스의 골수(bone marrow)를 관골(hip bone), 넙다리뼈(femur) 및 정강뼈(tibia)에서 분리하여 대식세포 콜로니자극인자 (Macrophage Colony Stimulating Factor, M-CSF, PeproTech, cat# 315-02, 30ng/ml)가 포함된 α-MEM 배지(Gibco, 12561-056, 10% fetal bovine serum, 1% penicillin/streptomycin)에서 3일 동안 배양하여 단핵세포(monocyte)만을 분리하였다. 분리한 단핵세포에 RANKL(PeproTech, cat# 315-11, 50ng/ml)을 처리하여 파골세포 분화를 유도하였다. 여기에 35D3(PPOA)을 함께 처리하여 3일 또는 5일 동안 배양하였다.
2) TRAP 염색 및 분석을 통한 파골세포 분화억제능 확인
마우스 골수에서 분리한 단핵세포 1x10 4 개를 96 well plate에 넣고 RANKL과 함께 처리하여 35D3(PPOA)(3μM)가 파골세포 분화능에 미치는 영향을 확인했다. 파골세포 분화시 발현이 증가하는 Tartrate-resistant acid phosphatase(TRAP)의 활성을 TRAP activity assay kit(Sigma-Aldrich, 387A-1kt)를 사용하여 확인하였으며, 이는 도 16에 나타냈다.
염색 후 현미경으로 파골세포 분화시 형성되는 다핵 세포를 현미경으로 확인하고, well당 12 장의 이미지를 찍어 다시 하나의 well 이미지로 합친 뒤 이를 Image J software를 이용하여 전체 면적 당 분화면적비율을 확인하였다. 전체 면적 당 분화면적비율을 도 17A에 나타나내었고, TRAP 양성 세포 (핵 번호> 3)의 면적을 DMSO (100 %)와 비교하여 상대 값으로 제시하였다.
또한 분화된 파골세포수의 개수를 세어 확인했고, 이를 도 17B에 나타내었고, 분화된 파골세포 안에 내재된 세포핵의 개수가 3-5개, 6-10개, 11-20개, 21개 이상인 파골세포를 구분하여 도 17C에 나타내었다.
도 16 및 도 17을 참조하면, 본 발명 화합물을 처리시에 정상적으로 파골세포를 분화시킨 그룹에 비해 분화면적, 파골세포의 수, 거대다핵세포 모두 유의하게 줄어든 것을 확인할 수 있었다. 이들 결과를 통해 35D3(PPOA)의 파골세포 분화 억제능을 확인할 수 있다.
3) 액틴-고리 형성 억제 및 골 흡수 저해 효과 확인
분화된 파골세포의 활성을 측정하기 위해 F-actin 염색을 통해 다핵 세포로의 분화능을 확인하였다. L-Lysine이 코팅된 유리(Corning, 354085)를 넣은 24 well plate에 마우스 골수 세포를 well당 5x10 4개를 넣고 동시에 35D3(PPOA) 6uM을 처리해 4 내지 5일동안 배양하였다. 분화된 세포를 4% formaldehyde를 이용해 10분간 고정하고, PBS로 세척하였다. 항원-항체 반응을 위해 0.1% Triton-PBS에 20분간 반응 시킨 후, 1% BSA로 1시간 동안 반응시켰다. F-actin 항체(Thermo Fisher Scientific, A12379)를 1시간 동안 반응 시킨 후 세척하였다. DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate, Thermo Fisher Scientific, D3571) 염색을 통해 세포 핵을 염색한 후 현미경으로 사진을 찍었다. 그 결과, 35D3(PPOA) 처리 유무에 따라 F-actin의 크기가 다른 것을 확인할 수 있었다(도 18을 참조). 이를 통해 35D3(PPOA)가 다핵 세포로의 분화를 억제할 수 있음을 알 수 있었다.
또한, Bone resorption assay kit (Cosmo Bio,CSR-BRA)를 사용하여 골 흡수능을 확인하였다. 마우스 골수 세포를 30 ng/Ml의 M-CSF를 함유한 bone resorption assay plate 48 (2 × 10 4 cells/well) 에 시딩하였다. 24 시간 후, 성숙한 파골 세포가 형성 될 때까지 마우스 골수 세포에 M-CSF 30 ng/mL 및 RANKL 100 ng/mL 자극하에 6μM 35D3(PPOA)를 처리하거나 처리하지 않았다. 다음날 세포에서 배양 상등액을 96-well black polypropylene micro-well plate (Thermo Fisher Scientific Nunc, Waltham, MD, USA)에 수거하였다. 0.1 N NaOH 50μL를 혼합 한 후, fluorescence plate reader (Molecular Devices, San Jose, CA, USA - model: SpectraMax i3x)로 형광 강도를 측정 하였고; excitation 및 emission wavelenghts는 각각 485 nm 및 535 nm였다. 흡수 영역은 ImageJ software (https://imagej.nih.gov/ij)를 사용하여 10 배로 촬영 한 well 당 무작위로 선택된 10 개의 사진을 고려하여 계산하였다.
도 19A는 광학 현미경을 사용하여 골 흡수 영역을 시각화한 것을 나타낸다. 도 19B는 485nm의 excitation wavelength 및 535nm의 emission wavelength에서 측정된 형광 강도를 나타낸다. 도 19C는 골 흡수 pits area를 계산한 결과를 나타낸다. 골 흡수 면적의 비율은 3, 6, 10 μM의 35D3(PPOA)에 노출 된 후에 유의한 감소를 보였다.
조골세포 분화 여부 효과 확인
생후 3 일령의 C57BL/6J mouse calvaria에서 세포를 채취하여 96 well plate 에 well 당 4x10 3 cell을 시딩한 후 분화 유도인자인 hBMP2를 100ng/ml 처리하였다. 분화 유도인자 처리와 동시에 35D35 화합물을 처리하여 7일간 배양한 후 ALP 염색을 통해 분화 영향성을 평가하였다. 구체적인 실험 방법 및 결과는 아래와 같다.
1) 마우스 두개골 세포의 분리 및 조골세포의 분화
마우스의 두개골에서 분리한 전구세포 (precursor cells)에 hBMP2 (Bone morphogenic protein 2, Sino biological, 10426- HNAE, 100ng/ml)를 처리하여 조골세포로의 분화를 유도하였다. 조골세포 특이적 단백질인 alkaline phosphatase(ALP) 염색을 통해 분화된 조골세포를 구분할 수 있다. 전구세포에 hBMP2를 처리할 때 35D35 화합물 각각을 함께 처리하며, 2~3 일마다 배지를 갈아주면서 7 일간 배양하였다.
2) 조골세포의 분화능 분석을 위한 ALP(alkaine phosphatase) 염색
조골세포 전구세포 4x10 3개를 96 well plate에 넣고 hBMP2를 처리하여 조골세포의 분화를 유도하였다. 이 때 35D35를 처리하여 7 일 동안 배양하였다.
조골세포 분화능 분석을 위해 조골세포 초기 분화단계에서 발현이 증가하는 ALP의 활성을 확인하기 위해 분화 유도 7 일 후 배지를 버리고, HBSS (Hanks’ Balanced Salt Solution, welgene)로 한 번 세척한 후 차가운 70% 에탄올을 넣고 1 시간 동안 세포를 고정하였다. 에탄올을 버리고 HBSS로 세척한 후 NBT solution(Sigma, B1911)을 well 당 l00μl 넣고 15분 동안 염색하였다. 물로 2번 세척하여 남아있는 염색약을 제거하였다. ALP 염색 후 그 발색 정도를 Image J software를 이용하여 측정한 뒤 그래프로 나타내어 비교하였다. 그 결과 35D35는 조골세포에 대해 영향을 미치지 않는 것을 확인하였다 (도 10 참조). 도 10은 ALP 염색을 통해 35D35 화합물에 의한 조골세포 분화능을 확인한 결과를 나타낸다. 도 10A는 ALP 염색을 통해 분화된 조골세포를 확인한 결과를 나타내며, 도 10B는 ALP 강도 그래프를 나타낸다("Con" = BMP2 단독 처리군),
생체 내 효과 확인
8주령 암컷 마우스에서 난소적제술을 시행해 에스트로겐 부족으로 인한 골다공증 동물 모델(OVX, ovariectomized mouse)을 제작하였다. 골다공증 마우스 모델에 화합물(35D35, 35D5, 35D3)을 2일에 한 번씩 복강 내 주사 하였다. 4주 후에 마우스의 정강뼈(tibia)를 마이크로 컴퓨터 단층촬영으로 골 밀도를 분석하였다. 그 결과, 35D3 화합물을 주사한 OVX 모델에서는 대조군(OVX) 보다 높은 골 밀도와 뼈 볼륨이 관측 되지 않은 반면, 35D35 및 35D5 화합물을 주사한 OVX 모델에서 대조군(OVX) 보다 높은 골 밀도와 뼈 볼륨이 관측 되었다(도 11 내지 14참조).
도 11 내지 14는 마우스 모델의 정강뼈를 마이크로 컴퓨터 단층 촬영 결과와(Sham: 난소가 제거되지 않은 대조군), 마이크로 컴퓨터 단층촬영 결과를 분석한 그래프를 나타낸다(* P <0.05, ** P <0.01, and *** P < 0.001 vs. the control group, OVX. BMD: trabecular bone mineral density).
전술한 실험 결과들을 통해, 본 발명 화합물(35D35, 35D5, 35D3)은 우수한 파골세포의 분화 억제 효과를 나타낼 수 있는 반면, 조골세포 분화에는 영향을 주지 않는 것을 확인하였다. 또한, 분자생물학적 실험을 통해 화합물이 NFATc1를 포함하는 파골세포 관련 유전자의 발현을 저해함으로써 파골세포 관련 유전자의 발현을 저해하는 것을 예측할 수 있었다. 아울러, 난소적출 골다공증 마우스 모델에 화합물을 처리(35D35, 35D5)한 경우 우수한 골 흡수능 억제를 나타냈다. 이처럼, 본 발명 화합물은 우수한 파골세포 분화억제 효과를 나타냄으로써 효과적인 골 대사 억제제로서 기능할 수 있을 것이다.

Claims (10)

  1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 포함하는 파골세포 과분화로 유발되는 골질환 예방 또는 치료용 약학 조성물:
    [화학식 1]
    Figure PCTKR2020009246-appb-img-000014
    상기 화학식 1에서,
    R 1은 C1 내지 C3의 알킬 또는 페닐이고;
    R 2 및 R 3는 각각 독립적으로 H 또는 할로임.
  2. 청구항 1에 있어서, 상기 R 1은 메틸, 에틸 또는 페닐인, 골질환 예방 또는 치료용 약학 조성물.
  3. 청구항 1에 있어서, 상기 R 1은 C1 내지 C3의 알킬이고, 상기 R 2는 할로이고, 상기 R 3은 H이거나; R 1은 페닐이고, 상기 R 2는 H 이고, 상기 R 3은 할로인, 골질환 예방 또는 치료용 약학 조성물.
  4. 청구항 1에 있어서, 상기 화학식 1로 표시되는 화합물은 하기 화학식 2 내지 화학식 4로 표시되는 화합물인, 골질환 예방 또는 치료용 약학 조성물:
    [화학식 2]
    Figure PCTKR2020009246-appb-img-000015
    [화학식 3]
    Figure PCTKR2020009246-appb-img-000016
    [화학식 4]
    Figure PCTKR2020009246-appb-img-000017
    .
  5. 청구항 1에 있어서, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택된 적어도 하나인, 골질환 예방 또는 치료용 약학 조성물.
  6. 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 포함하는 파골세포 과분화로 유발되는 골질환 예방 또는 개선용 건강기능식품:
    [화학식 1]
    Figure PCTKR2020009246-appb-img-000018
    상기 화학식 1에서,
    R 1은 C1 내지 C3의 알킬 또는 페닐이고;
    R 2 및 R 3는 각각 독립적으로 H 또는 할로임.
  7. 청구항 6에 있어서, 상기 R 1은 메틸, 에틸 또는 페닐인, 골질환 예방 또는 개선용 건강기능식품.
  8. 청구항 6에 있어서, 상기 R 1은 C1 내지 C3의 알킬이고, 상기 R 2는 할로이고, 상기 R 3은 H이거나; R 1은 페닐이고, 상기 R 2는 H 이고, 상기 R 3은 할로인, 골질환 예방 또는 개선용 건강기능식품.
  9. 청구항 6에 있어서, 상기 화학식 1로 표시되는 화합물은 하기 화학식 2 내지 화학식 4로 표시되는 화합물인, 골질환 예방 또는 개선용 건강기능식품:
    [화학식 2]
    Figure PCTKR2020009246-appb-img-000019
    [화학식 3]
    Figure PCTKR2020009246-appb-img-000020
    [화학식 4]
    Figure PCTKR2020009246-appb-img-000021
    .
  10. 청구항 6에 있어서, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택된 적어도 하나인, 골질환 예방 또는 개선용 건강기능식품.
PCT/KR2020/009246 2019-07-15 2020-07-14 골질환 예방 또는 치료용 약학 조성물 WO2021010728A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/627,912 US20220274935A1 (en) 2019-07-15 2020-07-14 Pharmaceutical composition for preventing or treating bone diseases
EP20841440.9A EP4000622A4 (en) 2019-07-15 2020-07-14 PHARMACEUTICAL COMPOSITION FOR THE PREVENTION OR TREATMENT OF BONE DISEASES

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2019-0084955 2019-07-15
KR1020190084955A KR102096793B1 (ko) 2019-07-15 2019-07-15 골질환의 예방 또는 치료용 의약 조성물
KR10-2020-0086332 2020-07-13
KR1020200086332A KR102466565B1 (ko) 2020-07-13 2020-07-13 골질환 예방 또는 치료용 약학 조성물

Publications (1)

Publication Number Publication Date
WO2021010728A1 true WO2021010728A1 (ko) 2021-01-21

Family

ID=74209916

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/009246 WO2021010728A1 (ko) 2019-07-15 2020-07-14 골질환 예방 또는 치료용 약학 조성물

Country Status (3)

Country Link
US (1) US20220274935A1 (ko)
EP (1) EP4000622A4 (ko)
WO (1) WO2021010728A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002030927A1 (fr) * 2000-10-10 2002-04-18 Pierre Fabre Medicament Derives d'aminophenyle piperazine ou d'amino phenyle piperidine inhibiteurs de proteines prenyl transferase
KR101809151B1 (ko) * 2013-07-18 2017-12-15 (주)앗코스텍 키레놀 또는 희첨 추출물을 포함하는 골다공증 예방, 개선 또는 치료용 조성물
KR20180028017A (ko) * 2016-09-07 2018-03-15 연세대학교 산학협력단 골질환의 예방 또는 치료용 약학 조성물
KR20180046392A (ko) * 2018-01-18 2018-05-08 다인바이오 주식회사 네오아가로올리고당을 포함하는 관절염 예방, 개선 또는 치료용 조성물
KR101902832B1 (ko) * 2018-05-31 2018-10-01 전남대학교산학협력단 조골 및 파골 세포의 분화 억제용 조성물 및 골질환의 예방 또는 치료용 의약 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002030927A1 (fr) * 2000-10-10 2002-04-18 Pierre Fabre Medicament Derives d'aminophenyle piperazine ou d'amino phenyle piperidine inhibiteurs de proteines prenyl transferase
KR101809151B1 (ko) * 2013-07-18 2017-12-15 (주)앗코스텍 키레놀 또는 희첨 추출물을 포함하는 골다공증 예방, 개선 또는 치료용 조성물
KR20180028017A (ko) * 2016-09-07 2018-03-15 연세대학교 산학협력단 골질환의 예방 또는 치료용 약학 조성물
KR20180046392A (ko) * 2018-01-18 2018-05-08 다인바이오 주식회사 네오아가로올리고당을 포함하는 관절염 예방, 개선 또는 치료용 조성물
KR101902832B1 (ko) * 2018-05-31 2018-10-01 전남대학교산학협력단 조골 및 파골 세포의 분화 억제용 조성물 및 골질환의 예방 또는 치료용 의약 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4000622A4 *

Also Published As

Publication number Publication date
EP4000622A4 (en) 2022-10-05
US20220274935A1 (en) 2022-09-01
EP4000622A1 (en) 2022-05-25

Similar Documents

Publication Publication Date Title
WO2017078499A2 (ko) 단백질 타이로신 탈인산화효소 억제제를 포함하는 신경염증성 질환의 예방 또는 치료용 조성물
WO2018182329A1 (ko) S1pr4를 타겟으로 하는 비알코올성 지방간염 예방 또는 치료용 조성물
WO2021010715A1 (ko) 골질환 예방 또는 치료용 약학 조성물
WO2018194309A1 (ko) 인디루빈 유도체를 유효성분으로 포함하는 약학 조성물
WO2019226015A1 (ko) 가공인삼추출물을 포함하는 근육 분화 촉진용 조성물
WO2019093673A2 (ko) 골질환 예방 또는 치료용 약학 조성물
WO2019231220A1 (ko) 2,3,5-치환된 싸이오펜 화합물의 유방암 예방, 개선 또는 치료 용도
WO2020141828A2 (en) Anticancer compositions comprising immune checkpoint inhibitors
WO2021010728A1 (ko) 골질환 예방 또는 치료용 약학 조성물
WO2020184884A1 (ko) 비만 또는 지질 관련 대사성 질환의 예방 또는 치료용 조성물
WO2016133352A1 (ko) 아모디아퀸을 유효성분으로 함유하는 대사성 질환의 예방, 개선, 또는 치료용 조성물
WO2013022139A1 (en) Method for treatment of diseases caused by accumulation of beta-amyloids in brain parenchyma with low concentration thiazolidinedione derivatives
WO2015102205A1 (ko) 프로테아좀 저해제와 로페라마이드를 유효성분으로 함유하는 암질환 예방 또는 치료용 약학조성물
WO2011081383A2 (ko) 나프토퀴논계 화합물을 포함하는 난청의 치료 또는 예방을 위한 조성물
WO2021054510A1 (ko) 셀레노사마필린 a를 유효성분으로 포함하는 유방암 예방 및 치료용 조성물
WO2020032452A1 (ko) 금제제를 유효성분으로 포함하는 파골세포 분화 억제용 조성물
WO2023085820A2 (ko) 근육 질환의 예방 또는 치료용 약학적 조성물
WO2017014545A1 (ko) 멜라닌 응집 호르몬을 유효성분으로 포함하는 파킨슨병 치료 및 레보도파 부작용 억제용 약학 조성물
WO2021206498A1 (ko) 항코로나바이러스능을 가지는 플라보노이드 배당체
AU2019418259B2 (en) Anticancer compositions comprising immune checkpoint inhibitors
WO2024101890A1 (ko) 건강 추출물, 쇼가올 및 레보도파를 유효성분으로 포함하는 파킨슨병 또는 도파민 유발 이상운동증의 예방 또는 치료용 조성물
WO2021201507A1 (ko) 갈색거저리 유충 단백질 또는 이의 가수분해물을 유효성분으로 포함하는 근감소증의 예방, 개선 또는 치료용 조성물
WO2022025709A1 (ko) 2,3,5-치환된 싸이오펜 화합물의 위장관기질종양 예방, 개선 또는 치료 용도
WO2023059099A1 (ko) 에제티미브를 유효성분으로 포함하는 폐섬유증의 예방, 개선, 완화 또는 치료용 약학적 조성물
WO2023080553A1 (ko) 생리 활성을 갖는 펩타이드 및 그의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20841440

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020841440

Country of ref document: EP

Effective date: 20220215