WO2021006623A1 - 신규한 락토코커스 중앙젠시스 cau 1447 균주 - Google Patents

신규한 락토코커스 중앙젠시스 cau 1447 균주 Download PDF

Info

Publication number
WO2021006623A1
WO2021006623A1 PCT/KR2020/008940 KR2020008940W WO2021006623A1 WO 2021006623 A1 WO2021006623 A1 WO 2021006623A1 KR 2020008940 W KR2020008940 W KR 2020008940W WO 2021006623 A1 WO2021006623 A1 WO 2021006623A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
cau
culture
composition
liver
Prior art date
Application number
PCT/KR2020/008940
Other languages
English (en)
French (fr)
Inventor
김원용
Original Assignee
중앙대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 중앙대학교 산학협력단 filed Critical 중앙대학교 산학협력단
Publication of WO2021006623A1 publication Critical patent/WO2021006623A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23C—DAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C19/00—Cheese; Cheese preparations; Making thereof
    • A23C19/02—Making cheese curd
    • A23C19/032—Making cheese curd characterised by the use of specific microorganisms, or enzymes of microbial origin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23C—DAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; MAKING THEREOF
    • A23C19/00—Cheese; Cheese preparations; Making thereof
    • A23C19/02—Making cheese curd
    • A23C19/032—Making cheese curd characterised by the use of specific microorganisms, or enzymes of microbial origin
    • A23C19/0323—Making cheese curd characterised by the use of specific microorganisms, or enzymes of microbial origin using only lactic acid bacteria, e.g. Pediococcus and Leuconostoc species; Bifidobacteria; Microbial starters in general
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/065—Microorganisms
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/32—Foods, ingredients or supplements having a functional effect on health having an effect on the health of the digestive tract
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/334—Foods, ingredients or supplements having a functional effect on health treating the effects of consuming alcohol, narcotics or other addictive behavior, e.g. treating hangover or reducing blood alcohol levels
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/46—Streptococcus ; Enterococcus; Lactococcus

Definitions

  • the present invention relates to a novel Lactococcus central gensis CAU 1447 strain, and in more detail, Lactococcus central gensis ( Lactococcus chungangensis ) CAU 1447 (bacterial cycle accession number: KCTC 13873BP) strain or its culture, its liver protection, hangover relief, prevention and treatment (improvement) for alcoholic liver disease, including the above strain or culture as an active ingredient It is for intestinal agents, probiotics, feed compositions and fermented products.
  • Lactobacillus plays a role in making it an important nutrient component by decomposing fiber and complex proteins while coexisting in the human digestive system.In this way, it has a beneficial effect on the health of the host by improving the intestinal microbial environment of the host in the gastrointestinal tract of animals including humans.
  • the state collectively refers to living microorganisms and is called probiotics.
  • Probiotics Probiotics Lactobacillus are most effective when they can settle in the intestine and grow and inhabit.
  • the hangover you feel the next day after drinking alcohol is a cause of lowering your quality of life as well as your physical health.
  • the next day after drinking most people suffer from hangovers such as heartburn, vomiting, and severe headaches.
  • Only 2-10% of ethanol absorbed by drinking is excreted from the body through urine or breath through the kidneys or lungs, and more than 90% of the remaining ethanol is metabolized in the liver at a rapid rate.
  • Acetaldehyde the primary metabolite produced by oxidation of alcohol, is a major factor in hangovers, and the effect of hangovers by acetaldehyde is greater than alcohol itself through toxic effects in the body when ingesting alcohol.
  • Chronic alcohol intake causes fatty liver by accumulating triglycerides in the liver, and excessive nicotinamide adenine dinucleotide (NADH) is produced, resulting in the formation of NADH oxidase.
  • NADH nicotinamide adenine dinucleotide
  • Acetaldehyde introduced into the liver through the bloodstream is mainly used for fatty acid synthesis. Fatty acid oxidation is reduced and synthesis is increased to accumulate neutral lipids in the liver, which is the cause of fatty liver (Cho et al., 2001; Keshavarzian et al.
  • Alcoholic liver disease is caused by excessive alcohol consumption and is the leading cause of cirrhosis-related deaths and accounts for 0.9% of deaths worldwide. Excessive intake of alcohol and long-term intake not only damages the liver, but also destroys the mucous membranes of the small intestine associated with nutrient absorption, and changes the function of other organs, including the heart, brain, kidneys and liver. The onset of ALD is associated with alcohol metabolism in the liver, which affects a variety of pathways including free radical formation, sequential oxidative stress and inflammatory cytokine secretion pathways. Toll-like receptor-4 (TLR4) is an important functional receptor that plays a major role in the progression of ALD and is involved in NF-kB activation.
  • TLR4 Toll-like receptor-4
  • NF-kB affects proinflammatory cytokine signaling and related mechanisms, including the secretion of other inflammatory mediators such as cyclooxygenase-2 (COX-2) and iNOS (inducible nitric oxide synthase). .
  • COX-2 cyclooxygenase-2
  • iNOS inducible nitric oxide synthase
  • alcohol degrading enzyme ADH
  • aldehyde degrading enzyme ADH
  • ADH aldehyde degrading enzyme
  • the present inventors isolated a novel Lactococcus central gensis CAU 1447 strain (bacterial cycle accession number: KCTC 13873BP) from cabbage kimchi, and the strain not only has ADH, ALDH activity, but also acid resistance and bile resistance important for intestinal survival of lactic acid bacteria
  • the present invention was completed by confirming that the property was excellent and that the actual hepatoprotective effect was remarkable in vivo.
  • Lactococcus central gensis Lactococcus chungangensis
  • CAU 1447 bacterial cycle accession number: KCTC 13873BP
  • Another object of the present invention is to provide an intestinal composition, a probiotic composition, a composition for feed, and a fermented product comprising the strain or a culture thereof as an active ingredient.
  • an intestinal composition a probiotic composition, a feed composition, and a fermented product consisting of the strain or a culture thereof.
  • an intestinal composition a probiotic composition, a feed composition, and a fermented product consisting essentially of the strain or a culture thereof.
  • Another object of the present invention is to provide a food composition for preventing or improving alcoholic liver disease, comprising the strain or a culture thereof as an active ingredient.
  • a food composition for preventing or improving alcoholic liver disease consisting essentially of the strain or a culture thereof.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating alcoholic liver disease, comprising the strain or a culture thereof as an active ingredient.
  • compositions for preventing or treating alcoholic liver disease consisting essentially of the strain or a culture thereof.
  • Another object of the present invention is to provide a food composition for liver protection or hangover relief (hangover improvement) comprising the strain or a culture thereof as an active ingredient.
  • liver protection or hangover relief consisting of the strain or a culture thereof.
  • liver protection or hangover relief consisting essentially of the strain or a culture thereof.
  • Another object of the present invention is to provide a method for preparing cream cheese for liver protection or hangover relief by using the strain or a culture thereof.
  • Another object of the present invention is to provide the use of the strain or a culture thereof for preparing a preparation for the treatment of alcoholic liver disease.
  • Another object of the present invention is to provide a method for treating alcoholic liver disease, comprising administering an effective amount of a composition comprising the strain or a culture thereof as an active ingredient to an individual in need thereof. will be.
  • Another object of the present invention is to provide the use of the strain or a culture thereof for preparing a preparation for protecting liver or relieving hangover.
  • the present invention provides a Lactococcus chungangensis CAU 1447 (Strain Accession Number: KCTC 13873BP) strain or a culture thereof.
  • the present invention provides an intestinal composition, a probiotic composition, a feed composition, and a fermented product comprising the strain or a culture thereof as an active ingredient.
  • the present invention provides an intestinal composition, a probiotic composition, a composition for feed, and a fermented product made of the strain or a culture thereof.
  • the present invention provides an intestinal composition, a probiotic composition, a composition for feed, and a fermented product consisting essentially of the strain or a culture thereof.
  • the present invention provides a food composition for preventing or improving alcoholic liver disease, comprising the strain or a culture thereof as an active ingredient.
  • the present invention provides a food composition for preventing or improving alcoholic liver disease consisting of the strain or a culture thereof.
  • the present invention provides a food composition for preventing or improving alcoholic liver disease consisting essentially of the strain or a culture thereof.
  • the present invention provides a pharmaceutical composition for preventing or treating alcoholic liver disease, comprising the strain or a culture thereof as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating alcoholic liver disease consisting of the strain or a culture thereof.
  • the present invention provides a pharmaceutical composition for preventing or treating alcoholic liver disease consisting essentially of the strain or a culture thereof.
  • the present invention provides a food composition for liver protection or hangover relief (hangover improvement) comprising the strain or a culture thereof as an active ingredient.
  • the present invention provides a food composition for liver protection or hangover relief (hangover improvement) consisting of the strain or a culture thereof.
  • the present invention provides a food composition for liver protection or hangover relief (hangover improvement) consisting essentially of the strain or a culture thereof.
  • a method for producing cream cheese for liver protection or hangover characterized in that using the strain or a culture thereof.
  • a method of treating alcoholic liver disease comprising administering an effective amount of a composition comprising the strain or a culture thereof as an active ingredient to an individual in need thereof Provides.
  • a description of a range such as 1 to 6 may refer to individual values within the range, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6, as well as 1 to 3, 1 to 4 , 1 to 5, 2 to 4, 2 to 6, 3 to 6, and the like should be regarded as specifically disclosed. This applies regardless of the width of the range.
  • the present invention is Lactococcus central gensis ( Lactococcus chungangensis ) CAU 1447 (bacterial cycle accession number: KCTC 13873BP) strain or a culture thereof is provided.
  • the strain of the present invention is characterized by having excellent acid resistance and bile resistance.
  • Lactococcus central gensis species there have been no reports that the bacteria have acid resistance or bile resistance, and as a fungus with excellent acid resistance and bile resistance discovered by the present inventors, Lactococcus central gensis CAU Strain 1447 (strain accession number: KCTC 13873BP) is the first to be disclosed in the present invention.
  • the strain of the present invention is characterized by retaining acid resistance in an acidic pH condition (environment) of pH 7.0 or less (preferably less than pH 7.0).
  • the strains of the present invention may be those that possess acid resistance, preferably at pH 2.0 to pH 7.0 (preferably at pH 2.0 or higher to pH 7.0 or lower).
  • the strain of the present invention may have a bile resistance to bile of 0.01% (w/v) to 0.4% (w/v).
  • Lactococcus central gensis CAU 1447 (hereinafter referred to as CAU 1447) of the present invention not only has the functionality of ADH and ALDH activity, but also has excellent acid resistance and bile resistance, so it is a strain in the digestive tract of animals (especially humans). It has a good ability to grow and exhibits functionality.
  • This is known as Lactococcus Central Gensys CAU28 T (Patent Accession No. KCTC12684BP, General Accession No. 13185 T) , which is known to have ADH and ALDH activity for the first time through'Korea Patent Registration 10-1670555'.
  • CAU28 in an embodiment of the present invention, it was confirmed that the CAU28 strain had little acid resistance and bile resistance, whereas the CAU 1447 strain of the present invention had excellent acid resistance and bile resistance, and in real animals (especially It was confirmed that when the lactic acid bacteria were introduced into humans), it showed better efficacy than the existing CAU28 strain.
  • the CAU 1447 strain of the present invention exhibited a recovery effect in various pathologies related to liver damage and inflammation induced by alcohol, and this recovery effect was compared with the CAU28 strain. It was confirmed that it was higher.
  • Lactococcus central gensys CAU 1447 of the present invention is characterized by including a 16S rRNA gene represented by SEQ ID NO: 1.
  • Lactococcus central gensys CAU 1447 of the present invention is characterized by having ADH (alcohol dehydrogenase) and ALDH (aldehyde dehydrogenase) genes, and characterized in that it has enzymatic activity by the gene.
  • the strain of the present invention is also D-glucose, D-Fructose, D-Mannose, D-mannitol, N-acetyl glucosamine (N -Acethyl glucosamine), Esculin, D-Cellobiose, D-Maltose, D-sucrose, D-Trehalose ) And genthiobiose (Gentiobiose) as a carbon source (that is, characterized by showing the sugar fermentation pattern listed above).
  • the strain of the present invention is D-glucose, D-Fructose, D-Mannose, D-mannitol, N-acetyl glucosamine (N-Acethyl glucosamine), Esculin, D-Cellobiose, D-Maltose, D-Sucrose, D-Trehalose -Trehalose), genthiobiose (Gentiobiose), amygdalin (Amygdalin) and potassium 5-keto-gluconate (Potassium 5-Keto-Gluconate) may be characterized by using as a carbon source (ie, sugar fermentation listed above It is characterized by representing a pattern).
  • The'Lactococcus central gensis CAU 1447 strain' includes not only the live bacteria obtained from the culture medium, but also any processing form for lactic acid bacteria known to those skilled in the art, for example, lysed cells, dried products, frozen products, freeze-dried products And the like, but is not limited thereto.
  • the term'culture' refers to all actions performed to grow microorganisms under appropriately artificially controlled environmental conditions
  • the term'culture (culture solution)' as a concept including'fermentation' in the present invention is' It means including'fermented product (fermented liquid)'.
  • the culture may mean the result of culturing in any medium (whether solid or liquid) itself (preferably in a state containing cells).
  • the medium may contain a carbon source and a nitrogen source, and may also contain vitamins or minerals (inorganic salts). Typical media used for culturing lactic acid bacteria and specific types of substances constituting the same are known in the art.
  • the present invention provides an intestinal composition, a probiotic composition, a composition for feed, and a fermented product comprising the strain or a culture thereof as an active ingredient.
  • the Lactococcus central gensis CAU 1447 strain of the present invention can be used as a use for promoting human and animal health, that is, a composition for an intestine, a probiotic, or a feed.
  • the composition includes the strain itself or a culture thereof as an active ingredient, and may further include an excipient or a carrier.
  • the content of the Lactococcus central gensis CAU 1447 strain in the composition may vary depending on the use and formulation of the composition.
  • the intestinal or probiotic composition according to the present invention can be prepared and administered in various formulations and methods.
  • Lactococcus central gensis CAU 1447 strain or a culture thereof is mixed with carriers and flavors commonly used in the pharmaceutical field, and mixed with tablets, troches, capsules, and elixirs ( elixir), syrup, powder, suspension, or granule.
  • a carrier a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, and the like can be used.
  • the method of administration may be oral, parenteral or application method, but it is preferable to administer it orally.
  • the dose to be administered can be appropriately selected according to the absorption, inactivation rate and excretion rate of the active ingredient in the body, and the age, sex, and condition of the recipient.
  • composition for feed according to the present invention may be prepared in the form of fermented feed, blended feed, pellet form, and silage.
  • the fermented feed may be prepared by fermenting organic matter by adding Lactococcus central gensys CAU 1447 strain of the present invention and various microbial bacteria or enzymes, and the compounded feed may be prepared by fermenting various types of general feed and Lactococcus central of the present invention. It can be prepared by mixing the Gencis CAU 1447 strain.
  • the pellet-type feed may be prepared by formulating the fermented feed or the compounded feed into a pellet machine, and the silage may be prepared by fermenting the blueberry feed with the Lactococcus central gensis CAU 1447 strain according to the present invention.
  • the Lactococcus central gensis CAU 1447 strain or a culture thereof according to the present invention may be used as a food additive for foods such as kimchi, beverages, and baby food.
  • the Lactococcus central gensys CAU 1447 strain of the present invention can be used as a starter for manufacturing fermented products.
  • The'starter' refers to a microbial culture (culture solution) used when manufacturing a fermented product. Therefore, the type of starter microorganism determines the characteristics of the product and has an important influence on the quality of the product.
  • The'fermented product' may be referred to interchangeably with the term'fermented food' in this specification.
  • the fermented product is a food that requires a fermentation process during manufacture, and its type is not limited as long as it is known in the art. Includes dairy products such as, etc.
  • the fermented product using the Lactococcus central gensys CAU 1447 strain of the present invention can be prepared according to a conventional method known in the art.
  • the manufacturing method of a fermented product generally consists of preparing raw materials, adding lactic acid bacteria, fermenting, and recovering the finished product.
  • the raw material preparation step is a step of preparing a material to be fermented and preparing fermentation conditions so that fermentation can be carried out well.
  • lactic acid bacteria is to add an appropriate amount of bacteria according to the amount of the fermentation target, and in the present invention, Lactococcus central gensys CAU 1447 is used. Fermentation is carried out according to the fermentation conditions of conventional fermenting bacteria, for example, it may be carried out for 24 to 168 hours at 20 °C to 40 °C.
  • the recovery of the finished product includes all post-processing and packaging to facilitate storage and transportation, from removing unnecessary by-products or unfermented materials from the fermented product.
  • the Lactococcus central gensys CAU 1447 strain according to the present invention can be used to prepare kimchi.
  • a culture of Lactococcus Jungang Gensys CAU 1447 strain of the present invention was added. You can make kimchi. It may be preferable to add 0.5 to 5% by weight of the culture of the Lactococcus central gensis CAU 1447 strain of the present invention based on the total weight of kimchi.
  • Lactococcus central gensis CAU 1447 strain according to the present invention can be used to prepare cheese.
  • Lactobacillus Lactococcus central gensys CAU 1447 or a culture (culture solution) thereof was inoculated into milk, pasteurized, and then mixed with milk and heated to obtain cheese (curd).
  • Cream cheese can be prepared by removing moisture therefrom.
  • the present invention in one embodiment, the present invention
  • Lactococcus central gensis CAU 1447 strain according to the present invention can be used to prepare a lactic acid bacteria beverage.
  • Lactococcus central gensis CAU 1447 strain of the present invention may be cultured and diluted with lactic acid fermentation, diluted with sterilized water, added sugar, flavoring, etc., and then filled into a container. Since these beverages generally contain lactic acid bacteria alive, intestinal intestinal action can be expected after drinking.
  • Lactococcus central gensys CAU 1447 strain according to the present invention after treating the Lactococcus central gensys CAU 1447 strain according to the present invention or 2-3 kinds of mixed lactic acid bacteria including the same in grain powder such as brown rice and adlay, fermented at an appropriate temperature, white tae, glutinous rice, sorghum, etc. Fermented raw products can be manufactured by properly blending various agricultural products to have excellent nutritional balance and palatability.
  • the present invention provides a pharmaceutical composition for preventing or/and treating alcoholic liver disease, comprising the strain or a culture thereof as an active ingredient.
  • the present invention provides a food composition for preventing or/and improving alcoholic liver disease, comprising the strain or a culture thereof as an active ingredient.
  • the alcoholic liver disease is not particularly limited as long as it is a disease in which liver damage caused by alcohol is a major pathology, and includes both acute and chronic conditions.
  • ALD involves three conditions: (a) fatty liver; (b) alcoholic hepatitis; And (c) may be selected from the group consisting of cirrhosis, but is not limited thereto.
  • Fatty liver eg steatosis
  • Alcoholic hepatitis is inflammation and more serious damage to the liver, caused by the body's immune system reacting to liver damage.
  • normal hepatocytes are replaced by wound tissue (ie, fibrosis), and as a result, the liver cannot function normally.
  • the present invention provides a food composition for liver protection or hangover relief (hangover improvement) comprising the strain or a culture thereof as an active ingredient.
  • the hangover relief means alleviation or improvement of hangover symptoms such as heartburn, vomiting, and headache that appear after drinking alcohol, including lowering blood alcohol concentration and lowering blood acetaldehyde concentration.
  • the food composition of the present invention includes all forms such as functional food, nutritional supplement, health food and food additives.
  • Food compositions of this type can be prepared in various forms according to conventional methods known in the art.
  • the Lactococcus central gensis CAU 1447 or a culture thereof of the present invention may be prepared in the form of tea, juice, and drink to be consumed, or granulated, encapsulated, and powdered to be consumed.
  • the Lactococcus central gensis CAU 1447 or a culture thereof of the present invention is prepared in the form of a composition by mixing with known substances or active ingredients known to have a hangover relief effect, alcoholic liver damage suppression effect, or intestinal flora improvement effect can do.
  • functional foods include beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruit, bottled, jam, marmalade, etc.), fish, meat and processed foods thereof (e.g., ham, sausage corn beef). Etc.), bread and noodles (e.g. udon, soba, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein, Retort foods, frozen foods, various seasonings (eg, miso, soy sauce, sauce, etc.) can be prepared by adding the Lactococcus central gensys CAU 1447 or a culture thereof of the present invention.
  • fruits and processed foods thereof e.g., canned fruit, bottled, jam, marmalade, etc.
  • fish e.g., ham, sausage corn beef
  • Etc. e.g. udon, soba, ramen, spaghetti, macaroni,
  • the preferred content of the Lactococcus central gensys CAU 1447 or a culture thereof in the food composition of the present invention is not limited thereto, but may be, for example, 0.01 to 90% by weight of the finally prepared food.
  • Lactococcus central gensys CAU 1447 or a culture thereof of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.
  • the strain of the present invention or a culture thereof may be included alone, or an additive such as one or more pharmaceutically acceptable carriers, excipients or diluents may be further included.
  • pharmaceutically acceptable is a non-toxic composition that is physiologically acceptable and does not inhibit the action of the active ingredient when administered to humans, and does not usually cause allergic reactions such as gastrointestinal disorders, dizziness or similar Say.
  • Pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, syrup, arabic rubber, pregelatinized starch, corn starch, powdered cellulose, hydride.
  • Roxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol and talc, and the like can be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
  • composition of the present invention can be administered in various oral and parenteral formulations at the time of actual clinical administration.
  • diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. It can be prepared using.
  • a pharmaceutically acceptable carrier for example, a carrier for oral administration or a carrier for parenteral administration may be further included.
  • Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Other pharmaceutically acceptable carriers may refer to those known in the art.
  • the pharmaceutical composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally (for example, a coating method).
  • the pharmaceutical composition of the present invention can be formulated as a formulation for oral administration or parenteral administration according to the route of administration as described above.
  • the composition of the present invention is known in the art as a freeze-dried powder, capsule, granule, tablet, pill, dragee, liquid, gel, syrup, slurry, suspension, wafer, etc. It can be formulated using a conventional method.
  • oral preparations may be provided by blending the active ingredient with a solid excipient and then adding a suitable adjuvant thereto and then processing it into a capsule or the like.
  • excipients examples include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch and potato starch, cellulose, Fillers such as celluloses including methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, gelatin, and polyvinylpyrrolidone may be included.
  • the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and a preservative, and the like, but is not limited thereto.
  • the effective amount of the colony forming unit (CFU) of the strain can be determined by the purpose (disease prevention, health or therapeutic treatment) or needs by those skilled in the art, and may also be determined according to the final formulation. I can.
  • 1 x 10 5 to 1 x 10 15 can be added to the strain of the present invention per 1 g (or ml) of the total composition in the manufacture of food or drug, and preferably 1 x It may be added in an amount of 10 6 to 1 x 10 13 , but is not limited thereto.
  • the daily intake of the composition containing the strain of the present invention is 1 ⁇ 10 5 to 1 ⁇ 10 10 CFU/kg, preferably 1 ⁇ 10 6 to as an example, based on the total number of cells. It may be 1 ⁇ 10 9 CFU/kg, and intake may be taken once a day, or may be divided several times, but is not limited thereto.
  • the present invention provides the use of the strain or a culture thereof for preparing a preparation for the treatment of alcoholic liver disease.
  • the present invention provides a method of treating alcoholic liver disease, comprising administering an effective amount of a composition comprising the strain or a culture thereof as an active ingredient to an individual in need thereof.
  • the present invention provides the use of the strain or a culture thereof for preparing a preparation for protecting liver or relieving hangover.
  • The'effective amount' of the present invention refers to an amount showing an improvement, treatment, prevention, detection, diagnosis, or suppression or reduction of alcoholic liver disease, when administered to an individual, and the'individual' is an animal , Preferably, it may be an animal including a mammal, especially a human, and may be a cell, tissue, organ, etc. derived from an animal. The individual may be a patient in need of the effect.
  • The'treatment' of the present invention generally refers to improving the symptoms of alcoholic liver disease or alcoholic liver disease, which may include curing, substantially preventing, or improving the condition of the disease. , Alleviating, curing or preventing one symptom or most of the symptoms resulting from the disease, but is not limited thereto.
  • the term “comprising” is used with the same meaning as “including” or “characterized by”, and in the composition or method according to the present invention, specifically mentioned It does not exclude additional components or method steps that have not been made.
  • the term “consisting of” means excluding additional elements, steps, or ingredients that are not separately described.
  • the term “essentially consisting of” means that, in the scope of a composition or method, it is possible to include a substance or step that does not substantially affect its basic properties in addition to the described substance or step.
  • the Lactococcus central gensys CAU 1447 of the present invention not only has ADH and ALDH-related functions, but also has excellent acid resistance and bile resistance, so it shows the functionality of the strain in the digestive tract of animals (especially humans) and grows. It has excellent ability to protect liver, relieve hangover, and prevent, improve, and treat alcoholic liver disease.
  • CAU 1447 a new strain Lactococcus of the present invention chungangensis CAU 1447 (hereinafter referred to as CAU 1447) as a result of measuring the proliferative capacity (general culture environment) and acid resistance (pH 2.0) ability, it was confirmed that it has excellent proliferation ability and acid resistance compared to the existing CAU28 strain.
  • Figure 2 shows the results of measuring the bile resistance ability of the new strain CAU 1447 of the present invention, it was confirmed that it has excellent bile resistance compared to the existing CAU28 strain.
  • FIG. 3 shows the results of confirming the expression status of ADH and ALDH genes for the new strain CAU 1447 of the present invention (A; Lactococcus chungangensis CAU1447, B: Lactococcus chungangensis CAU28,).
  • Figure 4a is a result of confirming the change in the level of ALP (alkaline phosphatase) in blood according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • ALP alkaline phosphatase
  • 4B is a result of confirming the change in blood aspartate aminotransferase (AST) level according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • AST blood aspartate aminotransferase
  • 4C is a result of confirming the change in blood ALT (alanine aminotransferase) level according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 4D is a result of confirming the change in blood bilirubin level according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 4E is a result of confirming the change in the level of triglycerides in the blood according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 4F is a result of confirming the change in blood albumin level according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 5A is a result of confirming the change in the expression level of TNF-alpha mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 5B is a result of confirming the change in the expression level of IFN-gamma mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 5C is a result of confirming the change in the expression level of IL-1beta mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 5D is a result of confirming the change in the expression level of IL-10 mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 6A is a result of confirming the change in the expression level of NF-kB mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 6B is a result of confirming the change in the expression level of COX-2 mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 6C is a result of confirming the change in the level of iNOS mRNA expression in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 6D is a result of confirming the change in the expression level of TLR4 mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 6E is a result of confirming the change in the expression level of SOD mRNA in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 8A is a result of confirming the change in butyrate level in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • 8B is a result of confirming the change in the level of acetate in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • Figure 8c is a result of confirming the change in the acetate / butyrate ratio (acetate / butyrate ratio) in the liver tissue according to the administration of CAU 1447 cells or CAU 1447 cream cheese in an alcoholic liver injury animal model.
  • FIG. 9 is a microscope image of observing pathological changes in liver tissue according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model (A: negative control, B: positive control, C: silymarin administration group , D: CAU 1447 cells administration group, E: CAU 1447 cream cheese administration group).
  • CAU 1447 cells is a microscopic image of observing pathological changes in small intestinal villi according to administration of CAU 1447 cells or administration of CAU 1447 cream cheese in an alcoholic liver injury animal model (A: negative control, B: positive control, C : Silymarin administration group, D: CAU 1447 cells administration group, E: CAU 1447 cream cheese administration group).
  • FIG. 11 shows comparatively the degree of liver weight improvement according to the administration of the CAU 1447 cells and the CAU 28 cells of the present invention in the alcoholic liver injury animal model.
  • FIG. 12 comparatively shows the degree of improvement in liver/body weight ratio according to administration of CAU 1447 cells and CAU 28 cells of the present invention in an alcoholic liver injury animal model.
  • FIG. 13A shows a comparatively the degree of ALP improvement according to administration of CAU 1447 cells and CAU 28 cells of the present invention in an alcoholic liver injury animal model.
  • 13B comparatively shows the degree of improvement in AST according to administration of CAU 1447 cells and CAU 28 cells of the present invention in an alcoholic liver injury animal model.
  • 13C comparatively shows the degree of improvement in ALT according to administration of CAU 1447 cells and CAU 28 cells of the present invention in an alcoholic liver injury animal model.
  • 13D comparatively shows the degree of improvement of triglycerides according to administration of CAU 1447 cells and CAU 28 cells of the present invention in an alcoholic liver injury animal model.
  • the present inventors took 1 ml of a liquid portion of a sample obtained by crushing 50 g of cabbage kimchi (Manri-dong traditional market, Seoul, Korea), diluted with a decimal dilution method using PBS (phosphate buffered saline), and then 100ul was diluted with M17 (BD BBL, Sparks, MD, USA)
  • the bacteria were observed by spreading on an agar plate and incubating for 2 to 3 days in an incubator at 30°C. Single colonies were randomly selected from each sample, separated and inoculated on MRS agar medium by stroke-line plate method, and cultured in an incubator at 30°C for 24 hours.
  • the identified bacteria were inoculated in MRS liquid medium and cultured at 30° C. for 16 hours to prepare 80% glycerol stock and stored in a cryogenic freezer (-70° C.) to be used in the experiment.
  • CAU 1447 strain was finally selected and analyzed for identification.
  • the strain was identified by physiological biochemical methods and molecular phylogenetic methods. 16S rRNA gene sequence determination and analysis method for this is as follows. For DNA separation, the first cultured cells were collected and suspended in 100 ⁇ l of STES buffer [0.4 M NaCl, 0.2 M Tris-HCl (pH 7.6), 0.01 M EDTA, 1% SDS]. Glass beads were added to the sample and crushed for 5 minutes with a micro tube mixer MT-360 (TOMY) to elute the cytoplasm.
  • STES buffer 0.4 M NaCl, 0.2 M Tris-HCl (pH 7.6), 0.01 M EDTA, 1% SDS. Glass beads were added to the sample and crushed for 5 minutes with a micro tube mixer MT-360 (TOMY) to elute the cytoplasm.
  • TOMY micro tube mixer
  • the cell eluate was suspended in 200 ⁇ l of TE buffer (pH 8.0) and 200 ⁇ l of phenol/chloroform and centrifuged at 12,000 rpm for 5 minutes, and then the supernatant was treated with 5 ⁇ l of RNase A and then 37°C. After reacting for 1 hour under conditions, chloroform was added again, followed by centrifugation at 12,000 rpm for 5 minutes. Thereafter, the supernatant of the centrifuged sample was washed twice with ethanol and then dried (vacuum dry: SpeedVac). The finally recovered DNA was dissolved and preserved in sterile distilled water.
  • TE buffer pH 8.0
  • phenol/chloroform phenol/chloroform
  • PCR premix (Bionia, Korea) and universal primer were used, and forward primer (5'-AGAGTTTGATCCTGGCTCAG-3'/SEQ ID NO: 2) and reverse primer (5'-AAGGAGGTGATCCAGCC-3' / SEQ ID NO: 3) was used to amplify.
  • forward primer (5'-AGAGTTTGATCCTGGCTCAG-3'/SEQ ID NO: 2)
  • reverse primer (5'-AAGGAGGTGATCCAGCC-3' / SEQ ID NO: 3) was used to amplify.
  • PCR was performed according to 20 ⁇ l of the total reaction solution. The process was repeated 30 times at 94° C. for 1 minute for DNA denaturation, 1 minute at 50° C. for primer binding, and 1 minute 50 seconds at 72° C. for DNA strand synthesis.
  • the sequencing and phylogenetic analysis of the amplified DNA was performed according to the method of Chang et al. (Chang et al., Int. J. Syst. Evol
  • the morphological features of the CAU 1447 strain is a Gram-positive bacteria was confirmed, sequence analysis of 16S rRNA genes results Lactococcus central Zensys CAU28 (Lactococcus chungangensis CAU28 , KCTC12684BP) showed 99.44% homology and was identified as the same species (see SEQ ID NO: 1).
  • the novel microorganism of the present invention is a pity Republic of Korea Daejeon, Korea Research Institute of Bioscience and Biotechnology Biological Resource Center located at Yuseong eoeundong 52 Street (Korean Collection for Type Cultures) in June 2019 to January 27, 'Lactococcus to chungangensis Deposited as CAU 1447' (Accession No. KCTC 13873BP).
  • CAU 1447 strain of the present invention is D-glucose, D-Fructose, D-Mannose, D-mannitol, N-acetyl glucosamine ( N-Acethyl glucosamine), Esculin, D-Cellobiose, D-Maltose, D-Sucrose, D-Trehalose Trehalose) and Gentiobiose sugars have been shown to be active, and in addition, Amygdalin and Potassium 5-Keto-Gluconate have also been shown to be used as carbon sources.
  • MRS liquid medium proteose peptone No.3 10.0g, Beef extract 10.0g, Yeast extract 5.0g, Dextrose 20.0g, Poly Sorbate adjusted to pH 2.0 using HCl. 80 1.0g, Ammonium citrate 2.0g, Sodium Acetate 5.0g, Magnesium Sulfate 0.1g, Manganese sulfate 0.05g, Dipotassium phosphate 2.0g) were inoculated and cultured, and the number of viable cells was measured. More specifically, after inoculating the Lactococcus central gensys CAU 1447 strain or CAU28 strain in MRS liquid medium, incubating at 30° C.
  • the OD 600 value was 1.0 with sterile water.
  • 30 ⁇ l of the suspension adjusted with was inoculated into the MRS liquid medium at pH 2.0 (same conditions as gastric juice) and cultured at 30° C. with time, and the number of viable cells was measured at A600 nm with Nanodrop (NanoQuant infinite M200, TECAN).
  • the data in Table 3 below shows the relative ATR for the result of culturing at pH 2.0 when the ATR in the general culture (control (pH 7.0)) state is 1 for each strain.
  • Acid tolerance rate (ATR) CAU 28 CAU 1447 pH 2.0 0.95 1.06
  • CAU1447 shows higher growth at the same time and conditions when compared to CAU28, and the new strain CAU1447 of the present invention is more It was confirmed to have high proliferative ability.
  • CAU 1447 showed the ability to grow in the MRS medium pH 2.0 (same conditions as gastric juice). It was confirmed that CAU 1447 was not inhibited under strong acid conditions, as the number of bacteria increased considerably as time passed. In contrast, the CAU28 strain was confirmed to be unable to proliferate. Therefore, it was confirmed that the CAU1447 of the present invention has more excellent acid resistance.
  • bile acids ox-bile (oxgall) dry pure, Merck, Germany
  • the OD 600 value with sterile water 30 ⁇ l of the suspension adjusted to 1.0 was inoculated in MRS liquid medium containing 0, 0.2 and 0.4% bile acids and incubated for 0-12 hours at 30°C, and the number of viable cells was added to Nanodrop (NanoQuant infinite M200, TECAN) at A600 nm. Measured.
  • the CAU 1447 strain showed better viability than the CAU 28 strain in the MRS medium to which 0.2% or 0.4% of bile was added.
  • L. chungangensis CAU28 strains are known to have existing ADH (alcohol dehydrogenase) and ALDH (aldehyde dehydrogenase) genes.
  • ADH alcohol dehydrogenase
  • ALDH aldehyde dehydrogenase
  • ADH and ALDH genes which are characteristic genes of the CAU28 strain, exist in CAU 1447, and the activities of ADH and ALDH enzymes were confirmed.
  • ADH and ALDH activities play an important role in relieving hangovers and protecting against alcoholic liver damage.
  • the new strain CAU 1447 of the present invention not only has ADH and ALDH activity, but also has high acid resistance compared to CAU28 and has a higher viability than the existing strain even in the presence of bile acid, when ingested as an actual probiotic (especially with alcohol When ingested), it was thought that the protective efficacy was better for relieving hangovers and liver damage caused by alcohol.
  • lactic acid bacteria are known to produce metabolites, which are various products produced during metabolic processes. Accordingly, fatty acids, organic acids, and amino acids were identified among the numerous types of metabolites produced by the new strain CAU 1447 of the present invention during metabolism. More specifically, the freeze-dried CAU 1447 strain was dissolved in PBS and analyzed by requesting the Institute of Agricultural and Life Sciences, Seoul National University.
  • Palmitic acid was 1.220mg/g
  • Palmitoleic acid (Omega-7) was 0.311mg/g
  • Oleic acid (Omega-9) was 0.435mg/g
  • Linoleic acid (Omega-6) was 0.099mg/g
  • Alpha-linolenic acid (ALA) (Omega-3) was 0.764mg/g.
  • Example 7 In an alcoholic liver disease animal model, confirming the hepatoprotective effect of the new strain CAU 1447 of the present invention
  • L. chungangensis CAU 1447 was incubated with tryptic soy broth (Difco, BD) at 30° C. for 2 to 3 days, freeze-dried, and then resuspended in PBS at a concentration of 1 ⁇ 10 9 CFU/mL, and a single dose ).
  • tryptic soy broth Difco, BD
  • L. chungangensis CAU 1447 cream cheese was prepared in the following manner.
  • L. chungangensis CAU 1447 to be used as a cream cheese starter was inoculated into acidified milk and incubated for 48 hours. After incubation, pasteurized at 68° C. for 30 minutes, cooled, mixed with milk and heated at 70° C. for 5 minutes. To remove moisture from the cheese generated after heating, only curd was obtained using a cloth, and the moisture was removed using 0.5% salt to complete the cheese. The cheese thus completed was dried to store in a solid form and stored at 4°C until further experiments.
  • rats were given 50% alcohol at 4 g/kg body weight/day. After that, the alcohol dose was increased by 1 g/kg every month, and the administration was continued for 2 months. After the dose reached 6g/kg/day, it was administered for an additional 2 weeks. Alcohol was administered once a day by oral gavage.
  • silymarin, L. chungangensis CAU 1447 cells and CAU 1447 cream cheese were each administered to rats 2 hours after alcohol administration. Body weight was measured daily.
  • Silymarin Sigma-Aldrich, St. Louis, MO, USA
  • ALD alcoholic liver disease
  • Silymarin 150 mg/kg body weight/day was dissolved in 1 mL of PBS and administered by oral gavage. Freeze-dried L.
  • chungangensis CAU 1447 (1 x 10 9 CFU/rat/day) cells and cream cheese (1.4 g/kg body weight/rat) made with L. chungangensis CAU 1447 were dissolved in 1 mL PBS, and It was administered by the oral gavage. The negative control was treated with the same amount of PBS. The test substance treatment lasted 10 weeks. After the adaptation period, the rats of each group were pre-administered with cream cheese made of silymarin, L. chungangensis CAU 1447 and L. chungangensis CAU 1447, respectively, for 1 week before oral administration of alcohol. After 10 weeks of alcohol administration, rats were fasted for about 12 hours before sacrifice and anesthetized by CO 2 inhalation. Organs were excised for analysis.
  • cytokines TNF-alpha, IFN-gamma, IL-1beta, IL-10
  • inflammatory factors iNOS, NF-kB, COX-2, and TLR4
  • RNA concentration of the extracted RNA was measured using a NanoQuant Spectrophotometer (Infinite 200; Tecan, Mannedorf, Switzerland).
  • a PrimeScript first-strand cDNA synthesis kit (Takara Bio, Shiga, Japan)
  • 1 ⁇ g total RNA was reverse transcribed into cDNA.
  • Real-time quantitative PCR was performed using a 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA, USA) and SYBR green PCR kit (Qiagen) to quantify mRNA expression. Fold changes were determined using the 2 - ⁇ Ct method.
  • the primer sequences used are shown in (Table 6).
  • GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) was used as a control.
  • IL-1beta Foward: CACCTTCTTTTCCTTCATCTTTG SEQ ID NO: 8 Reverse: GTCGTTGCTTGTCTCCTTGTA SEQ ID NO: 9 TNF-alpha
  • TGTGGGTGAGGAGCACATAG SEQ ID NO: 11 IFN-gamma
  • TTCAAGACTTCAAAGAGTCTGAGG Reverse: TTCAAGACTTCAAAGTCTGAGG SEQ ID NO: 13
  • IL-10 Foward: GGGAAGCAACTGAAACTTCG SEQ ID NO: 14 Reverse: ATCATGGAAGGAGCAACCTG SEQ ID NO: 15 COX-2
  • Liver antioxidant enzyme and SOD activity were measured according to the manufacturer's protocol using a Superoxide Dismutase Assay kit (Cayman Chemical, Ann Arbor, MI, USA). Rat liver tissue sections were stored in liquid nitrogen until use for analysis. Liver tissue was homogenized in cold HEPES buffer containing 210 mM mannitol, 1 mM EGTA and 70 mM sucrose, and centrifuged at 1500 x g for 5 min at 4°C. An aliquot of the supernatant was transferred to a sterilized microcentrifuge tube, and stored at -80°C until analysis of antioxidant enzyme activity. Activity was measured as U/mL. The absorbance at 450 nm was measured using a microplate reader.
  • Fresh liver (liver) and intestine (intestine) tissues were carefully separated, cut into 3-5 ⁇ m-thick sections, fixed in 10% formalin, and paraffin embedded. After 24 hours, the paraffin-embedded tissue was stained with hematoxylin and eosin (H&E). Thereafter, the tissue samples were observed under a microscope (DM 4000B; Leica Microsystems, Wetzlar, Germany) at 400x magnification to evaluate histopathological changes. A minimum of 3 slides were evaluated for each sample.
  • DM 4000B Leica Microsystems, Wetzlar, Germany
  • liver/body weight ratio Body weight and liver weight were measured to obtain a liver/body weight ratio.
  • the liver weight increased in the positive control group treated with only alcohol, and the liver/weight ratio was highest in the positive control group treated with only alcohol.
  • the liver/body weight ratio decreased, which was similar to that of the negative control group.
  • AST and ALT are hepatocyte markers and are released from the liver after hepatocyte injury.
  • the serum concentrations of bilirubin and triglycerid were lower than that of the positive control group (FIGS. 4D and 4E ).
  • serum albumin levels were the lowest in the positive control group (Fig. 4f), and increased in the CAU 1447 treatment group and the CAU 1447 cream cheese treatment group.
  • TNF-alpha stimulates various cytokines or chemokines to induce steatohepatitis and promote the progression of liver damage.
  • TNF-alpha is also thought to be associated with systemic inflammation and is an important factor in the progression of ALD.
  • IL-1beta is a major pro-inflammatory cytokine that is upregulated in the liver of ALD animal models and ALD patients. The expression of these pro-inflammatory cytokines results in hepatocellular dysfunction, inflammation, necrosis and apoptosis in liver damage.
  • NF-kB, COX-2, iNOS, TLR4 and SOD are associated with the onset of liver damage.
  • NF-kB activity and TLR4 expression are involved in the inflammatory response and regulate the level of inflammatory cytokines.
  • TLR4 is associated with liver disease and is associated with inflammation, necrosis and steatosis following alcohol absorption.
  • COX-2 and iNOS expression levels are affected by NF-kB activation.
  • upregulation of pro-inflammatory factors such as lipid peroxides, endotoxins and cytokines induces COX-2 expression, enhancing the inflammatory response in the liver.
  • NF-kB, COX-2, iNOS, TLR4 and SOD mRNA expressions were higher in the alcohol-treated positive control group than in the normal control group (Figs. 6a, 6b, and 6c. , See FIGS. 6D and 6E). However, this increase was blocked by administration of CAU 1447 cells and CAU 1447 cream cheese after alcohol administration. In addition, similar decreases in NF-kB, COX-2, iNOS, TLR4 and SOD levels were observed in the silymarin treatment group.
  • the activity of antioxidant enzymes such as SOD released from the liver is another indicator of liver damage. Accordingly, the activity of SOD, a liver antioxidant enzyme expressed during fatty liver and liver injury and induced by high alcohol concentration, was evaluated. Significantly increased SOD activity was observed in the alcohol-treated positive control compared to the negative control (see FIG. 7). In the silymarin treatment group, the SOD level was significantly decreased, and the SOD activity in the group treated with CAU 1447 cells and CAU 1447 cream cheese was also decreased compared to the positive control group, and showed similar activity level to the negative control group.
  • SOD a liver antioxidant enzyme expressed during fatty liver and liver injury and induced by high alcohol concentration
  • Short-chain fatty acids (SCFA) production by intestinal microbes was evaluated using fecal samples. Butyrate and acetate levels were decreased in the positive control compared to the negative control (see Figs. 8A and 8B). The levels of butyrate and acetate were increased in the CAU 1447 cream cheese group. In addition, compared with the positive control group and the drug (silymarin) treatment group, the acetate/butyrate ratio was most significantly decreased in the CAU 1447 cream cheese group (see FIG. 8C).
  • SCFAs play an important role in human health, including the immune response and inflammatory system.
  • composition of SCFAs depends on their interaction with the digestive tract microbes and the digestive tract environment.
  • high levels of butyrate were associated with the regulation of immune responses, including inhibition of TNF-alpha by inactivation of NF-kB in Kupffer cells.
  • butyrate inhibits the expression of cytokines induced by lipopolysaccharide.
  • SCFAs stimulate the immune response, either by association with the host and microbiome, or by directly affecting signal transduction.
  • the liver contains a variety of cell types that interact with small molecules produced by the gut microbiota to enable immune signaling.
  • the CAU 1447 cream cheese group showed elevated butyrate and acetate levels in fecal samples compared to the positive control.
  • the high levels of butyrate and acetate in the results of the present invention mean that it increases the metabolic activity of the digestive tract and promotes the immune response.
  • the structure of the intestinal villi in the negative control group did not show any morphological changes (Fig. 10A).
  • Fig. 10B in the alcohol-treated positive control (Fig. 10B), a change in the intestinal villi structure was observed, and the intestinal villi were greatly damaged and torn.
  • Oral administration of silymarin, CAU 1447 cells, or CAU 1447 cream cheese (C, D and E in Fig. 10) significantly reduced intestinal villi injury compared to the positive control.
  • the results of the CAU 1447 cells and the CAU 1447 cream cheese group were similar to those of the silymarin treatment group.
  • Example 8 In an alcoholic liver disease animal model, comparison of the effects of the new strains CAU 1447 and CAU28 strains of the present invention
  • An ALD animal model was prepared by ingesting alcohol in the same manner as described in Example 6, and a CAU 1447 cell sample and a CAU 28 cell sample were prepared and administered to the animals.
  • liver weight and liver weight were measured to obtain a liver/body weight ratio.
  • the liver weight increased and the liver/weight ratio increased, but the value decreased by the Lactococcus central gensis treatment.
  • the CAU1447 administration group of the present invention had a greater reduction ratio than the CAU28 administration group.
  • the present invention is a new strain, Lactococcus central gensis ( Lactococcus chungangensis ) CAU 1447 (bacterial cycle accession number: KCTC 13873BP) strain or its culture, its liver protection, hangover relief, prevention and treatment (improvement) for alcoholic liver disease, including the above strain or culture as an active ingredient It is for intestinal agents, probiotics, feed compositions and fermented products.
  • Lactococcus central gensys CAU 1447 of the present invention possesses ADH and ALDH characteristics, has functions for liver protection, hangover relief, treatment/improvement of alcoholic liver disease, and has excellent acid resistance and bile resistance. In particular, it shows the functionality of the strain in the digestive tract of a human (especially human) and has excellent ability to grow, so it has high industrial applicability.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Polymers & Plastics (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nutrition Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

이상 살펴본 바와 같이, 본 발명은 신균주인 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물, 이들의 간보호, 숙취해소, 알콜성 간질환에 대한 예방 및 치료(개선) 용도, 상기 균주 또는 배양물을 유효성분으로 포함하는 정장제, 생균제, 사료용 조성물 및 발효제품에 대한 것이다.

Description

신규한 락토코커스 중앙젠시스 CAU 1447 균주
본 출원은 2019년 7월 9일에 출원된 대한민국 특허출원 제10-2019-0082691호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 신규한 락토코커스 중앙젠시스 CAU 1447 균주에 관한 것으로, 보다 상세하게는 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물, 이들의 간보호, 숙취해소, 알콜성 간질환에 대한 예방 및 치료(개선) 용도, 상기 균주 또는 배양물을 유효성분으로 포함하는 정장제, 생균제, 사료용 조성물 및 발효제품에 대한 것이다.
유산균은 인체의 소화계에 공생하면서 섬유질 및 복합 단백질들을 분해하여 중요한 영양 성분으로 만드는 역할을 담당하며, 이와 같이 사람을 포함한 동물의 위장관 내에서 숙주의 장내 미생물 환경을 개선하여 숙주의 건강에 유익한 영향을 주는 살아있는 미생물을 통칭하여 프로바이오틱스(probiotics)라고 한다. 프로바이오틱스 생균제 유산균은 장내에 정착하여 증식 및 서식할 수 있을 때 가장 효율적이다. 유산균이 사람의 장내에서 그 기능을 잘 발휘하기 위해서는, 위액의 낮은 pH, 소장내의 담즙 및 점액 등에 대해 저항성이 있어야 한다(Havenaar et al., Probiotics: the Scientific Basis (Fuller, R., ed.), pp. 209-224, 1992).
한편, 음주 후 다음날 느끼는 숙취는 신체 건강은 물론 삶의 질까지 떨어뜨리는 원인이 된다. 술을 마시고 난 다음날이면 대부분의 사람들은 속 쓰림과 구토, 심한 두통 등의 숙취(hangover) 현상에 시달리게 된다. 음주로 흡수된 에탄올은 2~10%만이 신장이나 폐를 통해 소변이나 호흡으로 체외로 배출되고, 나머지 에탄올의 90% 이상은 빠른 속도로 간에서 대사된다. 알코올이 산화되어 만들어진 일차 대사산물인 아세트알데히드(acetaldehyde)는 숙취의 주요한 인자이며, 알코올 섭취 시 체내의 독성작용을 통해 알코올 그 자체보다 아세트알데히드에 의한 숙취의 영향이 더 크다. 알코올은 체내 대사과정에서 알코올 그 자체 및 알코올 대사물질이 간조직의 손상을 일으키므로 만성적 알코올 섭취는 간에 중성지방을 축적시켜 지방간을 일으키고 과량의 니코틴아미드 아데닌 디뉴클레오티드(NADH)가 생성되어 NADH oxidase의 활성이 높아져 -OH와 -O 2-와 같은 활성산소(oxygen radical)를 생성함으로써 항산화 시스템에도 영향을 미치게 된다. 혈류를 통해 간으로 유입된 아세트알데하이드는 주로 지방산 합성에 이용되는데, 지방산 산화가 감소되고, 합성은 증가되어 간에 중성지질이 축적되고, 이는 지방간의 원인이 된다(Cho et al., 2001; Keshavarzian et al., 1994). 지방간이 유발되고, 더 심해지게 되면 간세포의 장애가 초래되어 알코올성 간염이나 간경화증이 유발될 수 있다(Lee et al., 2009; Tsukamoto and Towner, 1984; Lieber, 1991).
알콜성 간 질환(Alcoholic liver disease, ALD)은 과도한 알코올 섭취로 발생하고 간경변-관련 사망의 주요 원인이며 전세계 사망자의 0.9 %를 차지한다. 알코올 과량섭취 및 장기간 섭취는 간 손상뿐만 아니라 영양소 흡수와 관련된 소장 점막을 파괴하고, 심장, 뇌, 신장 및 간을 포함한 다른 기관들의 기능을 변화시킨다. ALD 발병은 간에서의 알코올 대사와 관련이 있으며, 이는 자유 라디칼 형성, 순차적 산화 스트레스 및 염증성 사이토카인 분비 경로를 비롯한 다양한 경로에 영향을 미친다. Toll-like receptor-4(TLR4)는 ALD의 진행에 주요한 역할을 하는 중요한 기능적 수용체이며 NF-kB 활성화와 관련되어있다. NF-kB는 전염증성 사이토카인 신호 전달 및 관련 메커니즘에 영향을 미치며, 상기 관련 메커니즘으로는 cyclooxygenase-2 (COX-2) 및 iNOS (inducible nitric oxide synthase)와 같은 다른 염증 매개체의 분비 등을 포함한다. 일부 연구들은 NF-kB의 불활성화가 간 질환에서 iNOS 및 COX-2의 발현을 억제한다는 것을 보여 주었다.
일반적으로 간에는 알콜분해효소(ADH)와 알데히드분해효소(ALDH)가 존재하여 알콜이 인체에 유입되면 인체에 무해한 아세테이트로 전환되게 된다. 상기 효소 등의 활성 촉진을 통하여 알콜대사를 촉진함으로써 체내에 아세트알데히드 축적을 억제하는 것이 숙취 해소 및 알콜성 간손상에 대한 억제 기전의 하나로 주목 받고 있으며, 최근 건강식품 열풍과 더불어 상기 기능성을 가지는 프로바이오틱스 소재를 발굴하고자하는 트렌드가 확산되고 있다.
이에 본 발명자들은 배추김치로부터 신규한 락토코커스 중앙젠시스 CAU 1447 균주(균주기탁번호: KCTC 13873BP)를 분리하고, 상기 균주가 ADH, ALDH 활성을 가질뿐만아니라 유산균의 장내 생존에 중요한 내산성 및 내담즙성이 우수하며, in vivo 상에서 실제 간보호 효과가 현저한 것을 확인하여 본 발명을 완성하였다.
따라서 본 발명의 목적은, 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물을 제공하는 것이다.
본 발명의 다른 목적은, 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공하는 것이다.
또한 상기 균주 또는 이의 배양물로 이루어진 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공하는 것이다.
또한 상기 균주 또는 이의 배양물로 필수적으로 이루어진 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는 개선용 식품 조성물을 제공한다.
또한 상기 균주 또는 이의 배양물로 이루어진 알콜성 간 질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한 상기 균주 또는 이의 배양물로 필수적으로 이루어진 알콜성 간 질환의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명의 또 다른 목적은, 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한 상기 균주 또는 이의 배양물로 이루어진 알콜성 간 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한 상기 균주 또는 이의 배양물로 필수적으로 이루어진 알콜성 간 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 간보호 또는 숙취해소(숙취 개선)용 식품 조성물을 제공하는 것이다.
또한 상기 균주 또는 이의 배양물로 이루어진 간보호 또는 숙취해소(숙취 개선)용 식품 조성물을 제공하는 것이다.
또한 상기 균주 또는 이의 배양물로 필수적으로 이루어진 간보호 또는 숙취해소(숙취 개선)용 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 균주 또는 이의 배양물을 이용하여 간보호 또는 숙취해소용 크림치즈 제조방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 알콜성 간 질환(Alcoholic liver disease)의 치료용 제제를 제조하기 위한 상기 균주 또는 이의 배양물의 용도를 제공하는 것이다.
본 발명의 또 다른 목적은, 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 알콜성 간 질환(Alcoholic liver disease)의 치료 방법을 제공하는 것이다.
본 발명의 또 다른 목적은, 간 보호 또는 숙취해소용 제제를 제조하기 위한 상기 균주 또는 이의 배양물의 용도를 제공하는 것이다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물을 제공한다.
본 발명의 다른 목적을 달성하기 위하여, 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 이루어진 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 필수적으로 이루어진 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는 개선용 식품 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 이루어진 알콜성 간 질환의 예방 또는 개선용 식품 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 필수적으로 이루어진 알콜성 간 질환의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는 치료용 약학적 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 이루어진 알콜성 간 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 필수적으로 이루어진 알콜성 간 질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 간보호 또는 숙취해소(숙취개선)용 식품 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 이루어진 간보호 또는 숙취해소(숙취개선)용 식품 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물로 필수적으로 이루어진 간보호 또는 숙취해소(숙취개선)용 식품 조성물을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 상기 균주 또는 이의 배양물을 이용하는 것을 특징으로 하는 간보호 또는 숙취해소용 크림치즈 제조방법을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 알콜성 간 질환(Alcoholic liver disease)의 치료용 제제를 제조하기 위한 상기 균주 또는 이의 배양물의 용도를 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 알콜성 간 질환(Alcoholic liver disease)의 치료 방법을 제공한다.
본 발명의 또 다른 목적을 달성하기 위하여, 간 보호 또는 숙취해소용 제제를 제조하기 위한 상기 균주 또는 이의 배양물의 용도를 제공한다.
이하 본 발명을 상세히 설명한다.
본 개시 전반에 걸쳐서, 본 발명의 다양한 양상들이 범위 형식으로 제안될 수 있다. 본 명세서에서 범위값의 기재는, 별다른 언급이 없는 한 해당 경계값을 포함하는 것으로서 즉, 하한값 이상 내지 상한값 이하의 값을들 모두 포함하는 의미이다. 범위 형식의 서술은 단순히 편의성 및 간략성을 위한 것이며, 본 발명의 범위에 대한 융통성 없는 제한 (inflexible limitation)으로서 해석되지 않아야 하는 것으로 이해되어야 한다. 따라서, 범위의 서술은 상기 범위 내의 개별적인 수치값들뿐만 아니라 모든 가능한 하부범위(subrange)를 구체적으로 개시한 것으로 고려되어야 한다. 예를 들어, 1 내지 6과 같은 범위의 서술은 상기 범위 내의 개별적 수치들, 예를 들어, 1, 2, 2.7, 3, 4, 5, 5.3, 및 6뿐만 아니라, 1 내지 3, 1 내지 4, 1 내지 5, 2 내지 4, 2 내지 6, 3 내지 6 등과 같은 하부범위들을 구체적으로 개시한 것으로 간주되어야 한다. 이는 범위의 폭과 무관하게 적용된다.
본 발명은 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물을 제공한다.
본 발명의 상기 균주는 우수한 내산성 및 내담즙성을 갖는 것을 특징으로 한다. 기존에 락토코커스 중앙젠시스 종(species)에 있어서 상기 균에 내산성 또는 내담즙성의 특성이 있다는 보고는 전무하였으며, 본 발명자에 의해 발굴된 내산성 및 내담즙성이 우수한 균으로서 락토코커스 중앙젠시스 CAU 1447균주(균주기탁번호: KCTC 13873BP)는 본 발명에서 최초로 공개되는 것이다.
본 발명의 균주는 pH 7.0 이하(바람직하게 pH 7.0 미만)의 산성 pH 조건(환경)에서 내산성을 보유하는 것이 특징이다. 하나의 실시 양태에서, 하나의 실시양태에서, 본 발명의 균주는 바람직하게 pH 2.0 내지 pH 7.0(바람직하게 pH 2.0 이상 내지 pH 7.0 미만)에서 내산성을 보유하는 것일 수 있다.
본 발명의 균주는 0.01%(w/v) 내지 0.4%(w/v)의 담즙에 대한 내담즙성을 보유하는 것일 수 있다.
본 발명의 락토코커스 중앙젠시스 CAU 1447(이하, CAU 1447로 지칭)는 ADH 및 ALDH 활성의 기능성을 가질 뿐만 아니라, 우수한 내산성 및 내담즙성을 가지기 때문에 동물(특히, 인간)의 소화관 내에서 균주가 가지는 기능성을 잘 나타내며 생육하는 능력이 높다. 이는 기존에 '대한민국 등록특허 10-1670555'를 통해 최초로 ADH 및 ALDH 활성이 있는 것으로 알려진 락토코커스 중앙젠시스 CAU28 T(특허기탁번호 KCTC12684BP, 일반기탁번호 13185 T 로 알려짐. 이하 본 명세서에서 CAU28로 지칭)과 대비되는 것으로서, 본 발명의 일 실시예에서는 상기 CAU28 균주가 내산성 및 내담즙 능력이 거의 없는 반면 본 발명의 CAU 1447 균주는 우수한 내산성 및 내담즙성을 가짐을 확인하였고, 또한 실제 동물(특히 인간)에 상기 유산균의 도입 시 기존 CAU28균주보다 더 우수한 효능을 나타내는 것을 확인하였다. 알콜성 간질환 동물 모델을 이용한 in vivo 실험에서 본 발명의 CAU 1447 균주는, 알콜에 의해 유도된 간 손상 및 염증과 관련된 다양한 병리 측면에서 회복 효과를 나타내었으며, 이러한 회복 효과는 CAU28 균주와 비교하여 더 높음을 확인하였다.
또한 본 발명의 락토코커스 중앙젠시스 CAU 1447은 서열번호 1로 표시되는 16S rRNA 유전자를 포함하는 것을 특징으로 한다.
또한 본 발명의 락토코커스 중앙젠시스 CAU 1447은 ADH(alcohol dehydrogenase) 및 ALDH(aldehyde dehydrogenase) 유전자를 가지는 것을 특징으로 하며, 상기 유전자에 의한 효소 활성을 가지는 것을 특징으로 한다.
본 발명의 균주는 또한 D-글루코오스(D-glucose), D-프룩토오스(D-Fructose), D-만노스(D-Mannose), D-만니톨(D-mannitol), N-아세틸 글루코사민(N-Acethyl glucosamine), 에스쿨린(Esculin), D-셀로비오스(D-Cellobiose), D-말토오스(D-Maltose), D-수크로스(D-sucrose), D-트레할로오스(D-Trehalose) 및 겐티오비오스(Gentiobiose)를 탄소원으로 이용하는 것을 특징으로 한다(즉, 상기 열거된 당발효 패턴을 나타내는 것을 특징으로 한다).
더욱 바람직하게 본 발명의 균주는 D-글루코오스(D-glucose), D-프룩토오스(D-Fructose), D-만노스(D-Mannose), D-만니톨(D-mannitol), N-아세틸 글루코사민(N-Acethyl glucosamine), 에스쿨린(Esculin), D-셀로비오스(D-Cellobiose), D-말토오스(D-Maltose), D-수크로스(D-sucrose), D-트레할로오스(D-Trehalose), 겐티오비오스(Gentiobiose), 아미그달린(Amygdalin) 및 포타슘 5-케토-글루코네이트(Potassium 5-Keto-Gluconate)를 탄소원으로 이용하는 것을 특징으로 하는 것일 수 있다(즉, 상기 열거된 당발효 패턴을 나타내는 것을 특징으로 한다).
상기 '락토코커스 중앙젠시스 CAU 1447 균주'는 배양 배지로부터 수득된 생균 그 자체뿐만 아니라, 당업자에게 알려진 유산균에 대한 임의의 가공형태를 포함하는 것으로 예를 들어 균체 파쇄물, 건조물, 동결물, 동결건조물 등을 포함하며 이에 제한되지 않는다.
본 발명에서 용어 '배양'이란 미생물을 적당히 인공적으로 조절한 환경 조건에서 생육시키기 위하여 수행하는 모든 행위를 의미하며, 본 발명에서 '발효'를 포함하는 개념으로서 용어 '배양물(배양액)'은 '발효물(발효액)'을 포함하는 의미이다. 바람직한 실시 양태에서 상기 배양물은 임의의 배지(고체이든 액체이든)에서 배양한 결과물 자체(바람직하게 균체를 포함하고 있는 상태)를 의미하는 것일 수 있다. 상기 배지는 탄소원 및 질소원을 포함하며, 또한 비타민 또는 미네랄(무기염류) 등이 포함된 것을 사용할 수 있다. 유산균 배양에 사용되는 통상적인 배지 및 이를 구성하는 물질의 구체적인 종류는 당업계에 공지되어 있다.
따라서 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 정장용 조성물, 생균제 조성물, 사료용 조성물 및 발효제품을 제공한다.
본 발명의 락토코커스 중앙젠시스 CAU 1447 균주는 인간 및 동물의 건강 증진을 위한 용도, 즉, 정장용, 생균제 또는 사료용 조성물로 사용될 수 있다. 상기 조성물은 상기 균주 자체 또는 이의 배양물 등을 유효성분으로 포함하며, 부형제 또는 담체를 추가로 포함할 수 있다. 조성물 내 상기 락토코커스 중앙젠시스 CAU 1447 균주의 함량은 조성물의 용도 및 제형에 따라 달라질 수 있다. 본 발명에 따른 정장용 또는 생균제 조성물은 다양한 제형과 방법으로 제조 및 투여될 수 있다. 예를 들어, 락토코커스 중앙젠시스 CAU 1447 균주 또는 이의 배양물을 약제학적 분야에서 통상적으로 사용하는 담체 및 향료와 혼합하여 정제 (tablet), 트로키(troche), 캡슐(capsule), 엘릭실(elixir), 시럽(syrup), 산제 (powder), 현탁제(suspension) 또는 과립제(granule) 등의 형태로 제조 및 투여될 수 있다. 담체로는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제 등을 사용할 수 있다.
투여방식은 경구, 비경구 또는 도포법을 사용할 수 있으나, 바람직하게는 경구투여하는 것이 바람직하다. 또한, 투여용량은 체내에서 활성성분의 흡수도, 불활성율 및 배설속도, 피투여자의 연령, 성별, 상태 등에 따라 적절히 선택할 수 있다.
또한, 본 발명에 따른 사료용 조성물은 발효사료, 배합 사료, 펠렛형태 및 사일레지(silage) 등의 형태로 제조될 수 있다. 상기 발효사료는 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주와 여러 가지 미생물 균 또는 효소들을 첨가함으로써 유기물을 발효시켜 제조될 수 있으며, 상기 배합사료는 여러 종류의 일반 사료와 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주를 혼합하여 제조될 수 있다. 펠렛 형태의 사료는 상기 발효사료 또는 배합사료를 펠렛기로 제형화하여 제조될 수 있으며, 사일레지는 청예사료를 본 발명에 따른 락토코커스 중앙젠시스 CAU 1447 균주로 발효시킴으로서 제조될 수 있다.
본 발명에 따른 락토코커스 중앙젠시스 CAU 1447 균주 또는 이의 배양물은 김치, 음료, 이유식 등의 식품에 대한 식품첨가제로 사용될 수 있다. 아울러, 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주는 발효제품 제조를 위한 스타터(starter)로 사용될 수 있다. 상기 '스타터(starter)'란 발효물을 제조하는 경우에 사용하는 미생물 배양물(배양액)을 말한다. 따라서 스타터 미생물의 종류는 그 제품의 특성을 결정하게 되며 제품의 품질에 중요한 영향을 미친다.
상기 ‘발효제품’은 본 명세서에서 용어 ‘발효식품’과 혼용되어 지칭될 수 있다. 상기 발효제품은 제조시 발효공정이 필요한 식품으로서 당업계에 알려진 것이라면 그 종류가 제한되지 않으나, 예를 들어 치즈, 요거트, 버터, 크림, 아이스크림, 유산균 음료, 캐피어, 김치, 발효생식제품, 발효유 등과 같은 유제품 등을 포함한다. 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주를 이용한 발효제품은 당업계에 공지된 통상의 방법에 따라 제조될 수 있다. 발효제품의 제조방법은 통상적으로 원료의 준비, 유산균의 첨가, 발효, 완성된 제품의 회수 등의 과정으로 이루어진다. 원료의 준비 단계는 발효 대상이 되는 재료를 준비하고, 발효가 잘 이루어지도록 발효 조건을 준비하는 단계이다. 유산균의 첨가는 발효 대상의 양에 따라 적량의 균을 첨가하는 것으로, 본 발명에서는 락토코커스 중앙젠시스 CAU 1447을 사용하는 것을 특징으로 한다. 발효는 통상의 발효균의 발효조건에 따라 수행되는 것으로 예를 들어 20℃ 내지 40℃에서 24 내지 168시간 동안 수행될 수 있다. 완성된 제품의 회수는 발효물에서 불필요한 부산물이나 미발효된 재료를 제거하는 것에서부터 저장, 운반을 용이하게하기 위한 모든 후처리과정 및 포장 등을 포함한다.
구체적 일례로 본 발명에 따른 락토코커스 중앙젠시스 CAU 1447 균주는 김치를 제조하는데 사용할 수 있다. 이에 제한되지 않으나, 일례로 소금으로 절인 배추에 고춧가루, 마늘, 생강, 대파, 무채, 설탕과 같은 일반적인 김치 양념들을 혼합한 후, 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주의 배양물을 첨가하여 김치를 제조할 수 있다. 상기 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주의 배양물은 김치 전체 중량에 대하여 0.5 ~ 5 중량% 첨가하는 것이 바람직할 수 있다.
또한 본 발명에 따른 락토코커스 중앙젠시스 CAU 1447 균주는 치즈를 제조하는데 사용할 수 있다. 이에 제한되지 않으나, 일례로 유산균 락토코커스 중앙젠시스 CAU 1447 또는 이의 배양물(배양액)을 우유에 접종하고 배양한 것을 저온 살균하고, 이를 우유와 혼합 및 가열한 후 치즈(커드)를 수득한 뒤 이로부터 수분을 제거하여 크림치즈를 제조할 수 있다.
하나의 실시 양태에서, 본 발명은
(1) 락토코커스 중앙젠시스 CAU 1447 균주 또는 이의 배양물을 우유에 접종하고 배양하는 단계;
(2) 상기 (1) 단계에서 배양된 배양액을 저온 살균하는 단계;
(3) 상기 저온 살균한 배양액을 우유와 혼합하여 가열하는 단계; 및
(4) 상기 가열하여 얻어진 치즈에서 수분을 제거하는 단계를 포함하는 간보호 또는 숙취해소용 크림치즈 제조방법을 제공한다.
또한 본 발명에 따른 락토코커스 중앙젠시스 CAU 1447 균주는 유산균 음료를 제조하는데 사용할 수 있다. 본 발명의 락토코커스 중앙젠시스 CAU 1447 균주를 배양하여 젖산 발효시킨 것에 살균수를 가해서 희석하고 당분, 향료 등을 가한 다음 용기에 충전한 제품을 일 수 있다. 이러한 음료에는 일반적으로 유산균이 살아 있는 채로 함유되어 있으므로, 음용 후 장 안에서의 정장작용을 기대할 수 있다.
그리고, 현미와 율무 등의 곡류 분말에 본 발명에 따른 락토코커스 중앙젠시스 CAU 1447 균주 또는 이를 포함하는 2-3종의 혼합 유산균을 처리하여 적정 온도에서 발효시킨 후, 백태, 찹쌀, 수수 등의 다양한 농산물을 영양적인 균형과 기호성이 우수하도록 적절히 배합하여 발효 생식제품을 제조할 수 있다.
본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는/및 치료용 약학적 조성물을 제공한다.
또한 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는/및 개선용 식품 조성물을 제공한다.
상기 알콜성 간 질환(Alcoholic liver disease, ALD)은 알콜에 의해 유발된 간의 손상을 주요 병리로 하는 질환이라면 그 종류가 특별히 제한되지 않으며, 급성 또는 만성 상태를 모두 포함한다. 일반적으로 ALD는 다음의 세 가지 상태를 포함한다: (a) 지방간; (b) 알코올성 간염; 및 (c) 간경변증으로 이루어진 군에서 선택되는 것일 수 있으나, 이에 제한되지 않는다.
가장 일반적인 알코올-유도된 간 질환인 지방간(예컨대, 지방증)은 간세포 내부에 지방의 과도한 축적으로 특징화된다. 알코올성 간염은 간의 염증 및 보다 심각한 손상으로 신체의 면역 시스템이 간 손상에 반응하고 이로 인해 야기된다. 간경변증은 정상 간세포가 상처 조직에 의해 대체되고(즉, 섬유증), 그 결과 간이 정상적인 기능을 할 수 없다.
또한 본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 간보호 또는 숙취해소(숙취 개선)용 식품 조성물을 제공한다.
상기 숙취 해소(숙취 개선)란 혈중 알콜 농도 저하 및 혈중 아세트알데히드 농도 저하를 포함하여, 음주 후 나타나는 속 쓰림과 구토, 두통 등의 숙취 증상의 완화 또는 개선을 의미한다.
본 발명의 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.
예를 들면, 건강식품으로는 본 발명의 락토코커스 중앙젠시스 CAU 1447 또는 이의 배양물을 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한, 본 발명의 락토코커스 중앙젠시스 CAU 1447 또는 이의 배양물을 숙취해소 효과, 알콜성 간손상 억제 효과 또는 장내 균총 개선 효과가 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.
또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치즈 등), 식용식물유지, 마가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 락토코커스 중앙젠시스 CAU 1447 또는 이의 배양물을 첨가하여 제조할 수 있다.
본 발명의 식품 조성물 중 상기 본 발명의 락토코커스 중앙젠시스 CAU 1447 또는 이의 배양물의 바람직한 함유량으로는 이에 한정되지 않지만 예를들어 최종적으로 제조된 식품 중 0.01 내지 90 중량%일 수 있다.
또한, 본 발명의 락토코커스 중앙젠시스 CAU 1447 또는 이의 배양물을 식품 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.
본 발명의 약학적 조성물에는, 본 발명의 균주 또는 이의 배양물을 단독으로 포함하거나, 또는 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제 등의 첨가제를 추가로 포함할 수 있다. 상기에서 '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 활성 성분의 작용을 저해하지 않으며 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 비독성의 조성물을 말한다.
약제학적으로 허용 가능한 첨가제로는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바 납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산 알루미늄, 스테아린산칼슘, 백당, 덱스트로스, 소르비톨 및 탈크 등이 사용될 수 있다. 본 발명에 따른 약제학적으로 허용 가능한 첨가제는 상기 조성물에 대해 0.1~90 중량부로 포함되는 것이 바람직하나 이에 제한되는 것은 아니다.
또한, 본 발명의 조성물은 실제 임상 투여 시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 약학적으로 허용되는 담체로 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 그 밖의 약학적으로 허용되는 담체로는 당업계에 공지되어 있는 것을 참고로 할 수 있다.
본 발명의 약학적 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여(일례로 도포법 등)할 수 있다. 또한 본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.
일례로 경구 투여용 제제의 경우에 본 발명의 조성물은 동결-건조된 분말, 캡슐제, 과립, 정제, 환제, 당의정제, 액제, 겔제, 시럽제, 슬러리제, 현탁액, 웨이퍼 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 여기에 적합한 보조제를 첨가한 후 캡슐제 등으로로 가공함으로써 제공될 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 나아가, 본 발명의 약학적 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있으며, 이에 제한되지 않는다.
본 발명의 조성물에서, 균주의 유효량의 콜로니 형성 단위(CFU)는 당해 기술 분야의 당업자가 목적하는 바(질병 예방, 건강 또는 치료적 처치) 또는 필요에 의해 결정될 수 있으며, 또한 최종 제형에 따라 결정될 수 있다.
일례로, 본 발명의 균주를 식품 또는 약품의 제조 시에 전체 조성물 1g(또는 ㎖) 당 균을 1 x 10 5 내지 1 x 10 15 개(균수 또는 CFU) 첨가할 수 있고, 바람직하게는 1 x 10 6 내지 1 x 10 13개의 양으로 첨가할 수 있으나, 이에 제한되지 않는다.
또한 하나의 예시적 실시 양태에서, 본 발명의 균주가 포함된 조성물의 1일 섭취량은 총 균체수 기준으로 1×10 5 내지 1×10 10 CFU/kg, 바람직하게는 일례로 1×10 6 내지 1×10 9 CFU/kg일 수 있고, 섭취는 하루에 한 번 섭취할 수도 있고, 수회 나누어 섭취할 수도 있으나, 이에 제한되는 것은 아니다.
본 발명은 알콜성 간 질환(Alcoholic liver disease)의 치료용 제제를 제조하기 위한 상기 균주 또는 이의 배양물의 용도를 제공한다.
본 발명은 상기 균주 또는 이의 배양물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 알콜성 간 질환(Alcoholic liver disease)의 치료 방법을 제공한다.
본 발명은 간 보호 또는 숙취해소용 제제를 제조하기 위한 상기 균주 또는 이의 배양물의 용도를 제공한다.
본 발명의 상기 ‘유효량’이란 개체에게 투여하였을 때, 알콜성 간 질환의 개선, 치료, 예방, 검출, 진단 또는 알콜성 간 질환의 억제 또는 감소 효과를 나타내는 양을 말하며, 상기 ‘개체’란 동물, 바람직하게는 포유동물, 특히 인간을 포함하는 동물일 수 있으며, 동물에서 유래한 세포, 조직, 기관 등일 수도 있다. 상기 개체는 상기 효과가 필요한 환자(patient) 일 수 있다.
본 발명의 상기 ‘치료’는 알콜성 간 질환 또는 알콜성 간 질환의 증상을 개선시키는 것을 포괄적으로 지칭하고, 이는 상기 질환을 치유하거나, 실질적으로 예방하거나, 또는 상태를 개선시키는 것을 포함할 수 있으며, 상기 질환으로부터 비롯된 한 가지 증상 또는 대부분의 증상을 완화시키거나, 치유하거나 예방하는 것을 포함하나, 이에 제한되는 것은 아니다.
본 명세서에서 용어 “을 포함하는(comprising)”이란 “함유하는(including)” 또는 “특징으로 하는(characterized by)”과 동일한 의미로 사용되며, 본 발명에 따른 조성물 또는 방법에 있어서, 구체적으로 언급되지 않은 추가적인 구성 성분 또는 방법의 단계 등을 배제하지 않는다. 또한 용어 “로 이루어지는(consisting of)”이란 별도로 기재되지 않은 추가적인 요소, 단계 또는 성분 등을 제외하는 것을 의미한다. 용어 “필수적으로 이루어지는(essentially consisting of)”이란 조성물 또는 방법의 범위에 있어서, 기재된 물질 또는 단계와 더불어 이의 기본적인 특성에 실질적으로 영향을 미치지 않는 물질 또는 단계 등을 포함할 수 있는 것을 의미한다.
본 발명의 락토코커스 중앙젠시스 CAU 1447은 ADH 및 ALDH 관련 기능성을 가질뿐만 아니라, 특히 우수한 내산성 및 내담즙성을 가지기 때문에 동물(특히, 인간)의 소화관 내에서 균주가 가지는 기능성을 잘 나타내며 생육하는 능력이 우수하고, 간 보호, 숙취해소 및 알콜성 간질환에 대한 예방, 개선, 치료 효과가 우수하다.
도 1은 본 발명의 신균주 Lactococcus chungangensis CAU 1447(이하, CAU 1447로 지칭)의 증식능(일반적 배양환경) 및 내산성(pH 2.0) 능력을 측정한 결과를 나타내는 것으로서, 기존 CAU28 균주와 비교하여 우수한 증식능 및 내산성을 가짐을 확인하였다.
도 2는 본 발명의 신균주 CAU 1447의 내담즙성 능력을 측정한 결과를 나타내는 것으로서, 기존 CAU28 균주와 비교하여 우수한 내담즙성을 가짐을 확인하였다.
도 3은 본 발명의 신균주 CAU 1447에 대하여, ADH 및 ALDH 유전자 발현 상태를 확인한 결과를 나타낸다(A; Lactococcus chungangensis CAU1447, B: Lactococcus chungangensis CAU28,).
도 4a는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 혈액 내 ALP(alkaline phosphatase) 수준 변화를 확인한 결과이다.
도 4b는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 혈액 내 AST(aspartate aminotransferase) 수준 변화를 확인한 결과이다.
도 4c는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 혈액 내 ALT(alanine aminotransferase) 수준 변화를 확인한 결과이다.
도 4d는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 혈액 내 빌리루빈 수준 변화를 확인한 결과이다.
도 4e는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 혈액 내 중성지질(Triglyceride) 수준 변화를 확인한 결과이다.
도 4f는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 혈액 내 알부민 수준 변화를 확인한 결과이다.
도 5a는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 TNF-alpha mRNA 발현 수준 변화를 확인한 결과이다.
도 5b는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 IFN-gamma mRNA 발현 수준 변화를 확인한 결과이다.
도 5c는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 IL-1beta mRNA 발현 수준 변화를 확인한 결과이다.
도 5d는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 IL-10 mRNA 발현 수준 변화를 확인한 결과이다.
도 6a는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 NF-kB mRNA 발현 수준 변화를 확인한 결과이다.
도 6b는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 COX-2 mRNA 발현 수준 변화를 확인한 결과이다.
도 6c는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 iNOS mRNA 발현 수준 변화를 확인한 결과이다.
도 6d는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 TLR4 mRNA 발현 수준 변화를 확인한 결과이다.
도 6e는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 SOD mRNA 발현 수준 변화를 확인한 결과이다.
도 7은 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 SOD 활성 수준 변화를 확인한 결과이다. SOD 증가는 간손상의 지표이다.
도 8a는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 부티레이트(butyrate) 수준 변화를 확인한 결과이다.
도 8b는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 아세테이트(acetate) 수준 변화를 확인한 결과이다.
도 8c는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직 내 아세테이트/부티레이트 비율(acetate/butyrate ratio) 변화를 확인한 결과이다.
도 9는 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 간 조직의 병리학적 변화를 관찰한 현미경 이미지이다(A: 음성대조군, B: 양성대조군, C: 실리마린 투여군, D: CAU 1447 균체 투여군, E: CAU 1447 크림치즈 투여군).
도 10은 알콜성 간손상 동물모델에서, CAU 1447 균체 투여 또는 CAU 1447 크림치즈 투여에 따른 소장 융모(villus)의 병리학적 변화를 관찰한 현미경 이미지이다(A: 음성대조군, B: 양성대조군, C: 실리마린 투여군, D: CAU 1447 균체 투여군, E: CAU 1447 크림치즈 투여군).
도 11은 알콜성 간손상 동물모델에서 본 발명의 CAU 1447 균체 및 CAU 28 균체의 투여에 따른 간 무게 개선 정도를 비교적으로 나타낸다.
도 12는 알콜성 간손상 동물모델에서 본 발명의 CAU 1447 균체 및 CAU 28 균체 투여에 따른 간/체중 비율(liver/body weight ratio) 개선 정도를 비교적으로 나타낸다.
도 13a는 알콜성 간손상 동물모델에서 본 발명의 CAU 1447 균체 및 CAU 28 균체 투여에 따른 ALP 개선 정도를 비교적으로 나타낸다.
도 13b는 알콜성 간손상 동물모델에서 본 발명의 CAU 1447 균체 및 CAU 28 균체 투여에 따른 AST 개선 정도를 비교적으로 나타낸다.
도 13c는 알콜성 간손상 동물모델에서 본 발명의 CAU 1447 균체 및 CAU 28 균체 투여에 따른 ALT 개선 정도를 비교적으로 나타낸다.
도 13d는 알콜성 간손상 동물모델에서 본 발명의 CAU 1447 균체 및 CAU 28 균체 투여에 따른 중성지방(Triglyceride) 개선 정도를 비교적으로 나타낸다.
이하 본 발명을 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
실시예 1 : 신균주 Lactococcus chungangensis CAU 1447의 분리
1-1. 신균주의 분리 및 동정
유산균주의 개발을 위하여, 본 발명자들은 배추김치(만리동 재래시장, 서울, 한국) 50g을 분쇄한 시료의 액상 부분 1ml을 취하여, PBS(인산 완충 식염수)를 이용하여 십진 희석법으로 희석 후, 100ul를 M17(BD BBL, Sparks, MD, USA) 한천 플레이트에 도말하여 30℃ 배양기에 2 ~ 3 일 동안 배양하여 균을 관찰하였다. 각 시료에서 단일집락을 무작위로 선별하여 MRS 한천배지에 획선평판법으로 분리 접종 후 30℃ 배양기에 24시간 배양하였다. 확인된 균을 MRS 액체배지에 접종한 후 30℃에서 16시간 배양하여 80% glycerol stock을 제조해 초저온 냉동고(-70℃)에 보관하여 실험에 사용하였다.
분리된 다수의 균주 중, CAU 1447 균주를 최종 선발하여 동정 분석하였다. 균주의 동정은 생리 생화학적 방법과 분자계통분류학적 방법으로 실시하였다. 이를 위한 16S rRNA 유전자 염기서열 결정 및 분석 방법은 다음과 같다. DNA의 분리를 위하여, 먼저 배양한 균체를 모아 STES 버퍼[0.4 M NaCl, 0.2 M Tris-HCl(pH 7.6), 0.01 M EDTA, 1% SDS] 100 ㎕에 현탁시켰다. 시료에 글래스 비드(glass bead)를 첨가하여 5분간 TOMY(micro tube mixer MT-360)로 파쇄하여 세포질을 용출시켰다. 세포 용출액을 TE 버퍼(pH 8.0) 200 ㎕, 페놀/클로로포름(phenol/chloroform) 200 ㎕에 현탁하여 12,000 rpm에서 5 분간 원심분리를 수행한 후, 상층액을 RNase A 5 ㎕로 처리한 다음 37℃ 조건에서 1시간 동안 반응시키고 다시 클로로포름을 첨가하여 12,000rpm에서 5분간 원심분리를 수행하였다. 이후 원심분리한 시료의 상등액을 에탄올로 2회 세척한 후 건조(vacuum dry: SpeedVac)시켰다. 최종적으로 회수한 DNA는 멸균 증류수에 용해 보존하였다. 16S rDNA의 PCR 증폭에는 PCR premix(바이오니아, 대한민국)와 유니버셜 프라이머(universal primer)를 사용하였으며, 정방향 프라이머(5'-AGAGTTTGATCCTGGCTCAG-3'/서열번호 2)와 역방향 프라이머(5'-AAGGAGGTGATCCAGCC-3'/서열번호 3)를 사용하여 증폭시켰다. PCR 증폭시 총 반응액 20 ㎕로 맞추어 PCR을 수행하였다. DNA 변성을 위해 94℃에서 1분, 프라이머의 결합을 위해 50℃에서 1분, DNA 가닥의 합성을 위해 72℃에서 1분 50초 과정을 30회 반복하였다. 증폭된 DNA의 염기서열결정 및 계통분류학적 분석은 장 등(Chang et al., Int. J. Syst. Evol. Microbiol. 52: 377-381, 2002)의 방법에 따라 실시하였다.
CAU 1447 균주의 형태적인 특징으로는 그람 양성이며 구균임을 확인하였고, 16S rRNA 유전자의 염기서열 분석결과 락토코커스 중앙젠시스 CAU28( Lactococcus chungangensis CAU28 , KCTC12684BP)와 99.44%의 상동성을 나타내어 동일종으로 동정하였다(서열번호 1 참조). 상기 동정된 본 발명의 신규한 미생물은 대한민국 대전광역시 유성구 어은동 52번지에 위치한 한국생명공학연구원 생물자원센터 (Korean Collection for Type Cultures)에 2019년 6월 27 일자로 ' Lactococcus chungangensis CAU 1447'으로 기탁하였다(기탁번호 KCTC 13873BP).
실시예 2 : 생화학적 특성 조사
신균주의 생화학적 성상 분석을 위하여 API 50CH system(BioMrieux, Marcy I'Etolite, France)을 이용하여, 30℃에서 48시간 동안 배양한 후 본 발명 신균주의 당 발효패턴을 분석하였다. 탄수화물 대사 특성 분석결과는 하기 표 1에 나타내었다.
Figure PCTKR2020008940-appb-img-000001
(+,양성; -,음성; w,약한 양성)
API test를 이용하여 CAU28과 CAU1447의 당 발표 패턴을 확인한 결과, 상기 표 1 에서 보는 바와 같이 균 성장에 이용되는 탄수화물 종류가 서로 상이한 것을 확인하였다. 본 발명의 CAU 1447 균주는 D-글루코오스(D-glucose), D-프룩토오스(D-Fructose), D-만노스(D-Mannose), D-만니톨(D-mannitol), N-아세틸 글루코사민(N-Acethyl glucosamine), 에스쿨린(Esculin), D-셀로비오스(D-Cellobiose), D-말토오스(D-Maltose), D-수크로스(D-sucrose), D-트레할로오스(D-Trehalose) 및 겐티오비오스(Gentiobiose) 당의 이용이 활발한 것으로 나타났으며, 그 외에 아미그달린(Amygdalin) 및 포타슘 5-케토-글루코네이트(Potassium 5-Keto-Gluconate) 또한 탄소원으로 이용하는 것으로 나타났다.
실시예 3: 균체 증식능 및 내산성 평가
신균주 CAU 1447의 산에 대한 내성을 규명하기 위하여, HCl을 이용하여 pH 2.0으로 적정한 MRS 액체 배지(proteose peptone No.3 10.0g, Beef extract 10.0g, Yeast extract 5.0g, Dextrose 20.0g, Poly Sorbate 80 1.0g, Ammonium citrate 2.0g, Sodium Acetate 5.0g, Magnesium Sulfate 0.1g, Manganese sulfate 0.05g, Dipotassium phosphate 2.0g)에 균주를 접종하여 배양한 후 생균수를 측정하였다. 보다 구체적으로, 상기 락토코커스 중앙젠시스 CAU 1447 균주 또는 CAU28 균주를 MRS 액체배지에 접종 후, 30℃에서 12시간 동안 배양하고 균체를 원심분리를 통해 회수한 후에, 멸균수로 OD 600값을 1.0으로 조절한 현탁액 30μl를 pH 2.0(위액과 동일한 조건)으로 적정한 MRS 액체 배지에 접종하여 30℃ 조건에서 배양하면서 시간에 따라, 생균수를 Nanodrop (NanoQuant infinite M200, TECAN)으로 A600 nm에서 측정하였다. 하기 표 3의 데이터는 각 균주별로 일반배양(control(pH 7.0)) 상태의 ATR을 1로 할 때, pH 2.0에서 배양한 결과에 대한 상대적 ATR를 나타낸다.
ATR (Acid tolerance rate)
CAU 28 CAU 1447
pH 2.0 0.95 1.06
먼저, 일반적인 배양 환경에서(control) 양 균주간의 증식능을 비교하면, 도 1에서 보는 바와 같이, CAU1447은 CAU28과 비교하였을 때 동일 시간 및 조건에서 더 높은 성장을 보여, 본 발명의 신균주 CAU1447이 더 높은 증식능을 가지는 것으로 확인되었다.
또한 도 1 및 표 3에서 보는 바와 같이, CAU 1447은 pH 2.0(위액과 동일 조건)의 MRS 배지에서 성장하는 능력을 보였다. CAU 1447은 시간이 지날수록 균수가 상당 수준 증가하였으며, 이로서 강산의 조건에서 저해되지 않음을 확인하였다. 이에 반해 CAU28 균주는 균체가 증식하지 못하는 것으로 확인되었다. 따라서 본원 발명의 CAU1447이 더욱 우수한 내산성을 가짐을 확인하였다.
실시예 4 : 내담즙성 평가
신균주 CAU 1447의 담즙산에 대한 내성 특성을 실험하기 위하여, 담즙산(ox-bile(oxgall) dry pure, Merck, Germany)을 0, 0.2 및 0.4%(w/v)씩 첨가한 MRS 액체 배지에 균주를 접종하여 배양한 후 생균수를 측정하였다. 보다 구체척으로, 상기 락토코커스 중앙젠시스 CAU 1447 균주 또는 CAU28 균주를 MRS 액체배지에 접종 후, 30℃에서 12시간 동안 배양하고 균체를 원심분리를 통해 회수한 후에, 멸균수로 OD 600값을 1.0으로 조절한 현탁액 30μl를 0, 0.2 및 0.4%의 담즙산이 포함된 MRS 액체 배지에 접종하여 30℃에서 0-12시간 배양한 후에, 생균수를 Nanodrop (NanoQuant infinite M200, TECAN)으로 A600 nm에서 측정하였다.
Bacteria counts as log incubation time (h)
Bile concentration% strain 3h 6h 9h 12h
0.2 CAU 28 1.79±0.17 2.05±0.38 2.05±0.44 2.29±0.23
CAU 1447 1.84±0.21 2.59±0.12 3.89±0.2 4.51±0.05
0.4 CAU 28 1.71±0.28 1.68±0.14 1.63±0.09 2.35±0.05
CAU 1447 1.71±0.09 2.64±0.21 2.43±0.17 3.47±0.12
실험결과 도 2 및 표 4에서 보는 바와 같이, 0.2% 또는 0.4%의 담즙이 첨가된 MRS 배지에서 CAU 1447 균주는 CAU 28 균주보다 더 우수한 생육능을 보였다.
실시예 5: ADH 및 ALDH 효소 발현 및 활성 확인
L. chungangensis CAU28 균주는 기존에 ADH(alcohol dehydrogenase), ALDH(aldehyde dehydrogenase) gene을 보유하고 있는 것으로 알려져 있다. 이에 본 발명의 신균주 L. chungangensis CAU 1447에도 상기 유전자가 존재하는지 여부를 확인하였다. 구체적으로 표 5에 기재된 바와 같이 각 유전자를 증폭하는 프라이머 쌍을 이용하여, PCR을 이용한 증폭 여부로 유전자 존재 여부를 확인하였다.
유전자 정방향 프라이머(5'→3') 역방향 프라이머(5'→3')
ADH GGTTTGTGACCCAGGTATGGT(서열번호 4) GTTCCAAGCACCACCAACT(서열번호 5)
ALDH GTTGCCATCATTGACACTTGGT(서열번호 6) AGGAATGTTCCAAGCACCAC(서열번호 7)
실험 결과 도 3에서 보는 바와 같이, 기존에 CAU28 균주가 가지고 있는 특징적 유전자인 ADH, ALDH gene 이 CAU 1447에도 모두 존재하는 것을 모두 존재하였으며, ADH, ALDH 효소의 활성을 확인하였다. 숙취해소 및 알콜성 간 손상에 대한 보호 작용에 있어서 ADH 및 ALDH 활성은 중요하게 작용한다. 본 발명의 신균주 CAU 1447은 ADH 및 ALDH 활성을 가질 뿐만아니라 CAU28과 비교하여 높은 내산성을 나타내고 답즙산 존재 환경에서도 기존 균주보다 높은 생육능을 가지기 때문에, 실제 프로바이오틱스로서 섭취 시(특히, 알콜과 함께 섭취 시) 숙취해소 및 알콜에 의한 간손상에 대하여 보호 효능이 더 우수한 것으로 사료되었다.
실시예 6: 대사체(Metabolite) 분석
다양한 유산균들은 대사과정에서 생성되는 다양한 생성물인 대사체를 만들어내는 것으로 알려져 있다. 이에 본 발명의 신균주 CAU 1447 가 대사과정에서 만드는 수많은 대사체 종류 중에 지방산, 유기산, 아미노산을 확인하였다. 보다 구체적으로, 상기 동결 건조된 CAU 1447 균주를 PBS에 용해하여 서울대학교 농생명과학공동기기원에 의뢰하여 분석하였다.
Fatty acids L. chungangensis CAU 1447
mg/g
Caproic acid(Hexanoic acid) 0.094
Lauric acid (Dodecanoic acid) 0.087
Myristic acid (Tetradecanoic acid) 0.307
Palmitic acid (Hexadecanoic acid) 1.220
Palmitoleic acid (Omega-7) 0.311
Stearic acid (Octadecanoic acid) 1.038
Oleic acid (Omega-9) 0.435
Linoleic acid (Omega-6) 0.099
Alpha-linolenic acid(ALA) (Omega-3) 0.764
실험 결과 표 5에서 보는 바와 같이, L. chungangensis CAU 1447 균주가 대사과정에서 만드는 대사체 분석 결과 지방산의 경우 Palmitic acid가 1.220mg/g, Palmitoleic acid(Omega-7)는 0.311mg/g, Oleic acid(Omega-9)는 0.435mg/g, Linoleic acid(Omega-6)는 0.099mg/g 그리고 Alpha-linolenic acid(ALA) (Omega-3)는 0.764mg/g이 분석되었다.
Amino/Organic acids L. chungangensis CAU 1447
mg/L
Lactic acid 1138.339
Acetic acid 284.713
Aspartic acid 77.19
Glutamic acid 272.43
Asparagine 105.88
Serine 112.99
Glutamine 30.72
Histidine 44.81
Glycine 178.60
Threonine 89.12
Alanine 127.05
GABA 46.81
Valine 113.16
Methionine 61.57
Tryptophane 57.33
Phenylalanine 92.26
Isoleucine 61.15
Leucine 276.01
Lysine 397.66
Proline 16.58
실험 결과 표 6에서 보는 바와 같이, L. chungangensis CAU 1447 균주가 대사과정에서 만드는 대사체 분석 결과 유기산의 경우, Lactic acid가 1138.339mg/L 로 가장 많이 생성되었고 Acetic acid도 284.713mg/L로 높은 생성량을 확인하였다. 마찬가지로 아미노산의 경우 Glutamic acid는 272.43mg/L, Glycine은 178.60mg/L, Alanine은 127.05mg/L, Leucine은 276.01mg/L, 그리고 Lysine은 397.66mg/L로 높은 생성량을 확인하였다.
실시예 7: 알콜성 간질환 동물모델에서, 본 발명 신균주 CAU 1447의 간보호 효과 확인
실험방법
1) 균주 시료 준비
L. chungangensis CAU 1447을 tryptic soy broth (Difco, BD)로 30 ℃에서 2 ~ 3 일 동안 배양하고, 동결 건조시킨 후, PBS에 1x10 9 CFU/mL의 농도로 재현탁하여 1회 용량(single dose)으로 준비하였다.
L. chungangensis CAU 1447 크림치즈는 다음과 같은 방법으로 준비하였다. 크림치즈 스타터로 사용될 L. chungangensis CAU 1447를 산성화된 우유에 접종하여 48시간 동안 배양하였다. 배양 후, 68℃에서 30분 동안 저온 살균하여 식힌 것을 우유와 섞어 70℃에서 5분간 가열하였다. 가열 후 생긴 치즈의 수분을 제거하기 위해 천을 이용해 커드만을 얻었고, 0.5% 소금을 이용하여 수분을 제거하여 치즈를 완성하였다. 이렇게 완성된 치즈는 고체형태로 보관하기 위해 건조를 실시하여 추가 실험이 있기까지 4℃에서 보관하였다.
2) 동물 실험
5주령의 수컷 Sprague-Dawley(SD) 래트 (n = 30)를 Central Lab Animal Incorporation (Seoul, Korea)에서 구입하여, 실험 시작 전 1주일 동안 순응시켰다. 각 그룹 당 6마리의 래트가 구성되었고, 이들은 2개의 케이지(cage)에 케이지 당 3마리씩 나뉘어 수용되었다. 래트는 12-h light/dark 주기 하에서, 완전영양식(nutritionally complete diet)과 물을 자유롭게 이용할 수 있게 하였다. 온도와 24℃±2℃였으며, 습도는 55%±10%였다. 모든 실험은 한국 식품의약품안전처(Food and Drug Administration)의 지침에 따라 수행되었다. 중앙 대학교 동물 실험 센터의 기관 동물 관리 및 사용위원회에 제출 및 승인된 프로토콜에 의해 위임된 윤리 지침에 따라, 샘플을 래트에서 채취 하였다(승인 번호 2018-00022).
3) 에탄올 섭취
처음에 래트들은 50% 알코올을 4g/kg body weight/day로 투여 받았다. 그 후 알코올 투여량을 매월 1g/kg씩 증가시키고, 2개월 동안 투여를 지속하였다. 투여량이 6g/kg/day에 도달한 후에, 추가로 2주간 더 투여하였다. 알코올은 경구 위관법(oral gavage)으로 하루 1회 투여되었다.
4) 실험 설계
5 주령의 수컷 SD 래트(n = 30)를 무작위로 5개의 그룹(n = 6 / 그룹)으로 나누었으며, 각각의 시험군은 다음과 같다: (1) 음성 대조군(PBS), (2) 양성 대조군 (50% 알코올), (3) 약물 대조군(알코올 + 실리마린), (4) L. chungangensis CAU 1447 그룹 (알코올 + L. chungangensis CAU 1447 균체), 및 (5) CAU 1447 크림 치즈 그룹 (알코올 + L. chungangensis CAU 1447로 만든 크림 치즈)
연구 기간 동안, silymarin, L. chungangensis CAU 1447 균체 및 CAU 1447 크림 치즈는 각각 알코올 투여 2 시간 후에 래트에 투여되었다. 체중은 매일 측정되었다. Silymarin(Sigma-Aldrich, St. Louis, MO, USA)은 간 질환 치료에 흔히 사용되며, 본 연구에서 L. chungangensis CAU 1447 균체와 L. chungangensis CAU 1447로 만든 크림 치즈의 ALD(알콜성 간질환)에 대한 효과를 비교하기 위해 사용되었다. Silymarin(150 mg/kg body weight/day)을 PBS 1mL에 용해시키고 경구 위관법으로 투여했다. 동결 건조 L. chungangensis CAU 1447(1 x 10 9 CFU/rat/day) 균체와 L. chungangensis CAU 1447로 제조한 크림 치즈(1.4 g/kg body weight/rat)를 1 mL PBS에 용해시키고, 경구 위관법(oral gavage)으로 투여하였다. 음성 대조군은 동량의 PBS로 처리하였다. 상기 시험물질 처리는 10 주간 지속되었다. 적응 기간을 거치고 난 후, 알코올을 경구 투여하기 전 1 주일 동안 각 그룹의 래트들에 각각 silymarin, L. chungangensis CAU 1447 균체 및 L. chungangensis CAU 1447로 만든 크림 치즈가 사전 투여되었다. 알코올 투여 10주 후에, 래트를 희생시키기 전 약 12 시간 동안 금식시키고 CO 2 흡입에 의해 마취시켰다. 분석을 위해 장기를 절제하였다.
5) 혈청 생화학적 분석
장기를 적출하기 전에, CO 2로 마취를 하고 혈청 생화학 분석을 위해 1.5 mL의 microcentrifuge tube에 심장 혈액(cardiac blood)을 수집하였으며, 약 4 ℃에서 약 1 시간 동안 보관했다. 그 뒤, 혈액 샘플을 4℃에서 2000 x g으로 30 분간 원심분리하여 혈청을 분리하였다. ALP(alkaline phosphatase), AST, ALT, 빌리루빈, 알부민, 트리글리세라이드(triglyceride) 및 콜레스테롤 수치의 생화학적 분석을 수행하기 전까지는, 상기 혈청을 -80℃에서 보관했다. 생화학 분석은 GC Labs(Yongin, Korea)에 의해 수행되었다.
6) 간 조직으로부터 사이토카인, 염증 인자 및 SOD 수준 분석
신선한 간 조직 및 냉동 간 조직을 이용하여, 사이토카인들(TNF-alpha, IFN-gamma, IL-1beta, IL-10), 염증 인자들(iNOS, NF-kB, COX-2, 및 TLR4) 및 SOD의 mRNA 발현 수준 분석을 수행하였다. mRNA 수준은 real-time PCR 분석에 의해 정량화되었다. 약 20-30 mg의 간 조직을 균질화(homogenize)하였다. 간 조직으로부터 전체 RNA를 분리하기 위해 RNeasy mini kit(Qiagen, Hilden, Germany)를 제조업체의 지침에 따라 사용했다. 그 뒤, 추출된 RNA에 RNase-free water 50 μL를 첨가하여 -20℃에서 보관하였다. 추출된 RNA의 농도는 NanoQuant Spectrophotometer(Infinite 200; Tecan, Mannedorf, Switzerland)를 사용하여 측정되었다. 다음으로 PrimeScript first-strand cDNA synthesis kit (Takara Bio, Shiga, Japan)를 사용하여, 1μg total RNA를 cDNA로 역전사시켰다. 7500 Fast Real-time PCR system(Applied Biosystems, Foster City, CA, USA) 및 SYBR green PCR kit(Qiagen)를 이용해 real-time quantitative PCR을 수행하여, mRNA 발현을 정량화하였다. 배수변화(Fold changes)는 2 -△△Ct 방법을 사용하여 결정되었다. 사용된 프라이머 서열을 (표 6)에 나타내었다. GAPDH(Glyceraldehyde 3-phosphate dehydrogenase)를 대조군으로 사용 하였다.
IL-1beta Foward : CACCTTCTTTTCCTTCATCTTTG 서열번호 8
Reverse : GTCGTTGCTTGTCTCTCCTTGTA 서열번호 9
TNF-alpha Foward : GTCGTAGCAAACCACCAAGC 서열번호 10
Reverse : TGTGGGTGAGGAGCACATAG 서열번호 11
IFN-gamma Foward : TCTGGAGGAACTGGCAAAAG 서열번호 12
Reverse : TTCAAGACTTCAAAGAGTCTGAGG 서열번호 13
IL-10 Foward : GGGAAGCAACTGAAACTTCG 서열번호 14
Reverse : ATCATGGAAGGAGCAACCTG 서열번호 15
COX-2 Foward : AATCGCTGTACAAGCAGTGG 서열번호 16
Reverse : GCAGCCATTTCTTTCTCTCC 서열번호 17
iNOS Foward : CCTTGTTCAGCTACGCCTTC 서열번호 18
Reverse : GGTATGCCCGAGTTCTTTCA 서열번호 19
SOD Foward : GGTCCACCTCGAACTACTTTATG 서열번호 20
Reverse : GGTGATCAGGAACATGGAATCT 서열번호 21
TLR-4 Foward : GATGCCTCTCTTGCATCTGG 서열번호 22
Reverse : TCATGAGGGATTTTGCTGAGA 서열번호 23
NF-kB Foward : CAGAGCTGGCAGAGAGACTG 서열번호 24
Reverse : TACGAAGGAGACTGCCACTG 서열번호 25
GAPDH Foward : CAAGTTCAACGGCACAGTCAA 서열번호 26
Reverse : TGGTGAAGACGCCAGTAGACTC 서열번호 27
7) 간(liver) 항산화 효소 활성 분석
간 항산화 효소 및 SOD 활성은 Superoxide Dismutase Assay kit(Cayman Chemical, Ann Arbor, MI, USA)를 사용하여, 제조사의 프로토콜에 따라 측정하였다. 분석에 사용할 때까지 래트(rat) 간 조직 절편을 액체 질소에 보관 하였다. 210 mM 만니톨, 1 mM EGTA 및 70 mM 수크로오스(sucrose)를 함유하는 차가운 HEPES 완충액에서 간 조직을 균질화시키고, 4℃에서 5분 동안 1500 x g으로 원심분리시켰다. 상층액의 분취량(aliquot)을 멸균된 microcentrifuge tube에 옮기고, 항산화 효소 활성 분석시까지 -80 ℃에서 보관하였다. 활성은 U/mL 로서 측정되었다. 마이크로플레이트 리더를 사용하여 450 nm에서의 흡광도를 측정하였다.
8) 분변 시료 내 단쇄 지방산(Short-chain fatty acids , SCFAs)
분변 샘플을 매주 수집하고, 고성능 액체 크로마토그래피(HPLC; Ultimate 3000; Thermo Scientific Dionex, Sunnyvale, CA, USA)를 사용하여 SCFA의 농도를 측정하였다. 4-methylvaleric acid(0.25 mM)을 100 mg 분변 샘플에 첨가하고 볼텍싱(vortexing)한 후, 12,000 x g에서 5분간 원심 분리하였다. 상등액을 버린 후, 펠렛(pellet)을 증류수와 혼합하고 볼텍싱하였으며, 이를 12,000 x g에서 5분간 원심분리하였다. 그런 다음 상등액을 여과하고, 상등액의 분취량(aliquot)을 일회용 원심분리 튜브로 옮기고, HPLC 분석에 사용시까지 -20℃에서 보관했다. 부티레이트(Butyrate) 및 아세테이트산(acetate acid)을 HPLC로 분석하였다. 각 SCFA의 조성은, 전체 SCFA(mg/L)에 대한 백분율로 제시된다.
9) 조직학적 분석
신선한 간(liver)과 장(intestine) 조직을 조심스럽게 분리하고, 3-5μm 두께의 절편으로 자른 다음, 10% 포르말린에 고정시키고 파라핀 포매하였다. 24 시간 후, 파라핀 포매된 조직을 헤마톡실린 및 에오신(H&E)으로 염색하였다. 그 후 상기 조직 샘플들은 조직병리학적 변화를 평가하기 위해 400x 배율로 현미경(DM 4000B; Leica Microsystems, Wetzlar, Germany) 관찰되었다. 각 샘플에 대해 최소 3개의 슬라이드를 평가했다.
10) 통계학적 분석
통계 데이터는 GraphPad Prism(v.7.0)을 사용하여 분석하였으며, 데이터는 '평균값 ± 평균값의 표준 오차(means ± standard errors of the means)'로 표시된다. 두 개 이상의 그룹 간 효과를 비교하기 위해, Bonferroni's post-hoc test로 일원분산분석(one way analysis of variance)이 수행되었다. p 값이 0.05 미만인 결과는 유의한 것으로 간주되었다.
실험결과
7-1. L. chungangensis CAU 1447 처리에 의한 간/체중 비율 감소 효과
체중 및 간 중량을 측정하여, 간/체중 비율(liver/body weight ratio)을 구하였다. 알코올만 처리된 양성 대조군에서 간 중량이 증가하였고, 간/체중 비율이 알콜만 처리된 양성 대조군에서 가장 높았다. 대조적으로 CAU 1447(균체) 및 CAU 1447 크림 치즈 그룹에서는 간/체중 비율이 감소하여 음성 대조군과 비슷하게 나타났다.
7-2. 간 기능과 관련된 생화학적 파라미터들에 대한 L. chungangensis CAU 1447의 효과
다음으로 혈청 샘플을 이용하여 간 손상 및 지방간과 관련된 생화학적 요인들의 변화를 평가하였다. 과도한 장기간의 알코올 섭취는 ALD(Alcoholic liver disease) 및 간 손상을 일으킨다. 알콜-처리된 양성 대조군에서 ALP(alkaline phosphatase), AST(aspartate aminotransferase) 및 ALT(alanine aminotransferase) 혈청 수준의 유의한 증가가 관찰되었다. 이는 알콜 섭취가 간염, 지방간 및 장 손상에 영향을 미칠 수 있음을 제시한다. AST와 ALT는 간세포 마커이며 간세포 손상 후 간으로부터 방출된다.
그러나 silymarin 처리군, CAU 1447 균체 처리군 및 CAU 1447 크림 치즈 처리군에서는 ALP, AST 및 ALT의 혈청 수준이 양성 대조군과 비교하여 감소했다(도 4a, 도 4b 및 도 4c).
또한 silymarin 처리군, CAU 1447 처리군 및 CAU 1447 크림 치즈 처리군에서는 빌리루빈(bilirubin)과 트리글리세라이드(triglycerid) 혈청 농도가 양성 대조군보다 낮았다(도 4d 및 도 4e). 대조적으로, 혈청 알부민 수치는 양성 대조군에서 가장 낮았으며(도 4f), CAU 1447 처리군 및 CAU 1447 크림치즈 처리군에서 높아졌다.
7-3. L. chungangensis CAU 1447로 처리한 래트(rat)의 간 조직 내 mRNA 발현 수준
ALD에서 TNF-alpha의 상향 조절은 다양한 사이토카인 또는 케모카인을 자극하여 지방간염(steatohepatitis)을 유도하고 간 손상의 진행을 촉진시키는 것으로 알려졌다. TNF-alpha는 또한 전신성 염증과 관련이있는 것으로 생각되고 있으며 ALD의 진행에 중요한 요소이다. IL-1beta는 ALD 동물 모델과 ALD 환자의 간에서 상향 조절되는 주요한 전염증성 사이토카인이다. 이러한 전염증성 사이토카인들의 발현은 간 손상에서 간세포 기능 장애, 염증, 괴사 및 세포사멸(apoptosis)의 결과를 가져온다.
실험결과 TNF-alpha, IFN-gamma, IL-1beta 및 IL-10을 포함한 염증성 사이토카인의 발현 수준은 알콜-처리된 양성 대조군 간 조직에서 유의하게 증가하였다 (도 5a, 도 5b, 도 5c 및 도 5d). CAU 1447 균체 및 CAU 1447 크림 치즈의 경구 투여는 이들 사이토카인의 유도를 억제하였으며 또한, 이들 사이토카인의 발현 수준은 음성 대조군과 유사하거나 더 낮았다. CAU 1447 균체 및 CAU 1447 크림 치즈 처리군에서의 결과는 약물(실리마린) 투여군에서의 결과와 유사한 결과를 보였다.
7-4. L. chungangensis CAU 1447을 처리한 래트(rat)에서 NF -k B , COX-2, iNOS , TLR4 및 SOD의 발현
NF-kB, COX-2, iNOS, TLR4 및 SOD는 간 손상 발병과 관련이 있다. NF-kB 활성 및 TLR4 발현은 염증 반응에 관여하고 염증성 사이토카인의 수준을 조절한다. TLR4는 간 질환과 관련이 있으며 알코올 흡수에 따른 염증, 괴사 및 지방증(steatosis)과 관련이 있다. 더욱이, COX-2 및 iNOS 발현 수준은 NF-kB 활성화에 의해 영향을 받는다. ALD에서는, 지질 과산화물, 내독소 및 사이토카인들과 같은 전-염증성 인자의 상향 조절이 COX-2 발현을 유도하여 간에서의 염증 반응을 향상시킨다.
염증성 인자 및 항산화 효소의 mRNA 발현 수준을 평가한 결과, NF-kB, COX-2, iNOS, TLR4 및 SOD mRNA 발현이 정상 대조군에 비해 알코올 처리 양성 대조군에서 높게 나타났다 (도 6a, 도 6b, 도 6c, 도 6d 및 도 6e 참조). 그러나, 이러한 증가는 알코올 투여 후 CAU 1447 균체 및 CAU 1447 크림치즈 투여에 의하여 차단되었다. 또한 silymarin 처리군에서도 NF-kB, COX-2, iNOS, TLR4 및 SOD 수준의 감소가 유사하게 관찰되었다.
7-5. 간 항산화 효소 활성에 대한 L. chungangensis CAU 1447의 영향
간에서 방출된 SOD와 같은 항산화 효소 활성은 간 손상의 또 다른 지표이다. 이에 지방간 및 간 손상 시에 발현되고 고농도의 알코올에 의해 유도되는 간 항산화 효소인 SOD의 활성을 평가하였다. 음성 대조군과 비교하여 알콜-처리된 양성 대조군에서 유의하게 증가된 SOD 활성이 관찰되었다(도 7 참조). silymarin 처리군에서는 SOD 수준이 유의하게 감소하였으며, CAU 1447 균체 및 CAU 1447 크림 치즈로 처리된 그룹에서의 SOD 활성도 양성 대조군과 비교하여 감소되었고, 음성 대조군과 유사한 활성 수준을 나타내었다.
7-6. L. chungangensis CAU 1447 크림치즈 처리가 소화관(gut) 내 SCFA 농도에 미치는 영향
장내 미생물에 의한 SCFA(Short-chain fatty acids) 생산은 대변 샘플을 이용하여 평가되었다. 부티레이트(butyrate) 및 아세테이트(acetate) 수준이 음성 대조군과 비교하여 양성 대조군에서 감소했다(도 8a 및 도 8b 참조). CAU 1447 크림 치즈 그룹에서는 부티레이트 및 아세테이트의 수준이 증가하였다. 또한, 양성 대조군 및 약물(실리마린) 처리 그룹과 비교하여, 아세테이트/부티레이트 비율(acetate/butyrate ratio)은 CAU 1447 크림치즈 그룹에서 가장 현저히 감소하였다 (도 8c 참조).
SCFAs는 면역 반응 및 염증 시스템을 포함하여 인체 건강에 중요한 역할을 한다. 또한, SCFAs의 구성은 소화관 미생물 및 소화관 환경과의 상호 작용에 따라 다르다. 한 연구에 따르면 butyrate의 높은 수준은, Kupffer 세포에서 NF-kB의 불활성화에 의한 TNF-alpha의 억제를 포함하여 면역 반응의 조절과 관련이 있다. 또한, butyrate는 지질다당류(lipopolysaccharide)로 유도된 사이토카인들의 발현을 억제한다. SCFAs는 숙주 및 마이크로바이옴(microbiome)과의 연관성에 의해, 또는 신호 전달에 직접적으로 영향을 줌으로써, 면역 반응을 자극한다. 간에는 면역 신호 전달을 가능하게 하기 위해 장내 미생물에 의해 생성된 작은 분자와 상호 작용하는 다양한 세포 유형들이 포함되어있다. 본 연구에서, CAU 1447 크림 치즈 그룹은 양성 대조군과 비교하여 분변 샘플에서 부티레이트 및 아세테이트 수준의 상승을 나타냈다. 종합하여 볼 때, 본 발명 결과에서 부티레이트 및 아세테이트의 높은 수준은 소화관의 대사 활동을 증가시키고 면역 반응을 촉진 시킨다는 것을 의미한다.
7-7. 조직병리학적 변화
간세포 구조, 소엽 구조(lobular architecture) 및 장 구조를 H&E 염색으로 검사하였다. 음성 대조군에서는 간 손상이나 조직병리학적 변화가 관찰되지 않았다(도 9의 A). 알콜-처리된 양성 대조군(도 9의 B)에서는 간 중심정맥(central vein)을 둘러싼 간세포가 간 손상을 나타내었고 지방소적(lipid droplet)을 포함하고 있었다. silymarin, CAU 1447 균체 또는 CAU 1447 크림 치즈의 경구 투여는 상기 간손상 관련 표현형을 감소시켜, 손상 발생을 막고 지방소적 형성을 방지하였다(도 9의 C, D 및 E). CAU 1447 균체 및 CAU 1447 크림 치즈 군의 결과는 실리마린 처리군의 결과와 유사하였다.
또한 음성 대조군에서 장 융모(villus)의 구조는 어떠한 형태학적 변화도 보이지 않았다(도 10의 A). 대조적으로, 알콜-처리된 양성 대조군(도 10의 B)에서, 장 융모 구조의 변화가 관찰되었으며, 장 융모가 크게 손상되고 찢어졌다. 실리마린, CAU 1447 균체 또는 CAU 1447 크림 치즈 (도 10의 C, D 및 E)의 경구 투여는, 양성 대조군과 비교하여 장 융모 손상을 현저히 감소시켰다. CAU 1447 균체 및 CAU 1447 크림 치즈 군의 결과는 실리마린 처리군의 결과와 유사하였다.
실시예 8: 알콜성 간질환 동물모델에서, 본 발명 신균주 CAU 1447와 CAU28 균주 효과 비교
본 발명의 신균주 CAU 1447와 기존 균주 CAU 28의 간보호 효과 차이를 평가하였다. 상기 실시예 6에 기재된 것과 동일한 방법으로 알콜을 섭취시켜 ALD 동물 모델을 제작하고, 각각 CAU 1447 균체 시료 및 CAU 28 균체 시료를 준비하여 동물에 투여하였다.
간 보호 효과와 관련된 대표적인 몇가지 특성들을 비교 평가하였다. 먼저 체중 및 간 중량을 측정하여, 간/체중 비율(liver/body weight ratio)을 구하였다. 도 11 및 도 12에서 보는 바와 같이, 알콜-처리된 양성 대조군에서 간 중량이 증가하였고 간/체중 비율이 증가하였으나, 락토코커스 중앙젠시스 처리에 의해 수치가 감소하였다. 특히 본 발명의 CAU1447 투여군이 CAU28 투여군 보다 감소 비율이 더 컸다.
다음으로 혈청 샘플을 이용하여 간 손상 및 지방간과 관련된 생화학적 인자들의 변화를 평가하였다. 도 13a, 도 13b, 도 13c 및 도 13d에서 보는 바와 같이, 알콜-처리된 양성 대조군에서 ALP, AST, ALT 및 트리글리세라이드(triglycerid) 혈청 수준의 증가가 관찰되었으나, 락토코커스 중앙젠시스 처리에 의해 수치가 감소하였다. 특히 이러한 감소 효과는 CAU28 투여군 보다 본 발명의 CAU 1447 투여군에서 더 우수하였다.
이상 살펴본 바와 같이, 본 발명은 신균주인 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물, 이들의 간보호, 숙취해소, 알콜성 간질환에 대한 예방 및 치료(개선) 용도, 상기 균주 또는 배양물을 유효성분으로 포함하는 정장제, 생균제, 사료용 조성물 및 발효제품에 대한 것이다.
본 발명의 락토코커스 중앙젠시스 CAU 1447은 ADH 및 ALDH 특성을 보유하며 간보호, 숙취해소, 알콜성 간질환의 치료/개선에 대한 기능성을 가질뿐만아니라, 우수한 내산성 및 내담즙성을 가지기 때문에 동물(특히, 인간)의 소화관 내에서 균주가 가지는 기능성을 잘 나타내며 생육하는 능력이 우수하므로 산업상 이용가능성이 높다.
[수탁번호]
기탁기관명 : 한국생명공학연구원
수탁번호 : KCTC13873BP
수탁일자 : 20190627
기탁기관주소 : (56212) 대한민국 전라북도 정읍시 입신길 181 한국생명공학연구원(KRIBB)
Figure PCTKR2020008940-appb-img-000002

Claims (17)

  1. 락토코커스 중앙젠시스( Lactococcus chungangensis) CAU 1447 (균주기탁번호: KCTC 13873BP) 균주 또는 이의 배양물.
  2. 제1항에 있어서, 상기 균주는 내산성 및 내담즙성을 갖는 것을 특징으로 하는 균주.
  3. 제1항에 있어서, 상기 균주는 D-글루코오스(D-glucose), D-프룩토오스(D-Fructose), D-만노스(D-Mannose), D-만니톨(D-mannitol), N-아세틸 글루코사민(N-Acethyl glucosamine), 에스쿨린(Esculin), D-셀로비오스(D-Cellobiose), D-말토오스(D-Maltose), D-수크로스(D-sucrose), D-트레할로오스(D-Trehalose) 및 겐티오비오스(Gentiobiose)를 탄소원으로 이용하는 것을 특징으로하는 균주.
  4. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 정장용 조성물.
  5. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 생균제 조성물.
  6. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 사료용 조성물.
  7. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 발효제품.
  8. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는 개선용 식품 조성물.
  9. 제8항에 있어서, 상기 알콜성 간 질환은 알콜성 간염, 알콜성 간경화 또는 알콜성 지방간인 것을 특징으로 하는 조성물.
  10. 제8항에 있어서, 상기 식품은 치즈, 요거트, 버터, 크림, 아이스크림, 유산균 음료, 캐피어, 김치 또는 유제품인 것을 특징으로 하는 조성물.
  11. 제10항에 있어서, 상기 치즈는 크림치즈인 것을 특징으로 하는 조성물.
  12. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 알콜성 간 질환(Alcoholic liver disease)의 예방 또는 치료용 약학적 조성물.
  13. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 간 보호 또는 숙취해소용 식품 조성물.
  14. (1) 제1항의 균주 또는 이의 배양물을 우유에 접종하고 배양하는 단계;
    (2) 상기 (1) 단계에서 배양된 배양액을 저온 살균하는 단계;
    (3) 상기 저온 살균한 배양액을 우유와 혼합하여 가열하는 단계; 및
    (4) 상기 가열하여 얻어진 치즈에서 수분을 제거하는 단계를 포함하는 간보호 또는 숙취해소용 크림치즈 제조방법.
  15. 알콜성 간 질환(Alcoholic liver disease)의 치료용 제제를 제조하기 위한 제1항의 균주 또는 이의 배양물의 용도.
  16. 제1항의 균주 또는 이의 배양물을 유효성분으로 포함하는 조성물의 유효량을 이를 필요로 하는 개체에 투여하는 것을 포함하는 알콜성 간 질환(Alcoholic liver disease)의 치료 방법.
  17. 간 보호 또는 숙취해소용 제제를 제조하기 위한 제1항의 균주 또는 이의 배양물의 용도.
PCT/KR2020/008940 2019-07-09 2020-07-08 신규한 락토코커스 중앙젠시스 cau 1447 균주 WO2021006623A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0082691 2019-07-09
KR20190082691 2019-07-09

Publications (1)

Publication Number Publication Date
WO2021006623A1 true WO2021006623A1 (ko) 2021-01-14

Family

ID=74114542

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/008940 WO2021006623A1 (ko) 2019-07-09 2020-07-08 신규한 락토코커스 중앙젠시스 cau 1447 균주

Country Status (2)

Country Link
KR (1) KR102384755B1 (ko)
WO (1) WO2021006623A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101618330B1 (ko) * 2015-03-27 2016-05-09 중앙대학교 산학협력단 락토코커스 중앙젠시스를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR101670555B1 (ko) * 2014-12-16 2016-10-31 중앙대학교 산학협력단 락토코커스 중앙젠시스를 유효성분으로 포함하는 숙취개선용 식품조성물
KR20170109189A (ko) * 2016-03-18 2017-09-28 중앙대학교 산학협력단 효소활성을 나타내는 락토코커스 중앙젠시스의 신규한 용도

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101718590B1 (ko) * 2014-10-29 2017-03-22 중앙대학교 산학협력단 락토코커스 푸지엔시스를 유효성분으로 포함하는 숙취개선용 식품조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101670555B1 (ko) * 2014-12-16 2016-10-31 중앙대학교 산학협력단 락토코커스 중앙젠시스를 유효성분으로 포함하는 숙취개선용 식품조성물
KR101618330B1 (ko) * 2015-03-27 2016-05-09 중앙대학교 산학협력단 락토코커스 중앙젠시스를 유효성분으로 함유하는 염증성 질환의 예방 또는 치료용 약학적 조성물
KR20170109189A (ko) * 2016-03-18 2017-09-28 중앙대학교 산학협력단 효소활성을 나타내는 락토코커스 중앙젠시스의 신규한 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JONG-HWA KIM, KIYOUNG KIM, WONYONG KIM: "Cream Cheese-Derived Lactococcus chungangensis CAU 28 Modulates the Gut Microbiota and Alleviates Atopic Dermatitis in BALB/c Mice", SCIENTIFIC REPORTS, vol. 9, no. 1, 1 December 2019 (2019-12-01), XP055772026, DOI: 10.1038/s41598-018-36864-5 *
NAM YOHAN; KIM JONG-HWA; KONKIT MAYTIYA; KIM WONYONG: "Hepatoprotective effects of Lactococcus chungangensis CAU 1447 in alcoholic liver disease", JOURNAL OF DAIRY SCIENCE, AMERICAN DAIRY SCIENCE ASSOCIATION, US, vol. 102, no. 12, 11 September 2019 (2019-09-11), US, pages 10737 - 10747, XP085904065, ISSN: 0022-0302, DOI: 10.3168/jds.2019-16891 *

Also Published As

Publication number Publication date
KR20210006865A (ko) 2021-01-19
KR102384755B1 (ko) 2022-04-08

Similar Documents

Publication Publication Date Title
WO2019151843A1 (ko) 락토바실러스 플란타럼 kbl396 균주 및 그 용도
EP3454869A1 (en) A composition comprising a lactic acid bacteria for preventing and treating vaginosis and the use thereof
WO2020050553A1 (en) Probiotic strain for upper respiratory tract infection, stress, anxiety, memory and cognitive dysfunctions, and ageing
WO2015122717A1 (ko) 비만 억제 효능을 갖는 신규 유산균 및 이의 용도
AU2020336649B2 (en) Akkermansia muciniphila EB-AMDK19 strainand use thereof
WO2017204415A1 (ko) 혈당 조절 효능을 갖는 신규 유산균 및 이의 용도
WO2017047968A1 (ko) 다양한 기능성을 가진 신규 유산균 및 이의 용도
WO2021066549A1 (ko) 락토바실러스 애시도필러스 kbl409 균주 및 그 용도
WO2021194225A1 (ko) 락토바실러스 델브루키 subsp. 락티스 CKDB001 균주, 및 이를 포함하는 비알코올성 지방간의 예방, 개선, 또는 치료용 조성물
WO2021162282A1 (ko) 신규 락토바실러스 플란타룸 kc3 균주를 이용한 면역장애, 호흡기 염증 질환, 알레르기 및 천식의 예방 또는 치료용 조성물 및 이의 용도
WO2021040186A1 (en) Akkermansia muciniphila eb-amdk27 strain and use thereof
WO2021221398A1 (ko) 우수한 면역기능 증진 효과를 갖는 신규한 유산균 및 이를 포함하는 식품조성물, 건강기능성 식품 조성물 및 프로바이오틱스
WO2020262755A1 (ko) 장관면역 조절을 위한 신규한 프로바이오틱 조성물
WO2020130471A1 (ko) 체중 또는 체지방 감소 효능을 갖는 신규 유산균 및 이의 용도
WO2019226002A1 (ko) 락토바실러스 크리스파투스 kbl693 균주 및 그 용도
WO2023055188A1 (ko) 신규 프로바이오틱스 및 이의 용도
WO2018169297A1 (en) Tryptophanase-negative lactic bacteria, corresponding compositions and uses
WO2020091312A1 (ko) 프로바이오틱스를 유효성분으로 포함하는 알코올성 장손상 예방 또는 치료용 조성물
WO2022240224A1 (ko) 젤란검을 유효성분으로 하는 장내 균총 개선용 조성물 및 이를 포함하는 대사성 질환 개선, 예방 또는 치료용 조성물
WO2021006623A1 (ko) 신규한 락토코커스 중앙젠시스 cau 1447 균주
WO2014196775A1 (ko) 락토바실러스 브레비스 g-101 및 이의 용도
WO2022045719A1 (ko) 신규 락토바실러스 플란타룸 kc3 균주 및 익모초 추출물을 유효성분으로 포함하는 호흡기 질환의 예방 또는 치료용 약학적 조성물 및 이를 이용한 방법
WO2023058801A1 (ko) 락토바실러스 애시도필러스 kbl402 또는 kbl409 균주를 포함하는 장 질환 개선, 예방 또는 치료용 조성물
WO2020251208A1 (ko) 코리네박테리움 속 균주 및 이의 배양물을 포함하는 위장질환 예방, 치료 또는 개선용 조성물
WO2024117701A1 (en) Food and drug composition containing novel aldehyde dehydrogenase for suppressing tremor or movement disorder

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20837263

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 20837263

Country of ref document: EP

Kind code of ref document: A1