WO2020188216A1 - Méthode ultrasensible de détection de la mort cellulaire - Google Patents
Méthode ultrasensible de détection de la mort cellulaire Download PDFInfo
- Publication number
- WO2020188216A1 WO2020188216A1 PCT/FR2020/050571 FR2020050571W WO2020188216A1 WO 2020188216 A1 WO2020188216 A1 WO 2020188216A1 FR 2020050571 W FR2020050571 W FR 2020050571W WO 2020188216 A1 WO2020188216 A1 WO 2020188216A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell death
- cells
- sample
- cell
- pcr
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
Definitions
- the invention relates to a method for detecting cell death by using PCR (Polymerase Chain Reaction) techniques: qPCR, i.e. quantitative PCR; ddPCR i.e. digital droplet PCR, ...) or any other technique for detecting a small amount of DNA (nanostring, etc.).
- PCR Polymerase Chain Reaction
- Cell death is the irreversible cessation of vital functions with changes in structures at the cellular and molecular level. This cell death process can occur in a number of relatively different ways (Gallouzzi et al., Cell Death Differ, 2018).
- the methods of detecting apoptosis can be categorized according to 4 main principles, according to whether they detect i) alteration of the plasma membrane, ii) activation of caspases, iii) mitochondrial damage, iv) DNA fragmentation.
- phosphatidylserines exposed in the outer layer of the plasma membrane is also offered by a large number of suppliers (we will mention Pacific Blue TM Annexin V from BioLegend®).
- the principle is the use of annexin V (protein which binds specifically to phosphatidylserines in a calcium-dependent manner), coupled to various reporters (mainly fluorescent) allowing its detection.
- the analysis is carried out by flow cytometry (FACS) or by microscopy. This widely proposed method offers a large choice of fluorochromes and makes it possible to detect apoptotic and necrotic cells.
- Hooker et al. 2012 (Nucl Acids Res, 40 (15) e13); Hooker et al., 2009 (J Cell Mol Med, 13 (5): 948-958), and Staley et al., 1997 (Cell Death Differ, 4: 66-75) describe a method for detecting fragmented DNA by using a “quantitative ligation-mediated PCR” which makes it possible to amplify the fragments with blunt ends formed following the activation of nucleases. This laborious method requires multiple steps.
- the present invention relates to a method for detecting cell death based on the detection of fragments of genomic DNA of nuclear origin present in the cell cytoplasm. Indeed, the inventors have developed a very sensitive method for detecting fragments of genomic DNA of nuclear origin in the cytoplasm.
- cytoplasmic extract is obtained by incubating the cell sample with lysis buffer or hypotonic buffer in order to lyse or permeabilize the plasma membrane without permeabilizing the nuclear membrane.
- the cytoplasmic extracts correspond to all or part of the cellular cytoplasmic content.
- the cytoplasmic extract is enriched with genomic DNA of nuclear origin, compared to cells that did not initiate the death process.
- genomic DNA of nuclear origin present in the cytoplasm is measured by amplification / detection of an area present in at least one copy in the genome.
- genomic DNA fragments can advantageously be detected and quantified in a sample.
- the quantity of DNA fragments recovered is proportional to the quantity of cells that triggered the death process in the sample, thus making it possible to detect and quantify this process.
- the detection of genomic DNA fragments in the cytoplasm, using specific primers targeting repeated sequences present in the genome confers increased sensitivity on the method according to the invention. The comparative results obtained confirm that the sensitivity is greater than that obtained with existing conventional methods already marketed.
- FIG. 1 represents the level of activation of cell death achieved on cytoplasmic extracts of HepG2 cells obtained using different detergents in the method according to the invention.
- FIG. 2 represents the level of activation of cell death achieved on cytoplasmic extracts of OCI-AML3 cells obtained using different detergents in the method according to the invention.
- FIG. 3 represents the level of activation of cell death achieved on cytoplasmic extracts of OCI-AML3 cells obtained using different detergents in the method according to the invention.
- FIG. 4 represents the level of activation of cell death achieved on cytoplasmic extracts of MDA-MB-231 cells obtained using different detergents in the method according to the invention.
- FIG. 5 shows the comparison of the sensitivity of the method for detecting cell death by qPCR according to the present invention compared to a method of the state of the art Caspase Glo 3/7.
- Fig. 6 shows the comparison of the sensitivity of the method for detecting cell death by qPCR according to the present invention compared to a method of the state of the art Caspase Glo 3/7.
- FIG. 6 represents the comparison of the sensitivity of the method for detecting cell death by qPCR according to the present invention compared to a method of the state of the art flow cytometry (Annexin V labeling, propidium lodide).
- FIG. 7 represents the comparison of the sensitivity of the method for detecting cell death by qPCR (direct lysis) according to the present invention compared to flow cytometry (Annexin V labeling, propidium lodide).
- FIG. 8 represents the comparison of the sensitivity of the method for detecting cell death by qPCR according to the present invention compared to flow cytometry (Annexin V labeling, propidium lodide).
- FIG. 9 represents the comparison of the sensitivity of the method for detecting cell death by qPCR (direct lysis) according to the present invention compared to flow cytometry (Annexin V labeling, propidium lodide).
- FIG. 10 represents the comparison of the sensitivity as well as of the saturation threshold of the method for detecting cell death by qPCR according to the present invention compared to flow cytometry (Annexin V labeling, propidium lodide.
- FIG. 1 1 represents the comparison of the sensitivity of the method for detecting cell death by qPCR according to the present invention compared to flow cytometry (Annexin V labeling, propidium lodide).
- FIG. 12 represents the comparison of the sensitivity of the method for detecting cell death by ddPCR according to the present invention on isolated cells.
- FIG. 13 represents the level of activation of cell death achieved on cytoplasmic extracts of different cell lines using a pair of primers targeting a sequence present in one copy per genome.
- FIG. 14 represents the level of activation of cell death achieved on cytoplasmic extracts of different cell lines using a pair of primers targeting a sequence present in two copies per genome.
- FIG. 15 represents the level of activation of cell death achieved on cytoplasmic extracts from the OCI-AML3 cell line using two pairs of primers each targeting a sequence present in one copy per genome
- FIG. 16 demonstrates an increase in the quantity of DNA fragments in the cytoplasmic fraction obtained after extraction with a lysis buffer described in the method according to the invention, and detected by capillary electrophoresis, and this exclusively in cells treated with a drug inducing their death (staurosporine) (MDA 50 and MDA 100) compared to cells not treated with staurosporine (MDA NT).
- the present invention therefore relates to a method for quantifying cell death in a cell sample characterized in that at least one sequence present on fragments of genomic DNA of nuclear origin is amplified from the cytoplasmic extract. of said sample.
- the inventors have indeed advantageously exploited the abnormal presence of fragments of genomic DNA of nuclear origin located in the cytoplasm of cells during the cell death process. Fragmented genomic DNA of nuclear origin can thus be detected from cytoplasmic extracts of cells.
- cell death means cell death by apoptosis and / or cell death by necrosis.
- genomic DNA fragments or “fragmented genomic DNA” refers to DNA fragments of nuclear origin generated during the processes of cell death.
- the cell sample may be a sample of cells in culture in vitro, such as adherent cells, cells in suspension, a sample comprising circulating tumor cells, a sample comprising purified circulating tumor cells, a blood sample containing circulating cells or any other sample such as a plasma sample, a urine sample, a saliva sample.
- the method for quantifying cell death in a cell sample comprises:
- cytoplasmic extract means the soluble part of the cell cytoplasm, also called cytosol, which is recovered after specific permeabilization of the plasma membrane without alteration of the nuclear membrane, followed by centrifugation.
- the cytoplasmic extract and its methods of obtaining are known to those skilled in the art and are described in the state of the art, for example in Suzuki, Keiko et al. “REAP: A two minute cell fractionation method.” BMC research notes vol. 3,294. 10 Nov. 2010, doi: 10.1 186 / 1756-0500-3-294 or in Gary Zieve and Sheldon Penman, Small RNA species of the HeLa cell: Metabolism and subcellular localization Cell, May 1976, Pages 19-31.
- the cytoplasmic extract is obtained by incubating the cell sample with lysis buffer or hypotonic buffer.
- lysis buffer within the meaning of the present invention means any buffer making it possible to lyse or permeabilize the plasma membrane without permeabilization of the nuclear membrane.
- a nonionic detergent could be used, as described in the patent US5,637,465.
- an anti-DNA antibody could be used by those skilled in the art to determine the adequate concentration of the buffer to allow lysis or permeabilization of the plasma membrane without permeabilization of the nuclear membrane.
- the lysis buffer can be chosen from 4- (2-hydroxyethyl) -1 -piperazine ethane sulfonic acid), ethylenediaminetetraacetic acid, sodium chloride, saponins such as digitonin or saponin, Tween-20, NP40, tergitol, Triton X-100, Igepal CA630, Empigen, or a combination.
- the lysis buffer is a mixture of acid
- the lysis buffer is a mixture of 4- (2-hydroxyethyl) -1 -piperazine ethanesulfonic acid at 50mM, ethylenediaminetetraacetic acid at 5mM, sodium chloride at 150mM, and of digitonin at 50 pg / ml.
- the cytoplasmic extract can be obtained by the following steps:
- the centrifugation or filtration step separates the supernatant from the rest of the cell debris.
- the "cytoplasmic extract fraction” corresponds to an aliquot fraction of the cytoplasmic extract.
- the fraction of the cytoplasmic extract can be obtained by the following steps:
- the method for obtaining the fraction of the cytoplasmic extract may further comprise a step of diluting said aliquot fraction taken, at least 5 times in water, preferably 10 times in water. 'water.
- the dilution step can be applied when the quantification method is a PCR quantification method.
- the inventors have demonstrated that it is possible to detect cell death on cytoplasmic extracts using primers targeting a sequence present in one copy on the nuclear genome.
- the method for quantifying cell death according to the present invention is characterized in that said at least one sequence is a DNA sequence present in one copy on said DNA fragments. genomics.
- the method for quantifying cell death according to the present invention also makes it possible to detect cell death on cytoplasmic extracts using primers targeting a sequence present in addition to one copy in the nuclear genome.
- the method according to the present invention makes it possible to detect cell death in cytoplasmic extracts using primers targeting a sequence present in two copies in the nuclear genome.
- the method for quantifying cell death according to the present invention is characterized in that said at least one sequence is a DNA sequence present in at least two copies on said fragments of Genomic DNA.
- the sensitivity of the method according to the invention is increased proportionally to the number of repeated DNA sequences when the latter are used as markers for detecting and quantifying the quantity of cytoplasmic genomic DNA.
- the method for quantifying cell death according to the present invention is characterized in that said at least one sequence is a repeated DNA sequence.
- genomic DNA typically includes repeated sequences which may be small intercalated nuclear elements (SINE for Short Interspersed Nuclear Elements) or long intercalated nuclear elements (LINE for Long Interspersed Nuclear Elements).
- SINE small intercalated nuclear elements
- LINE long intercalated nuclear elements
- the Alu, MIR, MIR3 sequences can be chosen.
- the LINE1 sequences can be chosen.
- the method for quantifying cell death according to the present invention is characterized in that said at least one repeated DNA sequence is chosen from SINEs such as Alu, MIR, MIR3 and LINEs such as LINE1.
- the method for quantifying cell death according to the present invention is characterized in that several different sequences are amplified simultaneously.
- the detection / quantification of genomic DNA fragments can be carried out by quantitative PCR techniques or any other technique for detecting a small amount of DNA known to those skilled in the art.
- the quantification and detection of fragmented genomic DNA is carried out by quantitative PCR (qPCR).
- qPCR quantitative PCR
- the principle of qPCR is based on the possibility of determining the amount of DNA template present in a sample in real time using an intercalating agent or a probe (Taqman®).
- the fluorescence emitted is directly propositional to the amount of amplicons generated during the PCR reaction.
- the method for quantifying cell death according to the present invention is characterized in that the detection / quantification is carried out by qPCR.
- the quantification of genomic DNA fragments is performed by digital droplet PCR (ddPCR).
- DdPCR is a microfluidic PCR based on the partitioning of each sample into 20,000 1 nL droplets.
- the quantification of genomic DNA fragments is performed by Nanostring technology.
- the principle of Nanostring is based on two key stages. Upstream, two probes are designed specifically for each target of interest. One of the probes, called a capture probe, is coupled to a biotin, which will be used to immobilize the molecules of interest on a support dedicated to counting. The second probe, called a "reporter”, is specific for the molecule of interest. It contains a succession of 6 fluorochromes of 4 different colors, whose arrangement defines a bar code that will be specific to each molecule of interest. It is this barcode that will allow the ultra-sensitivity of this technique and therefore the possibility of analyzing biological material in small quantities (Nanostring LABEX DEEP platform).
- the quantification of genomic DNA fragments is carried out by multiplex PCR or multiplexing.
- a multiplex PCR a set of several pairs of primers will be used so as to simultaneously amplify several sequences present in the genome.
- a unique sequence is detected and quantified using for example the 5 'sense primer CGCCTGGATCATGTCAAGTCA 3' (SEQ ID NO: 1) and the 5 'antisense primer.
- a sequence present in two copies is detected and quantified using the 5 'T CT CCAC AACACTT AGTGG ACAGT 3' sense primer (SEQ ID NO: 5) and the anti-sense primer 5.
- SEQ ID NO: 5 the 5 'T CT CCAC AACACTT AGTGG ACAGT 3' sense primer
- SEQ ID NO: 6 the anti-sense primer 5.
- multiplexing can be carried out simultaneously, for example, using the pair of primers SEQ ID NO: 1 and SEQ ID NO: 2 with the pair of primers SEQ ID NO: 3 and SEQ ID NO: 4. .
- the Alu sequence is detected and quantified using the 5 'sense primer AG GT G AAACCCCGT CT CT ACT 3' (SEQ ID NO: 7) and the 5 'antisense primer CCATTCTCCTGCCTCAGCCT 3 '(SEQ ID NO: 8).
- the LINE1 sequence is detected and quantified using the 5 'forward primer GTCAGTGTGGCGATTCCTCAG 3' (SEQ ID NO: 9) and the anti-sense primer 5 'AGTAATGGGATGGCTGGGTCAA 3' (SEQ ID NO : 10) or by using the forward primer 5 'AACAACAGGTGCTGGAGAGGA 3' (SEQ ID NO: 1 1) and the reverse primer 5 'AT CG CCACACT G ACTT CCACA 3' (SEQ ID NO: 12).
- the amount of nucleic acid amplified in said nucleic acid sample will be compared to the amount of amplified nucleic acid in a control sample.
- control sample is meant a cell sample in which the process of cell death has not started.
- an increase in the amount of amplified nucleic acid in said “sample” compared to the amount of amplified nucleic acid in the "control sample” is indicative of cell death.
- the present invention also relates to a method for monitoring the efficiency and / or the effect of a treatment on cell death comprising the detection of cell death in a cell sample by the method according to the present invention. invention.
- the method is applicable to in vitro, in vivo and ex vivo conditions.
- the present invention can allow monitoring of a patient's response to treatment.
- the detection and quantification of cell death is indicative of whether or not the treatment is effective.
- the amount of amplified nucleic acid of the sample from the patient can be compared to the amount of amplified nucleic acid of a control sample, said control sample may be a patient sample obtained before administration of the treatment or a sample from the patient. 'a subject not affected by the pathology.
- an increase in the amount of nucleic acid amplified is synonymous with treatment efficiency, while the absence of significant change can mean treatment failure.
- the present invention also relates to a method for diagnosing a pathology involving a cell death process comprising the detection of cell death in a cell sample by the method according to the present invention.
- the level of activation of cell death in a cell sample would be indicative of a pathology involving a process of cell death.
- the amount of nucleic acid amplified from the sample from the patient can be compared to the amount of nucleic acid amplified from a control sample, said control sample may be a sample from a subject without the pathology.
- the present invention also relates to a method for the prognosis of a pathology involving a cell death process comprising the detection of cell death in a cell sample by the method according to the present invention.
- the present invention also relates to a screening method for compounds comprising:
- the method according to the invention will make it possible to determine the compound (s) that trigger cell death.
- a subject of the present invention is also a kit for the detection of cell death in a cell sample comprising:
- a lysis buffer or a hypotonic buffer capable of specifically lysing or permeabilizing the plasma membrane
- the lysis buffer advantageously makes it possible to lyse or permeabilize the plasma membrane without permeabilization of the nuclear membrane.
- the cell sample may be chosen from a sample of cells in culture in vitro, such as adherent cells, cells in suspension, a sample comprising circulating tumor cells, a sample comprising purified circulating tumor cells, a sample blood containing circulating cells or any sample comprising cells having triggered a process of cell death such as a plasma sample, a urine sample, a saliva sample.
- a sample of cells in culture in vitro such as adherent cells, cells in suspension, a sample comprising circulating tumor cells, a sample comprising purified circulating tumor cells, a sample blood containing circulating cells or any sample comprising cells having triggered a process of cell death such as a plasma sample, a urine sample, a saliva sample.
- the primers will be specific for the species studied.
- a centrifugation or filtration step separates the supernatant containing the DNA fragments resulting from its degradation from the rest of the cellular debris.
- An aliquot of the supernatant is taken, i.e., the fraction of cytoplasmic extract, which will optionally be diluted depending on the method of quantifying cell death used.
- PCR is performed on the samples using primers specifically amplifying repeated sequences dispersed throughout the genome, or using primers targeting a one-copy or two-copy sequence on the genome.
- the method for quantifying cell death could be carried out on a cytoplasmic extract obtained from cells lysed directly in the culture medium.
- the results are analyzed relative to a predetermined control condition.
- the final result can be obtained in two to three hours.
- OCI-AML3 cells in suspension are derived from acute myeloid leukemia. They are cultivated in RPMI-1640 medium (Sigma-Aldrich) supplemented with Penicillin-Streptomycin (Sigma-Aldrich) and 10% Fetal Calf Serum (SVF - Gibco) at 37 ° C with 5% C0 2 .
- HepG2 cells are derived from human liver carcinoma. They are cultured in Dulbecco's Modified Eagle Medium - High Glucose (DM EM - Sigma-Aldrich) medium supplemented with Penicillin-Streptomycin (Sigma-Aldrich) and 10% Fetal Calf Serum (SVF - Gibco) at 37 ° C with 5% of C0 2 .
- DM EM Dulbecco's Modified Eagle Medium - High Glucose
- Penicillin-Streptomycin Sigma-Aldrich
- Fetal Calf Serum SVF - Gibco
- MDA-MB-231 (adherent) cells are mammary tumor epithelial cells. They are grown in Dulbecco's Modified Eagle Medium - High Glucose (DMEM - Sigma-Aldrich) medium supplemented with Penicillin- Streptomycin (Sigma-Aldrich) and 10% Fetal Calf Serum (SVF - Gibco) at 37 ° C with 5% of C02.
- DMEM Dulbecco's Modified Eagle Medium - High Glucose
- Penicillin- Streptomycin Sigma-Aldrich
- Fetal Calf Serum SVF - Gibco
- MOLM14 cells in suspension are derived from acute myeloid leukemia. They are cultivated in RPMI-1640 medium (Sigma-Aldrich) supplemented with Penicillin-Streptomycin (Sigma-Aldrich) and 10% Fetal Calf Serum (SVF - Gibco) at 37 ° C. with 5% C02.
- the HeLa cells were cultured in Dulbecco's Modified Eagle Medium - Low Glucose (DMEM - Sigma-Aldrich) supplemented with Penicillin-Streptomycin (Sigma-Aldrich) and 10% Fetal Calf Serum (SVF - Gibco) at 37 ° C with 5% C02.
- DMEM Dulbecco's Modified Eagle Medium - Low Glucose
- Penicillin-Streptomycin Sigma-Aldrich
- Fetal Calf Serum Sigma-Aldrich
- the cells in suspension eg: OCI-AML3
- OCI-AML3 are seeded at 200,000 cells / mL in a 6-well plate.
- the cells are then treated or not with different drugs, at different concentrations and incubated for 16 hours.
- the adherent cells are seeded between 20,000 and 30,000 cells / well (eg MDA-MB-231, HepG2) in a 48-well plate in 250 ⁇ L of medium. The cells are then treated or not with different drugs, at different concentrations and incubated for 24 hours.
- 20,000 and 30,000 cells / well eg MDA-MB-231, HepG2
- the cells are then treated or not with different drugs, at different concentrations and incubated for 24 hours.
- the cytoplasmic fraction obtained will be diluted 10 times in water.
- the kit used is the SYBR qPCR Premix Ex Taq II (Takara). The samples were previously diluted 1/10 in water. Once the Master Mix has been prepared (as described in the table below), 6 ⁇ l are distributed in each well of the PCR plate. Then 4 ⁇ l of sample are added. PCR is performed in the Light Cycler 480 System real-time PCR reader (Roche). The amplification program is as follows: 95 ° C for 30 seconds, followed by 40 cycles broken down into two stages of 95 ° C for 5 seconds and 60 ° C for 20 seconds.
- Untreated (NT) or treated (TTT) cells to induce cell death were used in these assays. Under each of the NT and TTT conditions, 100,000 - 10,000 - 1,000 - 100 or 10 cells are transferred to a 96-well plate in 50 ml of medium (in triplicates). Then 50 ⁇ l of Caspase Glo 3/7 reagent is added. After 1 hour of incubation, the light emission resulting from cleavage of the substrate by caspases 3 and 7 is determined using a luminometer.
- the cells are washed with PBS and then resuspended in 1 ⁇ binding buffer at a concentration of 1 10 6 cells / ml.
- 10 ⁇ L Annexin V Pacific Blue and 10 ⁇ L of propidium iodide (Biolegend Kit) are added to 200 ⁇ L of this cell suspension which is then incubated for 15 min in the dark and at room temperature. After centrifugation at 300 g for 5 min, the supernatant is gently aspirated and 500 ⁇ L of Binding Buffer 1 X are added.
- Each ddPCR reaction is performed optimally in about 20,000 droplets of 1 nL in volume.
- Cytoplasmic extracts from untreated cells and treated to induce cell death were used as samples.
- a reaction mix of ddPCR (24mI_), requires 11 mI_ of 2X “EvaGreen ddPCR Supermix” (Bio-Rad), 0.22 pL of primers (sense and antisense each at 200nM final), 4mI_ of sample and 6.78 pL of water.
- the droplets are generated by the QX200 DropletGenerator (Bio-Rad) by emulsifying 20pL of ddPCR mix and 20pL of oil in the wells of DG8 (Bio-Rad) cartridges. Then the droplets / oil mixture is transferred into a 96-well plate which is sealed by “PX1 PCR Plate Sealer” (Bio-Rad).
- Amplification is carried out in a T100 thermal cycler (Bio-Rad) following the program: Enzyme activation: 95 ° C for 5 min; 40 cycles: denaturation at 95 ° C for 30 s then extension at 60 ° C for 1 min. Signal stabilization: 4 ° C for 5 min then 90 ° C for 5 min.
- the plate is then read by the QX200 Droplet Reader (Bio-Rad). The results are then exported and the data analyzed with the QuantaSoft software (Bio-Rad).
- Example 1 Detection of cell death on adherent cells in culture (HepG2 and MDA-MB-231) or cells in suspension (OCI-AML3)
- Figure 1 shows the level of activation of cell death achieved on cytoplasmic extracts of HepG2 cells obtained using different lysis buffers in the method according to the present invention.
- the pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8 was used on the fractions of cytoplasmic extracts obtained after lysis of the cells with Tween-20 0.075%, Triton X-100 0.0075% and Empigen 0.037%.
- Figure 2 shows the level of activation of cell death achieved on cytoplasmic extracts of OCI-AML3 cells obtained using different detergents in the method according to the present invention.
- the cells are treated or not for 18 h with 1 mM of doxorubicin. After centrifugation of 5,000 cells, they are lysed in a buffer containing different detergents: Tergitol 0.1%, Empigen 0.1%, Digitonin 150 ⁇ g / ml, NP40 0.1%. The qPCR is then carried out on fractions of cytoplasmic extracts using the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10.
- Figure 3 shows the level of activation of cell death achieved on cytoplasmic extracts of OCI-AML3 cells obtained using a lysis buffer made with different detergents in the method according to the present invention.
- FIG. 4 represents the level of activation of cell death carried out on cytoplasmic extracts of MDA-MB-231 cells obtained using a lysis buffer produced with different detergents in the method according to the present invention.
- 20,000 cells are treated or not for 18 hours with 1 mM of doxorubicin and then directly lysed in a buffer containing different detergents: Tergitol 0.1%, Igepal CA630 0.5%, Triton X-100 0.01% and Tween- 20 0.5%.
- the qPCR is then carried out on fractions of cytoplasmic extracts using the pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8.
- the method according to the present invention advantageously makes it possible to detect cell death and thus to measure its level of activation in samples of adherent cells and of cells in suspension.
- Example 2 Determination of the sensitivity of the method for detecting cell death by PCR according to the present invention compared to the Caspase qlo 3/7 method of the state of the art
- MOLM14 cells are treated for 16 h with 1 mM etoposide. Cell death is determined on a sample of cells ranging from 10 to 10,000 cells using the Caspase Glo technique. In parallel, a qPCR is carried out on a cytoplasmic extract originating from an identical number of cells (from 10 to 10,000 cells) with the pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8. The results of l The experiment presented in Figure 5 are means of three independent experiments.
- Example 3 Determination of the sensitivity of the method for detecting cell death according to the present invention relative to flow cytometry (Annexin V labeling, propidium lodide) of the state of the art
- the cells are labeled using the Pacific Blue TM Annexin V Kit (Biolegend) according to the supplier's recommendations, then analyzed by flow cytometry (MACSQuant VYB - MiltenyiBiotec). The percentage of positive apoptotic cells (annexin V) is determined.
- OCI-AML3 cells are treated or not (NT) for 16 h with increasing concentrations of etoposide (0 - 7.5 - 15 or 30 mM).
- the cells are labeled using the Pacific Blue TM Annexin V Kit (Biolegend) according to the supplier's recommendations, then analyzed by flow cytometry (MACSQuant VYB - Milteny iBiotec). The percentage of positive apoptotic cells (Annexin V) is determined.
- OCI-AML3 cells are treated or not (NT) for 16 h with increasing concentrations of Bortezomib (0 - 0.125 or 0.25 mM).
- the cells are labeled using the Pacific Blue TM Annexin V Kit (Biolegend) according to the supplier's recommendations, then analyzed by flow cytometry (MACSQuant VYB - MiltenyiBiotec). The percentage of positive apoptotic cells (Annexin V) is determined.
- OCI-AML3 cells are treated or not (NT) for 16 h with increasing concentrations of Bortezomib (0 - 0.125 or 0.25 mM).
- the cells are labeled using the Pacific Blue TM Annexin V Kit (Biolegend) according to the supplier's recommendations, then analyzed by flow cytometry (MACSQuant VYB - MiltenyiBiotec). The percentage of positive apoptotic cells (Annexin V) is determined.
- MOLM14 cells are treated or not (NT) for 16 h with increasing concentrations of etoposide (0 - 0.62 - 1, 25 - 2.5 - 5 or 10 mM).
- the cells are labeled using the Pacific Blue TM Annexin V Kit (Biolegend) according to the supplier's recommendations, then analyzed by flow cytometry (MACSQuant VYB - MiltenyiBiotec). The percentage of positive apoptotic cells (annexin V) is determined.
- a PCR is carried out on a cytoplasmic extract obtained from 10,000 cells lysed after centrifugation, with the pair of primers of SEQ ID NO: 7 and SEQ ID NO: 8.
- the sensitivity of the PCR method according to the present invention is much greater than the flow cytometry.
- the flow cytometric method reaches a detection level starting from the concentration of 2.5 mM of etoposide, which is not the case for the PCR method. The results are shown in Figure 10.
- the method also makes it possible to detect cell death directly after lysis in the culture medium, and this in a much more sensitive manner than with the techniques of the prior art.
- OCI-AML3 cells are treated or not for 16 h with 1 pM of doxorubicin.
- a PCR is carried out on a cytoplasmic extract originating from these 1000 cells (AV- / IP-) treated (TTT) or untreated (NT), using the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10.
- TTT cytoplasmic extract originating from these 1000 cells
- NT untreated
- the results of the experiment presented are averages of three independent experiments. The results are shown in Figure 1 1 B.
- MOLM14 cells are treated or not for 16 hours with 2.5 mM etoposide.
- the cells are labeled using the Pacific Blue TM Annexin V Kit (Biolegend). For each subpopulation, 1 cell is sorted and a ddPCR (digital droplet) is carried out on a cytoplasmic extract using the pair of primers of SEQ ID NO: 9 and SEQ ID NO: 10. The level of activation of death cell is determined and compared with the signals obtained from the cytoplasmic extract of an untreated cell negative for propidium lodide / Annexin V labeling.
- the method according to the invention makes it possible to detect cell death on a sample of a cell and thus offers optimized sensitivity compared to methods of the state of the art.
- Example 4 Detection of cell death carried out on cytoplasmic extracts of different cell lines using primers targeting a sequence present in one copy or in two copies on the genome.
- Figure 13 shows the level of activation of cell death achieved on cytoplasmic extracts of the cell lines indicated on the x-axis (MDA-MB-231, Molm14, HeLa, OCI-AML3).
- the MDA-MB-231 cells are treated (TTT) or not (NT) for 24 hours with 200 nM of staurosporine.
- the Molm14 cells are treated (TTT) or not (NT) for 16 h with 0.5 mM of doxorubicin.
- the HeLa cells are treated (TTT) or not (NT) for 24 hours with 400 nM of staurosporine.
- the OCI-AML3 cells are treated (TTT) or not (NT) for 16 h with 1 mM of doxorubicin.
- the qPCR is carried out on the cytoplasmic extracts, diluted 10 times, using the pair of primers of SEQ ID NO: 1 and SEQ ID NO: 2.
- FIG. 14 represents the level of activation of cell death produced on cytoplasmic extracts of the cell lines indicated on the x-axis (MDA-MB-231, Molm14, HeLa, OCI-AML3).
- the MDA-MB-231 cells are treated (TTT) or not (NT) for 24 hours with 200 nM of staurosporine.
- the Molm14 cells are treated (TTT) or not (NT) for 16 h with 0.5 mM of doxorubicin.
- the HeLa cells are treated (TTT) or not (NT) for 24 hours with 400 nM of staurosporine.
- the OCI-AML3 cells are treated (TTT) or not (NT) for 16 h with 1 mM of doxorubicin.
- the qPCR is carried out on the cytoplasmic extracts, diluted 10 times, using the pair of primers of SEQ ID NO: 5 and SEQ ID NO: 6
- the method according to the invention makes it possible to detect cell death by the detection and amplification of a DNA sequence present in one copy on the genome.
- Example 5 Detection of cell death carried out on cytoplasmic extracts by multiplexing
- Figure 15 shows the level of activation of cell death achieved on cytoplasmic extracts of the OCI-AML3 cell line.
- the cells are treated (TTT) or not (NT) for 24 hours with 10 mM aracytine. After centrifugation, the cells are lysed. The qPCR is then carried out on the cytoplasmic extracts, diluted 10 times, simultaneously using the pair of primers of SEQ ID: NO: 1 and SEQ ID NO: 2 with the pair of primers of SEQ ID: NO: 3 and SEQ ID NO: 4.
- the method for detecting cell death according to the present invention can advantageously be implemented by a multiplexing technique.
- Example 6 detection of the presence of DNA fragments in the cytoplasmic fraction obtained after extraction with a lysis buffer described in the method according to the invention, and detected by capillary electrophoresis in cells treated with a drug inducing their dead (staurosporine) or not (NT)
- the MDA-MB-231 cells were seeded in 6 T175 at a rate of 3 million cells per 35 ml of high glucose DMEM medium (10% FCS, P / S). The next day, the MDA-MB-231 were treated with 50nM and 100nM of staurosporine. The medium of the 2 untreated T175 was changed. After 24 h of treatment, the MDA-MB-231 cells were lysed with 2 mL of Lysis Buffer added to T175 for 15 min at room temperature, then the 2 mL were transferred to a tube and centrifuged at 2000g for 5 min. .
- the lysis buffer is a mixture of 4- (2-hydroxyethyl) -1 -piperazine ethanesulfonic acid at 50mM, ethylenediaminetetraacetic acid at 5mM, sodium chloride at 150mM, and digitonin at 50 ⁇ g / ml.
- DNA fragments are detected in the cytoplasmic fraction of cell samples treated with a drug that induces their death (staurosporine). There is little or no fragmented DNA in the cytoplasmic fraction of the cell sample that has not undergone any treatment that induces cell death.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202080021607.1A CN113994011A (zh) | 2019-03-18 | 2020-03-16 | 检测细胞死亡的超灵敏方法 |
JP2021556536A JP2022525670A (ja) | 2019-03-18 | 2020-03-16 | 細胞死を検出するための超高感度方法 |
US17/439,599 US20220154247A1 (en) | 2019-03-18 | 2020-03-16 | Ultrasensitive method for detecting cell death |
EP20726887.1A EP3942065A1 (fr) | 2019-03-18 | 2020-03-16 | Méthode ultrasensible de détection de la mort cellulaire |
CA3128119A CA3128119A1 (fr) | 2019-03-18 | 2020-03-16 | Methode ultrasensible de detection de la mort cellulaire |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR1902755A FR3094017A1 (fr) | 2019-03-18 | 2019-03-18 | Méthode ultrasensible de détection de la mort cellulaire |
FR1902755 | 2019-03-18 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2020188216A1 true WO2020188216A1 (fr) | 2020-09-24 |
WO2020188216A8 WO2020188216A8 (fr) | 2021-12-30 |
Family
ID=67185417
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2020/050571 WO2020188216A1 (fr) | 2019-03-18 | 2020-03-16 | Méthode ultrasensible de détection de la mort cellulaire |
Country Status (7)
Country | Link |
---|---|
US (1) | US20220154247A1 (fr) |
EP (1) | EP3942065A1 (fr) |
JP (1) | JP2022525670A (fr) |
CN (1) | CN113994011A (fr) |
CA (1) | CA3128119A1 (fr) |
FR (1) | FR3094017A1 (fr) |
WO (1) | WO2020188216A1 (fr) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5637465A (en) | 1993-06-03 | 1997-06-10 | Boehringer Mannheim Gmbh | Method for the detection of a programmed or induced cell death of eukaryotic cells |
AU2005200170A1 (en) * | 1999-03-05 | 2005-02-10 | University Of Iowa Research Foundation | Diagnostics and therapeutics for drusen associated ocular disorders |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005111613A2 (fr) * | 2004-04-29 | 2005-11-24 | The University Of Tennessee Research Foundation | Identification de cellules apoptotiques |
US20120064528A1 (en) * | 2010-06-01 | 2012-03-15 | The Macfarlane Burnet Institute For Medical Research And Public Health Ltd | Methods and reagents for quantifying nucleic acid fragmentation and apoptosis (qlm-pcr, cell number qpcr and apoqpcr) |
CN102928603A (zh) * | 2011-08-08 | 2013-02-13 | 刘军 | 一种通过检测转录因子激活蛋白-1判断视网膜细胞死亡进程的方法 |
-
2019
- 2019-03-18 FR FR1902755A patent/FR3094017A1/fr active Pending
-
2020
- 2020-03-16 US US17/439,599 patent/US20220154247A1/en active Pending
- 2020-03-16 JP JP2021556536A patent/JP2022525670A/ja active Pending
- 2020-03-16 EP EP20726887.1A patent/EP3942065A1/fr active Pending
- 2020-03-16 WO PCT/FR2020/050571 patent/WO2020188216A1/fr unknown
- 2020-03-16 CN CN202080021607.1A patent/CN113994011A/zh active Pending
- 2020-03-16 CA CA3128119A patent/CA3128119A1/fr active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5637465A (en) | 1993-06-03 | 1997-06-10 | Boehringer Mannheim Gmbh | Method for the detection of a programmed or induced cell death of eukaryotic cells |
AU2005200170A1 (en) * | 1999-03-05 | 2005-02-10 | University Of Iowa Research Foundation | Diagnostics and therapeutics for drusen associated ocular disorders |
Non-Patent Citations (16)
Title |
---|
BOTEZATU ET AL., CLIN CHEM, vol. 46, no. 8, 2000, pages 1078 - 1084 |
DAVID J. HOOKER ET AL: "A new way of measuring apoptosis by absolute quantitation of inter-nucleosomally fragmented genomic DNA", NUCLEIC ACIDS RESEARCH ADVANCE ACCESS, vol. 40, no. 15, 1 August 2012 (2012-08-01), GB, pages e113 - e113, XP055647891, ISSN: 0305-1048, DOI: 10.1093/nar/gks334 * |
DAVID J. HOOKER ET AL: "Measuring and monitoring apoptosis and drug toxicity in HIV patients by ligation-mediated polymerase chain reaction", JOURNAL OF CELLULAR AND MOLECULAR MEDICINE, vol. 13, no. 5, 1 May 2009 (2009-05-01), RO, pages 948 - 958, XP055647830, ISSN: 1582-1838, DOI: 10.1111/j.1582-4934.2008.00612.x * |
FAWZY ET AL., J EGYPT NATL CANC INST, vol. 28, 2016, pages 235 - 242 |
GALLOUZZI ET AL., CELL DEATH DIFFER, 2018 |
GARY ZIEVESHELDON PENMAN, SMALL RNA SPECIES OF THE HELA CELL: METABOLISM AND SUBCELLULAR LOCALIZATION CELL, May 1976 (1976-05-01), pages 19 - 31 |
GOLDENTHAL KLHEDMAN KCHEN JWAUGUST JTWILLINGHAM MC., J HISTOCHEM CYTOCHEM., vol. 33, no. 8, August 1985 (1985-08-01), pages 813 - 20 |
HOOKER ET AL., J CELL MOL MED, vol. 13, no. 5, 2009, pages 948 - 958 |
HOOKER ET AL., NUCL ACIDS RES, vol. 40, no. 15, 2012, pages e113 |
KEIKO ET AL.: "REAP: A two minute cell fractionation method", BMC RESEARCH NOTES, vol. 3, 10 November 2010 (2010-11-10), pages 294, XP021083179, DOI: 10.1186/1756-0500-3-294 |
LIU DONG ET AL: "Population structure ofCoilia nasusin the Yangtze River revealed by insertion of short interspersed elements", BIOCHEMICAL SYSTEMATICS AND ECOLOGY, PERGAMON PRESS, GB, vol. 54, 8 February 2014 (2014-02-08), pages 103 - 112, XP029027178, ISSN: 0305-1978, DOI: 10.1016/J.BSE.2013.12.022 * |
LOU ET AL., INT J MOL MED, vol. 35, pages 72 - 80 |
MARISA M. FISHER ET AL: "Detection of Islet β-Cell Death in Vivo by Multiplex PCR Analysis of Differentially Methylated DNA", ENDOCRINOLOGY, vol. 154, no. 9, 1 September 2013 (2013-09-01), pages 3476 - 3481, XP055162044, ISSN: 0013-7227, DOI: 10.1210/en.2013-1223 * |
NAOYUKI UMETANI1 ET AL: "Increased Integrity of Free Circulating DNA in Sera of Patients with Colorectal or Periampullary Cancer: Direct Quantitative PCR for ALU Repeats", CLINICAL CHEMISTRY, P.B. HOEBER, vol. 52, no. 6, 1 January 2006 (2006-01-01), pages 1062 - 1069, XP009123303, ISSN: 0009-9147, DOI: 10.1373/CLINCHEM.2006.068577 * |
STALEY ET AL., CELL DEATH DIFFER, vol. 4, 1997, pages 66 - 75 |
UMETANI ET AL., CLIN CHEM, vol. 52, no. 6, 2006, pages 1062 - 1069 |
Also Published As
Publication number | Publication date |
---|---|
WO2020188216A8 (fr) | 2021-12-30 |
CA3128119A1 (fr) | 2020-09-24 |
FR3094017A1 (fr) | 2020-09-25 |
CN113994011A (zh) | 2022-01-28 |
JP2022525670A (ja) | 2022-05-18 |
US20220154247A1 (en) | 2022-05-19 |
EP3942065A1 (fr) | 2022-01-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Yang et al. | A CRISPR-based and post-amplification coupled SARS-CoV-2 detection with a portable evanescent wave biosensor | |
Zhou et al. | Point-of-care COVID-19 diagnostics powered by lateral flow assay | |
KR102628577B1 (ko) | Crispr 이펙터 시스템 기반 진단법 | |
JP7228514B2 (ja) | Crisprエフェクターシステムベースの診断法 | |
de Miguel et al. | Proteome analysis of the surface of Trichomonas vaginalis reveals novel proteins and strain-dependent differential expression | |
US11898209B2 (en) | Digital analysis of circulating tumor cells in blood samples | |
JP2021508460A (ja) | Crisprエフェクター系に基づくマルチプレックス診断 | |
US11667970B2 (en) | Spatial molecular analysis of tissue | |
JP2023520754A (ja) | SARS-CoV-2ウイルスの迅速で現場配備可能な検出 | |
WO2021002476A1 (fr) | Procédé et kit de détection de fragment d'acide nucléique cible | |
WO2022051667A1 (fr) | Diagnostics basés sur un système effecteur crispr pour la détection de virus | |
JP2022520663A (ja) | in situハイブリダイゼーションによって、核酸をマルチプレックス検出する方法 | |
Grossegesse et al. | Global ubiquitination analysis reveals extensive modification and proteasomal degradation of cowpox virus proteins, but preservation of viral cores | |
EP2379752A1 (fr) | Procedes pour determiner la susceptibilite a contracter une infection nosocomiale chez un patient et pour etablir un pronostic d'evolution d'un syndrome septique | |
US20230002815A1 (en) | Methods for sequential detection of nucleic acids | |
EP3942065A1 (fr) | Méthode ultrasensible de détection de la mort cellulaire | |
US20200407467A1 (en) | Protease activity profiling via programmable phage display of comprehensive proteome-scale peptide libraries | |
WO2019166731A1 (fr) | Méthode pour génerer un profil des capacités de réparation de l'adn de cellules tumorales et ses applications | |
FR2927091A1 (fr) | Methode, procede, et kit de diagnostic, pronostic du cancer colorectal | |
EP1137802B1 (fr) | Procede de determination de l'activite d'une substance mettant en oeuvre un test fonctionnel in vitro | |
WO2006042969A1 (fr) | Atp-metrie pour detecter et denombrer les virus | |
US20230151415A1 (en) | Methods for detecting target nucleic acids by in situ hybridization and a kit thereof | |
EP1137801A1 (fr) | Methode de dtection et/ou de quantification d'une fonction connue a partir d'un echantillon d'acides nucleiques | |
JP2022525101A (ja) | in situでの2本鎖核酸の検出、及びその関連方法 | |
CA2610057A1 (fr) | Methode et trousses de detection de mutations associees a maladies genetiques recessives |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20726887 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 3128119 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 2021556536 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2020726887 Country of ref document: EP Effective date: 20211018 |