WO2020176740A1 - Improved process for dna integration using rna-guided endonucleases - Google Patents
Improved process for dna integration using rna-guided endonucleases Download PDFInfo
- Publication number
- WO2020176740A1 WO2020176740A1 PCT/US2020/020121 US2020020121W WO2020176740A1 WO 2020176740 A1 WO2020176740 A1 WO 2020176740A1 US 2020020121 W US2020020121 W US 2020020121W WO 2020176740 A1 WO2020176740 A1 WO 2020176740A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleotides
- cells
- donor dna
- strand
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/421—Immunoglobulin superfamily
- A61K40/4211—CD19 or B4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4214—Receptors for cytokines
- A61K40/4215—Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR], CD30
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4222—CD38 not IgG
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/48—Blood cells, e.g. leukemia or lymphoma
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/515—CD3, T-cell receptor complex
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/73—Hydrolases (EC 3.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/70—Vectors containing special elements for cloning, e.g. topoisomerase, adaptor sites
Definitions
- the present disclosure provides methods and compositions for efficiently integrating a DNA sequence of interest into a target DNA molecule, such as a host genome using an RNA- guided endonuclease such as a cas protein.
- CRISPR-Cas genome engineering is a fast and relatively simple way to knockout gene function, or precisely knock-in a DNA sequence for gene correction or gene tagging.
- Targeted gene knockout is achieved through generation of a double-strand break (DSB) in the DNA using Cas9 nuclease and guide RNA (gRNA).
- the DSB is then repaired, often imperfectly, by random insertions or deletions (indels), through the endogenous non-homologous end joining (NHEJ) repair pathway.
- NHEJ endogenous non-homologous end joining
- a DNA donor template is required and the DSB is repaired with the donor template typically through the homology-directed repair (HDR) pathway.
- ssDNA single-stranded DNA
- dsDNA donor plasmid
- RNA-guided Cas nuclease system involves a Cas endonuclease, coupled with a guide RNA molecule, that have the ability to create double-stranded breaks in genomic DNA at specific sequences that are targeted by the guide RNA.
- the RNA-guided Cas endonuclease has the ability to cleave the DNA where the RNA guide hybridizes to the genome sequence.
- the Cas9 nuclease cuts the DNA only if a specific sequence known as protospacer adjacent motif (PAM) is present immediately downstream of the target sequence in the genome.
- PAM protospacer adjacent motif
- the canonical PAM sequence in S. pyogenes is 5 ⁇ -NGG-3 ⁇ , where N refers to any nucleotide.
- Paired nicking can reduce off-target activity by 50- to 1,500-fold in cell lines and to facilitate gene knockout in mouse zygote without losing on-target cleavage efficiency.
- cas proteins have been isolated from a variety of bacteria and have been found to use different PAM sequences than S. pyogenes cas9.
- some cas proteins such as cas12a naturally use a single RNA guide– that is, they use a crRNA that hybridizes to a target sequence but do not use a tracrRNA.
- Adoptive immunotherapy involves transfer of autologous antigen-specific cells generated ex vivo, is a promising strategy to treat viral infections and cancer.
- the cells used for adoptive immunotherapy can be generated either by expansion of antigen-specific cells or redirection of cells through genetic engineering.
- CARs are synthetic receptors consisting of a targeting moiety that is associated with one or more signaling domains in a single fusion molecule.
- the binding moiety of a CAR consists of an antigen-binding domain of a single-chain antibody (scFv), comprising the light and variable fragments of a monoclonal antibody joined by a flexible linker. Binding moieties based on receptor or ligand domains have also been used successfully.
- the signaling domains for first generation CARs are derived from the cytoplasmic region of the CD3zeta or the Fc receptor gamma chains. First generation CARs have been shown to successfully redirect T cell cytotoxicity, however, they failed to provide prolonged expansion and anti-tumor activity in vivo.
- CARs have successfully allowed T cells to be redirected against antigens expressed at the surface of tumor cells from various malignancies including lymphomas and solid tumors.
- CAR chimeric antigen receptor
- the gene transfer techniques include viral-based gene transfer methods using gamma- retroviral vectors or lentiviral vectors.
- GMP FDA
- the viral vector has to comply with clinical safety standards such as replication incompetence, low genotoxicity, and low immunogenicity.
- RNA-guided endonucleases such as the Cas9/CRISPR system
- Cas9/CRISPR system appear to be an attractive approach for genetically engineering some mammalian cells
- the use of Cas9/CRISPR in primary cells, in particular in T cells is significantly more difficult because: (1) T-cells are
- RNA-guided endonuclease is determined only by sequences comprising 11 nucleotides (N12-20NGG, where NGG represents the PAM), which makes it very difficult to identify target sequences in desired loci that are unique in the genome.
- Other nucleases in addition to CAS9, are zinc finger nucleases (ZFN) or TAL effector nucleases (TALEN)
- the present disclosure aims to provide solutions to these limitations in order to efficiently implement RNA-guided endonuclease engineering in host cells such as T cells.
- RNA-guided endonuclease engineering in host cells such as T cells.
- the present disclosure was made to address this need in the art.
- a method for site-specific integration of a donor DNA into a target DNA molecule includes introducing into a cell: an RNA-guided endonuclease or a nucleic acid molecule encoding an RNA-guided endonuclease; at least one engineered guide RNA or at least one nucleic acid molecule encoding an engineered guide RNA; and a donor DNA molecule comprising at least two nucleic acid modifications.
- the guide RNA includes a target sequence designed to hybridize with a target site in the target DNA and the donor DNA is inserted into the target DNA molecule at the target site.
- the method may further include any of the following details, which may be combined with one another in any combinations unless clearly mutually exclusive:
- the at least two nucleic acid modifications may be on a single strand of the donor DNA molecule
- one or more nucleic acid modifications may be a modification of one or more nucleotides or nucleotide linkages within 10 nucleotides of the 5’ end of a modified strand of the donor DNA molecule;
- nucleic acid modifications may be a backbone modification
- one or more nucleic acid modifications may be a phosphorothioate modification or a phosphoramidite modification, or a combination thereof;
- nucleic acid modifications may be a modification or substitution of a nucleobase
- nucleic acid modifications may be a modification or substitution of a sugar
- nucleic acid modifications may be a 2’-O-methyl group modification of deoxyribose
- the donor DNA molecule may be a double stranded DNA molecule
- the donor DNA molecule may have a modified strand including the at least two nucleic acid modifications and may have a 5’ terminal phosphate on a strand opposite to the modified strand;
- the donor molecule may have between one and three phosphorothiorate modifications on the backbone within ten nucleotides of the 5’ terminus of the modified strand of the donor DNA molecule and between one and three 2’-O-methyl nucleotide modifications within ten nucleotides of the 5’ terminus of the modified strand of the donor DNA molecule;
- the donor molecule may have between one and three phosphorothiorate
- the donor DNA molecule may include homology arms flanking a sequence for integration into the genome;
- the homology arms may be from 50 to 2000 nucleotides in length; (xiv) at least one of the homology arms may be from 100 to 1000 nucleotides in length; (xv) at least one of the homology arms may be from 150 to 650 nucleotides in length; (xvi) at least one of the homology arms may be from 150 to 350 nucleotides in length; (xvii) at least one of the homology arms may be from 150 to 200 nucleotides in length; (xviii) the donor DNA molecule may include a modified strand and an opposite strand, wherein the modified strand may include two or more nucleic acid modifications, and the opposite strand may include a terminal phosphate;
- the donor DNA may include a chimeric antigen receptor (CAR) construct
- the guide RNA may be a crRNA
- the method may further include introducing a tracr RNA into the cell;
- the guide RNA may be a chimeric guide RNA
- the RNA-guided endonuclease may be Cas9, Cas12a, Cas12b, Cas13, Cas14, or CasX;
- At least one guide RNA may be introduced into the cell
- an RNA-guided endonuclease may be introduced into the cell
- RNA-guided endonuclease and the guide RNA may be introduced into the cell as a ribonucleoprotein complex (RNP);
- the RNP may include a tracr RNA
- the RNP may be introduced into the cell by electroporation or liposome transfer;
- the donor DNA and the RNP may be introduced into the cell simultaneously or separately;
- the RNA-guided endonuclease or the nucleic acid molecule encoding an RNA- guided endonuclease, the at least one engineered guide RNA or the at least one nucleic acid molecule encoding an engineered guide RNA, and the donor DNA molecule may be introduced into the cell simultaneously;
- the cell may be a eukaryotic cell
- the cell may be a mammalian cell
- the cell may be a human cell
- the cell may be a hematopoietic cell
- the cell may be a T cell
- the target site may be selected from a T cell receptor gene, a PD-1 gene, or a TIM3 gene.
- a host cell includes a donor DNA as described herein integrated into a target DNA molecule as described herein, wherein the host cell may be produced by any of the methods described herein.
- a population of primary T cells transfected with a chimeric antigen receptor (CAR) construct is described.
- the population of primary T cells includes T cells having the CAR construct integrated into the genome at a cas9 nuclease target site, wherein at least 20% of the T cells of the population express the CAR construct, and the T cells of the population do not include a recombinant viral vector or sequences derived therefrom.
- the population of primary T cells transfected with a chimeric antigen receptor (CAR) construct may further include any of the following
- the CAR construct may be at least 1.8 kb
- the CAR construct may be an anti-CD38 CAR construct, an anti-CD19 CAR construct, or an anti-BCMA CAR construct;
- the CAR construct may be inserted into the TRAC locus
- At least 20% of the cells of the population may not express the T cell receptor
- the CAR construct may be inserted into the PD-1 locus
- a system for targeted integration of a donor DNA into a target locus includes: an RNA-guided endonuclease or a nucleic acid molecule encoding an RNA guided endonuclease; a guide RNA or a nucleic acid molecule encoding a guide RNA; and a double-stranded donor DNA molecule.
- the donor DNA molecule includes one modified strand having one or more phosphorothioate bonds within ten nucleotides of the 5’ terminus of the modified strand.
- system may further include any of the following details, which may be combined with one another in any combinations unless clearly mutually exclusive:
- the system may include an RNA-guided endonuclease
- the system may include a guide RNA
- the donor DNA molecule may further include at least one modification of a sugar moiety or nucleobase of the modified strand within ten nucleotides of the 5’ terminus of the modified strand;
- the donor DNA may have homology arms flanking a sequence of interest for integration into the genome
- the one or more phosphorothioate bonds on the single strand of the double stranded DNA molecule may be within five nucleotides of the 5’ terminus of the modified strand;
- the at least one modification of a sugar moiety or nucleobase of the modified strand may be within five nucleotides of the 5’ terminus of the modified strand;
- the at least one modification of a sugar moiety may include a 2’-O methylation
- sequence of interest may include an expression cassette
- the expression cassette may include a construct including one or more antibody or receptor domains
- (x) at least one of the homology arms may be from 50 to 5000 nucleotides in length; (xi) at least one of the homology arms may be from 100 to 1000 nucleotides in length; (xii) at least one of the homology arms may be from 150 to 800 nucleotides in length; (xiii) the nuclease may be selected from the group consisting of Cas9, Cas12a, Cas12b, CasX, and combinations thereof;
- the guide RNA may be a chimeric guide having sequences of both a crRNA and a tracrRNA;
- the guide RNA may be a crRNA
- the guide RNA may include one or more phosphorothioate (PS) oligonucleotides;
- the guide RNA may be a crRNA and the system may further include a tracrRNA;
- the guide RNA may be a single guide RNA;
- the system may include a ribonucleoprotein complex including the RNA-guided endonuclease and the guide RNA.
- a composition for generating a donor DNA molecule includes: a first primer (single stranded deoxyoligonucleotide) having one or more phosphorothioate bonds and one or more modified nucleotides within five nucleotides of the 5’ terminus of the oligonucleotide; and a second primer (single stranded deoxyoligonucleotide) having a 5’ terminal phosphate.
- composition for generating a donor DNA molecule may further include the following details:
- the first and second primers may be homologous to sequences on opposite sides of a target site for an RNA-guided endonuclease in a target genome.
- a double-stranded donor DNA molecule configured to integrate a sequence of interest into a target site of a host genome.
- the double- stranded donor DNA molecule includes one or more modifications to nucleotides of one donor DNA strand; homology arms flanking the sequence of interest, where the homology arms include sequences homologous to sequences occurring in the host genome on either side of the target site; and from one to ten modified nucleotides that occur within ten nucleotides of the 5’ end of one strand of the donor DNA.
- the double-stranded donor DNA molecule may further include any of the following details, which may be combined with one another in any combinations unless clearly mutually exclusive:
- the double-stranded donor DNA molecule may include from one to five modified nucleotides that be within five nucleotides of the 5’ end of one strand of the donor DNA;
- the modified nucleotides may include from 1 to 4 phosphorothioate (PS) linkages, or from 1 to 42’-O-methylation modifications, or a combination thereof;
- PS phosphorothioate
- one strand of the double-stranded donor DNA molecule may have two or more modifications on any of the first ten or first five nucleotides from the 5’ end and the other strand has a terminal 5’ phosphate.
- the sequence of interest may include a chimeric antigen receptor (CAR) construct;
- the target site may be selected from a T cell receptor gene, a PD-1 gene, or a TIM3 gene.
- FIG.1A provides chemical drawings that show, in the right structure, a phosphorothioate (PS) modification of the bond between nucleotides as they might occur in a primer.
- the nucleotides shown in the oligonucleotide on the left are attached via a (nonmodified) phosphodiester bond.
- FIG.1B provides a chemical drawing of an oligonucleotide having two PS bonds that join the 5’-most nucleotide to the next nucleotide“downstream” in the
- oligonucleotide which in turn is attached to the following downstream nucleotide of the oligonucleotide by a PS bond.
- the 5’-most nucleotide of the oligonucleotide includes a 2’ O- methyl modification.
- FIG.2A is a diagram showing structure of a donor DNA construct, such as a CAR donor DNA construct that includes an open reading frame having a sequence encoding a single chain variable fragment (scFv), followed by the CD8a leader peptide which is then followed by a CD28 hinge-CD28 transmembrane-intracellular regions and then a CD3 zeta intracellular domain.
- the coding sequence is preceded by a JeT promoter (SEQ ID NO:3) and the construct includes homology arms (HA), in this case matching sequences of the human TRAC locus, flanking the promoter plus coding sequences.
- HA homology arms
- the anti-CD38A2 contains a CD38 CAR transgene with expression driven by the JeT promoter and flanked by homology arms on the 5’ and 3’ sides to enable targeted integration.
- FIG.2B shows primer design for confirming knock in, showing the same diagram as in FIG.2A and also indicating the positions of PCR primers used to confirm CAR
- FIG.3A provides flow cytometry plots of PBMCs 8 days after transformation with a donor DNA that included a construct for expressing an anti-CD38 CAR and an RNP comprising a guide RNA targeting the TRAC locus.
- the CAR cassette was flanked by homology arms having homology to TRAC locus sequences flanking the integration target site in exon 1 of the TRAC gene.
- the Y axis reports cell size.
- Anti-CD38 construct expression is along the x axis.
- FIG.3B provides the results of flow cytometry performed on the same cultures as in FIG.3A ten days after transfection.
- FIG.3C provides the results of flow cytometry performed on the culture that received the doubly- modified donor DNA and control (TRAC knockout only and TRAC knockout with retroviral transduction) twenty days after transfection.
- FIG.4 shows a gel of PCR products showing integration of the donor DNA at the targeted TRAC (Exon1) site.
- Primary human T cells were electroporated with TRAC RNP only or together with ssDNA.
- PCR was used to confirm the presence of the anti-CD38A2 CAR transgene integrated in the TRAC locus two weeks post-electroporation (lanes 3 and 6, depicting products from 5’ and 3’ integration regions). No bands were observed in non-transformed ATCs (lanes 1 and 4) or T cells that were transformed with the TRAC exon 1 targeting RNP but did not receive the donor DNA (lanes 2 and 5).
- FIG.5 is a graph showing cytotoxicity assay results with Activated T cells (ATCs, stars) as a control, TCR knock out ATC, anti-CD38A2 retrovirus transduced CART cells RV CART, black line), TRAC knock out retrovirus transduced CART cells (dots), TRAC knock out together with phosphorothioate modified ss donor DNA knock in (dashes), TRAC knock out together with phosphorothioate and 2’ O-Methyl modified ssDNA knock in (dashes and dots).
- ATCs Activated T cells
- FIG.6A, FIG.6B and FIG.6C provide graphs of the results of cytokine secretion assays using anti-CD38 CART cells and controls co-cultured with K52 or RPM18226 cells.
- the T cell cultures tested are as provided in FIG.5.
- FIG.7 provides the results of testing donor DNAs having homology arms (HAs) of different lengths. Cultures were assessed by flow cytometry for loss of TCR expression (Y axis) and anti-CD38 expression (X axis).
- FIG.8 provides the results of testing double stranded donor DNAs modified by the addition of three PS bonds and three 2’O methyl nucleotides proximal to the 5’ end of one strand of the donor DNA molecule. Cultures were assessed by flow cytometry for loss of TCR expression (Y axis) and anti-CD38 expression (X axis).
- FIG.9 provides the results of flow cytometry on cells transfected with a ds PS and 2’- OMe- modified donor DNA that included a cassette for expressing an anti-CD19 CAR.
- the donor was directed to the TRAC exon 1 locus by cotransfection with an RNP.
- TCR expression is determined on the Y axis and anti-CD19 CAR expression on the Y axis.
- FIG.10 provides the results of flow cytometry on cells transfected with a ds PS and 2’- OMe- modified donor DNA that included a cassette for expressing an anti-BCMA CAR.
- the donor was directed to the TRAC exon 1 locus by cotransfection with an RNP.
- TCR expression is determined on the Y axis and anti-BCMA CAR expression on the Y axis.
- FIG.11 provides the results of flow cytometry on cells transfected with a ds PS and 2’- OMe- modified donor DNA that included a cassette for expressing an anti-CD38 CAR.
- the donor was directed to the TRAC exon 3 locus by cotransfection with an RNP.
- TCR expression is determined on the Y axis and anti-CD38 CAR expression on the Y axis.
- FIG.12 provides the results of flow cytometry on cells transfected with a ds PS and 2’- OMe- modified donor DNA that included a cassette for expressing an anti-CD19 CAR.
- the donor had homology arms derived from TRAC exon 3 was directed to the TRAC exon 3 locus by cotransfection with an RNP having an exon 3 guide RNA (2 nd panel).
- the donor had homology arms derived from TRAC exon 1 was directed to the TRAC exon 1 locus by cotransfection with an RNP having an exon 1 guide RNA (2 nd panel).
- TCR expression is determined on the Y axis and anti-CD19 CAR expression on the Y axis.
- FIG.13 provides the results of flow cytometry on cells transfected with a ds PS and 2’- OMe- modified donor DNA that included a cassette for expressing an anti-C38 CAR and homology arms derived from the TRAC gene or the PD-1 gene.
- the donor had homology arms derived from TRAC exon 1 was directed to the TRAC exon 1 locus by
- TCR expression is determined on the Y axis and anti-CD38 or anti-PD-1 CAR expression on the Y axis.
- FIG.14 provides the results of cytotoxicity assays using T cell cultures that were transfected with doubly modified (PS and 2’-OMe) donor fragment that included and anti-CD38 CAR construct and PD-1 gene-derived homology arms was targeted to the PD-1 gene by an RNP that included a guide RNA having a target sequence from the PD-1 gene.
- doubly modified (PS and 2’-OMe) donor fragment that included and anti-CD38 CAR construct and PD-1 gene-derived homology arms was targeted to the PD-1 gene by an RNP that included a guide RNA having a target sequence from the PD-1 gene.
- the present disclosure provides an improved, safer, and commercially efficient process for developing genetically engineered and transduced cells for immunotherapy. More specifically, the disclosed process comprises introducing an RNA-guided endonuclease, a guide RNA, and a donor DNA construct into host cells, where the guide RNA is engineered to direct the cas protein with which it is complexed to a targeted site of the host genome. Cleavage of the genomic DNA at the target site by the RNA-guided endonuclease and subsequent repair of the double stranded break using the donor fragment that includes homology arms by homology- directed repair (HDR) results in integration of sequences of the donor DNA molecule positioned between the homology arms.
- HDR homology- directed repair
- the method can be used to simultaneously knock out a gene at the target locus and insert or“knock in” at the disrupted locus a transgene that is provided in the donor DNA molecule.
- the method can be used on any host cells, including prokaryotic and eukaryotic cells, and can be used with mammalian cells, such as human cells.
- the method has advantages in ease of use, efficiency, and the ability to generate genome modifications that do not entail the use of selectable markers or viral vectors that are undesirable in many applications, including clinical applications.
- the host cells are hematopoietic cells, such as, for example, T cells.
- the present disclosure also provides donor DNA compositions, where the donor DNA molecule includes one or more modifications to nucleotides of one donor DNA strand.
- the donor DNA can include homology arms flanking a sequence of interest whose integration into the host genome is desired, where the homology arms have sequences homologous to sequences occurring in the host genome on either side of the target sequence.
- the donor DNA in some embodiments is double-stranded.
- the donor DNA includes from one to ten modified nucleotides that are proximal to the 5’ end of one strand of the donor DNA, for example, that occur within ten nucleotides or within five nucleotides of the 5’ terminus of one
- the donor DNA has at least two types of nucleic acid modification of from one to ten nucleotides at the 5’ end of one strand of the donor DNA. In some embodiments the donor DNA has two types of nucleic acid modification of from one to ten nucleotides at the 5’ end of one strand of the donor DNA.
- the modification may be, for example, phosphorothioate (PS) linkages between nucleotides, or may be 2’-O-methylation of the deoxyribose of one or more nucleotides of the donor DNA molecule.
- PS phosphorothioate
- a donor DNA molecule can have one, two, three or four PS bonds within the first five, first six, or first seven nucleotides from the 5’ end of the modified strand and can also have one, two, three or four 2’- O-methyl modified nucleotides within the first five, first six, or first seven nucleotides from the 5’ end of the modified strand.
- the donor DNA molecule is double-stranded and one strand comprises the modifications at the 5’ end.
- the donor DNA molecule is double-stranded and one strand has two or more modifications on any of the first ten or first five nucleotides from the 5’ end and the opposite strand has a terminal 5’ phosphate.
- the donor DNA molecule is double-stranded and has at least two PS bonds and at least two 2’O-methyl-modified nucleotides on one strand of the donor DNA, where the PS and 2’-O methyl modifications occur within the first five nucleotides from the 5’ end of the modified strand.
- the donor DNA molecule is double-stranded and has three PS bonds and three 2’O-methyl-modified nucleotides on one strand of the donor DNA, where the PS and 2’-O methyl modifications occur within the first five nucleotides from the 5’ end of the modified strand.
- the opposite strand includes a terminal 5’ phosphate.
- the donor DNA is introduced into the cell as a double-stranded molecule.
- the present disclosure further provides a donor DNA construct designed for inserting a CAR (chimeric antigen receptor) into a host cell. Further, the present disclosure provides a host cell transduced with a CAR that lacks viral vectors. The disclosure provides for more efficient and more cost-effective process for engineering T cells to express CAR constructs.
- the CAR construct can include homology arms that target the construct to a T cell receptor gene, PD-1 gene, or TIM3 gene, as nonlimiting examples, for simultaneous knock-in of the CAR construct and knock out of the TCR, PD-1, or TIM3 gene.
- a system for genome modification that comprises: an RNA-guide endonuclease or a nucleic acid molecule encoding an RNA-guide endonuclease; a guide RNA or a nucleic acid molecule encoding a guide RNA; and a donor DNA molecule, where the donor DNA molecule includes at least one nucleotide modification within ten or
- the donor DNA is double- stranded and includes at least one, at least two, or at least three modifications on at least one, at least two, or at least three nucleotides occurring within ten or within five nucleotides of one strand of the double stranded donor DNA molecule.
- the modifications can be, for example, phosphorothioate bonds and/or 2’-O methylation of nucleotides.
- the donor DNA can have homology arms flanking a sequence of interest to be integrated into the genome.
- the sequence of interest can be an expression cassette, for example, for expression of a construct that includes one or more antibody or receptor domains.
- Homology arms can be between about 50 and about 5000 nucleotides in length, or between about 100 and 1000 nucleotides in length, for example between about 150 and about 800 nucleotides in length. In a donor DNA molecule, the homology arms may be the same length or different lengths.
- the nuclease is selected from the group consisting of Cas9, Cas12a, Cas12b, CasX, and combinations thereof.
- the guide RNA can be a chimeric guide, having sequences of both crRNA and tracrRNA, or can be a crRNA, and can optionally include one or more phosphorothioate (PS) oligonucleotides. Where the guide is a crRNA, and the RNA- guided endonuclease uses a tracrRNA, the system can also include a tracrRNA.
- Cas9 can be used with a crRNA and a tracrRNA or can be used with a chimeric guide RNA (sometimes called a single guide or“sgRNA”) that combines structural features of the crRNA and tracrRNA.
- Cas12a on the other hand naturally uses only a crRNA and has no associated tracrRNA.
- the RNA-guide endonuclease, guide RNA that can be a crRNA or a chimeric guide RNA
- tracr RNA can be complexed as a ribonucleoprotein complex that is introduced to the cell.
- the donor DNA can be introduced into the target cell together with the RNP, or separately, for example, in a separate electroporation or transfection.
- Also provided herein is a method for site-specific integration of a donor DNA into a target DNA molecule, where the method includes introducing into a cell: an RNA-guided endonuclease or a nucleic acid molecule encoding an RNA-guided endonuclease; at least one engineered guide RNA or at least one nucleic acid molecule encoding an engineered guide RNA; and a donor DNA molecule comprising at least one nucleic acid modification; where the guide RNA comprises a target sequence designed to hybridize with a target site in the target DNA and the donor DNA is inserted into the target DNA molecule at the target site.
- the donor DNA includes at least two modified nucleotides, which can have the same or different modifications, and preferably occur within ten or within five nucleotides of the
- the donor DNA is double- stranded and the one or more nucleotide modifications occur on a single strand of the donor DNA molecule. In some embodiments, the donor DNA is double-stranded and the one or more nucleotide modifications occur on a single strand of the donor DNA molecule within ten or within five nucleotides of the 5’ terminus of the modified strand. In some embodiments, the donor DNA includes a backbone modification such as a phosphoramidite or phoshorothioate modification. In some embodiments, the donor DNA includes a modification of a sugar moiety of a nucleotide.
- the donor DNA is double stranded and includes at least one, at least two, or at least three phosphorothioate modifications within five nucleotides of the 5’ end of a single strand of the donor DNA molecule and further includes at least one, at least two, or at least three 2’-O-methylated nucleotides within five nucleotides of the 5’ end of a single strand of the donor DNA molecule.
- the donor DNA includes homology arms flanking a DNA sequence of interest, such as, for example, an expression cassette, where the homology arms have homology to sites in the target genome on either side of the target site of the RNA-guide endonuclease.
- Homology arms can be from about 50 to about 2000 nt in length, and may be, for example between 100 and 1000 nt in length, or between 150 and 650 nt in length, for example, between 150 and 350 nt in length, or 150 to 200 nt in length.
- the homology arms may be the same length or different lengths.
- a donor DNA molecule has two or more nucleotide modifications on the modified strand and the opposite strand includes a terminal phosphate.
- the RNA-guided endonuclease can be a cas protein and can be, as nonlimiting example, a cas9, cas12a, or casX protein.
- the RNA-guided endonuclease and an RNA guide are introduced into the cell as a ribonucleoprotein complex (RNP).
- RNP ribonucleoprotein complex
- the RNP can in some embodiments further include a tracr RNA.
- An RNP can be introduced into a target cell by any feasible means, including electroporation or liposome transfer, for example.
- the donor DNA can be delivered to the cell simultaneously with the RNP, or separately.
- Also included herein are methods of producing a donor DNA molecule where the method includes amplifying a template DNA that includes homology arms flanking a sequence of interest using a first primer that includes at least two nucleotide modifications within the first five nucleotides of the 5’ terminus of the primer, and a second primer that includes a 5’ terminal phosphate.
- the first primer can include at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten
- a primer for producing a donor DNA molecule can include at least one phosphorothioate modification and at least one 2’O-methyl modification of a nucleotide within five nucleotides of the 5’ terminus of the primer.
- the first and second primers may be homologous to sequences on opposite sides of a target site for an RNA-guided endonuclease in a target genome.
- the first primer can include one or more phosphorothioate bonds and one or more 2’-O-methylated nucleotides within five nucleotides of the 5’ terminus of the modified strand of the oligonucleotide, for example, the first primer can have three phosphorothioate linkages and three 2’-O-methylated nucleotides.
- the primers can be, for example, from 17 to 100 nucleotides in length, for example, from 17 to 30 oligonucleotides in length.
- the primers are designed to hybridize to opposite strands of a genomic sequence on either side of cas target site in a genome, such as in a human gene, so that donor fragments based on constructs having flanking sequences homologous to sequences surrounding a target site of interest can be produced with the desired nucleotide or backbone modifications.
- composition that comprises primers for amplification of a donor DNA fragment for insertion into a mammalian genome.
- the composition can include a first DNA oligonucleotide primer and a second DNA oligonucleotide primer, where each of the first and second oligonucleotide primers include at least one 2’O-methyl modification of a nucleotide within five nucleotides of the 5’ terminus of the primer and at least one phosphorothioate modification within five nucleotides of the 5’ terminus of the primer.
- the first and second oligonucleotide primers are a primer pair, where the first and second primers are able to amplify a sequence that includes a target site of comprises a sequence of at least 18 nucleotides that is on one side of a target site for a cas nuclease and the second primer comprises a sequence of at least 18 nucleotides that is on the opposite strand side of a target site for a cas nuclease.
- references to “a cell” includes a plurality of such cells and reference to “the agent” includes reference to one or more agents known to those skilled in the art, and so forth.
- primary cell refers to a cell isolated directly from a multicellular organism. Primary cells typically have undergone very few population doublings and are therefore more representative of the main functional component of the tissue from which they are derived in comparison to continuous (tumor or artificially immortalized) cell lines. In some cases, primary cells are cells that have been isolated and then used immediately. In other cases, primary cells cannot divide indefinitely and thus cannot be cultured for long periods of time in vitro.
- genomic editing refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from a target DNA, e.g., the genome of a cell, using one or more nucleases.
- the nucleases create specific double-strand breaks (DSBs) at desired locations in a genome and harness a cell's endogenous mechanisms to repair the induced break by homology- directed repair (HDR) (e.g., homologous recombination) or by nonhomologous end joining (NHEJ).
- HDR homology- directed repair
- NHEJ nonhomologous end joining
- Any suitable nuclease can be introduced into a cell to induce genome editing of a target DNA sequence including, but not limited to, CRISPR-associated protein (Cas) nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs),
- Cas CRISPR-associated protein
- ZFNs zinc finger nucleases
- TALENs transcription activator-like effector nucleases
- Nuclease-mediated genome editing of a target DNA sequence can be "induced” or “modulated” (e.g., enhanced) using the modified single guide RNAs (sgRNAs) described herein in combination with Cas nucleases (e.g., Cas9 polypeptides or Cas9 mRNA), to improve the efficiency of precise genome editing via homology-directed repair (HDR).
- sgRNAs modified single guide RNAs
- Cas nucleases e.g., Cas9 polypeptides or Cas9 mRNA
- HDR homologous recombination
- nonhomologous end joining refers to a pathway that repairs double-strand DNA breaks in which the break ends are directly ligated without the need for a homologous template.
- nucleic acid refers to deoxyribonucleic acids (DNA), ribonucleic acids (RNA) and polymers thereof in either single-, double- or multi- stranded form.
- DNA deoxyribonucleic acids
- RNA ribonucleic acids
- the term includes, but is not limited to, single-, double- or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and/or
- a nucleic acid can comprise a mixture of DNA, RNA and analogs thereof.
- the term also encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
- a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res.19:5081 (1991); Ohtsuka et al, J. Biol. Chem.260:2605-2608 (1985); and Rossolini et al, Mol. Cell. Probes 8:91-98 (1994)).
- the term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene.
- nucleotide analog or “modified nucleotide” refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions), in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U), adenine (A) or guanine (G)), in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or open-chain sugar analog), or the phosphate.
- substitutions e.g., substitutions
- gene or "nucleotide sequence encoding a polypeptide” means the segment of DNA involved in producing a polypeptide chain.
- the DNA segment may include regions preceding and following the coding region (leader and trailer) involved in the
- polypeptide “peptide,” and “protein” are used interchangeably to refer to a polymer of amino acid residues.
- the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers.
- the terms encompass amino acid chains of any length, including full- length proteins, wherein the amino acid residues are linked by covalent peptide bonds.
- variable refers to a form of an organism, strain, gene, polynucleotide, polypeptide, or characteristic that deviates from what occurs in nature.
- complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-
- a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
- Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
- Substantially complementary refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%.97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.
- stringent conditions refers to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences.
- Stringent conditions are generally sequence-dependent and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence.
- Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology - Hybridization With Nucleic Acid Probes Part 1, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.
- hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
- the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
- the complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these.
- a "recombinant expression vector” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell.
- An expression vector may be part of a plasmid, viral genome, or nucleic acid fragment.
- an expression vector typically includes a
- polynucleotide to be transcribed operably linked to a promoter.
- “Operably linked” means two or more genetic elements, such as a polynucleotide coding sequence and a promoter, placed in relative positions that permit the proper biological functioning of the elements, such as the promoter directing transcription of the coding sequence.
- promoter refers to an array of nucleic acid control sequences that direct transcription of a nucleic acid.
- a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
- a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
- Other elements that may be present in an expression vector include those that enhance transcription (e.g., enhancers) and terminate transcription (e.g., terminators), as well as those that confer certain binding affinity or antigenicity to the recombinant protein produced from the expression vector.
- Recombinant refers to a genetically modified polynucleotide, polypeptide, cell, tissue, or organism.
- a recombinant polynucleotide or a copy or complement of a recombinant polynucleotide is one that has been manipulated using well known methods.
- a recombinant expression cassette comprising a promoter operably linked to a second
- polynucleotide e.g., a coding sequence
- polynucleotide can include a promoter that is heterologous to the second polynucleotide as the result of human manipulation (e.g., by methods described in Sambrook et al, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)).
- a recombinant expression cassette typically comprises polynucleotides in combinations that are not found in nature. For instance, human manipulated restriction sites or plasmid vector sequences can flank or separate the promoter from other sequences.
- a recombinant protein is one that is expressed from a recombinant polynucleotide, and recombinant cells, tissues, and organisms are those that comprise recombinant sequences (polynucleotide and/or polypeptide).
- single nucleotide polymorphism refers to a change of a single nucleotide with a polynucleotide, including within an allele. This can include the replacement of one nucleotide by another, as well as deletion or insertion of a single nucleotide. Most typically, SNPs are biallelic markers although tri- and tetra-allelic markers can also exist. By way of non- limiting example, a nucleic acid molecule comprising SNP A ⁇ C may include a C or A at the polymorphic position.
- expand when referring to cell culture itself or the process of culturing, can be used interchangeably to mean that a cell (e.g., primary cell) is maintained outside its normal environment under controlled conditions, e.g., under conditions suitable for survival.
- cells are allowed to survive, and culturing can result in cell growth, stasis, differentiation or division. The term does not imply that all cells in the culture survive, grow, or divide, as some may naturally die or senesce. Cells are typically cultured in media, which can be changed during the course of the culture.
- the terms "subject,” “patient,” and “individual” are used herein interchangeably to include a human or animal.
- the animal subject may be a mammal, a primate (e.g., a monkey), a livestock animal (e.g., a horse, a cow, a sheep, a pig, or a goat), a companion animal (e.g., a dog, a cat), a laboratory test animal (e.g., a mouse, a rat, a guinea pig, a bird), an animal of veterinary significance, or an animal of economic significance.
- a primate e.g., a monkey
- livestock animal e.g., a horse, a cow, a sheep, a pig, or a goat
- a companion animal e.g., a dog, a cat
- a laboratory test animal e.g., a mouse, a rat, a guinea pig, a bird
- administering includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or
- Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial.
- Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
- treating refers to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit.
- therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment.
- the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested.
- the term "effective amount” or “sufficient amount” refers to the amount of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) that is sufficient to effect beneficial or desired results.
- the therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
- the specific amount may vary depending on one or more of: the particular agent chosen, the target cell type, the location of the target cell in the subject, the dosing regimen to be followed, whether it is administered in combination with other agents, timing of administration, and the physical delivery system in which it is carried.
- pharmaceutically acceptable carrier refers to a substance that aids the administration of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) to a cell, an organism, or a subject.
- agent e.g., Cas nuclease, modified single guide RNA, etc.
- “Pharmaceutically acceptable carrier” refers to a carrier or excipient that can be included in a composition or formulation and that causes no significant adverse toxicological effect on the patient.
- Non-limiting examples of pharmaceutically acceptable carrier include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors and colors, and the like.
- pharmaceutically acceptable carrier include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors and
- increasing stability refers to modifications that stabilize the structure of any molecular component of the CRISPR system.
- the term includes modifications that decrease, inhibit, diminish, or reduce the degradation of any molecular component of the CRISPR system.
- increasing specificity refers to modifications that increase the specific activity (e.g., the on-target activity) of any molecular component of the CRISPR system.
- the term includes modifications that decrease, inhibit, diminish, or reduce the non-specific activity (e.g., the off-target activity) of any molecular component of the CRISPR system.
- decreasing toxicity refers to modifications that decrease, inhibit, diminish, or reduce the toxic effect of any molecular component of the CRISPR system on a cell, organism, subject, and the like.
- enhanced activity refers to an increase or improvement in the efficiency and/or the frequency of inducing, modulating, regulating, or controlling genome editing and/or gene expression.
- the term "about” in relation to a reference numerical value can include a range of values plus or minus 10% from that value.
- the amount “about 10” includes amounts from 9 to 11, including the reference numbers of 9, 10, and 11.
- the term “about” in relation to a reference numerical value can also include a range of values plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value. IV.
- the methods can be used for genome engineering of any cell type, and can be used, for example, in applications where engineered cells are introduced into a patient.
- the methods provided herein can be used for installing a cancer treating construct, e.g. a CAR, for example against any of CD38, CD19, CD20, CD123, BCMA and the like into T cells.
- a cancer treating construct e.g. a CAR
- the efficiency of gene transfer can reach 40-80%.
- This approach employing a targeted gene integration, can be used for both autologous and allogenic approaches, and importantly, does not carry a risk of secondary and unwanted cell
- Additional advantages include a modified guide strand, reliable gene integration, integration of large genes, gene integration of a CAR, and gene integration of a CAR with high expression.
- the examples disclose making CAR-T cells via RNA-guided endonuclease-mediated genome editing that uses phosphorothioate and 2’ O-methyl modified single-stranded or double- stranded donor DNA synthesized by PCR.
- the modified single-stranded (ss) or double-stranded (ds) DNA is produced by adding three PS bonds to the nucleotides within 10 nucleotides or five nucleotides of the 5'-end of one primer. Without limiting the invention to any particular mechanism, it is believed the PS modification inhibits exonuclease degradation of the modified strand of the donor DNA.
- Nucleotides within ten or within five nucleotides of the 5’ end of the primer were also modified with 2' O-methyl to avoid the non-specific binding which is caused by phosphorothioate bonds.
- the phosphorothioate and 2’ O-methyl modified ds donor DNA and ss donor DNA can be made through PCR, asymmetric PCR or reverse transcription.
- the final ds DNA product of a synthesis can be modified with phosphorothioate and 2’ O-methyl and dsDNA can be produced with modification on one strand only.
- a donor DNA construct such as a donor DNA construct having chemical modifications such as phosphorothioate and 2’ O-methyl that include a CAR construct, i.e., are designed for inserting a CAR (chimeric antigen receptor) into a defined genomic site of a host cell.
- a CAR construct chimeric antigen receptor
- the present disclosure provides a host cell transfected with a CAR that lacks viral vectors that can present a safety concern.
- This process using a donor DNA with modifications on one strand - can increase knock-in efficiency at least two-fold, which is comparable with viral vector methods and has advantages for site specificity of integration and very stable for CAR expression in T cells compared to conventional retrovirus or lentivirus approaches. At least double modification of
- one donor chain with phosphorothioate and/or 2’ O-methyl can increase knock-in efficiency.
- This one step knock-out/knock-in method provides a faster and cheaper CAR-T production process for multiple cancer therapy.
- the ability to use double stranded DNA and avoid nuclease treatment of the donor construct and recovery of the single strand which is laborious and reduces yields is another benefit of the method.
- the present disclosure provides a population of primary human T cells in which at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the cells of the population express a CAR construct that is integrated into the genome, where none of the cells of the population include a viral vector or any sequences derived therefrom.
- a population of T cells provided herein that include a CAR construct integrated into the genome does not have any retroviral or adenoviral sequences detectable in the population.
- the CAR construct integrated into the genome may include no viral vector sequences or sequences derived therefrom.
- the population can be a population that was transfected with a donor DNA encoding a CAR construct using the methods and/or systems provided herein.
- the CAR construct is integrated into a site in the genome of the T cells targeted by a guide RNA.
- the CAR construct is integrated at a cas target site, i.e., a site adjacent to a PAM specific for a cas nuclease.
- a CAR construct is integrated at a target site in the genome that is adjacent to a cas9 PAM.
- the CAR construct can be integrated into a T cell receptor gene (e.g., a TRAC gene) or a PD-1 gene, such as but not limited to, SEQ ID NO:1, SEQ ID NO:26, and SEQ ID NO:32.
- a T cell receptor gene e.g., a TRAC gene
- a PD-1 gene such as but not limited to, SEQ ID NO:1, SEQ ID NO:26, and SEQ ID NO:32.
- the insertion of the CAR construct into a targeted site in the genome such as a site in a TRAC gene or a site in a PD-1 gene results in knockout (disrupted expression) of the TRAC gene or PD-1 gene.
- the present disclosure provides a population of primary T cells in which at least 20%, at least 30%, or at least 40% of the cells of
- the population express a CAR construct that is integrated into the genome and do not express a gene that is knocked out by the targeted integration (e.g., a TRAC or PD-1 gene), where none of the cells include a viral vector or any sequences derived therefrom.
- a population of T cells provided herein that include a CAR construct integrated into the genome does not have any retroviral or adenoviral sequences detectable in the population.
- the integrated CAR construct can be at least 1.5 kb, at least 1.7 kb, at least 1.9 kb, at least 2 kb, or at least 2.1 kb in length.
- the CAR construct can be a CAR construct that encodes a CAR that binds any of CD38, CD19, CD20, CD123, or BCMA.
- a CAR construct can be an anti-CD38 CAR, an anti-CD19 CAR, or an anti-BCMA CAR.
- the present disclosure provides methods for expressing a CAR gene in a primary cell, the method comprising introducing into the primary cell:
- sgRNA single guide RNA
- Cas CRISPR-associated protein
- a Cas polypeptide, an mRNA encoding a Cas polypeptide, and/or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or Cas polypeptide wherein the modified sgRNA guides the Cas polypeptide to the site of knockout nucleic acid
- a donor target DNA comprising a 5’ HA sequences, a promoter sequence, a CAR construct, and 3’ HA sequence
- the donor target DNA is preferably double-stranded and has both or preferably one strand modified with at least one phosphothioate bond within five nucleotides of the 5’-end of the donor for reducing 5’exonuclease cleavage, and optionally includes one, two three, or four 2’-O-methyl-modified nucleotides within 5 nucleotides of the 5’ end.
- the opposite strand to the modified strand has a 5’ terminal phosphat
- the present disclosure provides a method for inducing gene expression of a CAR gene in a primary cell, the method comprising introducing into the primary cell:
- a tracrRNA and a crRNA comprising a first nucleotide sequence that is complementary to the selected target knockout nucleic acid, wherein one or more of the nucleotides in the tracrRNA and a crRNA are optionally modified nucleotides;
- a Cas polypeptide (b) a Cas polypeptide, an mRNA encoding a Cas polypeptide, and/or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide, or a Cas polypeptide; wherein the crRNA guides the Cas polypeptide to the site of knockout nucleic acid; and (c) a donor target DNA comprising a 5’ HA sequences, a promoter sequence, a CAR construct, and
- the donor target DNA is preferably double-stranded and has both or preferably one strand modified with at least one phosphothioate bond within five nucleotides of the 5’-end of the donor for reducing 5’exonuclease cleavage, and optionally includes one, two three, or four 2’-O-methyl-modified nucleotides within 5 nucleotides of the 5’ end.
- the opposite strand to the modified strand has a 5’ terminal phosphate.
- the examples show the advantages of the disclosed process to provide high transfection efficiency without the use of viral vectors for knocking in donor DNA and knocking out a targeted endogenous gene such as a T cell receptor (TCR) or PD-1 gene.
- a targeted endogenous gene such as a T cell receptor (TCR) or PD-1 gene.
- Buffy coats from healthy volunteer donors were obtained from the San Diego blood bank. Some fresh whole blood or leukapheresis products were obtained from StemCell
- PBMCs Peripheral blood mononuclear cells
- CD3 antibody BioLegend, San Diego, CA
- AIM-V medium ThermoFisher Scientific, Waltham, MA
- 5% fetal bovine serum Sigma, St. Louis, MO
- IL-2 Proleukin
- cells were cultured in CTSTM OpTmizerTM T Cell Expansion SFM (ThermoFisher) supplemented with 5% CTSTM Immune Cell SR (Thermofisher scientific) with 300U/mL IL-2 (Proleukin) at a density of 10 6 cells per mL.
- CTSTM OpTmizerTM T Cell Expansion SFM ThermoFisher
- CTSTM Immune Cell SR Thermofisher scientific
- 300U/mL IL-2 Proleukin
- T cells were isolated from PBMCs using magnetic negative selection using EasySepTM Human T Cell Isolation Kit or CD3 positive selective kit (Stemcell Technology Inc.) according to the manufacturer’s instructions.
- RPMI-8226 multiple myeloma cell line which express CD38
- GFP green fluorescent protein
- RFP green fluorescent protein
- Both cell lines were cultured in RPMI1640 medium (ATCC) supplemented with 10% fetal bovine serum (Sigma).
- CAR plasmids were generated with an In- Fusion® HD Cloning Kit (Takara Bio USA, Inc, Mountain View, CA).
- Backbone plasmid pAAV-MCS was purchased from Cell Biolabs (San Diego, CA).
- retrovirus-transduced T cells were compared with cas-mediated knock-in cells.
- Transduction of T cells with the retroviral construct was performed essentially as described in Ma et al., 2004 The Prostate 61:12-25; and Ma et al., The Prostate 74(3):286-296, 2014 (the disclosures of which are incorporated by reference herein in their entireties).
- the anti-CD38 CAR MFG retroviral vector plasmid DNA was transfected into Phoenix-Eco cell line (ATCC) using FuGene reagent (Promega, Madison, WI) to produce Ecotropic retrovirus, then harvested transient viral supernatant (Ecotropic virus) was used to transduce PG13 packaging cells with Gal-V envelope to produce retrovirus to infect human cells. Viral supernatant from PG13 cells was then used to transduce activated T cells (or PBMCs) two to three days after CD3 or CD3/CD28 activation.
- Activated human T cells were prepared by activating normal healthy donor peripheral blood mononuclear cells (PBMC) with 100 ng/ml mouse anti-human CD3 antibody OKT3 (Orth Biotech, Rartian, NJ) or anti-CD3,anti-CD28 TransAct (Miltenly Biotech, German) as manufacturer’s manual and 300-1000 U/ml IL-2 in AIM-V growth medium (GIBCO-Thermo Fisher scientific, Waltham, MA) supplemented with 5% FBS for two days.5 ⁇ 10 6 activated human T cells were transduced in a 10 ⁇ g/ml retronectin (Takara Bio USA) pre-coated 6-well plate with 3 ml viral supernatant and were centrifuged at 1000 g for 1 hour at 32 °C. After transduction, the transduced T cells were expanded in AIM-V growth medium supplemented with 5% FBS and 300-1000 U/ml IL-2.
- PBMC peripheral blood mononuclear cells
- an asterisk indicates a phosphorothioate (PS) linkage; Am, 2’-O-methylated deoxyadenosine; Cm, 2’-O-methylated deoxycytosine; Gm, 2’-O-methylated deoxyguanosine
- Example 1 Simultaneous knockout of the T-cell receptor gene and knock-in of anti-CD38 CAR in human T cells.
- the T cell receptor alpha constant (TRAC) gene was targeted with an anti-CD38 CAR construct as the donor DNA.
- the pAAV-TRAC-anti-CD38 construct was designed with approximately 1.3kb of genomic DNA sequence of the T cell receptor alpha constant (TRAC) that flanks the target sequence (CAGGGTTCTGGATATCTGT (SEQ ID NO:1)) in the genome.
- the target sequence was identified as a site upstream of the Cas9 PAM in exon 1 of the TRAC gene for Cas9-mediated gene disruption and insertion of the donor construct.
- the anti-CD38 CAR gene construct (SEQ ID NO:2) comprised a sequence encoding a
- scFv single chain variable fragment specific for human CD38
- CD8 and CD28 hinge-CD28 transmembrane-CD28 intracellular regions and a CD3 zeta intracellular domain.
- An exogenous JeT promoter (US Patent No.6,555,6674; SEQ ID NO:3) was used to initiate transcription of the anti-CD38 CAR.
- the anti-CD38A2 CAR construct with 650- 660 bp homology arms was synthesized by Integrated DNA Technologies (IDT, Coralville, IA).
- IDT Integrated DNA Technologies
- An in-fusion cloning reaction was performed at room temperature, containing pAAV-MCS vector double digested with MluI and BstEII (50 ng), the anti-CD38A2 CAR fragment with flanking homology arms (SEQ ID NO:4) (50ng), 1ul 5X In-Fusion HD Enzyme Premix (Takara Bio), and nuclease-free water.
- tracr RNA ALT- R® CRISPR-Cas9 tracrRNA
- crispr RNA ALT-R® CRISPR-Cas9 crRNA
- PrimeSTAR Max Premix (Takara Bio USA) was used for PCR reactions.
- the AAV donor plasmid pAAV-anti-CD38A2 described above was used as a template.
- the forward primer had the sequence: TGGAGCTAGGGCACCATATT (SEQ ID NO:36)
- the reverse primer had the sequence: CAACTTGGAGAAGGGGCTTA (SEQ ID NO:9).
- primers having sequences hybridizing to specific positions within the homology arms of the pAAV-anti- CD38A2 construct were used to produce donor fragments with homology arms of desired lengths by PCR.
- Phosphorothioate bonds were introduced into the terminal three nucleotides at the 5'-end of the forward primer (SEQ ID NO:36) to inhibit exonuclease degradation (that is, between the first and second, second and third, and third and fourth
- nucleotides from the 5’ terminus The nucleotides at the second, third and fourth positions from the 5’-end of the forward oligonucleotide primer were also 2'-O-methyl modified to avoid non- specific binding, potentially caused by the phosphorothioate (PS) backbone of the terminal 3 nucleotides (SEQ ID NO:8, FIG.2B).
- the reverse primer (SEQ ID NO:9) was modified by 5'- end phosphorylation so that the strand could be digested by a strandase provided by the Guide- itTM Long ssDNA Production System kit (Takara Bio USA).
- thermocycler settings were: one cycle of 98 °C for 30s, 35 cycles of 98 °C for 10s, 66 °C for 5s, 72 °C for 30s and one cycle of 72 °C for 10 min.
- Digestion with the strandase was done according to the manufacturer’s instructions (Takara Bio USA), and ssDNA was purified using the NucleoSpin Gel and PCR Clean-Up kits (Takara Bio USA). The concentration of ssDNA was determined by NanoDrop (Denovix, Wilmington, DE).
- donor fragments were produced with unmodified primers, such that the resulting donor fragment had no chemical modifications (no PS or 2’-O-methyl groups) or had the PS modification only (no 2’-O-methyl groups).
- T cells were activated by adding CD3 to the cultures. About 48 to 72 hours after initiating T-cell activation with CD3, the PBMC cultures including activated T cells were electroporated with SpCas9 protein plus crRNA (containing guide sequence SEQ ID NO:1) and tracrRNA using a Neon® Transfection System (ThermoFisher Scientific) and 10- ⁇ l tip or 100- ⁇ l tips.
- SpCas9 protein plus crRNA containing guide sequence SEQ ID NO:1
- tracrRNA containing guide sequence SEQ ID NO:1
- Neon® Transfection System ThermoFisher Scientific
- IDTT Alt-R CRISPR-Cas9 crRNA and Alt-R tracrRNA
- IDT Alt-R CRISPR-Cas9 crRNA and Alt-R tracrRNA
- 10 ⁇ g SpCas9 protein (IDT) was mixed with 200 pmol crRNA:tracrRNA duplex to form RNPs.1 x 10 6 cells were mixed with the RNP and
- CAR-expressing PBMCs were generated by transduction of T cells with a retrovirus that included the same anti-CD38A2 expression cassette (SEQ ID NO:2) in the retroviral vector that was used to make the donor fragment employed in CRISPR targeting.
- transfected or transduced PBMCs were washed with DPBS/5% human serum albumin, then stained with anti-CD3-BV421 antibody SK7 (BioLegend) and PE conjugated anti-CD38-Fc protein (Chimerigen Laboratories, Allston, MA) for 30-60 min at 4 °C.
- CD3 and anti-CD38 CAR expression were analyzed using iQue Screener Plus (Intellicyte Co.) Negative controls were cells that had been transfected with an RNP that included cas9 protein complexed with a hybridized tracrRNA and crRNA targeting the first exon of the TRAC gene, but were not transfected with the anti-CD38 CAR donor DNA.
- PBMCs that had been transfected with the RNP that included the guide targeting the TRAC locus were subsequently transduced with a retrovirus that included the anti-CD38 CAR construct as described above and analyzed for expression of the anti-CD38 CAR as well.
- FIG.3A shows that 8 days after transfection no expression of an anti-CD38 construct was detected in cells transformed with the RNP (for knock-ing out the TRAC gene) in the absence of a donor fragment for expression of the anti- CD38 CAR (leftmost panel).
- PBMCs that had a TRAC knockout and were subsequently transduced with a retrovirus that included a construct for expressing the anti-CD38 CAR did show expression of the anti-CD38 CAR in about 70% of the cells 8 days after transfection (rightmost panel of FIG.3A).
- HDR homology directed repair
- oligonucleotide primers were targeted to sequences outside of the TRAC homology arms but adjacent to the homology arm sequences in the genome.
- a total of 1 x 10 5 cells were resuspended in 30 pL of Quick Extraction solution (Epicenter) to extract the genomic DNA.
- the cell lysate was incubated at 65 °C for 5 min and then at 95 °C for 2 min and stored at -20 °C.
- the concentration of genomic DNA was determined by NanoDrop (Denovix).
- Genomic regions containing the TRAC target sites were PCR-amplified using the following primer sets: 5’ PCR forward primer on TRAC: CTGCTTTCTGAGGGTGAAG (SEQ ID NO: 10), 5’ PCR Reverse primer on CAR: CTTTCGACCAACTGGACCTG (SEQ ID NO: 11); 3’ Forward primer on CAR: CGTTCTGGGTACTCGTGGTT (SEQ ID NO: 12), 3’ Reverse primer on TRAC: GAGAGCCCTTCCCTGACTTT (SEQ ID NO: 13) (see FIG. IB). Both primer sets: 5’ PCR forward primer on TRAC: CTGCTTTCTGAGGGTGAAG (SEQ ID NO: 10), 5’ PCR Reverse primer on CAR: CTTTCGACCAACTGGACCTG (SEQ ID NO: 11); 3’ Forward primer on CAR: CGTTCTGGGTACTCGTGGTT (SEQ ID NO: 12), 3’ Reverse primer on TRAC: GAGAGCCCTTCCCTGACTTT (SEQ ID NO: 13)
- the concentration of genomic DNA was determined by NanoDrop (Denovix). Both primer sets were designed such that one primer of the pair annealed to a site in the genome outside of the homology arm, and the other primer of the pair annealed to a site within the coding region of the construct (i.e., not in a homology arm).
- the PCR contained 400 ng of genomic DNA and Q5 high fidelity 2X mix (New England Biolabs).
- the thermocycler setting consisted of one cycle of 98 °C for 2 min, 35 cycles of 98 °C for 10s, 65 °C for 15s, 72 °C for 45s and one cycle of 72 °C for 10 min.
- the PCR products were purified on 1% agarose gel containing SYBR Safe (Life Technologies).
- FIG.4 provides a photograph of the gel separating PCR products.
- the positive bands corresponding to the anti-CD38 construct adjacent to genomic sequences adjacent to the homology arms in the genome at the 5’ and 3’ ends of the construct were only seen in cells transfected with donor DNA (lanes 3 and 6) and not in non-transfected ATCs (lanes 1 and 4) or TRAC knock out cells (lanes 2 and 5). Sequencing of these PCR products confirmed that they included the anti-CD38 CAR sequence.
- the activated T cells that had been transfected with the anti-CD38 CAR targeted to the TRAC locus were starved with IL-2 overnight and tested in specific killing assays (FIG.5).
- the activated T cells were co- cultured with a target cell mixture of CD38 positive RPMI-8226/GFP cells and CD38 negative K562/RPE cells.
- the incubation effector-to-target cell ratio ranged from 10:1 to 0.08:1. After overnight incubation, the cells were analyzed by flow cytometry to measure the GFP-positive and RPE-positive cell populations to determine the specific target cell killing by anti-CD38A2 CART cells.
- FIG.5 shows that while non-transfected ATC cells showed some toxicity at the highest effector to target ratios, TRAC knockout cells showed virtually no killing regardless of effector-to-target cell ratio.
- the anti-CD38A2 CART cells however exhibited potent killing activity of CD38 positive cells- RPMI8226 but not CD38 negative cells– K562 (FIG.5).
- T cells that had integrated the chemically modified donor that included the anti-CD38 CAR cassette demonstrated cytotoxicity toward target cells similarly to that of cells transduced with retrovirus that included the anti-CD38 CAR construct.
- the transfected activated T cells were also tested for cytokine secretion (FIG. 6A, FIG.6B, and FIG.6C). T cells were starved in IL-2 free medium overnight. Anti-CD38
- CAR-T cells or ATC controls were then co-cultured with CD38 negative K562 or CD38 positive RPMI8226 cells.
- the incubation effector to target cell ratio was 2:1. After overnight incubation, the cells were centrifuged to collect the supernatants for quantitating cytokine IL-2, IFN-gamma and TNF alpha (Affymetrix eBioscience) according to the manufacturer’s instructions.
- the gene- edited TCR knockout anti-CD38A2 CART cells also released similar amount of IFN-g and other pro-inflammatory cytokines when co-cultured with CD38 positive tumor cells (RPMI8226) but not CD38 negative cells (K562).
- donor fragments having homology arms were produced.
- the pAAV-TRAC-anti-CD38 construct described in Example 1 that included the anti-CD38 cassette plus TRAC exon 1 homology arms of 660 and 650 nts was used as the template.
- a second set of primers, SEQ ID NO:14 and SEQ ID NO:15 was used to generate a donor fragment having homology arms of approximately 350 nt (375 and 321 nucleotides), where the primer of SEQ ID NO:14 had PS linkages between the between first and second, second and third, and third and fourth nucleotides from the 5’ terminus and had 2’-O- methyl-modified nucleotides at positions 2, 3, and 5.
- the forward primer SEQ ID Nos: 8, 14, and 18 was designed to have three PS linkages within the
- Each of the primer sets was used to generate a donor DNA molecule having multiple PS and 2’-O methyl modifications proximal to the 5’end of one strand of the donor and a 5’ phosphate at the 5’ terminus of the opposite strand of the donor.
- RNPs were assembled to include tracr and crRNAs as described in Example 1, where the crRNA included the target sequence of SEQ ID NO:1, a sequence found in exon 1 of the TRAC gene.
- the donor molecules having homology arms of approximately 665, 350, and 165 base pairs in length, were independently transfected into activated T cells as described in Example 1 except that donor fragments and RNPs were transfected in the same electroporation under conditions for electroporating the RNP (using a Neon® Transfection System (ThermoFisher Scientific) 1700 V, 20 ms pulse width, 1 pulse).
- activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus, but without donor DNA insertion.
- flow cytometry was performed as provided in Example 1.
- FIG.7 shows that, as expected, the T cell culture transfected with the RNP only had low levels of expression of the T cell receptor and also demonstrates no expression of the anti-CD38 CAR.
- T cells transfected with the RNP plus donor DNAs having homology arms of different sizes however show low levels of T cell receptor expression and good expression of anti-CD38 CAR in the cultures, demonstrating that transfection of a double-stranded DNA in highly effective for targeted knock- ins.
- the shortest HA lengths tested, 161/171 nt worked at least as well as longer lengths, with the percentages of knockout cells expressing the introduced construct being approximately 24% for approximately 665 nt arms, approximately 30% for approximately 350 nt arms, and approximately 38% for approximately 165 nt arms.
- the short homology arms are thus found to be very effective in targeted knock in genome modification using double-stranded DNA donors, which has the benefit of allowing for smaller constructs and/or allowing for more capacity in a construct to allow inclusion of additional or lengthier sequences to be included in the donor DNA.
- primer SEQ ID NO:18 had three PS linkages, occurring between first and second, third and fourth, and fourth and fifth nucleosides and three 2’-O-methyl-modified nucleotides within the first five nucleotides of the 5’ terminus of the primer (at nucleotide positions 2, 3, and 5) and primer SEQ ID NO:19 had a 5’ terminal phosphate (Table 1).
- primer SEQ ID NO:37 was identical to primer SEQ ID NO:18 except that primer SEQ ID NO:37 lacked chemical modifications see Table 1).
- the SEQ ID NO:37 primer and the SEQ ID NO:19 primer lacking a 5’ terminal phosphate were used to generate a donor DNA with no nucleotide modifications having the anti-CD38 CAR cassette.
- donor DNAs were transfected as double-stranded DNA molecules (with no denaturation or nuclease digestion of either strand) along with RNPs that included a tracr RNA and a crRNA that included the target sequence of SEQ ID NO:1 (within exon 1 of the TRAC gene) into activated T cells.
- RNPs that included a tracr RNA and a crRNA that included the target sequence of SEQ ID NO:1 (within exon 1 of the TRAC gene) into activated T cells.
- SEQ ID NO:1 within exon 1 of the TRAC gene
- Example 2 control activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion.
- flow cytometry was performed essentially as provided in Example 1. The results, shown in FIG. 8, show that transfection with the RNP and a modified double stranded donor resulted in at least twice the expression of the anti-CD38 construct across the culture as compared with transfection with the RNP and the unmodified double-stranded donor, resulting in over 50% of the cells of the culture expressing the anti-CD38 CAR transgene and not expressing the TCR (CD3 negative).
- Sequencing of PCR products produced using primers to diagnose the insertion locus provided sequences demonstrating the anti-CD38 CAR donor fragment integrated into exon 1 of the TRAC gene.
- the PCR product sequences included sequences adjacent to the homology arm in the genome, the homology arm present in the donor fragment, and portions of the anti-CD38 CAR in a single PCR product, demonstrating the expected insertion.
- An anti-CD19 CAR construct that included an anti-CD19 CAR cassette (SEQ ID NO:22) that included the Jet promoter (SEQ ID NO:3), and intron, an anti-CD19 CAR construct, and an SV40 polyA sequence was made essentially as described for the anti-CD38 CAR pAAV construct described in Example 1 and was cloned in a vector flanked by the TRAC gene exon 1 homology arms (HAs) of SEQ ID NO:20 and SEQ ID NO:21.
- HAs TRAC gene exon 1 homology arms
- the anti-CD19 CAR with HAs pAAV construct was used as a template in PCR reactions as provided in Example 1 using the primers provided as SEQ ID NO:18 and SEQ ID NO:19 that result in the production of modified donor DNA having HAs of approximately 170 and 160 nucleotides (see Table 1).
- the forward primer (SEQ ID NO:18) had three PS bonds between the first and second, third and fourth, and fourth and fifth nucleosides and three 2’-O-methyl modifications at nucleotides 3, 4, and 5 when numbering from the 5’-terminus of the primer.
- the reverse primer (SEQ ID NO:19) had a 5’- terminal phosphate.
- the resulting double-stranded donor DNA was therefore synthesized to have the corresponding modifications, a first strand with three PS and three 2’-O-methyl
- the double-stranded chemically modified donor fragment having the sequence of SEQ ID NO:38 with the nucleotide modifications of primers SEQ ID NO:18 and SEQ ID NO:19 described above incorporated was used to transfect cells along with an RNP that was produced according to the methods provided in Example 1, where the crRNA of the RNP included the target sequence of SEQ ID NO:1, targeting exon 1 of the TRAC gene.
- activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion.
- Example 2 Flow cytometry was performed essentially as described in Example 1 to evaluate the efficiency of introducing a different construct into the TRAC locus, except that anti-CD19 CAR expression was detected by CD19-Fc (Speed Biosystem) followed by APC anti-human IgG Fcg (Jackson Immunoresearch). The results are shown in FIG.9, where it can be seen that the anti-CD19 CAR was expressed in the absence of T cell receptor expression in approximately 42% of the cells in the culture.
- An anti-BCMA CAR construct was made through replacing the CD38 CAR with BCMA CAR based on the anti-CD38 CAR pAAV construct described in Example 1.
- the sequence of the insert is provided as SEQ ID NO:23.
- the anti-BCMA CAR construct was used as a template in PCR reactions as set forth in Example 1 using the primers provided as SEQ ID NO:18 and SEQ ID NO:19 that result in the production of donor DNA having HAs of approximately 160-170 nucleotides (see Table 1).
- the forward primer (SEQ ID NO:18) had three PS and three 2’-O-methyl modifications within five nucleotides of the 5’-terminus of the primer.
- the reverse primer (SEQ ID NO:19) had a 5’- terminal phosphate.
- the resulting double-stranded donor DNA was therefore synthesized to have a first strand with three PS and three 2’-O-methyl modifications within five nucleotides of the 5’- terminus, and a second strand with a 5’-terminal phosphate.
- activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion.
- Flow cytometry was performed as described in Example 1 to evaluate the efficiency of introducing a different construct into the TRAC locus, except that anti- BCMA CAR expression was detected by PE or APC conjugated BCMA-Fc (R&D). The results are shown in FIG.10, where it can be seen that the anti-BCMA CAR was expressed in the absence of T cell receptor expression in approximately 66% of the cells in the culture.
- an anti-CD38 CAR construct was made for producing a donor DNA having HAs from Exon 3 of the TRAC gene.
- the construct was produced essentially as described in Example 1 for the TRAC exon 1 targeting construct, except that the HAs (5’ HA SEQ ID NO:24 (183 nt) and 3’ HA SEQ ID NO:25 (140 nt)) were sequences surrounding the exon3 target site (SEQ ID NO:26).
- SEQ ID NO:27 The sequence of the insert of the pAAV construct that was then produced as a donor DNA with TRAC gene exon 3 homology arms is provided as SEQ ID NO:27.
- the forward primer included PS linkages between first and second, second and third, and third and fourth nucleosides and 2’-O-methyl modifications on the second, fourth, and fifth positions from the 5’-terminus
- the reverse primer SEQ ID NO:29
- the resulting double-stranded donor DNA that incorporated the primers had a first
- the double-stranded donor fragment having modified nucleotides by incorporation of the primers above and having the sequence of SEQ ID NO:27 was used to transfect cells along with an RNP that was produced according to the methods provided in Example 1, where the crRNA included the target sequence of SEQ ID NO:26, targeting exon 3 of the TRAC gene.
- activated T cells were transfected with the RNP in the absence of a donor fragment, which should result in knockout of the targeted TRAC locus without construct insertion.
- a further control was non-transfected activated T cells (ATCs). Flow cytometry was performed essentially as described in Example 1.
- Sequencing of PCR products produced using primers to diagnose the insertion locus provided sequences demonstrating the anti-CD38 CAR donor fragment integrated into exon 3 of the TRAC gene.
- the PCR product sequences included sequences adjacent to the homology arm in the genome, the homology arm present in the donor fragment, and portions of the anti-CD38 CAR in a single PCR product, demonstrating the expected insertion.
- FIG.12 compares targeting of the anti-CD19 CAR to exon 3 and exon 1 of the TRAC gene.
- the anti-CD19 CAR donor DNA directed to exon 3 is synthesized to include the anti- CD19 CAR cassette (SEQ ID NO:22) as set forth in the Examples above, where the anti-CD19 expression cassette is flanked by sequences from the exon 3 locus (SEQ ID NO:24 and SEQ ID NO:25) as set forth above.
- the anti-CD19 CAR donor directed to exon 1 (having the sequence of SEQ ID NO:38) is provided in Example 4.
- each of these constructs was used to produce donor fragment using modified forward primers having PS and 2’-O-methyl modifications on the three 5’-terminal most nucleotides.
- the reverse primers had 5’-terminal phosphates.
- the primers for producing the anti-CD19 CAR donor flanked by exon 1 HAs were SEQ ID NO:18 and SEQ ID NO:19, where the SEQ ID NO:18 primer included PS linkages between first and second, third and fourth, and
- the primers for producing the anti-CD19 CAR donor flanked by exon 3 HAs were SEQ ID NO:28 and SEQ ID NO:29, where the SEQ ID NO:28 primer had PS linkages between the first and second, second and third, and third and fourth nucleosides from the 5’ end and 2’-O- methyl groups at position 2, position 4, and position 5 from the 5’ end.
- the resulting double- stranded donor DNAs thus had a first strand with corresponding PS and 2’-O-methyl modifications on the 5’-terminal end nucleotides, and a second strand having a 5’-terminal phosphate.
- the donor fragments were independently transfected into activated T cells with RNPs.
- RNPs were produced as described in Example 1, except that for targeting TRAC gene exon 1, the target sequence of the crRNA was SEQ ID NO:1, and for targeting TRAC gene exon 3, the target sequence of the crRNA was SEQ ID NO:26.
- the PD-1 locus was also targeted with a CAR construct.
- the anti-CD38 CAR cassette (SEQ ID NO:2) was juxtaposed with homology arms (SEQ ID NO:30 and SEQ ID NO:31) having sequences of the PD-1 locus that surround a target site (SEQ ID NO:32) using the methods essentially as described in Example 1 to provide a template for producing donor DNA.
- Donor DNA was produced essentially as described in Example 1, using a forward primer (SEQ ID NO:34) that included a 5’ phosphate and a reverse primer that included
- the double-stranded chemically modified donor fragment (SEQ ID NO:33) was used to transfect cells along with an RNP produced according to the methods provided in Example 1, where the crRNA included the target sequence of SEQ ID NO:32, targeting the PD-1 gene.
- SEQ ID NO:33 The double-stranded chemically modified donor fragment was used to transfect cells along with an RNP produced according to the methods provided in Example 1, where the crRNA included the target sequence of SEQ ID NO:32, targeting the PD-1 gene.
- activated T cells were transfected with the RNP in the absence of a donor fragment, which generates a knockout of the targeted PD-1locus without CAR construct insertion.
- a further control was non-transfected activated T cells (ATCs).
- Flow cytometry was performed essentially as described in Example 1, where an additional control of nontransfected activated T cells (ATCs) was included.
- a BV421-conjugated antibody to PD-1(EH12.2H7, BioLegend) was used to detect PD-1 expression.
- results are shown in FIG.13, where it can be seen the percentage of cells expressing PD-1 dropped from approximately 19% in ATCs to approximately 4% in the cells of cultures transfected with the RNP targeting the PD-1 locus (PD-1 RNP).
- the anti-CD38 CAR was expressed in the absence of PD-1 expression in approximately 27% of the cells in the culture that was transfected with the PD-1 targeting RNP plus a donor with HAs having homology to the PD-1 locus.
- Sequencing of PCR products produced using primers to diagnose the insertion locus provided sequences demonstrating the anti-CD38 CAR donor fragment integrated into the PD-1 gene.
- the PCR product sequences e.g., SEQ ID NO:43
- FIG.14 provides the results of a cytotoxicity assay that was performed using PBMCs and isolated T cells from cultures transfected with the anti-CD38 CAR donor fragment and an RNP targeting the PD-1 locus (“PD-1 KOKI PBMC” and“PD-1 KOKI Tcell” respectively).
- modified cells showed a high level of cytotoxicity toward target cells in the assay with respect to control cells that had a PD-1 gene knockout but did not receive a CAR construct (“PD- 1 KO”) and control cells that had a TRAC gene knockout but did not receive a CAR construct (“TRAC-1 KO”) and were outperformed somewhat by cells that were transfected the anti-CD38 CAR donor fragment and an RNP targeting the TRAC locus (“TRAC KOKI”), likely due to the lower efficiency of donor CAR construct integration at the PD-1 site that was observed (FIG. 13).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Hematology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3131588A CA3131588A1 (en) | 2018-02-27 | 2020-02-27 | Improved process for dna integration using rna-guided endonucleases |
| CN202080031829.1A CN113906136A (zh) | 2018-02-27 | 2020-02-27 | 使用rna引导的核酸内切酶进行dna整合的改进工艺 |
| KR1020217030805A KR20210134000A (ko) | 2018-02-27 | 2020-02-27 | Rna-가이드된 엔도뉴클레아제를 사용한 dna 통합을 위한 개선된 방법 |
| US17/434,209 US20220169984A1 (en) | 2018-02-27 | 2020-02-27 | Improved process for dna integration using rna-guided endonucleases |
| EP20715999.7A EP3931322A1 (en) | 2018-02-27 | 2020-02-27 | Improved process for dna integration using rna-guided endonucleases |
| JP2021549970A JP2022521787A (ja) | 2018-02-27 | 2020-02-27 | Rna誘導型エンドヌクレアーゼを使用するdna組み込みのための改善された方法 |
| MX2021010322A MX2021010322A (es) | 2018-02-27 | 2020-02-27 | Procedimiento mejorado para la integracion de adn utilizando endonucleasas guiadas por arn. |
| SG11202109332RA SG11202109332RA (en) | 2018-02-27 | 2020-02-27 | Improved process for dna integration using rna-guided endonucleases |
| AU2020229848A AU2020229848A1 (en) | 2018-02-27 | 2020-02-27 | Improved process for DNA integration using RNA-guided endonucleases |
| IL285842A IL285842A (en) | 2018-02-27 | 2021-08-24 | Improved process for dna integration using rna-guided endonucleases |
| JP2024219750A JP2025061660A (ja) | 2018-02-27 | 2024-12-16 | Rna誘導型エンドヌクレアーゼを使用するdna組み込みのための改善された方法 |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862635702P | 2018-02-27 | 2018-02-27 | |
| US16/288,052 | 2019-02-27 | ||
| US16/288,052 US20200224160A1 (en) | 2018-02-27 | 2019-02-27 | Process for dna integration using rna-guided endonucleases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020176740A1 true WO2020176740A1 (en) | 2020-09-03 |
Family
ID=71516309
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/020121 Ceased WO2020176740A1 (en) | 2018-02-27 | 2020-02-27 | Improved process for dna integration using rna-guided endonucleases |
Country Status (11)
| Country | Link |
|---|---|
| US (2) | US20200224160A1 (enExample) |
| EP (1) | EP3931322A1 (enExample) |
| JP (2) | JP2022521787A (enExample) |
| KR (1) | KR20210134000A (enExample) |
| CN (1) | CN113906136A (enExample) |
| AU (1) | AU2020229848A1 (enExample) |
| CA (1) | CA3131588A1 (enExample) |
| IL (1) | IL285842A (enExample) |
| MX (1) | MX2021010322A (enExample) |
| SG (1) | SG11202109332RA (enExample) |
| WO (1) | WO2020176740A1 (enExample) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021217083A1 (en) | 2020-04-24 | 2021-10-28 | Sorrento Therapeutics, Inc. | Memory dimeric antigen receptors |
| WO2022015956A1 (en) | 2020-07-15 | 2022-01-20 | Sorrento Therapeutics, Inc. | Improved process for dna integration using rna-guided endonucleases |
| WO2022215978A1 (ko) * | 2021-04-05 | 2022-10-13 | 주식회사 셀렌진 | Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도 |
| US12201699B2 (en) | 2014-10-10 | 2025-01-21 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| US12398187B2 (en) | 2019-03-05 | 2025-08-26 | Nkarta, Inc. | CD19-directed chimeric antigen receptors and uses thereof in immunotherapy |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019165168A1 (en) | 2018-02-23 | 2019-08-29 | Pioneer Hi-Bred International, Inc. | Novel cas9 orthologs |
| WO2020123887A2 (en) | 2018-12-14 | 2020-06-18 | Pioneer Hi-Bred International, Inc. | Novel crispr-cas systems for genome editing |
| KR20210133261A (ko) * | 2019-02-26 | 2021-11-05 | 소렌토 쎄라퓨틱스, 인코포레이티드 | Bcma에 결합하는 항원 결합 단백질 |
| EP3980533A1 (en) | 2019-06-07 | 2022-04-13 | Scribe Therapeutics Inc. | Engineered casx systems |
| AU2021320556A1 (en) * | 2020-08-07 | 2023-03-09 | Neogene Therapeutics B.V. | Methods to enrich genetically engineered T cells |
| JP2023550323A (ja) | 2020-11-11 | 2023-12-01 | モンサント テクノロジー エルエルシー | 部位特異的組込み頻度を改善するための方法 |
| KR20230128289A (ko) | 2020-12-03 | 2023-09-04 | 스크라이브 테라퓨틱스 인크. | 조작된 클래스 2 유형 v crispr 시스템 |
| WO2026020171A2 (en) | 2024-07-19 | 2026-01-22 | Aera Therapeutics, Inc. | Chimeric antigen receptor constructs |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6556674B1 (en) | 1998-11-19 | 2003-04-29 | Legerity, Inc. | Signal detector with matched filter coefficient |
| WO2017070429A1 (en) * | 2015-10-22 | 2017-04-27 | Regents Of The University Of Minnesota | Methods involving editing polynucleotides that encode t cell receptor |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6010907A (en) * | 1998-05-12 | 2000-01-04 | Kimeragen, Inc. | Eukaryotic use of non-chimeric mutational vectors |
| US9957515B2 (en) * | 2013-03-15 | 2018-05-01 | Cibus Us Llc | Methods and compositions for targeted gene modification |
| WO2014191128A1 (en) * | 2013-05-29 | 2014-12-04 | Cellectis | Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system |
| EP4628587A3 (en) * | 2016-04-15 | 2026-02-25 | Memorial Sloan Kettering Cancer Center | Transgenic t cell and chimeric antigen receptor t cell compositions and related methods |
| US10428327B2 (en) * | 2016-05-27 | 2019-10-01 | Life Technologies Corporation | Compositions and methods for enhancing homologous recombination |
| WO2018023631A1 (zh) * | 2016-08-04 | 2018-02-08 | 汤隆初 | 自动浇水技术的使用情况反馈方法以及自动浇水装置 |
| WO2018073391A1 (en) * | 2016-10-19 | 2018-04-26 | Cellectis | Targeted gene insertion for improved immune cells therapy |
| EP3679144A1 (en) * | 2017-09-08 | 2020-07-15 | Life Technologies Corporation | Methods for improved homologous recombination and compositions thereof |
| EP3781677A4 (en) * | 2018-04-16 | 2022-01-19 | University of Massachusetts | COMPOSITIONS AND METHODS FOR IMPROVED GENE EDITTING |
-
2019
- 2019-02-27 US US16/288,052 patent/US20200224160A1/en not_active Abandoned
-
2020
- 2020-02-27 WO PCT/US2020/020121 patent/WO2020176740A1/en not_active Ceased
- 2020-02-27 EP EP20715999.7A patent/EP3931322A1/en not_active Withdrawn
- 2020-02-27 JP JP2021549970A patent/JP2022521787A/ja not_active Ceased
- 2020-02-27 MX MX2021010322A patent/MX2021010322A/es unknown
- 2020-02-27 CN CN202080031829.1A patent/CN113906136A/zh active Pending
- 2020-02-27 CA CA3131588A patent/CA3131588A1/en active Pending
- 2020-02-27 AU AU2020229848A patent/AU2020229848A1/en not_active Abandoned
- 2020-02-27 SG SG11202109332RA patent/SG11202109332RA/en unknown
- 2020-02-27 US US17/434,209 patent/US20220169984A1/en active Pending
- 2020-02-27 KR KR1020217030805A patent/KR20210134000A/ko not_active Withdrawn
-
2021
- 2021-08-24 IL IL285842A patent/IL285842A/en unknown
-
2024
- 2024-12-16 JP JP2024219750A patent/JP2025061660A/ja active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6556674B1 (en) | 1998-11-19 | 2003-04-29 | Legerity, Inc. | Signal detector with matched filter coefficient |
| WO2017070429A1 (en) * | 2015-10-22 | 2017-04-27 | Regents Of The University Of Minnesota | Methods involving editing polynucleotides that encode t cell receptor |
Non-Patent Citations (20)
| Title |
|---|
| "Current Protocols in Molecular Biology", vol. 1-3, 1994, JOHN WILEY & SONS, INC. |
| BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081 |
| JIAN-PING ZHANG ET AL.: "Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage", GENOME BIOLOGY, vol. 18, no. 1, 20 February 2017 (2017-02-20), XP055399694, DOI: 10.1186/s13059-017-1164-8 * |
| JIE LIU ET AL.: "Building potent chimeric antigen receptor T cells with CRISPR genome editing", FRONTIERS IN IMMUNOLOGY, vol. 10, 19 March 2019 (2019-03-19), pages 456, XP055579973, DOI: 10.3389/fimmu.2019.00456 * |
| JOSE ARTURO GUTIERREZ-TRIANA ET AL.: "Efficient single-copy HDR by 5' modified long dsDNA donors", ELIFE, vol. 7, 29 August 2018 (2018-08-29), XP055702260, DOI: 10.7554/eLife.39468 * |
| KATHRIN SCHUMANN ET AL.: "Generation of knock-in primary human T cells using Cas9 ribonucleoproteins - supporting information", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 112, no. 33, 27 July 2015 (2015-07-27), pages 1 - 7, XP055659571, ISSN: 0027-8424, DOI: 10.1073/pnas.1512503112 * |
| KATHRIN SCHUMANN ET AL.: "Generation of knock-in primary human T cells using Cas9 ribonucleoproteins", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 112, no. 33, 27 July 2015 (2015-07-27), pages 10437 - 10442, XP055277999, ISSN: 0027-8424, DOI: 10.1073/pnas.1512503112 * |
| LIU ET AL.: "supplementary information s1", 1 January 2016 (2016-01-01), pages 38 - 33, XP055702703, Retrieved from the Internet <URL:https://www.nature.com/articles/cr2016142#Sec2> [retrieved on 20200609] * |
| LIU ET AL.: "supplementary information S2", 36.5 35.0 34.4 INDEL% 18.3 18 28.56 3.89 6.58 60.97 59, 1 January 2016 (2016-01-01), pages 68 - 65, XP055702705, Retrieved from the Internet <URL:https://www.nature.com/articles/cr2016142#Sec2> [retrieved on 20200609] * |
| LIU ET AL.: "supplementary information, data S1", 1 January 2016 (2016-01-01), XP055702707, Retrieved from the Internet <URL:https://www.nature.com/articles/cr2016142#Sec2> [retrieved on 20200609] * |
| MA ET AL., THE PROSTATE, vol. 61, 2004, pages 12 - 25 |
| MA ET AL., THE PROSTATE, vol. 74, no. 3, 2014, pages 286 - 296 |
| OHTSUKA, J. BIOL CHEM., vol. 260, 1985, pages 2605 - 2608 |
| REN ET AL., CLIN. CANCER RES., vol. 16, 4 November 2016 (2016-11-04), pages 1300 |
| RENZHAO, PROTEIN CELL, vol. 8, no. 9, 2017, pages 634 - 643 |
| ROSSOLINI ET AL., MO/. CELL. PROBES, vol. 8, 1994, pages 91 - 98 |
| ROTH THEODORE L. ET AL.: "Reprogramming human T cell function and specificity with non-viral genome targeting", NATURE, MACMILLAN JOURNALS LTD, LONDON, vol. 559, no. 7714, 11 July 2018 (2018-07-11), pages 405 - 409, XP036544239, ISSN: 0028-0836, [retrieved on 20180711], DOI: 10.1038/S41586-018-0326-5 * |
| SAMBROOK ET AL.: "Molecular Cloning - A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| TIJSSEN: "Laboratory Techniques In Biochemistry And Molecular Biology - Hybridization With Nucleic Acid Probes Part 1", 1993, ELSEVIER, article "Overview of principles of hybridization and the strategy of nucleic acid probe assay" |
| XIAOJUAN LIU ET AL.: "CRISPR-Cas9-mediated multiplex gene editing in CAR-T cells", CELL RESEARCH - XIBAO YANJIU, vol. 27, no. 1, 1 January 2017 (2017-01-01), GB, CN, pages 154 - 157, XP055555205, ISSN: 1001-0602, DOI: 10.1038/cr.2016.142 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12201699B2 (en) | 2014-10-10 | 2025-01-21 | Editas Medicine, Inc. | Compositions and methods for promoting homology directed repair |
| US12398187B2 (en) | 2019-03-05 | 2025-08-26 | Nkarta, Inc. | CD19-directed chimeric antigen receptors and uses thereof in immunotherapy |
| WO2021217083A1 (en) | 2020-04-24 | 2021-10-28 | Sorrento Therapeutics, Inc. | Memory dimeric antigen receptors |
| WO2022015956A1 (en) | 2020-07-15 | 2022-01-20 | Sorrento Therapeutics, Inc. | Improved process for dna integration using rna-guided endonucleases |
| WO2022215978A1 (ko) * | 2021-04-05 | 2022-10-13 | 주식회사 셀렌진 | Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도 |
Also Published As
| Publication number | Publication date |
|---|---|
| IL285842A (en) | 2021-10-31 |
| KR20210134000A (ko) | 2021-11-08 |
| EP3931322A1 (en) | 2022-01-05 |
| MX2021010322A (es) | 2022-01-06 |
| JP2025061660A (ja) | 2025-04-11 |
| US20200224160A1 (en) | 2020-07-16 |
| JP2022521787A (ja) | 2022-04-12 |
| US20220169984A1 (en) | 2022-06-02 |
| CA3131588A1 (en) | 2020-09-03 |
| SG11202109332RA (en) | 2021-09-29 |
| CN113906136A (zh) | 2022-01-07 |
| AU2020229848A1 (en) | 2021-10-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220169984A1 (en) | Improved process for dna integration using rna-guided endonucleases | |
| US20220145333A1 (en) | Improved process for integration of dna constructs using rna-guided endonucleases | |
| AU2025275210A1 (en) | Cpf1-related methods and compositions for gene editing | |
| JP2022137112A (ja) | 内因性t細胞受容体の標的置換 | |
| JP2022097517A (ja) | リンパ球における高レベル且つ安定な遺伝子移入のための方法 | |
| JP7611564B2 (ja) | Cas9塩基エディターを使用するリンパ球造血系操作 | |
| WO2016183236A1 (en) | Crispr/cas-related methods and compositions for treating hiv infection and aids | |
| JP2022547865A (ja) | 培養液中における改善された残存率を有する遺伝子操作されたt細胞 | |
| US11998567B2 (en) | Engineered chimeric guide RNA and uses thereof | |
| JP2023519819A (ja) | 標的核酸を改変するための組成物および方法 | |
| AU2022324118A1 (en) | Method for producing genetically modified cells | |
| WO2022159753A1 (en) | Enhancing efficiency of targeted gene knockin by base editors | |
| CA3253302A1 (en) | CELL COMPOSITIONS AND ENGINEERING METHODS | |
| WO2022015956A1 (en) | Improved process for dna integration using rna-guided endonucleases | |
| KR102858467B1 (ko) | 면역세포의 면역조절 유전자의 활성 조절을 위한 조성물 및 그 용도 | |
| US20200377878A1 (en) | Modified t cells and uses thereof | |
| WO2025128722A2 (en) | Methods and compositions for genomic integration | |
| WO2025117745A1 (en) | Methods and compositions for improving precision of endonuclease-mediated genome editing | |
| WO2024037461A1 (zh) | 工程化免疫细胞及其制备方法 | |
| HK40046558B (zh) | 使用cas9碱基编辑器的淋巴造血改造 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20715999 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3131588 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021549970 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20217030805 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2020715999 Country of ref document: EP Effective date: 20210927 |
|
| ENP | Entry into the national phase |
Ref document number: 2020229848 Country of ref document: AU Date of ref document: 20200227 Kind code of ref document: A |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2020715999 Country of ref document: EP |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 285842 Country of ref document: IL |