WO2022215978A1 - Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도 - Google Patents

Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도 Download PDF

Info

Publication number
WO2022215978A1
WO2022215978A1 PCT/KR2022/004794 KR2022004794W WO2022215978A1 WO 2022215978 A1 WO2022215978 A1 WO 2022215978A1 KR 2022004794 W KR2022004794 W KR 2022004794W WO 2022215978 A1 WO2022215978 A1 WO 2022215978A1
Authority
WO
WIPO (PCT)
Prior art keywords
pdcd
guide rna
gene
guide
nucleic acid
Prior art date
Application number
PCT/KR2022/004794
Other languages
English (en)
French (fr)
Inventor
안재형
한나경
김동희
Original Assignee
주식회사 셀렌진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220041231A external-priority patent/KR20220138340A/ko
Application filed by 주식회사 셀렌진 filed Critical 주식회사 셀렌진
Publication of WO2022215978A1 publication Critical patent/WO2022215978A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • It relates to a guide RNA complementary to the PDCD-1 gene and uses thereof.
  • Gene scissors refers to an enzyme that binds to a gene and cuts a specific DNA region, or a genome editing technique using the same. Using gene scissors, it can be used in various fields such as correction of mutations that cause genetic diseases in stem cells or somatic cells, and anticancer cell therapy.
  • the gene editing technology has evolved into the first generation zinc finger nuclease (ZFN), the second generation TALEN (transcription activator-like effector nuclease), and the third generation CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9.
  • CRISPR gene scissors (CRISPR/Cas9) consists of a guide RNA and Cas9 nuclease having specific nucleotide sequence information of the targeted DNA, and delivers it into the cell to cut a gene at a desired location or remove an existing gene. and insert new genes.
  • Cas9 nuclease cleaves the DNA target sequence specified by the sequence of the guide RNA.
  • a method of editing a genome using gene scissors is known through a number of documents such as Korean Publication No. 10-2015-0101478. Recently, Cas9 variants with increased accuracy have been developed to reduce the probability of off-target that cuts off-target points.
  • Such high-fidelity variants include HypaCas9, SpCas9, evoCas9, eSpCas9, Sniper-Cas9, SpCas9-HF1, xCas9, and the like.
  • PDCD-1 Programmed cell death protein-1
  • PD-1 protein is an immune checkpoint receptor, and when it binds to its ligand, Programmed death-ligand 1 (PD-L1), which is present in large amounts in some cancer cells, the activity of T cells is greatly inhibited and the cancer cells inhibit T cell attack.
  • PD-L1 Programmed death-ligand 1
  • the PDCD-1 gene is an important therapeutic target because it is possible to increase the anticancer efficacy of immune cells by inhibiting the defense mechanism of these cancer cells.
  • One aspect is to provide a guide RNA comprising a nucleic acid sequence identical to or complementary to a polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 5.
  • Another aspect is to provide a CRISPR/Cas9 system comprising the guide RNA and the Cas9 editor protein or a variant thereof, and a recombinant vector comprising the same.
  • Another aspect is to provide a composition for PDCD-1 gene editing comprising the guide RNA, the CRISPR/Cas9 system, and a recombinant vector comprising them.
  • One aspect provides a guide RNA comprising a nucleic acid sequence identical to or complementary to one polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 5.
  • guide RNA refers to a polynucleotide that cuts, inserts, or connects a target DNA in a cell through RNA editing.
  • the guide RNA may be a single-chain guide RNA (sgRNA).
  • the guide RNA may be a crRNA (CRISPR RNA) specific for a target nucleic acid sequence.
  • the guide RNA may further include a trans-activating crRNA (tracrRNA) that interacts with the Cas9 nuclease.
  • the tracrRNA may include a polynucleotide forming a loop structure.
  • a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize to the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence.
  • the PDCD-1 gene (Programmed cell death protein-1) is a gene expressing the PD-1 protein distributed on the surface of T cells or B cells, which are immune cells, and is located at position 2q37.3 of chromosome 2 in humans.
  • the PDCD-1 gene is, for example, NCBI Accession No. currently registered in NCBI GenBank, respectively. It may correspond to NG_012110.1.
  • NCBI Accession No. currently registered in NCBI GenBank, respectively. It may correspond to NG_012110.1.
  • Those skilled in the art will be able to easily identify the sequence using the sequence ID accession number.
  • the specific sequence corresponding to the Sequence ID number registered in the UCSC genome browser or GenBank may be slightly changed over time. It will be apparent to those skilled in the art that the scope of the present invention also extends to such altered sequences.
  • any nucleotide sequence that can be used for genetic manipulation to reduce the expression or activity of the PDCD-1 gene or the protein expressed by the PDCD-1 gene may be used as a guide RNA without limitation, for example, the nucleotide sequence may be combined with the PDCD-1 gene. It may be a hybridizable sequence, for example, it may include a polynucleotide consisting of SEQ ID NOs: 1 to 5 or a nucleic acid sequence complementary thereto. In addition, a portion of the guide RNA nucleotide sequence may be modified in order to modify/enhance the function of the guide RNA.
  • the degree of complementarity between a guide sequence and its corresponding target sequence when optimally aligned using an appropriate alignment algorithm, is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more.
  • Optimal alignment can be determined using any algorithm suitable for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the Burroughs- Algorithms based on the Burrows-Wheeler Transform (eg Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novocraft Technologies, ELAND (Illumina), SOAP (available at soap.genomics.org.cn) and Maq (available at maq.sourceforge.net).
  • any algorithm suitable for aligning sequences non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the Burroughs- Algorithms based on the Burrows-Wheeler Transform (eg Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novocraft Technologies, ELAND (Illumina), SOAP (available at soap.genomics.org.cn) and Maq (available at maq
  • the guide RNA may be 10 nucleotides to 30 nucleotides in length.
  • the guide RNA has a length of, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
  • the guide RNA may include a nucleic acid sequence identical to or complementary to two or more consecutive polynucleotides in a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5.
  • the guide RNA may include two or more continuous polynucleotides complementary to the remaining nucleic acid sequences except for the PAM sequence among the target nucleic acid sequences selected from the group consisting of SEQ ID NOs: 1 to 5.
  • the guide RNA may include a polynucleotide complementary to a nucleic acid sequence other than a PAM sequence among target nucleic acid sequences selected from the group consisting of 1 to 5.
  • the complementary nucleic acid sequence may include a polynucleotide into which one polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 5 is transcribed.
  • the guide RNA may include RNA, DNA, PNA, or a combination thereof.
  • the guide RNA may be chemically modified.
  • the guide RNA may hybridize with the PDCD-1 gene, and specifically, the guide RNA hybridizes or binds to at least one site in a region consisting of exon 1 to exon 2 of the PDCD-1 gene. it could be
  • the guide RNA may be a component of a programmable nuclease.
  • Genetic scissors refer to any type of nuclease that can cut by recognizing a specific position on the genome.
  • the gene scissors are, for example, transcription activator-like effector nuclease (TALEN), zinc finger nuclease, meganuclease, RNA-guided endonuclease (RGEN), Cpf1 and allologs. (Ago homolog, DNA guided endonuclease).
  • the RGEN refers to a nuclease comprising a guide RNA specific for a target DNA and a Cas protein as components. Said polynucleotide is, for example, a component of an RGEN.
  • the guide RNA may induce modification in the nucleic acid sequence of the PDCD-1 gene.
  • the guide RNA may remove the nucleic acid sequence encoding the PDCD-1 protein by non-homologous end-joining (NHEJ) from the genome of the cell.
  • NHEJ non-homologous end-joining
  • modifications in the nucleic acid sequence include 1) deletion of all or a continuous 1bp to 15bp nucleotide sequence region of the PDCD-1 gene, 2) 1 to 15 nucleotides of the PDCD-1 gene, a nucleotide different from the wild-type gene 3) insertion into PDCD-1 of 1 to 15 nucleotides each independently selected from A, T, C and G, or 4) a combination of two or more selected from 1) to 3) above have.
  • the deletion may be a deletion of a sequence region of about 4 bp, 8 bp, 11 bp, and/or 13 bp of the PDCD-1 gene, and the insertion is 1 bp, 4 bp, 8 bp, 11 bp, and/or 13 bp, or 15 bp sites.
  • One aspect is a nucleic acid sequence identical to or complementary to one polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 5; and a Cas9 editor protein or variant thereof; or a CRISPR/Cas9 system comprising a nucleic acid sequence encoding the same.
  • a “CRISPR system” refers to a sequence that collectively encodes a Cas gene, a tracr (trans-activating CRISPR) sequence (eg, tracrRNA or active moiety tracrRNA), a tracr-mate sequence (in the context of an endogenous CRISPR system, “ CRISPR-related (including direct repeats” and tracrRNA-processing portion direct repeats), guide sequences (also referred to as “spacers” in the context of endogenous CRISPR systems), guide RNAs or other sequences and transcripts from the CRISPR locus "Cas”) refers to transcripts and other elements involved in the expression of or inducing its activity.
  • one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, eg, Streptococcus pyogenes. In general, CRISPR systems are characterized by elements that promote the formation of CRISPR complexes at the site of the target sequence (also referred to as protospacers in the context of endogenous CRISPR systems).
  • a target sequence or “target gene” refers to a sequence to which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence enhances the formation of the CRISPR complex. Although essentially perfect complementarity is not required, there is sufficient complementarity to cause hybridization and promote formation of the CRISPR complex.
  • the target sequence may comprise any polynucleotide, eg, a DNA or RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of the cell.
  • Cas protein When the Cas protein forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), it forms an active endonuclease or nickase.
  • Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx16, CsX, Csx3, Csx10, Csx, Csx Csf2, Csf3, Csf4, homologues thereof
  • the amino acid sequence of the Streptococcus pyogenes Cas9 protein can be obtained from the SwissProt database under accession number Q99ZW2.
  • the unmodified CRISPR enzyme eg, Cas9
  • the CRISPR enzyme is Cas9, which may be Cas9 from Streptococcus pyogenes or Streptococcus pneumoniae.
  • the Cas protein is codon-optimized for expression in a eukaryotic cell.
  • the Cas protein is one of the protein components of the CRISPR/Cas system, and may be an activated endonuclease or a nick forming enzyme.
  • the Cas protein may form a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) to exhibit its activity.
  • the Cas protein may be, for example, from the genus Streptococcus (eg, Streptococcus pyogens), from the genus Neisseria (eg, Neisseria meningitidis), from the genus Pasteurella (eg, Pasteurella multocida), from the genus Francisella (eg, Francisella novicida), or It may be a polynucleotide derived from a bacterium of the genus Campylobacter (eg, Campylobacter jejuni).
  • the Cas protein is GenBank Accession No. and the amino acid sequence of Q99ZW2.1.
  • the Cas protein may be a wild-type Cas protein or a mutant Cas protein.
  • the mutant Cas protein may be, for example, a protein in which a catalytic aspartate residue is changed to another amino acid (eg, alanine).
  • the Cas protein may be a recombinant protein.
  • the Cas protein may be a Cas9 protein or a Cpf1 protein.
  • the Cas9 protein may be a Cas9 protein variant.
  • the variant may be one or more selected from the group consisting of HypaCas9, SpCas9, evoCas9, eSpCas9, Sniper-Cas9, SpCas9-HF1 and xCas9.
  • eSpCas9 may be translated from the sequence of the polynucleotide consisting of SEQ ID NO: 8
  • evoCas9 may be translated from the sequence of the polynucleotide consisting of SEQ ID NO: 9
  • HypaCas9 is the polynucleotide consisting of SEQ ID NO: 10
  • Sniper-Cas9 may be translated from the sequence of the polynucleotide consisting of SEQ ID NO: 11
  • SpCas9 may be translated from the sequence of the polynucleotide consisting of SEQ ID NO: 12
  • SpCas9- HF1 may be translated from the sequence of the polynucleotide consisting of SEQ ID NO: 13
  • xCas9 may be translated from the sequence of the polynucleotide consisting of SEQ ID NO: 14.
  • Another aspect is a nucleic acid sequence identical to or complementary to one polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 5; and a Cas9 editor protein or variant thereof; Or it provides a recombinant vector comprising a nucleic acid sequence encoding the same.
  • the vector may be introduced into a cell or subject to generate a guide RNA.
  • the vector can be introduced into a cell or subject to express the PDCD-1 guide RNA and/or Cas protein, thereby forming an insertion/deletion site in the nucleic acid sequence encoding the PD-1 protein in the cell or subject to induce mutation. .
  • polynucleotide is a polymer of deoxyribonucleotides or ribonucleotides that exist in single-stranded or double-stranded form. It encompasses RNA genomic sequences, DNA (gDNA and cDNA) and RNA sequences transcribed therefrom, and includes analogs of natural polynucleotides, unless otherwise specified.
  • the polynucleotide includes not only a nucleotide sequence encoding the amino acid sequence of the fusion protein, but also a sequence complementary to the sequence.
  • the complementary sequence includes not only perfectly complementary sequences, but also substantially complementary sequences, which under stringent conditions known in the art, for example, nucleotides encoding the amino acid sequence of the fusion protein. It refers to a sequence capable of hybridizing with the nucleotide sequence of the sequence.
  • the vector can be constructed through various methods known in the art.
  • the vector may be a vector for cloning or a vector for expression.
  • the vector may be a viral vector, a plasmid vector, or an agrobacterium vector.
  • the vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host.
  • a strong promoter capable of propagating transcription eg, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL ⁇ promoter, pR ⁇ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter
  • a ribosome binding site for initiation of translation e.g, a promoter capable of propagating transcription (eg, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL ⁇ promoter, pR ⁇ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence.
  • a strong promoter capable of propagating transcription eg, tac promoter, lac promoter
  • a promoter derived from the genome of a mammalian cell eg, metallotionine promoter
  • a promoter derived from a mammalian virus eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV
  • a promoter derived from the genome of a mammalian cell eg, metallotionine promoter
  • a promoter derived from a mammalian virus eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV
  • the vector is a plasmid often used in the art (eg pSC101, ColE1, pBR322, pUC, pUC8/9, pHC79, pUC19 and pET, etc.), phage (eg ⁇ gt4 ⁇ B, ⁇ -Charon, ⁇ ⁇ z1 and M13) or viruses (eg, SV40, etc.).
  • the vector may include a CBh promoter, a U6 promoter, a CMV promoter, an EF-1 ⁇ promoter, or a combination thereof.
  • the recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host.
  • a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pL promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) ), a ribosome binding site for initiation of translation and a transcription/translation termination sequence.
  • a strong promoter capable of propagating transcription eg, pL promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.
  • the replication origin operating in the eukaryotic cell contained in the vector includes the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the adeno origin of replication, the AAV origin of replication and the BBV origin of replication. It is not limited.
  • promoters derived from the genome of mammalian cells eg, metallotionine promoter
  • mammalian viruses eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV
  • the vector may include an antibiotic resistance gene.
  • the antibiotic resistance gene may include an ampicillin resistance gene, a puromycin resistance gene, chloramphenicol, a blasticidin resistance gene, or a combination thereof.
  • Another aspect is a guide RNA and a Cas9 editor protein or a variant thereof comprising a nucleic acid sequence identical to or complementary to one polynucleotide selected from the group consisting of SEQ ID NOs: 1 to 5; Or it provides a composition for PDCD-1 gene editing comprising a nucleic acid sequence encoding the same.
  • the guide RNA, the vector, the PDCD-1 protein, and the nucleic acid sequences encoding the PDCD-1 protein are as described above.
  • composition may be for administration in vitro or in vivo .
  • the expression or activity is lower than the measured PDCD-1 gene or the expression or activity level of the protein encoded by the PDCD-1 gene of the cell or individual, or the expression or activity is decreased.
  • the PDCD-1 gene can be edited to be reduced or inactivated. This means that the expression or activity can be exhibited to a lower degree than the expression or activity level of the protein encoded by the PDCD-1 gene of the cells or administered individual in vitro, or the expression or activity can be abolished.
  • the gene editing by the composition shows that the expression or activity of the PDCD-1 gene or the protein encoded by the PDCD-1 gene is about 20% or more, about 30% higher than that of the original non-engineered parent cell. or more, about 40% or more, about 50% or more, about 55% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more It may be more, or may be reduced by about 100%.
  • composition is capable of editing the genome such that the nucleic acid sequence encoding the PDCD-1 protein is altered in the genome of a cell to induce any modification that eliminates or reduces the function of the PDCD-1 protein, i.e., deletion, substitution, insertion, or It is possible to effectively knockout the PDCD-1 gene by inducing a frameshift mutation.
  • the cells may be selected from the group consisting of cancer cells, stem cells, vascular endothelial cells, leukocytes, immune cells, epithelial cells, germ cells, fibroblasts, myocytes, bone marrow cells, epidermal cells, osteoblasts and neurons.
  • Genetically engineered or edited cells with reduced expression or activity of the PDCD-1 gene or the protein encoded by the PDCD-1 gene can be identified using any method known in the art.
  • the term “inactivation” may mean that a gene that is not expressed at all or a protein that has no activity even if it is expressed is generated.
  • the term “depression” means that the PDCD-1 gene is expressed at a lower level compared to the non-engineered cell, or that the activity is low or the activity is removed even if the protein encoded by the PDCD-1 gene is expressed. can do.
  • the "removal” refers to any modification in which the function of the PDCD-1 protein is eliminated or reduced by altering the nucleic acid sequence encoding the PDCD-1 protein in the genome of a cell.
  • the term “removal” may be used interchangeably with “mutation”.
  • the deletion or mutation may be, for example, a deletion, substitution, insertion, or frameshift mutation.
  • composition for gene editing can be genetically engineered or edited to reduce the expression or activity of a protein encoded by the PDCD-1 gene, and thus can be used for the prevention and/or treatment of cancer in an individual to which the composition is administered.
  • a composition for PDCD-1 gene editing comprising a guide RNA, a vector comprising the same, the guide RNA and Cas9 editor protein or a variant thereof according to an aspect is capable of effectively knocking out the PDCD-1 gene from the genome of a cell or individual. It can be, and through this, can be usefully used to prevent or treat cancer as personalized medicine or precision medicine.
  • FIG. 1 is a diagram illustrating a pcDNA 3.1 plasmid, which is a plasmid containing a nucleic acid sequence encoding Cas 9 or a variant thereof.
  • FIG. 2 is a diagram schematically schematically illustrating a vector map of a mutant of the spCas9 gene editor protein (HypaCas9, SpCas9-HP1, evoCas9 and eSpCas9(1.1)) used in Examples.
  • FIG. 3A is a diagram showing a plasmid including a guide RNA used in the experiment
  • FIG. 3B is a diagram showing a vector map when the spCas9 gene editor protein and guide RNA are converted into an All-in-One vector system (in this case) It is constructed by inserting the U6 promoter-guide RNA-scaffold sequence portion of FIG. 3A in front of the CMV/EF-1 ⁇ promoter of the Cas9 plasmid).
  • FIG. 4 is a diagram illustrating a plasmid encoding a PDCD-1 guide RNA was transfected into HEK293T cells, and the expression level was confirmed through enhanced Green Fluorescent Protein (eGFP) fluorescence.
  • eGFP Green Fluorescent Protein
  • FIG. 5 is a diagram showing the main pattern, confirming the gene editing with PDCD-1 guide 2 (SEQ ID NO: 2) and the guide RNA and SpCas9-HF1, evoCas9 and eSpCas9 confirmed to have high indel efficiency.
  • FIG. 6 is a view showing sub-patterns confirming the gene editing of PDCD-1 guide 2, the guide RNA, and SpCas9-HF1, evoCas9 and eSpCas9, which were confirmed to have high indel efficiency.
  • FIG. 7 is a view showing the main pattern, confirming the gene editing pattern of PDCD-1 guide 4 (SEQ ID NO: 4) and the guide RNA and HypaCas9 and eSpCas9 confirmed to have high indel efficiency.
  • FIG. 8 is a diagram illustrating sub-patterns confirming the gene editing patterns of PDCD-1 guide 4, the guide RNA, and HypaCas9 and eSpCas9 confirmed to have high indel efficiency.
  • FIG. 9 is a diagram confirming the gene editing pattern of PDCD-1 guide 5 (SEQ ID NO: 5) and the guide RNA and SpCas9-HF1 and eSpCas9 confirmed to have high indel efficiency.
  • HypaCas9, SpCas9-HP1, evoCas9, and eSpCas9(1.1) were cloned into pcDNA 3.1 vector (Thermofisher) with improved accuracy.
  • the high-fidelity Cas9 variant interacts with the DNA-RNA heteroduplex to modify the REC3 domain that binds to the target site, or cuts the HNH domain that cuts the complementary DNA strand or the non-complementary DNA strand.
  • the CMV promoter was used.
  • CMV is the most widely used promoter and shows strong expression in most cell lines, and CMV is basically configured in pcDNA3.1 plasmid.
  • the CMV promoter or EF- operably linked to the Cas9 mutant The 1 ⁇ promoter was used.
  • the vector since IRES is more stable than P2A, the vector was constructed to be expressed in the form of Cas9-IRES-eGFP by utilizing the IRES sequence between Cas9 and EGFP.
  • FIG. 1 A schematic diagram of the specifically used IRES-eGFP expression vector is shown in FIG. 1, and vector maps of four Cas9 variants HypaCas9, SpCas9-HP1, evoCas9, and eSpCas9(1.1) are shown in FIG. 2, respectively.
  • RNAs targeting the PDCD-1 gene were synthesized.
  • a guide RNA capable of knocking out both isoforms of PDCD-1 was designed by selecting a common part of exon 2 of isoform 1 of the human PDCD-1 gene and exon 1 of isoform 2 as target candidates for guide RNA.
  • the positions and sequences of the five guide RNA candidate sequences are shown in Table 1 below.
  • PDCD-1 location Target candidate sequence (5'-3') SEQ ID NO: Guide1 151:180 CAAGCTGGCCGCCTTCCCCG One Guide2 280:309 GGAGATGGCCCCACAGAGGT 2 Guide3 269:298 GACAGCGGCACCTACCTCTG 3 Guide4 316:345 GCAGATCAAAGAGAGCCTGC 4 Guide5 127:156 CATGAGCCCCAGCAACCAGA 5
  • GX19 vector was used as a plasmid expressing the guide RNA designed in Example 2-1.
  • the U6 promoter was used as the promoter, and a guide RNA scaffold sequence binding to Cas9 was inserted, and a guide RNA target sequence of 20 bp in size was positioned between the U6 promoter and the scaffold sequence.
  • the oligonucleotide sequences of Table 1 were synthesized, respectively, and annealed using forward/reverse primers, T4 polynucleotide kinase, and NEB annealing buffer. Annealing conditions were set at 95° C. for 5 minutes, followed by ramping to 25° C. (0.1° C. per second).
  • the annealed oligonucleotides were ligated into the GX19 vector digested with Bsa I restriction enzyme using T4 ligase.
  • This guide RNA plasmid is shown in FIG. 3A, and a schematic plasmid vector map is shown in FIG. 3B.
  • HEK293T cells a human embryonic kidney cell line, were transfected with a plasmid encoding PDCD-1 guide RNA, and the expression level was confirmed by eGFP (enhanced Green Fluorescent Protein) fluorescence.
  • eGFP enhanced Green Fluorescent Protein
  • Cas9 plasmid 3 ⁇ g, guide RNA plasmid 1 ⁇ g Cas9 to guide ratio is 3:1
  • 5 x 10 6 HEK293T cells under the conditions of 1300 v, 20 ms, and 1 pulse using the Neon transfection system (Thermofisher).
  • HEK293T cells expressed the PDCD-1 guide RNA and high-fidelity Cas9 mutant designed in Examples 1 and 2-1, and the transfected cells were selected.
  • Example 4 Measurement of indel frequency and selection of optimal guide RNA
  • NGS Next generation sequencing
  • next-generation sequencing was performed to measure the frequency of indels (insertion/deletion, indel) in the genome in the cells prepared in Example 3.
  • the indel frequency was calculated according to the following equation.
  • NGS prepared and used the primers as follows to enable sequencing of 50-100 bp downstream of the PAM (-NGG) sequence of the guide RNA target sequence, a total of 200-250 bp.
  • the NGS result was analyzed using the web-based NSG analyzer algorithm afterwards, and the NGS result was input to compare the insertion and deletion ratios, size, and sequence information, and the mutation rate due to indels in all cells was confirmed. did.
  • Table 2 shows the indel frequency when a different sequence is identified by comparing the 200-300bp region including the target region 20bp with the wild-type sequence through NGS analysis after PCR, which is not the indel frequency by CRIPSR/Cas9, but a PCR error, etc. It was confirmed that the error was caused by Accordingly, Table 2 is data for excluding errors from Tables 3 to 6, which are actual data, not actual experimental data, and it was confirmed that the indel frequency in Table 2 is a result indicating an error range.
  • Example 4 An experiment was performed by the method of Example 4 to check the gene editing efficiency of the guide RNA for PDCD-1 and whether there is a main editing pattern thereof when gene editing occurs. Specifically, among the five guide RNAs for PDCD-1, it was confirmed that PDCD-1 guides 2, 4, and 5 had a high indel frequency. An experiment to confirm was performed.
  • the sub-pattern showed the most CCTCTGTGGGG 11bp deletion pattern in the TACCTCTGTGGGGCCA sequence in the case of PDCD-1 guide 2 regardless of the type of Cas9 mutant.
  • GCCTGCGG 8bp deletion patterns were the most common in the GAGAGCCTGCGGGCA sequence, followed by GCCT 4bp deletion and AGAGCCTGCGGGC 13bp deletion patterns.
  • PDCD-1 guide 2 showed the highest frequency of guide-induced indels in combination with evoCas9 and SpCas9-HF1 Cas9 mutants
  • PDCD-1 guide 4 showed the highest frequency of guide-induced indels in combination with HypaCas9 and eSpCas9. It was confirmed that indels induced by

Abstract

PDCD-1 유전자에 상보적인 가이드 RNA 및 이의 용도에 관한 것이다. 일 양상에 따른 가이드 RNA, 이를 포함하는 벡터, 상기 가이드 RNA 및 Cas9 에디터 단백질 또는 이의 변이체를 포함하는 PDCD-1 유전자 편집용 조성물은 세포 또는 개체의 유전체에서 PDCD-1 유전자를 효과적으로 제거(knockout)할 수 있고, 이를 통해 맞춤의료 또는 정밀의료로서 암을 예방 또는 치료하는데 유용하게 사용될 수 있다.

Description

PDCD-1 유전자에 상보적인 가이드 RNA 및 이의 용도
PDCD-1 유전자에 상보적인 가이드 RNA 및 이의 용도에 관한 것이다.
유전자 가위는 유전자에 결합하여 특정 DNA 부위를 절단하여 사용하는 효소 또는 이를 이용한 유전체 편집(genome editing) 기법을 말한다. 유전자 가위를 이용하여 줄기세포 또는 체세포에서 유전병의 원인이 되는 돌연변이 교정, 항암 세포 치료제와 같이 다양한 분야에서 활용할 수 있다. 유전자 가위 기술은 1세대 ZFN(zinc finger nuclease), 2세대 TALEN(transcription activator-like effector nuclease) 및 3세대 CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9으로 발전해왔다.
크리스퍼 유전자 가위(CRISPR/Cas9)는 표적으로 정한 DNA의 특정 염기 서열 정보를 갖는 가이드(Guide) RNA와 Cas9 뉴클레아제로 구성되며, 이를 세포 내로 전달하여 유전자를 원하는 위치에서 절단하거나 기존 유전자를 제거하고 새로운 유전자를 삽입할 수 있다. 유전자 가위를 이용하여 특정 DNA를 절단할 때, Cas9 뉴클레아제는 가이드 RNA의 서열에 의해 특정된 DNA 표적 서열을 절단한다. 유전자 가위를 이용하여 유전체를 편집하는 방법은 한국 공개 번호 10-2015-0101478 등 다수의 문헌을 통해 알려져 있다. 최근에는 표적 이외의 지점을 절단하는 표적이탈(off-target) 발생 확률을 줄이기 위해 정확성을 높인 Cas9 변이체들이 개발되었다. 이러한 고-정확도(high-fidelity) 변이체로는 HypaCas9, SpCas9, evoCas9, eSpCas9, Sniper-Cas9, SpCas9-HF1, xCas9 등이 있다.
PDCD-1(Programmed cell death protein-1)은 면역세포인 T 세포나 B 세포의 표면에 분포하는 PD-1 단백질을 발현하는 유전자로, 사람에서는 2번 염색체의 2q37.3 위치에 존재한다. PD-1 단백질은 면역관문수용체로, 이의 리간드인, 일부 암세포에 다량으로 존재하는 PD-L1(Programmed death-ligand 1)과 결합하게 되면 T 세포의 활성이 크게 억제되어 암세포는 T 세포의 공격을 회피하게 된다. 이러한 암세포의 방어 기전을 억제하면 면역세포의 항암 효능을 높일 수 있기 때문에, PDCD-1 유전자는 중요한 치료적 표적이다.
따라서, PDCD-1 유전자를 표적으로 하는 가이드 RNA를 개발할 필요가 있다.
일 양상은 서열번호 1 내지 5로 이루어진 군으로부터 선택된 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열을 포함하는 가이드 RNA를 제공하는 것이다.
다른 양상은 상기 가이드 RNA 및 Cas9 에디터 단백질 또는 이의 변이체를 포함하는 CRISPR/Cas9 시스템 및 이를 포함하는 재조합 벡터를 제공하는 것이다.
또 다른 양상은 상기 가이드 RNA, CRISPR/Cas9 시스템 및 이들을 포함하는 재조합 벡터를 포함하는 PDCD-1 유전자 편집용 조성물을 제공하는 것이다.
본 출원의 다른 목적 및 이점은 첨부한 청구범위 및 도면과 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다. 본 명세서에 기재되지 않은 내용은 본 출원의 기술 분야 또는 유사한 기술 분야 내 숙련된 자이면 충분히 인식하고 유추할 수 있는 것이므로 그 설명을 생략한다.
본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
일 양상은 서열번호 1 내지 5 로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열을 포함하는 가이드 RNA를 제공한다.
본 명세서에서, 용어 "가이드(guide) RNA"는 RNA 편집(editing)을 통해 세포내에서 표적 DNA를 절단, 삽입, 또는 연결시키는 폴리뉴클레오티드를 말한다. 상기 가이드 RNA는 단일-사슬 가이드 RNA(single-chain guide RNA, sgRNA)일 수 있다. 상기 가이드 RNA는 표적 핵산 서열에 특이적인 crRNA(CRISPR RNA)일 수 있다. 상기 가이드 RNA는 Cas9 뉴클레아제와 상호작용하는 tracrRNA(trans-activating crRNA)를 더 포함할 수 있다. 상기 tracrRNA는 루프(loop) 구조를 형성하는 폴리뉴클레오티드를 포함할 수 있다.
일반적으로, 가이드 서열은 표적 서열과 혼성화하고, 표적 서열로의 CRISPR 복합체의 서열-특이적 결합을 유도하기에 충분한, 표적 폴리뉴클레오티드 서열과의 상보성을 갖는 임의의 폴리뉴클레오티드 서열이다.
PDCD-1 유전자(Programmed cell death protein-1)는 면역세포인 T 세포나 B 세포의 표면에 분포하는 PD-1 단백질을 발현하는 유전자로, 사람에서는 2번 염색체의 2q37.3 위치에 존재한다. 상기 PDCD-1 유전자는 예를 들어, 각각 NCBI GenBank에 현재 등록된 NCBI Accession No. NG_012110.1에 해당할 수 있다. 통상의 기술자라면 시퀀스 ID 등록번호를 이용하여 서열을 용이하게 확인할 수 있을 것이다. UCSC genome browser 또는 GenBank에 등록되어 있는 상기 Sequence ID 번호에 해당하는 구체적인 서열은 시간이 지남에 따라 다소 변경될 수 있다. 본 발명의 범위가 상기 변경된 서열에도 미치는 것은 통상의 기술자에게 자명할 것이다.
또한 PDCD-1 유전자 또는 PDCD-1 유전자가 발현하는 단백질의 발현 또는 활성을 감소시키기 위한 유전자 조작에 이용할 수 있는 염기 서열이라면 제한 없이 가이드 RNA로 이용할 수 있으며, 예컨대 상기 염기 서열은 PDCD-1 유전자와 혼성화할 수 있는 서열일 수 있고, 예를 들면 서열번호 1 내지 5로 이루어진 폴리뉴클레오티드 또는 이와 상보적인 핵산서열을 포함하는 것일 수 있다. 또한 상기 가이드 RNA의 기능을 변형/증진시키기 위하여 가이드 RNA 염기 서열의 일부분을 변형할 수 있다. 또한 일부 구현 예에서, 가이드 서열과 그의 상응하는 표적 서열 간의 상보성의 정도는 적절한 정렬 알고리즘을 사용하여 최적으로 정렬되는 경우, 약 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% 이상이다. 최적의 정렬은 서열을 정렬하기에 적절한 임의의 알고리즘의 사용으로 결정될 수 있으며, 그의 비제한적인 예는 스미스-워터만 (Smith-Waterman) 알고리즘, 니들만-분쉬 (Needleman-Wunsch) 알고리즘, 버로우즈-휠러 트랜스폼(Burrows-Wheeler Transform)에 기초한 알고리즘(예를 들어, 버로우즈 휠러 얼라이너(Burrows Wheeler Aligner)), ClustalW, Clustal X, BLAT, 노보얼라인 (Novocraft Technologies), ELAND(Illumina), SOAP(soap.genomics.org.cn에서 이용가능) 및 Maq(maq.sourceforge.net에서 이용가능)를 포함한다.
상기 가이드 RNA는 길이가 10 뉴클레오티드 내지 30 뉴클레오티드일 수 있다. 상기 가이드 RNA는 길이가 예를 들어, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 또는 30 뉴클레오티드일 수 있다.
상기 가이드 RNA는 서열번호 1 내지 5로 이루어진 군으로부터 선택된 핵산 서열에서 2개 이상의 연속 폴리뉴클레오티드와 동일하거나 상보적인 핵산 서열을 포함할 수 있다. 상기 가이드 RNA는 서열번호 1 내지 5로 이루어진 군으로부터 선택된 표적 핵산 서열 중 PAM 서열을 제외한 나머지 핵산 서열에 상보적인 2 이상 연속 폴리뉴클레오티드를 포함할 수 있다. 상기 가이드 RNA는 1 내지 5로 이루어진 군으로부터 선택된 표적 핵산 서열 중 PAM 서열을 제외한 나머지 핵산 서열에 상보적인 폴리뉴클레오티드를 포함할 수 있다.
또한 상기 가이드 RNA에 있어서 상보적인 핵산 서열은 서열번호 1 내지 5로 이루어진 군으로부터 선택된 표적 핵산 서열 선택된 1종의 폴리뉴클레오티드가 전사된 폴리뉴클레오티드를 포함하는 것일 수 있다.
상기 가이드 RNA는 RNA, DNA, PNA, 또는 이들의 조합을 포함할 수 있다. 상기 가이드 RNA는 화학적으로 변형된 것일 수 있다.
상기 가이드 RNA는 PDCD-1 유전자와 혼성화하는 것일 수 있고, 구체적으로 상기 가이드 RNA는 PDCD-1 유전자의 엑손(exon) 1 내지 엑손 2로 이루어진 부위에서 적어도 하나의 부위를 타겟으로하여 혼성화하거나 결합되는 것일 수 있다.
상기 가이드 RNA는 프로그램 가능한 유전자 가위(programmable nuclease)의 구성요소일 수 있다. 유전자 가위는 유전체 상의 특정 위치를 인식하여 절단할 수 있는 모든 형태의 뉴클레아제를 의미한다. 상기 유전자 가위는 예를 들어, TALEN(transcription activator-like effector nuclease), 징크 핑거 뉴클레아제(zinc finger nuclease), 메가 뉴클레아제(meganuclease), RGEN(RNA-guided endonuclease), Cpf1 및 아고 상동체(Ago homolog, DNA guided endonuclease)이다. 상기 RGEN은 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 구성요소로 포함하는 뉴클레아제를 말한다. 상기 폴리뉴클레오티드는 예를 들어 RGEN의 구성요소이다.
또한 가이드 RNA는 PDCD-1 유전자의 핵산 서열 내 변형을 유도하는 것일 수 있다. 상기 가이드 RNA는 세포의 유전체에서 비상동성 말단-접합(non-homologous end-joining, NHEJ)에 의해 PDCD-1 단백질을 암호화하는 핵산 서열을 제거할 수 있다. 구체적으로 상기 핵산 서열 내 변형은 1) PDCD-1 유전자의 전부 또는 연속하는 1bp 내지 15bp의 염기서열 부위의 결실(deletion), 2) PDCD-1 유전자의 1 내지 15개의 뉴클레오티드의 야생형 유전자와 상이한 뉴클레오티드로의 치환, 3) 각각 독립적으로 A, T, C 및 G 중에서 선택된 1 내지 15개의 뉴클레오티드의 PDCD-1 로의 삽입(insertion), 또는 4) 상기 1) 내지 3) 중에서 선택된 2 가지 이상의 조합일 수 있다. 구체적으로 상기 결실은 PDCD-1 유전자의 연속하는 약 4 bp, 8 bp, 11 bp, 및/또는 13 bp의 염기서열 부위의 결실일 수 있으며, 상기 삽입은 1 bp, 4 bp, 8 bp, 11 bp, 및/또는 13 bp, 또는 15 bp 부위의 삽입일 수 있다.
일 양상은 서열번호 1 내지 5 로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열; 및 Cas9 에디터 단백질 또는 이의 변이체; 또는 이를 암호화하는 핵산 서열을 포함하는 CRISPR/Cas9 시스템을 제공한다.
일반적으로, "CRISPR 시스템"은 집합적으로 Cas 유전자를 인코딩하는 서열, tracr(트랜스-활성화 CRISPR) 서열(예를 들어, tracrRNA 또는 활성 부분 tracrRNA), tracr-메이트 서열(내인성 CRISPR 시스템의 맥락에서 "직접 반복부" 및 tracrRNA-가공 부분 직접 반복부 포함), 가이드 서열(내인성 CRISPR 시스템의 맥락에서 "스페이서"로도 지칭), 가이드 RNA 또는 CRISPR 유전자좌로부터의 기타 서열 및 전사물을 포함하는 CRISPR-관련("Cas") 유전자의 발현에 수반되거나, 그의 활성을 유도하는 전사물 및 다른 요소를 지칭한다. 일부 구현예에서, CRISPR 시스템의 하나 이상의 요소는 I형, II형 또는 III형 CRISPR 시스템으로부터 유래된다. 일부 구현예에서, CRISPR 시스템의 하나 이상의 요소는 내인성 CRISPR 시스템을 포함하는 특정 유기체, 예를 들어, 스트렙토코커스 피오게네스로부터 유래된다. 일반적으로, CRISPR 시스템은 표적 서열의 부위에서 CRISPR 복합체의 형성을 증진시키는 요소(내인성 CRISPR 시스템의 맥락에서 프로토스페이서로도 지칭)를 특징으로 한다. CRISPR 복합체의 형성의 맥락에서, "표적 서열" 또는 "표적 유전자"는 가이드 서열이 상보성을 갖도록 설계된 서열을 지칭하며, 여기서, 표적 서열과 가이드 서열 간의 혼성화는 CRISPR 복합체의 형성을 증진시킨다. 본질적으로 완전한 상보성이 필요하지 않지만, 혼성화를 야기하고, CRISPR 복합체의 형성을 증진시키는 충분한 상보성이 존재한다. 표적 서열은 임의의 폴리뉴클레오티드, 예를 들어, DNA 또는 RNA 폴리뉴클레오티드를 포함할 수 있다. 일부 구현예에서, 표적 서열은 세포의 핵 또는 세포질 내에 위치한다.
상기 Cas 단백질은 CRISPR RNA (crRNA) 및 트랜스-활성화 crRNA (trans-activating crRNA, tracrRNA)로 불리는 두 RNA와 복합체를 형성할 때, 활성 엔도뉴클레아제 또는 니카아제 (nickase)를 형성한다. 상기 Cas 단백질의 비제한적인 예는 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9(Csn1 및 Csx12로도 알려짐), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, 그의 상동체 또는 그의 변형된 버전을 포함한다. 이들 효소가 알려져 있으며; 예를 들어, 스트렙토코커스 피오게네스 Cas9 단백질의 아미노산 서열은 수탁 번호 Q99ZW2 하에 스위스프로트(SwissProt) 데이터베이스에서 얻을 수 있다. 일부 구현예에서, 비변형 CRISPR 효소, 예를 들어, Cas9는 DNA 절단 활성을 갖는다. 일부 구현예에서, CRISPR 효소는 Cas9이며, 스트렙토코커스 피오게네스 또는 스트렙토코커스 뉴모니애로부터의 Cas9일 수 있다. 일부 구현예에서, Cas 단백질은 진핵 세포에서의 발현을 위해 코돈-최적화된다.
상기 Cas 단백질은 CRISPR/Cas 시스템의 단백질 구성 요소 중 하나로서, 활성화된 엔도뉴클레아제 또는 닉(nick) 형성 효소일 수 있다. 상기 Cas 단백질은 crRNA(CRISPR RNA) 및 tracrRNA(trans-activating crRNA)와 복합체를 형성하여 그의 활성을 나타낼 수 있다.
상기 Cas 단백질은 예를 들어 스트렙토코커스 속(예, Streptococcus pyogens), 네이세리아 속(예, Neisseria meningitidis), 파스테우렐라 속(예, Pasteurella multocida), 프란시셀라 속(예, Francisella novicida), 또는 캄필로박터 속(예, Campylobacter jejuni)의 세균으로부터 유래된 폴리뉴클레오티드일 수 있다. 상기 Cas 단백질은 GenBank Accession No. Q99ZW2.1의 아미노산 서열을 포함할 수 있다
상기 Cas 단백질은 야생형 Cas 단백질 또는 돌연변이 Cas 단백질일 수 있다. 상기 돌연변이 Cas 단백질은 예를 들어 촉매적 아스파라긴산 잔기(catalytic aspartate residue)가 다른 아미노산(예, 알라닌)으로 변경된 단백질일 수 있다. 상기 Cas 단백질은 재조합 단백질일 수 있다.
상기 Cas 단백질은 Cas9 단백질은 또는 Cpf1 단백질일 수 있다.
상기 Cas9 단백질은 Cas9 단백질 변이체(variant)일 수 있다. 예를 들어, 상기 변이체로는 이에 제한되지는 않으나 HypaCas9, SpCas9, evoCas9, eSpCas9, Sniper-Cas9, SpCas9-HF1 및 xCas9로 이루어진 군으로부터 선택되는 하나 이상일 수 있다. 상기 Cas 9 단백질 변이체 중 eSpCas9는 서열번호 8로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있고, evoCas9는 서열번호 9로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있고, HypaCas9은 서열번호 10으로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있고, Sniper-Cas9은 서열번호 11로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있고, SpCas9은 서열번호 12로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있고, SpCas9-HF1은 서열번호 13으로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있고, xCas9은 서열번호 14로 이루어진 폴리뉴클레오티드의 서열로부터 번역되는 것일 수 있다.
다른 양상은 서열번호 1 내지 5 로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열; 및 Cas9 에디터 단백질 또는 이의 변이체; 또는 이를 암호화하는 핵산 서열을 포함하는 재조합 벡터를 제공한다. 상기 벡터는 세포 또는 개체에 도입되어 가이드 RNA를 생성하는 것일 수 있다. 상기 벡터는 세포 또는 개체에 도입되어 PDCD-1 가이드 RNA 및/또는 Cas 단백질을 발현하여, 세포 또는 개체 내에서 PD-1 단백질을 암호화하는 핵산 서열에 삽입/결실 부위를 형성하여 돌연변이를 유발할 수 있다.
용어 "폴리뉴클레오티드(polynucleotide)"는 단일가닥 또는 이중가닥 형태로 존재하는 디옥시리보뉴클레오티드 또는 리보뉴클레오티드의 중합체이다. RNA 게놈 서열, DNA(gDNA 및 cDNA) 및 이로부터 전사되는 RNA 서열을 포괄하며, 특별하게 다른 언급이 없는 한 천연의 폴리뉴클레오티드의 유사체를 포함한다.
상기 폴리뉴클레오티드는 상기 융합 단백질의 아미노산 서열을 코딩하는 뉴클레오티드 서열뿐만 아니라, 그 서열에 상보적인(complementary) 서열도 포함한다. 상기 상보적인 서열은 완벽하게 상보적인 서열뿐만 아니라, 실질적으로 상보적인 서열도 포함하며, 이는 당업계에 공지된 엄격 조건(stringent conditions) 하에서, 예를 들어, 상기 융합 단백질의 아미노산 서열을 코딩하는 뉴클레오티드 서열의 뉴클레오티드 서열과 혼성화될 수 있는 서열을 의미한다.
상기 벡터는 당업계에 공지된 다양한 방법을 통해 구축될 수 있다.
상기 벡터는 클로닝을 위한 벡터 또는 발현을 위한 벡터인 것일 수 있다. 상기 벡터는 바이러스 벡터, 플라스미드 벡터 또는 아그로박테리움 (agrobacterium) 벡터인 것일 수 있다.
상기 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 상기 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터 (예를 들면, tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pLλ프로모터, pRλ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로모터, trp 프로모터 및 T7 프로모터 등), 해독의 개시를 위한 리보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것일 수 있다. 상기 벡터가 발현을 위한 벡터이고, 진핵 세포를 숙주로 하는 경우에는, 포유동물 세포의 게놈으로부터 유래된 프로모터 (예를 들면, 메탈로티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터 (예를 들면, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터 및 HSV의 tk 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 갖을 수 있다. 한편, 상기 벡터는 당업계에서 종종 사용되는 플라스미드 (예를 들면 pSC101, ColE1, pBR322, pUC, pUC8/9, pHC79, pUC19 및 pET 등), 파지 (예를 들면 λgt4·λB, λ-Charon, λ△z1 및 M13 등) 또는 바이러스 (예를 들면 SV40 등)을 조작하여 제작될 수 있다. 상기 벡터는 CBh 프로모터, U6 프로모터, CMV 프로모터, EF-1α 프로모터 또는 이들의 조합을 포함하는 것일 수 있다.
상기 재조합 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터 (예를 들어, pL프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터 등), 해독의 개시를 위한 리보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵 세포를 숙주로 하는 경우에는, 벡터에 포함되는 진핵 세포에서 작동하는 복제원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 및 BBV 복제원점 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터 (예를 들어, 메탈로티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터 (예를 들어, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터 및 HSV의 tk프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.
상기 벡터는 항생제 저항성 유전자를 포함하는 것일 수 있다. 상기 항생제 저항성 유전자는 암피실린 저항성 유전자, 퓨로마이신 저항성 유전자, 클로람페니콜, 블라스티시딘 저항성 유전자, 또는 이들의 조합을 포함하는 것일 수 있다.
또 다른 양상은 서열번호 1 내지 5 로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열을 포함하는 가이드 RNA 및 Cas9 에디터 단백질 또는 이의 변이체; 또는 이를 암호화하는 핵산 서열을 포함하는 PDCD-1 유전자 편집용 조성물을 제공한다.
상기 가이드 RNA, 벡터, PDCD-1 단백질, 및 PDCD-1 단백질을 암호화하는 핵산 서열은 전술한 바와 같다.
상기 조성물은 상기 조성물은 시험관 내(in vitro) 또는 생체 내(in vivo) 투여용일 수 있다.
상기 조성물을 시험관 내 세포 또는 생체 내에 투여하는 경우 세포 또는 개체의 측정된 PDCD-1 유전자 또는 PDCD-1 유전자에 의해 코딩되는 단백질의 발현 또는 활성 수준보다 낮은 정도로 발현 또는 활성이 나타내거나 발현 또는 활성을 감소시킬 수 있거나 불활성화시킬 수 있도록 PDCD-1 유전자를 편집할 수 있다. 이는 시험관 내 세포 또는 투여된 개체의 PDCD-1 유전자에 의해 코딩되는 단백질의 발현 또는 활성 수준보다 낮은 정도로 발현 또는 활성이 나타내거나 발현 또는 활성이 없앨 수 있는 것을 의미한다. 즉, 세포에 있어서 상기 조성물에 의한 유전자 편집은 PDCD-1 유전자 또는 PDCD-1 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 본래 조작되지 않은 모세포의 발현 또는 활성보다 약 20% 이 상, 약 30% 이상, 약 40% 이상, 약 50% 이상, 약 55% 이상, 약 60% 이상, 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85% 이상, 약 90% 이상, 약 95% 이상, 또는 약 100% 감소시킬 수 있는 것일 수 있다.
상기 조성물은 세포의 유전체에서 PDCD-1 단백질을 암호화하는 핵산 서열이 변경됨으로써 PDCD-1 단백질의 기능이 없어지거나 감소되는 모든 변형을 유도하도록 유전체를 편집할 수 있고, 즉 결실, 치환, 삽입, 또는 프레임 시프트 돌연변이를 유도하여 PDCD-1 유전자를 효과적으로 제거(knockout)할 수 있다.
상기 세포는 암세포, 줄기세포, 혈관내피 세포, 백혈구, 면역 세포, 상피 세포, 생식 세포, 섬유아세포, 근육세포, 골수 세포, 표피 세포, 골아세포 및 신경세포로 이루어진 군으로부터 선택될 수 있다.
PDCD-1 유전자 또는 PDCD-1 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소된 유전적으로 조작 또는 편집된 세포는 당업계에 공지된 임의의 방법을 사용하여 확인될 수 있다. 용어 "불활성화 (inactivation)"는 전혀 발현이 되지 않는 유전자 또는 발현이 되더라도 그 활성이 없는 단백질이 생성되는 것을 의미할 수 있다. 용어 "감소 (depression)"는 PDCD-1 유전자가 조작되지 않은 세포에 비하여 낮은 수준으로 발현되거나, 또는 PDCD-1 유전자에 의해 코딩되는 단백질이 발현이 되더라도 그 활성이 낮거나 활성이 제거된 것을 의미할 수 있다.
상기 "제거"는 세포의 유전체에서 PDCD-1 단백질을 암호화하는 핵산 서열이 변경됨으로써 PDCD-1 단백질의 기능이 없어지거나 감소되는 모든 변형을 말한다. 용어 "제거"는 "돌연변이"와 상호 교환적으로 사용될 수 있다. 상기 제거 또는 돌연변이는 예를 들어 결실, 치환, 삽입, 또는 프레임 시프트 돌연변이일 수 있다.
상기 유전자 편집용 조성물은 PDCD-1 유전자에 의해 코딩되는 단백질의 발현 또는 활성이 감소시키도록 유전적으로 조작 또는 편집할 수 있어, 이를 투여한 개체의 암의 예방 및/또는 치료 용도로 사용될 수 있다.
일 양상에 따른 가이드 RNA, 이를 포함하는 벡터, 상기 가이드 RNA 및 Cas9 에디터 단백질 또는 이의 변이체를 포함하는 PDCD-1 유전자 편집용 조성물은 세포 또는 개체의 유전체에서 PDCD-1 유전자를 효과적으로 제거(knockout)할 수 있고, 이를 통해 맞춤의료 또는 정밀의료로서 암을 예방 또는 치료하는데 유용하게 사용될 수 있다.
도 1은 Cas 9 또는 이의 변이체를 암호화하는 핵산서열을 포함하는 플라스미드인 pcDNA 3.1 플라스미드를 나타낸 도이다.
도 2는 실시예에서 사용한 spCas9 유전자 편집체 에디터 단백질(HypaCas9, SpCas9-HP1, evoCas9 및 eSpCas9(1.1))의 변이체의 벡터맵을 간단히 모식화하여 나타낸 도이다.
도 3A는 실험에 사용한 가이드 RNA를 포함한 플라스미드를 나타낸 도이며, 도 3B는 spCas9 유전자 편집체 에디터 단백질과 가이드 RNA를 All-in-One 백터 시스템으로 변환한 경우의 벡터맵을 나타낸 도이다(이 경우 도 3A의 U6 promoter-guide RNA-scaffold sequence 부분을 Cas9 plasmid의 CMV/EF-1α promoter 앞부분에 삽입하여 구성된다).
도 4는 HEK293T 세포에 PDCD-1 가이드 RNA를 암호화하는 플라스미드를 형질주입(transfection)시키고, 발현 정도를 eGFP(enhanced Green Fluorescent Protein) 형광을 통해 확인한 도이다.
도 5는 PDCD-1 가이드 2(서열번호 2)와 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 SpCas9-HF1, evoCas9 및 eSpCas9로의 유전자 편집을 확인하고, 메인 패턴을 나타낸 도이다.
도 6은 PDCD-1 가이드 2와 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 SpCas9-HF1, evoCas9 및 eSpCas9로의 유전자 편집을 확인하고, 서브 패턴을 나타낸 도이다.
도 7은 PDCD-1 가이드 4(서열번호 4)와 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 HypaCas9 및 eSpCas9로의 유전자 편집 패턴을 확인하고, 메인 패턴을 나타낸 도이다.
도 8은 PDCD-1 가이드 4와 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 HypaCas9 및 eSpCas9로의 유전자 편집 패턴을 확인하고, 서브 패턴을 나타낸 도이다.
도 9는 PDCD-1 가이드 5(서열번호 5)와 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 SpCas9-HF1 및 eSpCas9로의 유전자 편집 패턴을 확인한 도이다.
이하 일 양상을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 일 양상을 예시적으로 설명하기 위한 것으로 일 양상의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니며, 일 양상의 실시예 및 실험예는 당업계에서 평균적인 지식을 가진 자에게 일 양상을 보다 완전하게 설명하기 위해서 제공되는 것이다.
실시예 1: High-fidelity CRISPR/Cas9 플라스미드 클로닝
정확성을 높인 High-fidelity Cas9 변이체 4종 HypaCas9, SpCas9-HP1, evoCas9, eSpCas9(1.1)(연세대학교 의과대학 김형범 교수 연구실)을 pcDNA 3.1 벡터(Thermofisher)에 클로닝하였다. 상기 High-fidelity Cas9 변이체는 DNA-RNA 이형이중가닥(heteroduplex)와 상호작용하여 표적 부위에 결합하는 REC3 도메인을 변형시키거나, 상보적인 DNA 가닥을 절단하는 HNH 도메인 또는 비상보적인 DNA 가닥을 절단하여 DNA 이중가닥 절단(double-strand breaks, DSBs)을 생성하는 RuvC ²도메인을 변형시켜, 표적 효율성(on-target efficiency)을 유지하면서 표적이탈(off-target effect) 확률을 낮춘 Cas9 변이체를 사용하였다.
HEK293T에서 빠르게 가이드 RNA의 효율을 확인하기 위하여 CMV 프로모터를 사용하였다. CMV는 가장 널리 사용되고 있는 프로모터로 대부분의 세포주(cell line)에서 강한 발현을 보이며, pcDNA3.1 플라스미드에 기본적으로 CMV가 구성되어 있어, 프로모터로는 상기 Cas9 변이체에 작동가능하게 연결된 CMV 프로모터 또는 EF-1α 프로모터를 사용하였다. 또한, P2A보다 IRES가 더 안정적이기 때문에 Cas9과 EGFP사이에 IRES sequence를 활용하여, Cas9-IRES-eGFP의 형태로 발현되도록 벡터를 구성하였다. 구체적으로 사용한 IRES-eGFP 발현 벡터의 모식도를 도 1에 나타내었고, Cas9 변이체 4종 HypaCas9, SpCas9-HP1, evoCas9, eSpCas9(1.1)의 벡터맵을 도 2에 각각 나타내었다.
실시예 2: 가이드 RNA 플라스미드 클로닝
2-1: 가이드 RNA 설계
PDCD-1 유전자를 표적으로 하는 5종의 가이드 RNA를 합성하였다. 인간 PDCD-1 유전자 isoform 1의 엑손 2 및 isoform 2의 엑손 1의 공통된 부분을 가이드 RNA의 표적 후보로 선정하여 PDCD-1의 두가지 isoform을 모두 넉아웃(knockout)할 수 있는 가이드 RNA를 설계하였다. 상기 5종 가이드 RNA 후보 서열의 위치 및 서열을 하기 표 1에 나타내었다.
PDCD-1 위치 표적 후보 서열 (5'-3') 서열번호
Guide1 151:180 CAAGCTGGCCGCCTTCCCCG 1
Guide2 280:309 GGAGATGGCCCCACAGAGGT 2
Guide3 269:298 GACAGCGGCACCTACCTCTG 3
Guide4 316:345 GCAGATCAAAGAGAGCCTGC 4
Guide5 127:156 CATGAGCCCCAGCAACCAGA 5
2-2: 가이드 RNA 플라스미드 클로닝
실시예 2-1에서 설계한 가이드 RNA를 발현하는 플라스미드로 GX19 벡터를 이용하였다. 프로모터로는 U6 프로모터를 사용하였고, Cas9와 결합하는 가이드 RNA 스캐폴드 서열을 삽입하고 U6 프로모터 및 상기 스캐폴드 서열 사이에 20 bp 크기의 가이드 RNA 표적 서열이 위치하도록 하였다. 상기 표 1의 올리고뉴클레오티드 서열을 각각 합성하고, 정방향/역방향 프라이머, T4 폴리뉴클레오티드 키나아제 및 NEB 어닐링(annealing) 버퍼를 이용하여 어닐링하였다. 어닐링 조건은 95℃에서 5분, 이어서 25℃로 램핑(ramping)하는 단계(초당 0.1℃)로 설정하였다. 어닐링된 올리고뉴클레오티드를 T4 리가아제를 이용하여 Bsa Ⅰ제한효소로 절단된 GX19 벡터에 라이게이션하였다. 이러한 가이드 RNA 플라스미드를 도 3A에, 플라스미드 벡터 맵을 모식화하여 도 3B에 나타내었다.
실시예 3: PDCD-1 가이드 RNA의 세포 내 도입
설계한 가이드 RNA의 효율을 측정하기 위한 실험을 수행하였다. 인간 배아 신장 세포주인 HEK293T 세포를 PDCD-1 가이드 RNA를 암호화하는 플라스미드로 형질주입(transfection)시키고, 발현 정도를 eGFP(enhanced Green Fluorescent Protein) 형광을 통해 확인하였다. 구체적으로, Neon 형질주입 시스템(Thermofisher)을 이용하여 1300 v, 20 ms, 1 pulse 조건으로 5 x 106 개의 HEK293T 세포에 Cas9 플라스미드 3μg, 가이드 RNA 플라스미드 1μg(Cas9과 가이드의 비율은 3:1) 및 형질주입된 HEK293T 세포만을 선택하기 위한 퓨로마이신 플라스미드 400ng을 첨가하여 HEK293T 세포를 형질주입시켰다. 형질주입의 효율을 측정하기 위하여, 형질주입 5일 후 eGFP 발현 정도를 확인하여 도 4에 나타내었고 이후 형질주입된 세포를 선별하였다.
도 4에서 확인한 바와 같이, HEK293T 세포가 상기 실시예 1 및 2-1에서 설계한 PDCD-1 가이드 RNA 및 high-fidelity Cas9 변이체를 발현함을 확인하고, 형질주입된 세포를 선별하였다.
실시예 4: 인델 빈도의 측정 및 최적 가이드 RNA의 선별
차세대염기서열분석(Next Generation Sequencing, NGS)을 수행하여 최적 가이드 RNA 및 사용한 Cas9 변이체를 확인하기 위한 실험을 수행하였다. 구체적으로 실시예 3에서 준비된 세포에서 유전체 중 인델(insertion/deletion, indel) 빈도를 측정하기 위해 차세대염기서열분석을 수행하였다. 인델 빈도는 하기 수학식에 따라 산출하였다.
[수학식 1]
Figure PCTKR2022004794-appb-img-000001
구체적으로 NGS는 가이드 RNA 타겟 시퀀스의 PAM(-NGG) 시퀀스의 다운 스트림 50~100bp, 총 200~250bp 시퀀싱이 가능하도록 하기와 같은 프라이머를 제작하고 이를 사용하였다.
어댑터 시퀀스(Adapter sequence) : (5'-3')
정방향 5'-CTACACGACGCTCTTCCGATCT (서열번호 6)
역방향 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (서열번호 7)
구체적으로 이후 웹 기반 NSG analyzer 알고리즘을 이용하여 NGS 결과 분석하였고, NGS 결과를 입력하여 삽입(insertion), 삭제(deletion) ratio와 사이즈, 시퀀스 정보를 비교하고, 전체 세포에서 인델로 인한 돌연변이 비율을 확인하였다.
총 5종의 가이드 RNA와 4 종의 Cas9 변이체(eSpCas9, evoCas9, HypaCas9, SpCas9-HF1)로 실험을 진행하였고, 가장 높은 인델 빈도를 보인 가이드 RNA와 Cas9 조합을 선정하기 위한 실험을 진행하였으며, NGS 분석을 통하여 가이드 RNA의 인델 빈도를 확인한 결과를 하기 표 2에 나타내었다. evoCas9을 활용한 인델빈도 확인 결과를 표 3에, HypaCas9을 활용한 인델빈도 확인 결과를 표 4에, SpCas9을 활용한 인델빈도 확인 결과를 표 5에, eSpCas9을 활용한 인델빈도 확인 결과를 표 6에 나타내었다.
PDCD1 Target Seq Background
Indel Total Indel Freq (%)
Guide1 CAAGCTGGCCGCCTTCCCCG 383 23823 1.61
Guide2 GGAGATGGCCCCACAGAGGT 0 24306 0.00
Guide3 GACAGCGGCACCTACCTCTG 0 24329 0.00
Guide4 GCAGATCAAAGAGAGCCTGC 5 24984 0.02
Guide5 CATGAGCCCCAGCAACCAGA 379 23722 1.60
evoCas9 score Indel freq (%)
Guide 2 Top 1 54.97
Guide 3 Top 2 50.80
HypaCas9 score Indel freq (%)
Guide 4 Top 1 60.27
Guide 1 Top 2 42.11
SpCas9-HF1 score Indel freq (%)
Guide 2 Top 1 62.44
Guide 5 Top 2 63.57
Guide 1 Top 3 47.45
eSpCas9 score Indel freq (%)
Guide 2 Top 1 60.13
Guide 4 Top 2 66.14
Guide 5 Top 3 61.38
상기 표 2는 타겟 부위 20bp를 포함한 200~300bp 부위를 PCR 후 NGS 분석을 통하여 야생형 서열과 비교하여 상이한 시퀀스가 확인되면 인델 빈도로 나타내었고, 이는 CRIPSR/Cas9에 의한 인델 빈도가 아닌 PCR 오류 등으로 인하여 생기는 오차인 것으로 확인되었다. 이에, 상기 표 2는 실제 실험 데이터가 아닌 실제 데이터인 표 3 내지 표 6에서 오차를 제외시켜 주기 위한 데이터로서, 표 2의 인델 빈도는 오차범위를 나타내는 결과인 것을 확인하였다.
또한 상기 표 3 내지 6에서 확인한 바와 같이, PDCD-1 가이드 2(서열번호 2)와 Cas9 변이체 evoCas9, SpCas9-HF1 및 eSpCas9의 조합을 사용하는 경우 인델 빈도가 높은 것을 확인할 수 있었다. 아울러 PDCD-1 가이드 4(서열번호 4)와 Cas9 변이체 HypaCas9에서 인델 빈도가 가장 높았으며, PDCD-1 가이드 4(서열번호 4)와 eSpCas9(1.1)의 조합 역시도 인델 빈도가 높게 나타남을 확인하였다. 또한 PDCD-1 가이드 5(서열번호 5)와 SpCas9-HF1 및 eSpCas9의 조합을 사용하는 경우 각각의 인델 빈도가 60%를 넘어서는 것을 확인하여 높게 나타나는 것을 확인하였다.
실시예 5: 선별된 가이드 RNA을 통한 유전자 편집 효율과 유전자 편집 패턴의 확인
PDCD-1에 대한 가이드 RNA의 유전자 편집 효율과 이의 유전자 편집이 일어나는 경우 이의 메인 편집패턴이 있는지를 상기 실시예 4의 방법으로 확인하는 실험을 수행하였다. 구체적으로 PDCD-1에 대한 가이드 RNA 5종 중에서 PDCD-1 가이드 2, 4 및 5가 인델 빈도가 높은 것을 확인하였으므로 이들 3종을 가이드 RNA로 선별하고 이의 유전자 편집 효율과 함께 이들의 유전자 편집 패턴을 확인하는 실험을 수행하였다.
가이드 RNA 간 인델 빈도를 분석하여, 각각 evoCas9 및 HypaCas9 Cas9 변이체는 인델빈도가 가장 높은 가이드 2종을 확인하였고, SpCas9-HF1 및 eSpCas9는 인델빈도가 가장 높은 가이드 3종의 인델 빈도를 확인하였고, 이의 결과를 차례대로 표 7 내지 표 10에 나타내었다.
evoCas9 score Indel freq (%)
Guide 2 Top 1 39.0
Guide 3 Top 2 37.0
HypaCas9 Score Indel freq (%)
Guide 4 Top 1 53.6
Guide 1 Top 2 39.8
SpCas9-HF1 score Indel freq (%)
Guide 2 Top 1 51.3
Guide 5 Top 2 57.9
Guide 1 Top 3 45.3
eSpCas9 score Indel freq (%)
Guide 2 Top 1 46.9
Guide 4 Top 2 58.1
Guide 5 Top 3 56.0
아울러, 상기 가이드 RNA로 확인한 유전자 편집 중에서 가장 메인으로 나타나는 패턴을 확인하였고, 이를 확인한 결과를 evoCas9 및 HypaCas9 Cas9 변이체의 결과를 각각 표 11 및 12에 나타내었고, SpCas9-HF1 및 eSpCas9는 차례대로 표 13 내지 표 14에 나타내었다.
evoCas9 Of total indel freq (%) Of total insertion freq (%)
Guide 2 28 65
Guide 3 31 62
HypaCas9 Of total indel freq (%) Of total insertion freq (%)
Guide 4 26 68
Guide 1 28 75
SpCas9-HF1 Of total indel freq (%) Of total insertion freq (%)
Guide 2 34 66
Guide 5 26 76
Guide 1 31 76
eSpCas9 Of total indel freq (%) Of total insertion freq (%)
Guide 2 31 67
Guide 4 18 58
Guide 5 29 75
이중, 가이드 2, 4 및 5의 유전자 편집 패턴을 확인하는 실험을 수행하였다. 먼저 PDCD-1 가이드 2번과 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 SpCas9-HF1, evoCas9 및 eSpCas9로의 유전자 편집 패턴을 확인하였고, 메인 패턴으로 확인된 결과를 도 5에, 서브 패턴으로 확인된 결과를 도 6에 나타내었다.
도 5에 나타난 유전자 편집 패턴으로서 SpCas9-HF1와 PDCD-1 가이드 2에서 확인된 총 인델빈도 중 34% 및 총 삽입 빈도의 66%가 도 5와 같이 나타났으며, 또한 evoCas9-HF1와 PDCD-1 가이드 2의 총 인델빈도 중 28%, 총 삽입 빈도 중 65%가 도 5와 같이 나타난 것으로 확인되었다. 또한 eSpCas9와 PDCD-1 가이드 2로 유도된 유전자 편집 중 총 인델빈도의 31%, 총 삽입 빈도의 67%가 도 5와 같이 나타나는 것을 확인하였다. 따라서, 이를 종합해보면 PDCD-1 가이드 2의 유전자 편집은 수치 상으로도 결실(deletion)도 다수 나타나면서 이의 패턴도 다양한 것으로 나타났으나, 가장 주된 패턴은 삽입으로서 Cas9 종류에 상관없이 PDCD-1 가이드 2의 경우에 TACCTCTGTG 시퀀스 사이에 TACCTTCTGTG로 T 1bp 삽입 패턴이 가장 많이 나타나는 것을 확인하였다.
도 6에서 확인한 바와 같이, 서브 패턴은 Cas9 변이체 종류에 상관없이 PDCD-1 가이드 2의 경우에는 TACCTCTGTGGGGCCA 시퀀스에서 CCTCTGTGGGG 11bp 결실 패턴이 가장 많이 나타나는 것을 확인하였다.
또한 PDCD-1 가이드 4번과 상기 PDCD-1 가이드 RNA와 인델효율이 높은 것으로 확인된 HypaCas9 및 eSpCas9로의 유전자 편집 패턴을 확인하였고, 메인 패턴으로 확인된 결과를 도 7에, 서브 패턴으로 확인된 결과를 도 8에 나타내었다.
도 7에 나타난 유전자 편집 패턴으로서 HypaCas9와 PDCD-1 가이드 4에서 확인된 총 인델빈도 중 26%, 총 삽입 빈도의 68%가 도 7과 같이 나타났고, 또한 eSpCas9와 PDCD-1 가이드 4의 총 인델 빈도 중 18%, 총 삽입 빈도 중 58% 가 도 7와 같이 나타난 것으로 확인되었다. 이에 메인 패턴은 삽입이 가장 많았으며, Cas9 종류에 상관없이 PDCD-1 가이드 4의 경우에는 AGAGAGCCTGCG 시퀀스 사이에 AGAGAGCCCTGCG로 C 삽입 패턴이 가장 많이 나타나는 것을 확인하였다. 도 8에서 확인한 바와 같이, PDCD-1 가이드 4의 서브 패턴은 GAGAGCCTGCGGGCA 시퀀스에서 GCCTGCGG 8bp 결실 패턴이 가장 많았고, 그 다음으로는 GCCT 4bp 결실, AGAGCCTGCGGGC 13bp 결실 패턴이 많은 것으로 확인되었다.
또한 PDCD-1 가이드 5와 상기 가이드 RNA와 인델효율이 높은 것으로 확인된 SpCas9-HF1 및 eSpCas9로의 유전자 편집 패턴을 확인하였고, 이의 결과를 도 9에 나타내었다.
도 9에 나타난 유전자 편집 패턴으로서 SpCas9-HF1와 PDCD-1 가이드 5에서 확인된 총 인델빈도 중 26%, 총 삽입 빈도 중 76%가 도 9와 같이 나타나는 것을 확인하였다. 이에, 메인 패턴은 삽입이 많았고, 메인 패턴 이외에 서브패턴이 적은 빈도로 다양하게 나타나는 것을 확인하였다. 종합적으로, Cas9 변이체 종류에 상관없이 PDCD-1 가이드 5의 경우는 CAGCAACCAGACG 시퀀스 사이에 CAGCAACCCAGACG로 C 삽입 패턴이 가장 많이 나타나는 것을 확인하였다.
종합하여, 표 11 내지 표 14에서 확인한 바와 같이, NGS 결과 분석을 통하여 확인한 결과 PDCD-1 가이드 2가 총 인델 빈도에서 메인 패턴의 비율이 가장 높게 나타난 것을 확인하였고, 총 삽입 빈도에서는 PDCD-1 가이드 5의 메인 삽입 패턴이 이 가장 높게 나타나는 것을 확인하였다. PDCD-1 가이드 1 및 PDCD-1 가이드 5번이 가이드 4에 비해 총 삽입 빈도에서 더 높은 메인 패턴이 나타나는 것을 확인하였다. 이에 PDCD-1 가이드 RNA는 대부분의 가이드 RNA에서 1bp 삽입이 메인으로 확인되는 것을 확인하였다. 구체적인 수치상으로는 결실의 경우 높게 보이지만 여러 패턴이 포함되어 있어서 메인 패턴끼리 비교할 경우 1bp 삽입이 가장 많이 발생되는 것으로 확인하였다.
최종적으로 PDCD-1 가이드 2는 evoCas9, SpCas9-HF1 Cas9 변이체와의 조합에서 가이드에 의하여 유도된 인델이 가장 높은 빈도로 나타났고, PDCD-1 가이드 4는 HypaCas9, eSpCas9과의 조합에서 가장 높게 가이드에 의하여 유도된 인델이 가장 높은 빈도로 나타난 것을 확인하였다.
전술한 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (10)

  1. 서열번호 1 내지 5로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열을 포함하는 가이드 RNA.
  2. 청구항 1에 있어서, 상기 상보적인 핵산 서열은 선택된 1종의 폴리뉴클레오티드가 전사된 폴리뉴클레오티드인 것인 가이드 RNA.
  3. 청구항 1에 있어서, 상기 가이드 RNA는 PDCD-1 유전자와 혼성화하는 것인 가이드 RNA.
  4. 청구항 1에 있어서, 상기 가이드 RNA는 PDCD-1 유전자의 엑손 1 내지 2로 이루어진 부위에서 적어도 하나의 부위에 결합되는 것인 가이드 RNA.
  5. 청구항 1에 있어서, 상기 가이드 RNA는 PDCD-1 유전자의 핵산 서열 내 변형을 유도하는 것인 가이드 RNA.
  6. 청구항 5에 있어서, 상기 핵산 서열 내 변형은
    1) PDCD-1 유전자의 전부 또는 연속하는 1bp 내지 15bp의 염기서열 부위의 결실,
    2) PDCD-1 유전자의 1 내지 15개의 뉴클레오티드의 야생형 유전자와 상이한 뉴클레오티드로의 치환,
    3) 각각 독립적으로 A, T, C 및 G 중에서 선택된 1 내지 15개의 뉴클레오티드의 PDCD-1 로의 삽입, 또는
    4) 상기 1) 내지 3) 중에서 선택된 2 가지 이상의 조합
    에 의한 것인 가이드 RNA.
  7. 서열번호 1 내지 5로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열; 및
    Cas9 에디터 단백질 또는 이의 변이체; 또는 이를 암호화하는 핵산 서열을 포함하는 CRISPR/Cas9 시스템.
  8. 청구항 7에 있어서, 상기 Cas9 에디터 단백질의 변이체는 HypaCas9, SpCas9, evoCas9, eSpCas9, Sniper-Cas9, SpCas9-HF1 및 xCas9로 이루어진 군으로부터 선택되는 하나 이상인 것인 CRISPR/Cas9 시스템.
  9. 서열번호 1 내지 5로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열; 및
    Cas9 에디터 단백질 또는 이의 변이체; 또는 이를 암호화하는 핵산 서열을 포함하는 재조합 벡터.
  10. 서열번호 1 내지 5로 이루어진 군으로부터 선택된 1종의 폴리뉴클레오티드와 동일하거나 이와 상보적인 핵산 서열을 포함하는 가이드 RNA 및 Cas9 에디터 단백질 또는 이의 변이체; 또는 이를 암호화하는 핵산 서열을 포함하는 PDCD-1 유전자 편집용 조성물.
PCT/KR2022/004794 2021-04-05 2022-04-04 Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도 WO2022215978A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210044310 2021-04-05
KR10-2021-0044310 2021-04-05
KR1020220041231A KR20220138340A (ko) 2021-04-05 2022-04-01 Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도
KR10-2022-0041231 2022-04-01

Publications (1)

Publication Number Publication Date
WO2022215978A1 true WO2022215978A1 (ko) 2022-10-13

Family

ID=83545593

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004794 WO2022215978A1 (ko) 2021-04-05 2022-04-04 Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2022215978A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3309248A1 (en) * 2013-05-29 2018-04-18 Cellectis Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system
EP3634496A2 (en) * 2017-06-06 2020-04-15 Dana-Farber Cancer Institute, Inc. Methods for sensitizing cancer cells to t cell-mediated killing by modulating molecular pathways
WO2020150534A2 (en) * 2019-01-16 2020-07-23 Beam Therapeutics Inc. Modified immune cells having enhanced anti-neoplasia activity and immunosuppression resistance
WO2020176740A1 (en) * 2018-02-27 2020-09-03 Sorrento Therapeutics, Inc. Improved process for dna integration using rna-guided endonucleases
KR20210008502A (ko) * 2018-05-11 2021-01-22 크리스퍼 테라퓨틱스 아게 암을 치료하기 위한 방법 및 조성물

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3309248A1 (en) * 2013-05-29 2018-04-18 Cellectis Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system
EP3634496A2 (en) * 2017-06-06 2020-04-15 Dana-Farber Cancer Institute, Inc. Methods for sensitizing cancer cells to t cell-mediated killing by modulating molecular pathways
WO2020176740A1 (en) * 2018-02-27 2020-09-03 Sorrento Therapeutics, Inc. Improved process for dna integration using rna-guided endonucleases
KR20210008502A (ko) * 2018-05-11 2021-01-22 크리스퍼 테라퓨틱스 아게 암을 치료하기 위한 방법 및 조성물
WO2020150534A2 (en) * 2019-01-16 2020-07-23 Beam Therapeutics Inc. Modified immune cells having enhanced anti-neoplasia activity and immunosuppression resistance

Similar Documents

Publication Publication Date Title
US20230304000A1 (en) Compositions and methods of improving specificity in genomic engineering using rna-guided endonucleases
Broker et al. Molecular and genetic recombination of bacteriophage T4
Huang et al. Methylation profiling of CpG islands in human breast cancer cells
Bailey et al. Primate segmental duplications: crucibles of evolution, diversity and disease
Aretz et al. Familial adenomatous polyposis: aberrant splicing due to missense or silent mutations in the APC gene
Su et al. Genomic rearrangements of the APC tumor-suppressor gene in familial adenomatous polyposis
EP4012037A1 (en) Crispr/cas9 gene editing system and application thereof
Hansen X inactivation-specific methylation of LINE-1 elements by DNMT3B: implications for the Lyon repeat hypothesis
Krug et al. Ribonuclease H activities associated with viral reverse transcriptases are endonucleases.
Gao et al. Genomic and transcriptomic analyses of prime editing guide RNA–independent off-target effects by prime editors
Traboni et al. A novel method for site‐directed mutagenesis: its application to an eukaryotic tRNAPro gene promoter.
Francastel et al. DNA methylation in satellite repeats disorders
Srikanta et al. An alternative pathway for Alu retrotransposition suggests a role in DNA double-strand break repair
EP3814510A1 (en) Microhomology mediated repair of microduplication gene mutations
Wen et al. CRISPR–Cas9 gene editing induced complex on-target outcomes in human cells
WO2022215978A1 (ko) Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도
Besselink et al. The genome-wide mutational consequences of DNA hypomethylation
WO2022215982A1 (ko) Trac 유전자에 상보적인 가이드 rna 및 이의 용도
Ando et al. Detection of 12 germ-line mutations in the adenomatous polyposis coli gene by polymerase chain reaction
JP2022504166A (ja) 調節された遺伝子編集システム
US20220251558A1 (en) Compositions and methods for disrupting the molecular mechanisms associated with mitochondrial dysfunction and neurodegenerative disease
Boehden et al. Recombination at chromosomal sequences involved in leukaemogenic rearrangements is differentially regulated by p53
KR20220138340A (ko) Pdcd-1 유전자에 상보적인 가이드 rna 및 이의 용도
US11155873B2 (en) Method for detecting variation of reference sequence in target nucleic acid region
KR20220138341A (ko) Trac 유전자에 상보적인 가이드 rna 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22784888

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22784888

Country of ref document: EP

Kind code of ref document: A1