WO2020148458A1 - Aav-mediated gene therapy restoring the otoferlin gene - Google Patents
Aav-mediated gene therapy restoring the otoferlin gene Download PDFInfo
- Publication number
- WO2020148458A1 WO2020148458A1 PCT/EP2020/051283 EP2020051283W WO2020148458A1 WO 2020148458 A1 WO2020148458 A1 WO 2020148458A1 EP 2020051283 W EP2020051283 W EP 2020051283W WO 2020148458 A1 WO2020148458 A1 WO 2020148458A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- otoferlin
- otof
- mice
- vector system
- aav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/16—Otologicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/054—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
- A01K2217/056—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to mutation of coding region of the transgene (dominant negative)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/20—Animal model comprising regulated expression system
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0306—Animal model for genetic diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14132—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14144—Chimeric viral vector comprising heterologous viral elements for production of another viral vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14171—Demonstrated in vivo effect
Definitions
- Deafness genes encode proteins with a wide range of molecular functions vital for cochlear functioning, such as development of the sensory organ, sound transduction in the stereocilia of hair cells, maintenance of the endocochlear potential (EP) and high concentration of extracellular potassium, and synaptic neurotransmission between hair cells and spiral ganglion neurons (SGNs).
- Major proteins made from deafness genes include ion channels and transporters, gap junctions and tight junctions, protein subunits in cytoskeleton and molecular motors, and transcription factors transiently expressed in cochlear development. Whether a mutation affects early cochlear development and leads to a significant cellular degeneration is a major factor in determining the“treatment time window”, which is a crucial problem in this therapeutic field.
- Prosthetic cochlear implants are currently used for rehabilitation (Krai A & O’Donoghue GM N Engl J Med 363(15):1438-1450 (2010)), but hearing recovery is far from perfect, particularly for the perception of speech in noisy environments or of music, because of their inherent limitation of frequency resolution as imposed by inter-channel electrical interference.
- a primary motivation in developing biological treatments is to restore hearing without the implantation of any prosthetic device, and to achieve sound resolution quality and unit cost that is much better than what is currently achievable with cochlear implants.
- gene therapy with local Adeno-associated virus (AAV)-mediated gene therapy has already been proposed for treating human forms of deafness (Zhang et al, Frontiers in Molecular Neuroscience, vol.1 1 , Art.221 , 2018).
- AAV2/1 vesicular glutamate transporter 3 ( Vglut3 ) cDNA into neonatal (i.e., postnatal days 1 to 12) KO mouse cochleas in order to treat a disorder of synaptic transmission of the inner hair cells.
- Vglut3 vesicular glutamate transporter 3
- KO mouse cochleas in order to treat a disorder of synaptic transmission of the inner hair cells.
- ABR auditory brainstem response
- acoustic startle reflexes they demonstrated that auditory function in injected ears recovered within 2 weeks.
- the mouse inner ear is still structurally and functionally immature at birth, and that the hearing onset takes place in this animal species at postnatal day 12 (P12) to end around postnatal day 20 (P20) (Shnerson and Willott, J. Comp. Physiol. Psychol. 94, 36-40 (1980)).
- the hearing onset and maturation occurs in a completely different timing in humans.
- the human inner ear is capable of auditory function as early as 4.5 month in utero and is ended at birth (cf. figure 6 and Hepper PG & Shahidullah BS Arch Dis Child7' ⁇ (2):F81 -87 (1994)).
- the ultimate goal for cochlear gene therapy is the treatment of common genetic deafness in humans after a potential genetically induced deafness can be detected or diagnosed i.e., most of the time, after their birth.
- gene therapy approaches should therefore be tested and efficient in reversing established deafness phenotype affecting mature auditory systems, for example when administered to mice at postnatal days > P20 (corresponding to young or adult humans).
- the present inventors have developed alternative studies in order to identify treatments that have a realistic chance to efficiently prevent or reverse hearing loss in a subject, especially a human, in which the auditory system, especially the cochlea, is mature, yet without involving embryonic gene delivery. In this context, they have been able to demonstrate that the recombinant expression of the Otoferlin protein in inner hair cells is able to restore the audition in model mice treated at postnatal days > P20 (corresponding to young or adult humans).
- Otoferlin is abundantly expressed in sensory inner hair cells (IHCs) of the cochlea. It is also expressed in other cells of the central nervous system. It plays a key role in the final steps of synaptic vesicle fusion at cochlear hair cell synapses with afferent spiral ganglion neurons. More precisely, it is important for exocytosis at the auditory ribbon synapse (Roux et al, Cell 127(2):277- 89, 2006).
- IHCs sensory inner hair cells
- Otoferlin gene mutations affecting the Otoferlin gene
- OTOF gene mutations affecting the Otoferlin gene
- Some of them also lead to a temperature-sensitive nonsyndromic auditory neuropathy, that is triggered when the body temperature increases importantly (for example in case of fever, see Marlin S. et al, Biochemical and Biophysical Research Communications, 394 (2010) 737-742 and Varga R. et al, J. Med. Genet 2006; 43:576-581).
- At least 60 mutations have been identified so far (cf.
- thermosensitive P.Q994VfsX6, P.I515T, p.G541 S, PR1607W, p.E1804del as described in Pangrsic T. et al, Trends in Neurosciences,
- DFNB9 deafness accounts for up to 8% of autosomal recessive non-syndromic hearing loss in some Western populations, thereby residing within the top five of genetic hearing disorders that still require a therapeutic intervention.
- the present inventors report here, in the DFNB9 mouse model (OTOF knock-out mice), the first proof-of-principle that cochlear delivery of a fragmented cDNA via a dual-AAV vector approach can effectively and long-lastingly correct the profound deafness phenotype of these mice when administered well after their auditory system has matured (P30). This result suggests that the therapeutic window for local gene transfer in patients with congenital deafness due to DFNB9 is in fact longer than initially suspected.
- the administration of the vectors of the invention each providing a portion of the OTOF gene and enabling for the expression of the full-length OTOF protein in the transfected inner hair cells of OTOF knock-out mice at late postnatal days (P30), lead to better results than when younger mice were treated.
- mice affected by genetic deafness was embryonic or in early post-natal days (Ahmed et al, JARO 18:649-670 (2017); Zhang et al, Frontiers in Molecular Neuroscience, vol.1 1 , Art.221 , 2018). It is known that, in mice, the full range of responsive frequencies can be observed by P14 (i.e., fourteen days after birth). Response latencies and interpeak intervals matured rapidly over the course of the second and third postnatal weeks and achieve adultlike characteristics at P18 (Song L. et al, J Acoust Soc Am 1 19(4):2242-2257 (2006)). At P30, the auditory system of the mice is therefore completely matured. It corresponds to the auditory system of an infant or adult human (see figure 6).
- the present invention relates to a vector system that allows the expression of the full-length Otoferlin polypeptide, or a functional fragment thereof, in inner hair cells, for use to treat patients suffering from DFNB9 deafness, wherein said patients are preferably toddlers, infants, teenagers or adult humans.
- Otoferlin designates the Otoferlin polypeptide. It is herein abbreviated as OTOF”. This polypeptide is also known as“AUNB1”;“DFNB6”; “DFNB9”; “NSRD9” and
- the full-length of the isoform 1 of the wild-type human Otoferlin polypeptide is presented in SEQ ID NO:1 (corresponding to Genbank number AF183185.1).
- This polypeptide is a member of the Ferlin family of transmembrane proteins, which has C2 domains as synaptotagmins, PKC and PLC. This long form contains six C2 domains. As mentioned above, it is involved in synaptic vesicle fusion between cochlear hair cell and afferent spiral ganglion neurons (Roux et al, Cell 127(2):277-89, 2006; Michalski et al, Elife, 2017 Nov 7;6 e31013).
- Otoferlin polypeptide designates the Otoferlin polypeptide of SEQ ID NO:1 and homologous sequences thereof, that retain at least one biological function of the Otoferlin polypeptide that is of interest in the present context.
- this biological function is related to the modulation of vesicles fusion at the cochlear inner hair cell ribbon synapses that activate the primary auditory neurons (Roux et al 2006; Michalski et al, Elife, 2017 Nov 7;6 e3l0l3). This modulation could be assessed with classical ex vivo electrophysiological measures.
- the vector system of the invention allows for the expression of a homologous polypeptide whose amino acid sequence shares at least 70% identity and/or similarity with SEQ ID NO:1.
- Said homologous sequence more preferably shares at least 75%, and even more preferably at least 80%, or at least 90% identity and/or similarity with SEQ ID NO:1.
- Said homologous polypeptide can have for example the amino acid sequence presented in SEQ ID NO:5 (corresponding to Genbank number NP_001274418). Said sequence characterises the isoform e (variant 5) of the wild-type human Otoferlin polypeptide.
- This isoform e is encoded by the cDNA variant having the sequence SEQ ID NO:22.
- This variant lacks an alternate in-frame exon in the 3' coding region and uses a downstream stop codon compared to SEQ ID NO:1 . It encodes a distinct C-terminus as compared to SEQ ID NO:1 (but its N-terminal part is the same).
- Said homologous polypeptide can also have the amino acid sequence presented in SEQ ID NO:6 (corresponding to Genbank number NP_004793.2) or the amino acid presented in SEQ ID NO:24 (corresponding to Genbank number NP_919303.1) corresponding to the short isoforms b and c (variants 2 and 3) respectively. More precisely, SEQ ID NO:6 represents the isoform b (variant 2, also called 'short form T) which has a shorter N-terminus and lacks a segment compared to SEQ ID NO:1 .
- SEQ ID NO:24 represents the isoform c (variant 3, also called“short form 2”), which differs in the 5' UTR and coding sequence compared to variant 1 (SEQ ID NO:1) because it has a shorter and distinct C-terminus compared to SEQ ID NO:1 .
- Said homologous sequence can also be for example the Otoferlin polypeptide of another animal species, such as SEQ ID NO:7 which is the mouse full-length isoform 1 of the Otoferlin polypeptide (corresponding to Genbank number NP_001093865.1). This isoform is encoded by the cDNA of SEQ ID NO:16 (NM_1 100395).
- sequence comparisons between two amino acid sequences or two nucleotide sequences can be performed for example by using any software known by the skilled person, such as the“needle” software using the“Gap open” parameter of 10, the“Gap extend” parameter of 0.5 and the“Blosum 62” matrix.
- the invention provides systems encoding homologous amino acid sequences that are“similar” to SEQ ID NO:1 or SEQ ID NO:5 or SEQ ID NO: 6 or SEQ ID NO:24.“Similarity” of two targeted amino acid sequences can be determined by calculating a similarity score for the two amino acid sequences.
- the “similarity score” refers to the score generated for the two sequences using the BLOSUM62 amino acid substitution matrix, a gap existence penalty of 1 1 , and a gap extension penalty of 1 , when the two sequences are optimally aligned.
- Two sequences are“optimally aligned” when they are aligned so as to produce the maximum possible score for that pair of sequences, which might require the introduction of gaps in one or both of the sequences to achieve that maximum score.
- Two amino acid sequences are substantially similar if their similarity score exceeds a certain threshold value.
- the threshold value can be any integer ranging from at least 1 190 to the highest possible score for a particular reference sequence (e.g.,
- the threshold similarity score can be 1 190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, 1500, or higher.
- the threshold score is set at, for example, 1300
- the reference sequence is SEQ ID NO:1
- any amino acid sequence that can be optimally aligned with SEQ ID NO:1 to generate a similarity score of greater than 1300 is“similar” to SEQ ID NO:1 .
- Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well-known in the art and described, e.g., in Dayhoff et al. (1978),“A model of evolutionary change in proteins”, “Atlas of Protein Sequence and Structure,” Vol. 5, Suppl. 3 (ed. M. O. Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, D.C. and in Henikoff et al. (1992)
- the vector system of the invention can allow for the expression of a functional fragment of the Otoferlin polypeptide.
- the term “functional fragment” herein designates any fragment of the human Otoferlin polypeptide or any fragment of a polypeptide having a homologous sequence as defined above, wherein said fragment retains at least one biological function of the Otoferlin polypeptide that is of interest in the present context.
- this biological function is related to the modulation of vesicles fusion at the cochlear inner hair cell ribbon synapses that activate the primary auditory neurons (Roux et al 2006; Michalski et al, Elife, 2017 Nov 7;6 e31013). This modulation could be assessed with classical ex vivo electrophysiological measures.
- said functional fragment can have the amino acid sequence presented in SEQ ID NO:6 (corresponding to isoform b having a Genbank number NP_004793.2) or in SEQ ID NO:24 (corresponding to isoform c having a Genbank number NP_919303.1). Said sequences characterise short isoforms of the wild-type human Otoferlin polypeptide, comprising only three C2 domains.
- the vector system of the invention is administered to patients suffering from DFNB9 deafness.
- patients suffering from DFNB9 deafness it is herein meant a patient, especially a human patient, that is thought to have (or has been diagnosed to have) a mutation in the constitutive Otoferlin gene, said mutation triggering an abnormal expression, function or both, of the Otoferlin protein.
- said mutation can be thermosensitive. To date, more than 60 pathogenic mutations have been reported in otoferlin (see Figure 7).
- thermosensitive mutations identified in patients affected by episodic deafness conditioned by fever (P.Q994VfsX6, P.I515T, p.G541 S, PR1607W, p.E1804del).
- the patient has one or more of the following nonsense or missense mutations in the OTOF gene: TYR730TER, GLN829TER, PR01825ALA, PRO50ARG, LEU101 1 PRO, ILE515THR, ARG1939GLN,or GLY541 SER.
- the patient has an A-to-G transition at the intron 8/exon 9 junction (IVS8-2A- G) or a G-to-A transition at position +1 , the first intronic nucleotide in the splice donor site of exon 5 or a G-C transversion in the donor splice site of intron 39.
- the patient has a one base pair deletion (1778G) in exon 16, leading to a stop codon, and a 6141 G-A change, resulting in an ARG-to-GLN substitution in exon 48.
- the patients to which the vector system of the invention is administered are patients, especially human patients, in which the auditory system, especially the cochlea, is already developed and mature. These patients, especially human patients, are therefore not human embryos or foetuses, because the administration is not intended to be performed in utero.
- the patients targeted by the present invention are preferably new born human babies, typically younger than 6 months old, or even younger than 3 months old, if DFNB9 deafness is diagnosed that young. These human babies are more preferably between 3 months and 1 year.
- the human cochlea as a whole attains an adult size between 17 and 19 weeks’ gestation and is fully morphologically mature at 30-36 weeks (corresponding to 12 days after birth in the mouse).
- the functional maturation of the inner hair cell ribbon synapse can be evaluated by monitoring the wave I of the ABR recording, that can be recorded at about the 28th week of gestation in humans. Recordings and analyses of the ABR wave I (reflecting the function of the inner hair cell synapses with the primary auditory neurons) have shown a complete functional maturation in human babies at birth (corresponding to 20 days after birth in the mouse). This is well known in the art (see for example Pujol et Lavigne-Rebillard, Acta oto-laryngologica. Supplementum February 1991 ).
- the patients of the invention are in particular human infants diagnosed as being affected by DFNB9 deafness after language acquisition.
- the patients of the invention are human beings that are 6 years and older, i.e. , the administration of the treatment occurs when their Central Nervous System is completely mature (cf. figure 7).
- the vector system of the invention is administered to human patients suffering from DFNB9 deafness induced by thermosensitive mutations, preferably to teenagers or adult humans carrying at least one of the Otoferline thermosensitive mutations mentioned above.
- the term "treating” is intended to mean the administration of a therapeutically effective amount of one of the vector system of the invention to a patient suffering from DFNB9 deafness, in order to restore partially or completely the hearing in said patient. Said recovery can be assessed by testing the auditory brain stem responses (ABRs) with electrophysiologic devices. “Treatment of the DFNB9 deafness” is in particular intended to designate the complete restoration of hearing function regardless of the cellular mechanisms involved.
- the vector system of the invention can also be administered to prevent the loss of hearing induced from the body temperature modulation.
- the term "preventing" designates impairing or delaying the loss of hearing within audible frequency range.
- the vector system of the invention can be administered both for preventing the loss of hearing before it occurs, and for restoring the hearing capacity when hearing loss has already occurred.
- the cochlea is highly compartmentalized and separated from the rest of the body by the blood- cochlear barrier (BCB), which minimizes the therapeutic injection volume and leakage into the body’s general circulation system, to protect cochlear immune privilege and reduce the chance of systemic adverse immune responses.
- BCB blood- cochlear barrier
- the hair cells and supporting cells in the cochlea normally do not divide, the cells in the cochlea remain stable, therefore making it possible to use nonintegrating viral vectors (e.g., AAV) for sustained transgene expression.
- the vector system of the invention is administered in human ear via one of the two common and well-established techniques that are routinely used in clinical otologic surgical practice. More precisely, these approaches will be adopted to target the perilymphatic spaces. To this end, the injections using a micro-catheter will be carried out either through the oval window using laser stapedotomy (trans-stapes) or transmastoid / trans-round window (Dai C. et al, JARO, 18:601 -617, 2017).
- trans-stapes laser stapedotomy
- transmastoid / trans-round window Dai C. et al, JARO, 18:601 -617, 2017.
- the vector system of the invention contains at least one polynucleotide vector that can trigger the expression of the full-length Otoferlin polypeptide, or a functional fragment thereof, in inner hair cells.
- said polynucleotide vector contains a coding sequence encoding said polypeptide, or a functional fragment thereof, which is operatively linked with a promoter that enables the expression of the gene in said cells specifically.
- Said coding sequence can also be the shorter cDNA sequence NM_001287489.1 (isoform e or variant 5) of SEQ ID NO:22, the cDNA sequence NM_004802.3 (isoform b or variant 2), the cDNA sequence NM_194322.2 (isoform c or variant 3), or the cDNA sequence NM_194323.2 (isoform d or variant 4).
- a number of viral and nonviral vectors have been developed for delivery of genetic material in various tissues and organs. In most cases, these vectors are replication incompetent and pose little threat of viral-induced disease. Rather, the viral genome has been partly or fully deleted, expanding the capacity to allow inclusion of therapeutic DNA cargo within the viral capsid. Some vectors include single-stranded DNA, while others include double-stranded DNA. Particularly preferred vectors in the context of the invention are lentiviral vectors, adenovirus vectors, Adeno- associated viruses (AAV) as disclosed in Ahmed et al, JARO 18:649-670 (2017). Specifically, AAVs are small replication-deficient adenovirus-dependent viruses from the Parvoviridae family.
- the AAV genome can persist in a stable episome state by forming high molecular weight head-to-tail circular concatamers, or can integrate into the host cell genome. Both scenarios provide long- term and high-level transgene expression.
- AAV appears to be a promising virus for cochlear gene therapies based on results obtained in human trials of ocular gene therapy.
- the vector system of the invention comprises at least one AAV particle comprising a polynucleotide encoding the full-length of the Otoferlin polypeptide or a functional fragment thereof, as described above.
- the vector system of the invention comprises at least two AAV particles, each of them comprising a polynucleotide comprising a partial coding sequence that encodes i) the N-terminal part of the Otoferlin polypeptide, or of a functional fragment thereof, for one, and ii) the C-terminal part of the Otoferlin polypeptide, or of a functional fragment thereof, for the other.
- AAV twelve natural occurring serotypes of human AAV have been characterized to date. These serotypes have different inherent tropisms and transduction efficiencies in muscles, lung, liver, brain, retina, and vasculature. Multiple attempts of AAV pseudotyping and capsid engineering resulted in considerable improvement of tropism and efficiency of transduction.
- AAV1-4, 7, and 8 were shown to infect spiral limbus, spiral ligament, and spiral ganglion cells in vivo. Infection of IHCs was also shown for AAV1-3, 5, 6, and 8.
- AAV1 was the most effective and occasionally infected OHCs and supporting cells.
- AAV5 was shown to be efficient for Claudius cells, spiral ganglion, and inner sulcus cells.
- AAV2/1 was found to efficiently transduce progenitor cells giving rise to IHCs and OHCs in mouse cochlea
- AAV2/2 was optimal for IHCs of guinea pig cochlea (Ahmed et al, JARO 18:649- 670 (2017)).
- the vector system of the invention contains an AAV vector chosen in the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAV10.
- the serotype of said vector is AAV2, AAV8, AAV5, or AAV1 .
- the serotype of said vector is AAV2 or AAV8.
- AAV8, which is the most preferred serotype in the context of the present invention, is currently tested in vivo.
- genetic modifications of AAV can be performed. These genetic modifications include the deletion of the E1 region, deletion of the E1 region along with deletion of either the E2 or E4 region, or deletion of the entire adenovirus genome except the cis-acting inverted terminal repeats and a packaging signal. Such vectors are advantageously encompassed in the present invention.
- genetically modified AAV having a mutated capsid protein may be used so as to direct the gene expression towards a particular tissue type, e.g., to auditory cells.
- modified serotype-2 and -8 AAV vectors in which tyrosine residues in the viral envelope are substituted for alanine residues can be used.
- tyrosine mutant serotype-2 tyrosine 444 can be substituted with alanine (AAV2-Y444A).
- serotype 8 tyrosine 733 can be substituted with an alanine reside (AAV8-Y733A).
- the polynucleotide(s) of the invention expressing the Otoferlin polypeptide or gene or functional fragment thereof is contained in recombinant AAV2 particles in which all the tyrosine residues have been replaced by phenylalanine residues (AAV2 (Y->F) or Quad Y-F, as disclosed in Petrs-Silva H et al, Mol. Ther. 19, 293-301 (201 1) and in the examples below.
- Mutated tyrosine residues on the outer surface of the capsid proteins include, for example, but are not limited to, mutations of Tyr252 to Phe252 (Y252F), Tyr272 to Phe272 (Y272F), Tyr444 to Phe444 (Y444F), Tyr500 to Phe500 (Y500F), Tyr700 to Phe700 (Y700F), Tyr704 to Phe704 (Y704F), Tyr730 to Phe730 (Y730F) and Tyr733 to Phe733 (Y733F).
- These modified vectors facilitate penetration of the vector across the round window membranes, which allow for non- invasive delivery of the vectors to the hair cells/spiral ganglion neurons of the cochlea.
- These mutated vectors avoid degradation by the proteasome, and their transduction efficiency is significantly increased.
- AAV2- AAV3 hybrids AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41 , AAV9.45, AAV6 (Y445F/Y731 F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShHI O, AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41 , and AAVr3.45 (Asokan A. et al, Mol. Therapy, vol.20 n°4, 699-708, 2012).
- AAV AAV
- cells can be coinfected or transfected with adenovirus or polynucleotide constructs comprising adenovirus genes suitable for AAV helper function. Examples of materials and methods are described, for example, in U.S. 8,137,962 and 6,967,018.
- the system of the invention can be a one-vector system.
- modified capsids may be used (cf. AAV/PHP.B vectors).
- AAV capsid has a limited packaging capacity of 5 kilobases, it is better to use dual vector systems as disclosed for example in WO 2013/075008, which is incorporated herein by reference.
- the present inventors have used said dual-AAV vector approach to provide the two half-portions of the Otoferlin gene to inner hair cells, where an homologous recombination occurs and the full- length protein is expressed. Their results show that the two distinct AAVs vectors are able to transduce efficiently the targeted inner hair cells, where the Otoferlin protein is produced and restores in a long-lasting way the profound deafness phenotype of mice OTOF KO that suffer from congenital deafness due to DFNB9 invalidation.
- the vector system of the invention preferably comprises at least two AAV particles, each of said AAV particles comprising either: a) a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5’ to 3’: a suitable promoter followed by a partial coding sequence that contains the N-terminal part of the Otoferlin gene, and a splice donor site, or b) a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5’ to 3’: a splice acceptor site, a partial coding sequence that contains the C-terminal part of the Otoferlin gene, optionally followed by a polyadenylation sequence, wherein the said first and second polynucleotides also contain a recombinogenic sequence that is located after the splice donor site in said
- This preferred embodiment uses a“first” and a“second” polynucleotide. It is however understood that “first” and “second” are not meant to imply a particular order or importance, unless expressly stated otherwise.
- the first and second polynucleotides used in this particular embodiment should contain specific genetic components in order to induce the appropriate recombination and expression of the Otoferlin protein in the target cells.
- These specific components are the following:
- the partial or the full-length cDNA of the OTOF gene is inserted into two ITR-containing plasmids.
- the ITR sequences of a polynucleotide described herein can be derived from any AAV serotype (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) or can be derived from more than one serotype.
- the ITR sequences are derived from AAV2.
- ITR sequences and plasmids containing ITR sequences are known in the art and commercially available.
- An exemplary AAV2 ITR sequence for flanking the 5' end of an expression construct comprises the sequence SEQ ID NO:10.
- An exemplary AAV2 ITR sequence for flanking the 3' end of an expression construct comprises the sequence SEQ ID NO:1 1 .
- Such ITRs can also advantageously be used if the polynucleotide of the invention is a single vector system.
- Promoters contemplated for use in the vector system of the invention include, but are not limited to, cytomegalovirus (CMV) promoter, SV40 promoter, Rous sarcoma virus (RSV) promoter, chimeric CMV/chicken beta-actin promoter (CBA) and the truncated form of CBA (smCBA) (U.S. Patent No. 8,298,818).
- CMV cytomegalovirus
- RSV40 promoter Rous sarcoma virus
- CBA chimeric CMV/chicken beta-actin promoter
- smCBA truncated form of CBA
- the promoter used in the vector system of the invention is the truncated chimeric CMV b actin (smcBA) promoter of SEQ ID NO:8 or a promoter comprising a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:8.
- smcBA truncated chimeric CMV b actin
- Promoters can be incorporated into a vector using standard techniques known in the art. Multiple copies of promoters or multiple promoters can be used in the vector systems of the invention. In one embodiment, the promoter can be positioned about the same distance from the transcription start site as it is from the transcription start site in its natural genetic environment. Some variation in this distance is permitted without substantial decrease in promoter activity. A transcription start site is typically included in the vector.
- the two polynucleotides of the invention comprise a so-called“recombinogenic region” which can promote homologous recombination between the two polynucleotides once delivered to a cell (see, e.g., Ghosh et al. Hum Gene Ther. 201 1 Jan;22(l):77-83).
- This recombinogenic region typically consists in a first region of the first polynucleotide that has a homologous region in the second polynucleotide, or vice versa.
- the two regions preferably have a threshold level of sequence identity with each other of at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity, as defined above.
- This recombinogenic region has preferably a size comprised between 50 and 500, 50 and 400, 50 and 300, 100 and 500, 100 and 400, 100 and 300, 200 and 500, 200 and 400, or 200 and 300 nucleotides.
- the two regions are identical and have a size comprised between 200 and 300 nucleotides.
- These recombinogenic sequences have sequences which are sufficiently homologous so as to permit hybridization with each other under standard stringent conditions and standard methods.
- stringent conditions for hybridization refers to conditions wherein hybridization is typically carried out overnight at 20-25°C below the melting temperature (Tm) of the DNA hybrid in 6x SSPE, 5x Denhardt’s solution, 0.1 % SDS, 0.1 mg/ml denatured DNA.
- Tm melting temperature
- Washes are typically earned out as follows: (1 ) Twice at room temperature for 15 minutes in 1x SSPE, 0.1 % SDS (low stringency wash). 2) Once at Tm-20°C for 15 minutes in 0.2x SSPE, 0.1 % SDS (moderate stringency wash).
- the two regions are identical and have the sequence SEQ ID NO:9 or an homologous sequence having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:9.
- the full-length cDNA contains a splice donor / splice acceptor pair that causes splicing out of the recombinogenic region.
- the polynucleotides included in the dual-vector system of the invention comprise a splice donor or a splice acceptor site.
- the splice donor and/or splice acceptor sites contain splice consensus sequences.
- the splice donor and/or splice acceptor sites carried by the polynucleotides included in the vector system of the invention contain splice consensus sequences derived from the alkaline phosphatase enzyme.
- the polynucleotides included in the dual-vector system of the invention comprise SEQ ID NO:12 and/or SEQ ID NO:13 as splice donor and acceptor site respectively, or splice sites comprising a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:12 and/or SEQ ID NO:13 as splice donor and acceptor site respectively, or splice sites comprising a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:12 and/or SEQ ID NO:13 as splice donor and acceptor site respectively, or splice sites comprising a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 9
- the polynucleotide sequences of the invention may contain other regulatory components that are functional in the inner hair cells in which the vector is to be expressed.
- regulatory elements include, for example, internal ribosome entry site (IRES), transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements.
- Transcription termination regions can typically be obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of a coding sequence to provide for efficient termination.
- Signal peptide sequence is an amino terminal sequence that encodes information responsible for the relocation of an operably linked polypeptide to a wide range of post-translational cellular destinations, ranging from a specific organelle compartment to sites of protein action and the extracellular environment.
- Enhancers are cis-acting elements that increase gene transcription and can also be included in a vector. Enhancer elements are known in the art, and include, but are not limited to, the CaMV 35S enhancer element, cytomegalovirus (CMV) early promoter enhancer element, and the SV40 enhancer element.
- CMV cytomegalovirus
- DNA sequences which direct polyadenylation of the mRNA encoded by the structural gene can also be included in a vector.
- a dual-vector approach is advantageous to split the coding sequence of the OTOF gene into two parts, in order to be packaged more easily into virions having a limited packaging capacity.
- AAVs capsids it is preferred to use polynucleotides that contain an OTOF coding sequence that contains no more than 5 kilobases, no more than 4 kilobases, and even more preferably no more than 3 kilobases.
- the coding sequence of the human OTOF gene is preferably cut at a natural splicing site.
- the human OTOF gene isoform 1 of SEQ ID NO:2 can be split into a N-terminal part having a nucleotide sequence as presented in SEQ ID NO:3 (nucleotides 1 -2676 of SEQ ID NO:2) and a C-terminal part having a nucleotide sequence as presented in SEQ ID NO:4 (nucleotides 2677-5994 of SEQ ID NO:2).
- the human OTOF gene isoform 5 having SEQ ID NO:22 can be split into a N-terminal part of SEQ ID NO:3 and a C-terminal part of SEQ ID NO:23.
- Exemplary polynucleotides that can be used as first and second polynucleotide in the vector system of the invention are for example SEQ ID NO:19 and SEQ ID NO:20 respectively. These two polynucleotides encode respectively the N-terminal and the C-terminal part of the isoform 1 of the Otoferlin human protein.
- SEQ ID NO:19 contains: the 5 ITR sequence of AAV2 having the sequence SEQ ID NO: 10 (nt 20-162) the CMV enhancer (nt 186-440), the chicken b-actin promoter (nt 441 - 835), the exon 1 and chimeric intron of the b-actin protein (nt 836 - 1 130), all the three being called “smCBA”, corresponding to sequence SEQ ID NO:8,
- SEQ ID NO:20 contains: the 5’ ITR sequence of AAV2 having the sequence SEQ ID NO: 10 (nt 20-162), the recombinogenic sequence having the sequence SEQ ID NO:9 (nt 207-493), the splice acceptor site of the Alkaline phosphatase having the sequence SEQ ID NO:13 (nt 516-564), the 3’ part of the human Otoferlin isoform 1 coding sequence having the sequence SEQ
- Exemplary polynucleotides that can be used as first and second polynucleotide in the vector system of the invention are for example SEQ ID NO:19 and SEQ ID NO:21 respectively. These two polynucleotides encode respectively the N-terminal and the C-terminal part of the isoform 5 of the Otoferlin human gene of SEQ ID NO:22 (as the N-terminal parts of isoforms 1 & 5 are identical, it is possible to use SEQ ID NO:19 for inducing the expression of the two isoforms).
- SEQ ID NO:21 contains: the 5’ ITR sequence of AAV2 having the sequence SEQ ID NO: 10 (nt 20-162), the recombinogenic sequence having the sequence SEQ ID NO:9 (nt 207-493), the splice acceptor site of the Alkaline phosphatase having the sequence SEQ ID NO:13 (nt 516-564),
- compositions of the invention are provided.
- the present invention targets a pharmaceutical composition comprising the vector system of the invention, as described above (i.e. , the polynucleotides or the virions containing same), for treating patients, especially human patients, having a mature auditory system, suffering from DFNB9 deafness or for preventing DFNB9 deafness in patients having
- this pharmaceutical composition can be administered to human subjects suffering from congenital hearing loss due to altered DFNB59 gene expression or deficiency. Said deficiency can be observed for example when Otoferlin is expressed at normal levels but is not functional.
- the present invention relates to the use of the vector system of the invention, as described above, for manufacturing pharmaceutical compositions intended to prevent and / or treat patients having a mature auditory system, especially human beings, suffering from the above-cited disorders, linked to altered DFNB59 gene expression or deficiency.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
- pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
- isotonic agents for example, sugars, polyalcohol such as mannitol, sorbitol, or sodium chloride in the composition.
- Pharmaceutically acceptable carriers can further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the antioxidant compounds or of the pharmaceutical compositions containing same.
- compositions of the invention may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
- liquid solutions e.g
- compositions typically must be sterile and stable under the conditions of manufacture and storage.
- the pharmaceutical composition of the invention is preferably formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration.
- Sterile injectable solutions can be prepared by incorporating the vectors of the invention in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the vectors of the invention into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and spray-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- the proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prolonged absorption of injectable compositions can be achieved by including an agent in the composition that delays absorption, for example, monostearate salts and gelatin.
- the typical mode of administration of the composition of the invention is intratympanic (in the middle ear), intracochlear, or parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal).
- the pharmaceutical composition of the invention is administered by intravenous infusion or injection.
- the pharmaceutical composition of the invention is delivered to a specific location using stereostatic delivery, particularly through the tympanic membrane or mastoid into the middle ear.
- compositions of the invention can be administered by using a micro-catheter that will be carried out either through the oval window using laser stapedotomy (trans-stapes) or transmastoid / trans-round window (Dai C. et al, JARO, 18:601 -617, 2017).
- the pharmaceutical composition of the invention is administered in human ear via intra-cochlear administration, more precisely by targeting endolymphatic spaces in the vestibular system or by the semi-circular approach mentioned above.
- compositions of the invention typically include a "therapeutically effective amount” or a “prophylactically effective amount” of the vectors of the invention.
- a “therapeutically effective amount” refers to the amount of the vectors of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, in this case for both prophylaxis and treatment of hearing loss without unacceptable toxicity or undesirable side effects.
- a therapeutically effective amount of the vectors of the invention can vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of said compound to elicit a desired response in same.
- a therapeutically effective amount can also be one in which any toxic or detrimental effects of the claimed compounds are outweighed by the therapeutically beneficial effects.
- prophylactically effective amount refers to an amount of the vectors of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose can be used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount is usually less than the therapeutically effective amount.
- Dosage regimens can be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus can be administered, several divided doses can be administered over time or the dose can be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
- Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of the vector compound of the invention calculated to produce the desired therapeutic or prophylactic effect in association with the required pharmaceutical carrier.
- first and second AAV particles are to be used, the first and second AAV polynucleotides / particles may be contained within the same composition or within different compositions and may be administered together or separately.
- the composition of the invention contains from 10 6 to 10 14 particles/mL or from 10 10 to 10 15 particles/mL, or any values there between for either range, such as for example, about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 particles/mL. In one embodiment, the composition of the invention contains more than 10 13 of AAV particles/mL
- the amount administered is the same for both particles.
- the present invention also relates to treating methods involving the administration of the vector system and pharmaceutical compositions containing same, to patients, especially human patients having a mature auditory system, suffering from DFNB9 deafness. All the embodiments disclosed above apply to said treating methods.
- Figure 1 shows the expression of otoferlin in HEK293 cells following dual AAV-vector delivery.
- A) A schematic representation of the recombinant AAV vector pair used in this study, and of the recombination, transcription, splicing, and translation processes producing the full-length protein otoferlin in co-infected cells.
- the recombinant AAV-Otof NT and AAV-Otof CT vectors contain the 5' and 3' parts of the otoferlin cDNA, respectively.
- the recombinogenic bridging sequence present in the two recombinant vectors is indicated by a gray sphere.
- the red bars under the protein diagram denote the two peptides used to produce the antibodies against the N-terminal and C- terminal parts of otoferlin.
- ITR inverted terminal repeats
- smCBA cytomegalovirus immediate early/chicken b-actin chimeric promoter
- SA splice acceptor site
- SD splice donor site
- polyA polyadenylation signal
- TM transmembrane domain.
- HEK293 cells were infected with AAV-Otof NT alone (upper panel), AAV-Otof CT alone (middle panel), or AAV- Otof NT and AAV-Otof CT together (lower panel).
- Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, whereas they tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 pm.
- Right panel In the Otof-/- mice treated on P10 (arrow), the hearing thresholds for click stimuli were stable for at least six months after recovery (c)
- Left panel ABR traces, recorded three weeks after therapeutic injection, in a wild-type mouse, an Otof -/- mouse (Otof -/-), and a rescued Otof -/- mouse (Otof -/- injected), showing similar waveforms in the wild-type and rescued mice.
- Figure 3 shows that dual AAV-mediated gene therapy in Otof -/- mice on P17 durably restores otoferlin expression and hearing.
- Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, whereas they tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 pm.
- Figure 4 shows that dual AAV-mediated gene therapy in Otof -/- mice on P30 restores otoferlin expression and hearing in a sustained manner.
- Synaptic active zones have a normal distribution in transduced IHCs expressing otoferlin, whereas they tend to form clusters (arrowheads) in non-transduced IHCs (indicated by dashed lines). Scale bar: 5 pm.
- mice hearing restoration to near-wild type levels is maintained for at least twenty weeks post-injection (c)
- Left panel ABR traces, recorded seven weeks after therapeutic injection, in a wild-type mouse (black), an Otof - /- mouse (Otof -/-), and a rescued Otof -/- mouse (Otof -/- injected), showing similar waveforms in the wild-type and rescued mice.
- Figure 5 shows the dual AAV-mediated gene therapy in Otof ⁇ mice restores otoferlin normal expression and hearing.
- Figure 7 describes some of the mutations of the DFNB9 gene that have been identified so far. These mutations underlay recessive form of the prelingual deafness DFNB9.
- Figure 8 shows (A) the protein aggregation and misfolding of Otoferlin in the inner hair cells of Otof ts/ts mouse and (B) the auditory brainstem responses (ABRs) in Otof +/ts , and Otof ts/ts mice (see also Figure 5).
- Figure 9 discloses the effect of unilateral injection of the AAV-Otof NT plus AAV-Otof CT recombinant vector pair on Otof ts/ts mice. 5 weeks after the injection, the sensory epithelium of the treated cochleas of three Otof ts/ts mice was microdissected and immunolabeled for otoferlin. Otoferlin expression in the IHC of the treated cochlea has been measured and compared with its expression in Otof ts/ts non-treated mice (see also Figure 5).
- Figure 10 discloses the voltage-activation curve of fca (A) and corresponding AC m responses (B) in wild-type, Otof s/ls and Otof s/ls treated IHC. Changes in cell membrane capacitance (AC m ) were used to monitor fusion of synaptic vesicles during exocytosis.
- Otoferlin knockout mice produced in the C57BL/6 strain (Roux I. et al, Cell, 127, 277- 289 (2006) were backcrossed with FVB mice for more than ten generations to obtain a homogeneous FVB genetic background, as this background, unlike the C57BL/6 background, is associated with stable hearing thresholds in the first ten months of life ( Kommareddi, P., et al. J Assoc Res Otolaryngol 16, 695-712 (2015)).
- Recombinant AAV2 vectors were delivered to the Otof -/- mice in an FVB genetic background.
- mice were anesthetized by intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset, 100 mg/kg), xylazine hydrochloride (Xyla-ject, 10 mg/kg), and acepromazine (2 mg/kg). The depth of anesthesia was checked by monitoring the deep tissue response to toe pinch. Before and every 24 hours after surgery for a week, the mice received subcutaneous injection of carprofen (2 mg/kg) to reduce inflammation and pain. Animals were monitored for signs of distress and abnormal weight loss after surgery.
- thermosensitive mutation in the C2F domain (p.E1804del) was generated.
- the Otof ⁇ mice are profoundly deaf.
- the results shown on Figure 8 highlight that the distribution of otoferlin in the IHCs of these mice is abnormal/strongly perturbed: the protein is aggregated and misfolded in the inner hair cells.
- ABRs auditory brainstem responses
- the full-length coding sequence of the murine otoferlin cDNA was divided into a 5’ fragment (nucleotides 1 -2448) and a 3’ fragment (nucleotides 2449-5979), and these fragments were synthesized (Genscript, Piscataway, NJ).
- the 5’ construct contained the 5’ part of the Otofl cDNA (encoding amino acids 1 -816, which includes the C2A, C2B, and C2C domains of the protein) and a splice donor (SD) site
- the 3’ construct contained the 3’ part of the Otofl cDNA (encoding amino acids 817- 1992, which includes the C2D, C2E, C2F and transmembrane domains of the protein), a splice acceptor site (SA).
- both constructs contain the alkaline phosphatase recombinogenic bridging sequence [Lay Y et al, Hum Gene Ther 17, 1036-1042 (2006); Ghosh A.
- AAV-Otof NT and AAV-Otof CT An additional recombinant vector containing the green fluorescent protein (GFP) cDNA was engineered to serve as a positive control of cell transduction.
- the recombinant vectors were packaged in the AAV2 quadY-F capsid (Petrs-Silva H. et al, Molecular therapy : the journal of the American Society of Gene Therapy 19, 293-301 (201 1), and recombinant viruses were purified and titered by the University of Florida Ocular Gene Therapy Core, as previously described [Zolotukhin S. et al, Methods 28, 158-167 (2002); Jacobson SG et al., Molecular therapy : the journal of the American Society of Gene Therapy 13, 1074-1084 (2006)].
- HEK293 cells were grown in 6-well plates on polylysine-coated coverslips in Dulbecco's modified Eagle's medium supplemented with 1x non-essential amino acids and 10% fetal bovine serum (Gibco), and penicillin-streptomycin (Pen/Strep, Invitrogen).
- coverslips with the cells at 75% confluence were incubated in 200 pi of serum-free medium containing either one or both AAV2-Otof recombinant viruses (10 000 genome-containing particles/cell for each vector) at 37 °C with 5% C02.
- the virus was delivered to the left cochlea as previously described (Akil O. et al, Neuron 75, 283- 293 (2012)).
- Anesthetized Otof-/- mice received an injection of the AAV2-Otof vector pair through the round window membrane into the scala tympani of the cochlea on P10, P17, or P30.
- the ear was approached via a dorsal incision (Duan M et al, Gene Ther 1 1 Suppl 1 , S51 -56 (2004).
- a small hole was made in the bulla with an 18G needle, and expanded with forceps.
- the round window membrane was gently punctured with a borosilicate capillary glass pipette, which was then removed.
- mice were anesthetized with an intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset, 100 mg/ml) and xylazine hydrochloride (Xyla-ject, 10 mg/ml), with subsequent injections of one fifth of the initial dose if required.
- Body temperature was maintained with a heating pad and monitored with a rectal probe throughout recording.
- Auditory brainstem responses were recorded with the TDT BioSig III system (Tucker Davis Technologies) and three subdermal needle electrodes located on the mouse scalp: one at the vertex, one below the pinna of the left ear (reference electrode), and one below the contralateral ear (ground electrode).
- the sound stimuli were clicks (5 ms duration, 31 Hz) and tone pips at 8, 16, and 32 kHz (10 ms duration, cosine squared shaping, 21 Hz). They were delivered in free- field conditions, with monaural response recording from the left ear (the right ear was blocked during the recording).
- EEG electroencephalographic activity
- SPL sound pressure level
- the hearing threshold was defined as the lowest stimulus level at which ABR peaks for waves l-V were clearly and repeatedly present upon visual inspection. These threshold evaluations were confirmed by the offline analysis of stored waveforms.
- the latency of ABR wave I was measured as the time interval between the click stimulus and the peak amplitude of wave I.
- the values of wave I peak amplitudes on the ABR traces were normalized against the mean value in control wild-type mice (taken as 100 %) for a comparison between rescued Otof -/- mice and wild-type mice.
- Mouse cochleas were perfused with 4% paraformaldehyde in 0.1 M PBS (pH 7.4) and incubated in the same fixative at 4°C for two hours.
- the cochleas were rinsed three times with PBS, and decalcified by incubation with 5% ethylenediamine tetra-acetic acid (EDTA) in 0.1 M PBS at 4°C overnight.
- EDTA ethylenediamine tetra-acetic acid
- the cochlear sensory epithelium organ of Corti was microdissected into a surface preparation, preincubated in 0.25% Triton X-100 and 5% normal goat serum in PBS (blocking buffer) at room temperature for one hour, and incubated with the primary antibody at 4°C overnight.
- rabbit antiotoferlin C-terminal part C19, 1 :250 dilution
- mouse (lgG1) anti-CtBP2/ribeye mouse (lgG2a) anti-glutamate receptor subunit A2 (Millipore, 1 :200 dilution)
- rabbit anti-GFP Invitrogen, A1 1 122; 1 :250 dilution
- the samples were rinsed three times in PBS, and incubated with the appropriate secondary antibody: Alexa Fluor 488-conjugated anti-mouse lgG1 , Alexa Fluor 568-conjugated anti-mouse lgG2a (Life Technologies, 1 :1000 dilution), or Atto Fluor 647-conjugated anti-rabbit IgG (Sigma, 1 :200 dilution).
- the samples were washed three times in PBS, and mounted on a glass slide in one drop of Fluorsave, with DAPI to stain cell nuclei.
- IHCs Inner hair cells
- Reverse transcription (RT) was carried out with oligodT primers and superscript II RNase H- (Invitrogen) at 42°C for 50 minutes.
- Two microliters of the RT reaction product were used for the polymerase chain reaction (PCR; Taq DNA polymerase, Invitrogen) consisting of 35 cycles (94°C for 30 s, 60°C for 45 s, 72°C for 60 s) with final extension at 72°C for 10 minutes.
- the PCR primer pair (forward primer TGTCTCAGAGCTCCGAGGCA (SEQ ID NO: 14) and reverse primer ATCGTGGAGGAGGAACTGGGCA (SEQ ID NO:15) was designed to amplify a 2676 bp intermediate fragment (nucleotides 27 to 2702) of the otoferlin cDNA (GenBank accession number NM_001100395.1) encompassing the junction between the AAV-Otof NT and AAV-Otof CT inserts.
- PCR products were purified by electrophoresis on a 2% agarose gel containing 0.5 mg/ml ethidium bromide (Qiaquick gel extraction kit, QIAGEN), sequenced (Elim Biopharmaceuticals), and checked for sequence identity to the otoferlin cDNA sequence.
- QIAGEN Qiaquick gel extraction kit
- An AAV2-based vector was engineered to express the green fluorescent protein (GFP) gene under the control of a chimeric CMV-chicken b-actin promoter.
- GFP green fluorescent protein
- This expression cassette was packaged in the AAV2 quadY-F capsid wherein four surface tyrosine (Y) residues of the AAV2 capsid have been replaced by phenylalanine (F) residues, which was shown to increase the efficiency of gene transfer in the retina (Petrs-Silva H. et al, Molecular therapy : the journal of the American Society of Gene Therapy 19(2):293-301 (2011)).
- the recombinant virus was injected through the round window membrane into the left cochlea of five wild-type mice on P2.
- the coding sequence of the murine otoferlin cDNA was split into a 5’ fragment (Otof NT, nucleotides 1 -2448) and a 3’ fragment (Otof CT, nucleotides 2449-5979), each of which was inserted into an AAV vector carrying a recombinogenic bridging sequence (Ghosh A.
- the AAV-Otof NT recombinant vector carries the 5' part of the cDNA followed by a splice donor site, and the AAV-Otof CT recombinant vector carries a splice acceptor site followed by the 3’ part of the cDNA (see Methods and Figure 1). Each of these recombinant vectors was packaged in the AAV2 quadY-F capsid.
- HEK293 cells were infected with AAV-Otof NT, AAV Otof CT, or both recombinant viruses, and immunostained for otoferlin 48 hours later. Two different antibodies were used, directed against the C-terminal part or the N-terminal part of the protein (Roux I, et al, Cell 127:277-289 (2006)), and obtained identical results. Otoferlin was detected only in cells infected simultaneously with both viruses, thus indicating that the two vectors were able to recombine and generate concatemers via their inverted terminal repeats, with correct splicing of the resulting transcript to produce the protein ( Figure 1).
- a single unilateral injection of the AAV-Otof NT plus AAV-Otof CT recombinant vector pair was administered to Otof -/- mice through the round window membrane into the left cochlea, before (on P10) or after hearing onset. Injections after hearing onset were carried out at one of two different time points, P17 and P30, because the maturation of IHC ribbon synapses is still underway at P17 (Kros CJ et al, Nature 394(6690):281-284 (1998); Wong AB et al, EMBO J 33(3):247-264 (2014)), whereas the cochlea is mature at P30 (Song L. et al, J Acoust Soc Am 1 19(4):2242-2257 (2006)).
- the sensory epithelium of the treated cochleas of three Otof -/- mice was microdissected and immunolabeled for otoferlin (with an antibody directed against the C-terminal part of the protein) to estimate the IHC transduction rate.
- ABR Auditory brainstem response
- Hearing thresholds in response to clicks remained unchanged for 20 weeks after injection, demonstrating a sustained restoration of hearing in these mice despite a mean ABR wave I amplitude about half that in wild-type mice (47 ⁇ 10%) ( Figures 3b, c).
- Otoferlin expression in the IHC (dashed lines) of the treated cochlea was found nearly normal when compared to the otoferlin aggregates in non-treated cochlea of the Otof ts/ts mouse (arrows).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Environmental Sciences (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Toxicology (AREA)
- Marine Sciences & Fisheries (AREA)
- Cell Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (23)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020267009428A KR20260046255A (ko) | 2019-01-18 | 2020-01-20 | 오토페를린 유전자을 회복시키는 aav-매개된 유전자 치료요법 |
| JP2021541524A JP7595013B2 (ja) | 2019-01-18 | 2020-01-20 | オトフェリン遺伝子を回復させるaav媒介遺伝子治療 |
| PL20701951.4T PL3911354T3 (pl) | 2019-01-18 | 2020-01-20 | Terapia genowa zależna od aav przywracająca gen otoferliny |
| CA3126884A CA3126884A1 (en) | 2019-01-18 | 2020-01-20 | Aav-mediated gene therapy restoring the otoferlin gene |
| RS20230958A RS64794B1 (sr) | 2019-01-18 | 2020-01-20 | Aav-posredovana genska terapija koja obnavlja otoferlin gen |
| FIEP20701951.4T FI3911354T3 (fi) | 2019-01-18 | 2020-01-20 | Otoferliinigeenin palauttava AAV-välitteinen geeniterapia |
| AU2020208933A AU2020208933B2 (en) | 2019-01-18 | 2020-01-20 | AAV-mediated gene therapy restoring the otoferlin gene |
| EP23184106.5A EP4295913A3 (en) | 2019-01-18 | 2020-01-20 | Aav-mediated gene therapy restoring the otoferlin gene |
| ES20701951T ES2960880T3 (es) | 2019-01-18 | 2020-01-20 | Terapia génica mediada por AAV que restaura el gen de la otoferlina |
| KR1020217026056A KR102946735B1 (ko) | 2019-01-18 | 2020-01-20 | 오토페를린 유전자를 회복시키는 aav-매개된 유전자 치료요법 |
| IL284742A IL284742B2 (en) | 2019-01-18 | 2020-01-20 | Aav-mediated gene therapy restoring the otoferlin gene |
| HRP20231296TT HRP20231296T1 (hr) | 2019-01-18 | 2020-01-20 | Genska terapija posredovana s avv koja obnavlja gen za otoferlin |
| EP20701951.4A EP3911354B8 (en) | 2019-01-18 | 2020-01-20 | Aav-mediated gene therapy restoring the otoferlin gene |
| SI202030290T SI3911354T1 (sl) | 2019-01-18 | 2020-01-20 | Aav posredovana genska terapija za obnovitev otoferlin gena |
| LTEPPCT/EP2020/051283T LT3911354T (lt) | 2019-01-18 | 2020-01-20 | Aav mediacijos genų terapija, atstatanti otoferlino geną |
| DK20701951.4T DK3911354T5 (da) | 2019-01-18 | 2020-01-20 | AVV-formidlet genterapi, der genskaber otoferlin-genet |
| BR112021013996-6A BR112021013996A2 (pt) | 2019-01-18 | 2020-01-20 | Terapia gênica mediada por aav que recupera o gene otoferlina |
| SM20230359T SMT202300359T1 (it) | 2019-01-18 | 2020-01-20 | Terapia genica aav-mediata ripristinante il gene dell'otoferlina |
| MX2021008622A MX2021008622A (es) | 2019-01-18 | 2020-01-20 | Terapia genica mediada por aav que restaura el gen de la otoferlina. |
| CN202080022300.3A CN113924109A (zh) | 2019-01-18 | 2020-01-20 | Aav介导的基因疗法恢复耳畸蛋白基因 |
| US17/422,737 US20220125875A1 (en) | 2019-01-18 | 2021-01-20 | Aav-mediated gene therapy restoring the otoferlin gene |
| JP2024204975A JP2025032155A (ja) | 2019-01-18 | 2024-11-25 | オトフェリン遺伝子を回復させるaav媒介遺伝子治療 |
| AU2025271467A AU2025271467A1 (en) | 2019-01-18 | 2025-11-28 | AAV-mediated gene therapy restoring the Otoferlin gene |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP19305071.3 | 2019-01-18 | ||
| EP19305071 | 2019-01-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020148458A1 true WO2020148458A1 (en) | 2020-07-23 |
Family
ID=65351986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2020/051283 Ceased WO2020148458A1 (en) | 2019-01-18 | 2020-01-20 | Aav-mediated gene therapy restoring the otoferlin gene |
Country Status (22)
| Country | Link |
|---|---|
| US (1) | US20220125875A1 (https=) |
| EP (2) | EP4295913A3 (https=) |
| JP (2) | JP7595013B2 (https=) |
| KR (2) | KR20260046255A (https=) |
| CN (1) | CN113924109A (https=) |
| AU (2) | AU2020208933B2 (https=) |
| BR (1) | BR112021013996A2 (https=) |
| CA (1) | CA3126884A1 (https=) |
| DK (1) | DK3911354T5 (https=) |
| ES (1) | ES2960880T3 (https=) |
| FI (1) | FI3911354T3 (https=) |
| HR (1) | HRP20231296T1 (https=) |
| HU (1) | HUE063458T2 (https=) |
| IL (1) | IL284742B2 (https=) |
| LT (1) | LT3911354T (https=) |
| MX (1) | MX2021008622A (https=) |
| PL (1) | PL3911354T3 (https=) |
| PT (1) | PT3911354T (https=) |
| RS (1) | RS64794B1 (https=) |
| SI (1) | SI3911354T1 (https=) |
| SM (1) | SMT202300359T1 (https=) |
| WO (1) | WO2020148458A1 (https=) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022178298A1 (en) * | 2021-02-19 | 2022-08-25 | Decibel Therapeutics, Inc. | Methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| WO2023036966A1 (en) * | 2021-09-10 | 2023-03-16 | Institut Pasteur | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
| US11660353B2 (en) | 2018-04-27 | 2023-05-30 | Decibel Therapeutics, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| US11807867B2 (en) | 2020-02-21 | 2023-11-07 | Akouos, Inc. | Compositions and methods for treating non-age-associated hearing impairment in a human subject |
| JP2023549124A (ja) * | 2020-11-06 | 2023-11-22 | イーライ リリー アンド カンパニー | 難聴の治療のためのバリアントアデノ随伴ウイルス(aav)カプシドポリペプチド、及びその遺伝子治療薬 |
| US12233136B2 (en) | 2018-04-27 | 2025-02-25 | Decibel Therapeutics, Inc. | Myosin 15 promoters and uses thereof |
| US12252520B2 (en) | 2019-02-08 | 2025-03-18 | Decibel Therapeutics, Inc. | Myosin 15 promoters and uses thereof |
| US12359221B2 (en) | 2017-05-05 | 2025-07-15 | The Regents Of The University Of California | Compositions and methods for expressing otoferlin |
| US12377169B2 (en) | 2020-04-01 | 2025-08-05 | University Of Florida Research Foundation, Incorporated | Dual AAV-MYO7A vectors with improved safety for the treatment of USH1B |
| US12410442B2 (en) | 2019-02-08 | 2025-09-09 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| EP4527933A4 (en) * | 2022-05-17 | 2025-12-24 | Eye & Ent Hospital Of Fudan Univ | DUAL-SUPPORT SYSTEM FOR THE TREATMENT OF HEARING LOSS, AND ITS USE |
| US12589168B2 (en) | 2019-10-30 | 2026-03-31 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106824B (zh) * | 2022-05-17 | 2025-09-02 | 上海佑音医药生物科技有限公司 | 一种治疗听力损伤的双载体系统及其应用 |
| CN116925239B (zh) * | 2023-07-17 | 2024-10-18 | 苏州星奥拓维生物技术有限公司 | 双载体系统表达Otof基因的组合物和方法 |
| CN117305367A (zh) * | 2023-08-21 | 2023-12-29 | 复旦大学附属眼耳鼻喉科医院 | 一种表达全长耳畸蛋白的双aav载体系统及其应用 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6967018B2 (en) | 2002-01-11 | 2005-11-22 | Applied Genetic Technologies Corporation | Adiponectin gene therapy |
| WO2011075838A1 (en) | 2009-12-21 | 2011-06-30 | Audigen Inc. | Method of treating or preventing hearing loss |
| US8137962B2 (en) | 2004-09-03 | 2012-03-20 | University Of Florida Research Foundation | Compositions for treating cystic fibrosis |
| US8298818B2 (en) | 2006-04-28 | 2012-10-30 | University Of Florida Research Foundation, Inc. | Self-complementary adeno-associated virus having a truncated CMV-chicken β-actin promoter |
| WO2013075008A1 (en) | 2011-11-16 | 2013-05-23 | University Of Florida Research Foundation Inc. | Aav dual vector systems for gene therapy |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT1453547T (pt) | 2001-12-17 | 2016-12-28 | Univ Pennsylvania | Sequências do vírus adeno-associado (aav) do serotipo 8, vetores contendo as mesmas, e utilizações destas |
| EP3492597A3 (en) | 2013-05-21 | 2019-08-28 | University of Florida Research Foundation, Inc. | Capsid-modified, raav3 vector compositions and methods of use in gene therapy of human liver cancer |
| EP3258955A1 (en) * | 2015-02-20 | 2017-12-27 | Institut Pasteur | Prevention and/or treatment of hearing loss or impairment |
| SG10201913266UA (en) | 2015-12-11 | 2020-02-27 | Massachusetts Eye & Ear Infirmary | Materials and methods for delivering nucleic acids to cochlear and vestibular cells |
| EP3510161A4 (en) | 2016-08-23 | 2020-04-22 | Akouos, Inc. | COMPOSITIONS AND METHODS FOR TREATING PERSONAL HEARING LOSS IN A PERSON |
| KR102606810B1 (ko) * | 2017-05-05 | 2023-11-27 | 유니버시티 오브 플로리다 리서치 파운데이션, 인코포레이티드 | 오토펄린을 발현시키기 위한 조성물 및 방법 |
| IL325122A (en) * | 2018-02-22 | 2026-02-01 | Akouos Inc | Compositions and methods for treating non-age-related hearing impairment in humans |
| US11660353B2 (en) * | 2018-04-27 | 2023-05-30 | Decibel Therapeutics, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| KR20220130093A (ko) | 2019-10-30 | 2022-09-26 | 데시벨 테라퓨틱스, 인크. | 오토펄린 듀얼 벡터 시스템을 사용한 감각신경성 난청을 치료하기 위한 조성물 및 방법 |
-
2020
- 2020-01-20 EP EP23184106.5A patent/EP4295913A3/en active Pending
- 2020-01-20 CA CA3126884A patent/CA3126884A1/en active Pending
- 2020-01-20 ES ES20701951T patent/ES2960880T3/es active Active
- 2020-01-20 BR BR112021013996-6A patent/BR112021013996A2/pt unknown
- 2020-01-20 RS RS20230958A patent/RS64794B1/sr unknown
- 2020-01-20 HR HRP20231296TT patent/HRP20231296T1/hr unknown
- 2020-01-20 WO PCT/EP2020/051283 patent/WO2020148458A1/en not_active Ceased
- 2020-01-20 PT PT207019514T patent/PT3911354T/pt unknown
- 2020-01-20 FI FIEP20701951.4T patent/FI3911354T3/fi active
- 2020-01-20 IL IL284742A patent/IL284742B2/en unknown
- 2020-01-20 EP EP20701951.4A patent/EP3911354B8/en active Active
- 2020-01-20 SM SM20230359T patent/SMT202300359T1/it unknown
- 2020-01-20 PL PL20701951.4T patent/PL3911354T3/pl unknown
- 2020-01-20 CN CN202080022300.3A patent/CN113924109A/zh active Pending
- 2020-01-20 JP JP2021541524A patent/JP7595013B2/ja active Active
- 2020-01-20 LT LTEPPCT/EP2020/051283T patent/LT3911354T/lt unknown
- 2020-01-20 KR KR1020267009428A patent/KR20260046255A/ko active Pending
- 2020-01-20 MX MX2021008622A patent/MX2021008622A/es unknown
- 2020-01-20 SI SI202030290T patent/SI3911354T1/sl unknown
- 2020-01-20 KR KR1020217026056A patent/KR102946735B1/ko active Active
- 2020-01-20 HU HUE20701951A patent/HUE063458T2/hu unknown
- 2020-01-20 AU AU2020208933A patent/AU2020208933B2/en active Active
- 2020-01-20 DK DK20701951.4T patent/DK3911354T5/da active
-
2021
- 2021-01-20 US US17/422,737 patent/US20220125875A1/en active Pending
-
2024
- 2024-11-25 JP JP2024204975A patent/JP2025032155A/ja active Pending
-
2025
- 2025-11-28 AU AU2025271467A patent/AU2025271467A1/en not_active Abandoned
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6967018B2 (en) | 2002-01-11 | 2005-11-22 | Applied Genetic Technologies Corporation | Adiponectin gene therapy |
| US8137962B2 (en) | 2004-09-03 | 2012-03-20 | University Of Florida Research Foundation | Compositions for treating cystic fibrosis |
| US8298818B2 (en) | 2006-04-28 | 2012-10-30 | University Of Florida Research Foundation, Inc. | Self-complementary adeno-associated virus having a truncated CMV-chicken β-actin promoter |
| WO2011075838A1 (en) | 2009-12-21 | 2011-06-30 | Audigen Inc. | Method of treating or preventing hearing loss |
| WO2013075008A1 (en) | 2011-11-16 | 2013-05-23 | University Of Florida Research Foundation Inc. | Aav dual vector systems for gene therapy |
Non-Patent Citations (40)
| Title |
|---|
| "GenBank", Database accession no. NM_001100395.1 |
| "Genbank", Database accession no. NP_001093865.1 |
| AHMED HENA ET AL: "Emerging Gene Therapies for Genetic Hearing Loss", JOURNAL OF THE ASSOCIATION FOR RESEARCH IN OTOLARYNGOLOGY, SPRINGER, NEW YORK, NY, US, vol. 18, no. 5, 16 August 2017 (2017-08-16), pages 649 - 670, XP036327909, ISSN: 1525-3961, [retrieved on 20170816], DOI: 10.1007/S10162-017-0634-8 * |
| AKIL O. ET AL., NEURON, vol. 75, 2012, pages 2213 - 2236 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| ASOKAN A. ET AL., MOL. THERAPY, vol. 20, no. 4, 2012, pages 699 - 708 |
| DAI C. ET AL., JARO, vol. 18, 2017, pages 601 - 617 |
| DAYHOFF ET AL.: "Atlas of Protein Sequence and Structure", vol. 5, 1978, NATL. BIOMED. RES. FOUND., article "A model of evolutionary change in proteins", pages: 345 - 352 |
| DUAN M ET AL., GENE THER, vol. 11, no. 1, 2004, pages 51 - 56 |
| DYKA F.M. ET AL., HUM GENE THER METHODS, vol. 25, no. 2, 2014, pages 166 - 177 |
| GHOSH A. ET AL., HUM GENE THER, vol. 22, no. 1, 2011, pages 77 - 83 |
| GHOSH ET AL., HUM GENE THER., vol. 22, no. l, January 2011 (2011-01-01), pages 77 - 83 |
| GYORGY ET AL., MOL. THER., vol. 25, no. 2, 2017, pages 379 - 391 |
| HANAN AL-MOYED ET AL: "A dual-AAV approach restores fast exocytosis and partially rescues auditory function in deaf otoferlin knock-out mice", EMBO MOLECULAR MEDICINE (ONLINE), vol. 11, no. 1, 1 January 2019 (2019-01-01), DE, pages e9396, XP055574125, ISSN: 1757-4684, DOI: 10.15252/emmm.201809396 * |
| HENIKOFF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, pages 10915 - 10919 |
| HEPPER PGSHAHIDULLAH BS, ARCH DIS CHILD, vol. 71, no. 2, 1994, pages F81 - 87 |
| JACOBSON SG ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 13, 2006, pages 1074 - 1084 |
| KOMMAREDDI, P. ET AL., J ASSOC RES OTOLARYNGOL, vol. 16, 2015, pages 695 - 712 |
| KRAL AO'DONOGHUE GM, N ENGL J MED, vol. 363, no. 15, 2010, pages 1438 - 1450 |
| KROS CJ ET AL., NATURE, vol. 394, no. 6690, 1998, pages 281 - 284 |
| LAY Y ET AL., HUM GENE THER, vol. 17, 2006, pages 1036 - 1042 |
| LOPES V.S. ET AL., GENE THER, vol. 20, 2013, pages 824 - 833 |
| MARLIN S. ET AL., BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 394, 2010, pages 737 - 742 |
| MICHALSKI ET AL., ELIFE, vol. 6, 7 November 2017 (2017-11-07), pages e31013 |
| PAN ET AL., NATURE BIOTECHNOLOGY, vol. 35, no. 3, 2017, pages 264 - 272 |
| PANGRSIC T. ET AL., TRENDS IN NEUROSCIENCES, 2012 |
| PETRS-SILVA H ET AL., MOL. THER., vol. 19, 2011, pages 293 - 301 |
| PETRS-SILVA H. ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 19, no. 2, 2011, pages 293 - 301 |
| PUJOLLAVIGNE-REBILLARD, ACTA OTO-LARYNGOLOGICA, February 1991 (1991-02-01) |
| ROUX I. ET AL., CELL, vol. 127, no. 2, 2006, pages 277 - 289 |
| SHNERSONWILLOTT, J. COMP. PHYSIOL. PSYCHOL., vol. 94, 1980, pages 36 - 40 |
| SHNERSONWILLOTT, J. COMP. PHYSIOL. PSYCHOL., vol. 94, no. 1, February 1980 (1980-02-01), pages 36 - 40 |
| SMITHWATERMAN, J. MOL. EVOL., vol. 18, no. 1, 1981, pages 38 - 46 |
| SONG L. ET AL., J ACOUST SOC AM, vol. 119, no. 4, 2006, pages 2242 - 2257 |
| SUZUKI ET AL., SCI. REP., vol. 7, 2017, pages 45524 |
| VARGA R. ET AL., J. MED. GENET, vol. 43, 2006, pages 576 - 581 |
| WONG AB ET AL., EMBO J, vol. 33, no. 3, 2014, pages 247 - 264 |
| YOSHIMURA ET AL., SCI. REP., vol. 8, 2018, pages 2980 |
| ZHANG ET AL., FRONTIERS IN MOLECULAR NEUROSCIENCE, vol. 11, 2018 |
| ZOLOTUKHIN S. ET AL., METHODS, vol. 28, 2002, pages 158 - 167 |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12359221B2 (en) | 2017-05-05 | 2025-07-15 | The Regents Of The University Of California | Compositions and methods for expressing otoferlin |
| US12233136B2 (en) | 2018-04-27 | 2025-02-25 | Decibel Therapeutics, Inc. | Myosin 15 promoters and uses thereof |
| US11660353B2 (en) | 2018-04-27 | 2023-05-30 | Decibel Therapeutics, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| US12252520B2 (en) | 2019-02-08 | 2025-03-18 | Decibel Therapeutics, Inc. | Myosin 15 promoters and uses thereof |
| US12410442B2 (en) | 2019-02-08 | 2025-09-09 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| US12589168B2 (en) | 2019-10-30 | 2026-03-31 | Regeneron Pharmaceuticals, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| US11807867B2 (en) | 2020-02-21 | 2023-11-07 | Akouos, Inc. | Compositions and methods for treating non-age-associated hearing impairment in a human subject |
| US12077773B2 (en) | 2020-02-21 | 2024-09-03 | Akouos, Inc. | Compositions and methods for treating non-age-associated hearing impairment in a human subject |
| US12305191B2 (en) | 2020-02-21 | 2025-05-20 | Akouos, Inc. | Compositions and methods for treating non-age-associated hearing impairment in a human subject |
| US12377169B2 (en) | 2020-04-01 | 2025-08-05 | University Of Florida Research Foundation, Incorporated | Dual AAV-MYO7A vectors with improved safety for the treatment of USH1B |
| JP2023549124A (ja) * | 2020-11-06 | 2023-11-22 | イーライ リリー アンド カンパニー | 難聴の治療のためのバリアントアデノ随伴ウイルス(aav)カプシドポリペプチド、及びその遺伝子治療薬 |
| WO2022178298A1 (en) * | 2021-02-19 | 2022-08-25 | Decibel Therapeutics, Inc. | Methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| WO2023036966A1 (en) * | 2021-09-10 | 2023-03-16 | Institut Pasteur | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
| EP4527933A4 (en) * | 2022-05-17 | 2025-12-24 | Eye & Ent Hospital Of Fudan Univ | DUAL-SUPPORT SYSTEM FOR THE TREATMENT OF HEARING LOSS, AND ITS USE |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3911354B1 (en) | Aav-mediated gene therapy restoring the otoferlin gene | |
| JP6453307B2 (ja) | デュアルaavベクターによる大型遺伝子の効果的送達 | |
| CN112423791B (zh) | 将核酸递送至耳蜗和前庭细胞的组合物和方法 | |
| KR20180043373A (ko) | 색소성망막염의 치료 | |
| US20220378945A1 (en) | Gene therapy targeting cochlear cells | |
| JP7289306B2 (ja) | 網膜障害を治療するための組成物及び方法 | |
| US20250295716A1 (en) | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof | |
| US20220096658A1 (en) | Adeno-associated viruses and their uses for inner ear therapy | |
| US20220348957A1 (en) | Adeno-associated viruses and their uses for inner ear therapy | |
| US11827680B2 (en) | Compounds and methods of treating usher syndrome III | |
| HK40105471A (en) | Aav-mediated gene therapy restoring the otoferlin gene | |
| CN120322449A (zh) | Atp7b基因疗法 | |
| US20240050520A1 (en) | Gene therapy for treating usher syndrome | |
| JP2022524747A (ja) | Akt経路を標的とする神経保護遺伝子療法 | |
| CN118215508A (zh) | 编码耳畸蛋白同工型5的双重组aav8载体系统及其用途 | |
| WO2025162267A1 (zh) | 表达myo7a蛋白的双载体系统及其用途 | |
| WO2025157179A1 (zh) | 表达strc蛋白的双载体系统及其用途 | |
| EA046019B1 (ru) | Композиции и способы лечения нарушений сетчатки | |
| WO2021087445A1 (en) | Targeting deltafosb (δfosb) for treatment of dyskinesia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20701951 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3126884 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021541524 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112021013996 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2020208933 Country of ref document: AU Date of ref document: 20200120 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20217026056 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2020701951 Country of ref document: EP Effective date: 20210818 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112021013996 Country of ref document: BR Free format text: APRESENTAR NOVO CONTEUDO DE LISTAGEM DE SEQUENCIAS NOS MOLDES DA PORTARIA 405, DE 21/12/2020, POIS O CONTEUDO DA LISTAGEM APRESENTADA POSSUI CAMPOS DIVERGENTES AO PEDIDO (DEPOSITANTE). |
|
| ENP | Entry into the national phase |
Ref document number: 112021013996 Country of ref document: BR Kind code of ref document: A2 Effective date: 20210715 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P-2023/0958 Country of ref document: RS |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 1020267009428 Country of ref document: KR |