WO2020138570A1 - 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물 - Google Patents

신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2020138570A1
WO2020138570A1 PCT/KR2018/016898 KR2018016898W WO2020138570A1 WO 2020138570 A1 WO2020138570 A1 WO 2020138570A1 KR 2018016898 W KR2018016898 W KR 2018016898W WO 2020138570 A1 WO2020138570 A1 WO 2020138570A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
substituted
formula
complex compound
compound represented
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/016898
Other languages
English (en)
French (fr)
Inventor
송준명
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Priority to PCT/KR2018/016898 priority Critical patent/WO2020138570A1/ko
Publication of WO2020138570A1 publication Critical patent/WO2020138570A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/555Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07FACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F15/00Compounds containing elements of Groups 8, 9, 10 or 18 of the Periodic Table

Definitions

  • the present invention relates to a novel ruthenium complex compound, a method for manufacturing the same, and a pharmaceutical composition for preventing or treating cancer containing the same as an active ingredient.
  • Non-Patent Document 1 Shen DW, Pouliot LM, Hall MD, Gottesman MM. 2012. Pharmacological reviews 64:706-721) .
  • ruthenium-based metal complex has been proposed as an alternative to platinum derivatives.
  • ruthenium complexes have strong affinity for serum albumin and transferrin similar to Fe, and the vasculature It has been reported that it is possible to transport Ru complexes across.
  • Non-Patent Document 2 Brookes et al., 2006; Kwok and Richardson 2002.
  • transition metal complex compound when the transition metal complex compound accumulates in mitochondria or ER, reactive oxygen species (ROS) are effectively generated through fenton-type oxidation and reduction reactions, and thus the redox cycle is an important characteristic of transition metals.
  • ROS reactive oxygen species
  • ROS production is one of the characteristics of cancer cells, and increased metabolic activity of peroxisomes and mitochondria is a major cause of ROS production in tumors.
  • Cancer cells effectively use ROS for cell proliferation, angiogenesis, and metastasis progression, and cancer cells can precisely regulate excess ROS by increasing the expression of antioxidant proteins such as glutathione and thioredoxin, so cancer cells can ROS It can withstand the limits of toxicity.
  • cancer stem cells (Cancer Stem Cell) is well-proven that it expresses a high level of protein of antioxidant enzymes as well as non-enzymatic antioxidant proteins compared to proliferative cancer cells (Non-Patent Document 3: Nagano et al., 2013 ; Trachootham et al., 2009).
  • Non-Patent Document 3 Nagano et al., 2013 ; Trachootham et al., 2009.
  • the cancer cell survival mechanism described above allows CSCs to develop drug resistance to chemotherapy drugs.
  • a therapeutic strategy such as suppressing the antioxidant capacity of cancer cells as well as simultaneously increasing ROS production may induce irreversible oxidative stress and subsequent cell death.
  • Non-Patent Document 4 Dharmaraja 2017, Sznarkowska et al ., 2017
  • the development of anti-cancer drugs, or therapeutic agents that can effectively suppress the development of cancer and cancer stem cell resistance has not been developed, and thus requires continuous research and effort.
  • the present inventors can solve the problems of cancer resistance, side effects, etc. with conventional platinum-based chemotherapeutic agents, in particular, can excellently inhibit the mechanism of resistance development of cancer stem cells, and further, have excellent cell killing effect as an anti-cancer agent.
  • the novel Ru complex according to the present invention While trying to develop a therapeutic agent that can be achieved, the novel Ru complex according to the present invention not only excellently suppresses the mechanism of resistance development of cancer stem cells, but also induces ROS generation remarkably, and has an excellent cancer cell killing effect. As it turned out, the present invention has been completed.
  • Another object of the present invention is to provide a method for preparing the transition metal complex compound.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer containing the transition metal complex compound as an active ingredient.
  • Another object of the present invention is to provide a composition for inhibiting anticancer agent resistance containing the transition metal complex compound as an active ingredient.
  • Another object of the present invention is to provide a health functional food for preventing or improving cancer containing the transition metal complex compound as an active ingredient.
  • the present invention provides a complex compound represented by Formula 1 below, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 3;
  • z is 0 to 3;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i and R 3j are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, Or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano. ,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • the present invention provides a complex compound represented by the following Chemical Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 2;
  • z is 0 to 1;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i , R 3j , and R 3k are each independently hydrogen, substituted or unsubstituted C 1-6 side chain Or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are one or more selected from the group consisting of halogen, oxo, nitro, and cyano. Substituted with a substituent,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Formula 1 above.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Chemical Formula 2.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of cancer containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a composition for inhibiting anti-cancer agent resistance containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a composition for inhibiting the anti-cancer agent resistance and a pharmaceutical composition for preventing or treating cancer, including a chemotherapeutic agent.
  • the novel Ru complex according to the present invention not only exhibits an excellent killing effect against cancer cells, but also can excellently inhibit the mechanism of occurrence of resistance of cancer stem cells, and a pharmaceutical composition for preventing or treating cancer containing it as an active ingredient Or, it can be usefully used as a pharmaceutical composition for preventing or treating cancer in which an existing anticancer drug resistance problem is improved by using the composition for inhibiting anticancer drug resistance and other chemotherapeutic agents.
  • FACS analysis of Figure 1a is a graph showing the uptake by CD44 positive MCF7 cells at different time points (30, 60 and 90 minutes) after treatment with Example 1 of the invention at 10 ⁇ M
  • FACS analysis of Figure 1b is 10 A graph showing the uptake by CD44 positive MCF7 cells at different time points (30, 60 and 90 minutes) after treatment with Example 2 (RU-2) of the present invention of ⁇ M
  • the FACS analysis in FIG. 1C shows 10 ⁇ M A graph showing the uptake by CD44 positive MCF7 cells at different time points (30, 60 and 90 minutes) after Example 3 (RU-3) treatment of the present invention.
  • FIG. 2 shows the localization in cells observed with confocal microscopy after treatment of Example 1 of the invention in Cd133 positive HCT-116 cells:
  • FIG. 2A Location of localization in mitochondria-(a) nuclear staining
  • b light emission of Example 1
  • c light emission of Mito-tracker red
  • FIG. 2B Location of localization in endoplasmic reticulum-(a) Nuclear staining
  • b Luminescence of Example 1
  • Luminescence of ER-tracker red (d) Overlapping image.
  • FIG. 3 is a fluorescence image showing the degree of intracellular ROS in CD44 positive MCF7 and CD133 positive HCT-116 cells treated with Example 1 at different concentrations of 1, 5 and 10 ⁇ M (FIG. 3A) and 1, 5 and 10 ⁇ M.
  • FIG. 4 is an image showing the results of high-content analysis to find MPTP, cytoplasmic calcium and caspase 3/7 in Example 1 treated CD133 positive HCT-116 cells of the present invention performed using AOTF (FIG. 4A ). ) And graphs (FIG. 4B ). Cancer cells were treated with different concentrations of Ru-1 (1, 5 and 10 ⁇ M) for 16 hours for 37 hours in a humidified atmosphere of 5% CO 2 , fluorescence of calcein AM, calcium orange and magic red caspase 3/7 Emissions were monitored using AOTF at 525nm, 580nm and 630nm, respectively. The green fluorescence image corresponds to the MPT cell image, the orange fluorescence image (FIG. 4A) represents cytoplasmic calcium, and the red fluorescence image represents caspase 3/7. Bar graphs (FIG. 4B) show the average fluorescence intensity of calcein AM, calcium indicator orange and caspase 3/7.
  • Figure 5 is an image and graph showing the expression of the cell death induction and anti-cell death protein in Example 1 of the present invention treated CD133 positive HCT116 cells:
  • Figure 5a Expression of Bax (row 1-DAPI, row 2-Bax, row 3-overlapping);
  • Figure 5b Expression of Bak (row 1-DAPI, row 2-Bak, row 3-overlapping);
  • Figure 5c Expression of Bcl-2 (row 1-DAPI, row 2-Bcl-2, row 3-overlapping);
  • Fig. 5d Western blot analysis of Bcl-2, Bax and Bak in control or Example 1 treated cells;
  • Figure 5e The graph is a graph showing the relative expression of Bcl-2, Bax and Bak according to Example 1 treatment compared to the control group. Error bars represent standard deviation of three independent measurements (* P ⁇ 0.** P ⁇ 0.01, Vs Control).
  • Example 6 is an image of Example 1 of the present invention docked with GRP 78 obtained from the CDOCKER program of Discovery Studio.
  • FIG. 7A shows (A) GRP78 according to different concentrations of Example 1 of the invention in HEK293 cells transfected with pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 and pAC-ATR-GFP1-N1.
  • mRNA expression was analyzed by RT-PCR; 7D shows the expression of GRP78 in CD133 positive HCT116 cells treated with control or inventive example 1 (0, 6, and 12 ⁇ M).
  • the expression fluorescence of GRP-78 is consistent with that of ER tracker red; 7E is a bar graph showing the mean fluorescence intensity of GRP-78 in CD133 positive HCT cancer cells treated with different concentrations of Example 1; 7F is a Western blot showing the expression of GRP78 in CD133 positive HCT116 cells treated with control or Example 1; And Figure 7g is a bar graph showing the relative expression of GRP-78 compared to the control group. Error bars represent standard deviation of three independent measurements (** P ⁇ 0.01, Vs Control).
  • Figure 8 Figure 8a. Treatment Protocol: CD133 positive HCT116 cells were injected intravenously into mice at day 0, and Example 1 of the present invention was treated with mice at days 14-18. Mice were sacrificed on the last day of the experiment; Figure 8b. Photographs of experimental mice (control, low and high dose treatment); Fig. 8c. Photocontrol, low- and high-dose treatment of tumors isolated from experimental mice); Fig. 8d. Tumor volume of experimental mice during the treatment period; Fig. 8e. Weight of tumor xenograft isolated from experimental mice; Fig. 8f.
  • FIG. 8g An image showing fluorescence emission of a CD133 antibody labeled with Alexaflour680 in a control or experimental mouse treated with Example 1 of the present invention.
  • Figure 8g is a graph showing the fluorescence intensity of the CD133 antibody labeled with Alexaflour680.
  • the present invention provides a complex compound represented by Formula 1 below, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 3;
  • z is 0 to 3;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i and R 3j are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, Or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano. ,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • the complex compound represented by Chemical Formula 1 may be a complex compound of Chemical Formula 1'.
  • R 1 , X, n are as defined in Chemical Formula 1.
  • Lig (ligand) of the Ru complex of the present invention may be a ligand of a bidentate.
  • the Ru complex is ionized in a weakly acidic state of the cytoplasm, from which Ru(II) complex is accumulated in mitochondria or ER of cancer cells. This accumulation continues to induce the production of ROS (active oxygen species). Normally, such ROS production is inhibited or controlled by cancer cells by regulating antioxidant protein expression. In addition to ROS production, the Ru complex of the present invention inhibits the expression of these antioxidant proteins itself, which greatly increases the oxidative stress applied to the cells. Killing cancer cells Actively induces apoptosis, and eventually shows the effect of killing cancer and cancer stem cells.
  • ROS active oxygen species
  • the Ru complex of the present invention is useful as an active ingredient of a pharmaceutical composition for the prevention or treatment of cancer, and furthermore, as described in the present invention, it can be used as a more excellent anti-cancer agent, especially because it is easy to enter cells and rapidly. .
  • the novel Ru complex of the present invention exhibits an excellent effect of suppressing the mechanism of cancer resistance development, in addition to the killing effect on cancer and cancer stem cells.
  • a conventional cancer resistance generating mechanism it has been found that resistance to anticancer agents is generated from increased expression of GRP-78 by cancer stem cells (CSC). Therefore, inhibitory activity against GRP-78 is an important pathway that can inhibit or prevent the development of anticancer drug resistance.
  • the novel Ru complex of the present invention significantly inhibits GRP-78 expression and activity.
  • the Ru complex of the present invention not only inhibits the expression of GRP-78, but also binds to GRP-78 dimers, it was experimentally confirmed that its activity is inhibited, which is meaningful, and it is meaningful for CSC in cancer cell lines. After separating the bay, it was found that the mechanism of resistance development of cancer stem cells is significantly suppressed.
  • the novel Ru complex of the present invention can be used as a composition for inhibiting anti-cancer agent resistance, and especially in cancers showing resistance to conventional chemotherapeutic agents, such as platinum-based chemotherapeutic agents, as an adjuvant for anti-cancer treatment that can be used in combination It can be useful.
  • the present invention provides a complex compound represented by the following Chemical Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 2;
  • z is 0 to 1;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i , R 3j , and R 3k are each independently hydrogen, substituted or unsubstituted C 1-6 side chain Or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are one or more selected from the group consisting of halogen, oxo, nitro, and cyano. Substituted with a substituent,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • the complex compound represented by Chemical Formula 2 may be a complex compound of Chemical Formula 2′.
  • R 1 , X, n are as defined in Chemical Formula 2.
  • Lig (ligand) of the Ru complex of the present invention may be a ligand of a tridentate.
  • the ligand represented by Lig may be used without limitation as long as it is a tridentate ligand, and the present invention includes it.
  • the Ru complex is ionized in a weakly acidic state of the cytoplasm, from which Ru(II) complex is accumulated in mitochondria or ER of cancer cells. This accumulation continues to induce the production of ROS (active oxygen species). Normally, such ROS production is inhibited or controlled by cancer cells by regulating antioxidant protein expression. In addition to ROS production, the Ru complex of the present invention inhibits the expression of these antioxidant proteins itself, which greatly increases the oxidative stress applied to the cells. Killing cancer cells Actively induces apoptosis, and eventually shows the effect of killing cancer and cancer stem cells. Particularly, it was proved in the present invention that a superior killing effect was exhibited compared to the cancer cell killing effect of cisplatin, which is a conventional chemotherapy agent (anticancer agent) (see Experimental Example 1 and Table 2 below).
  • the Ru complex of the present invention is useful as an active ingredient of a pharmaceutical composition for the prevention or treatment of cancer, and furthermore, as described in the present invention, it can be used as a more excellent anti-cancer agent, especially because it is easy to enter cells and rapidly. .
  • the novel Ru complex of the present invention exhibits an excellent effect of suppressing the mechanism of cancer resistance development, in addition to the killing effect on cancer and cancer stem cells.
  • a conventional cancer resistance generating mechanism it has been found that resistance to anticancer agents is generated from increased expression of GRP-78 by cancer stem cells (CSC). Therefore, inhibitory activity against GRP-78 is an important pathway that can inhibit or prevent the development of anticancer drug resistance.
  • the novel Ru complex of the present invention significantly inhibits GRP-78 expression and activity.
  • the Ru complex of the present invention not only inhibits the expression of GRP-78, but also binds to GRP-78 dimers, it was experimentally confirmed that its activity is inhibited, which is meaningful, and it is meaningful for CSC in cancer cell lines. After separating the bay, it was found that the mechanism of resistance development of cancer stem cells is significantly suppressed.
  • the novel Ru complex of the present invention can be used as a composition for inhibiting anti-cancer agent resistance, and especially in cancers showing resistance to conventional chemotherapeutic agents, such as platinum-based chemotherapeutic agents, as an adjuvant for anti-cancer treatment that can be used in combination It can be useful.
  • the complex compound represented by Formula 1 or Formula 2 of the present invention can be used in the form of a pharmaceutically acceptable salt, and the salt is an acid formed by a pharmaceutically acceptable free acid.
  • Addition salts are useful. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid and phosphorous acid, aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes It is obtained from non-toxic organic acids such as dioate, aromatic acids, aliphatic and aromatic sulfonic acids, acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid and the like.
  • the types of pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and eye Odide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, sube Late, sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate
  • the acid addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving a derivative of Formula 1 or Formula 2 in an organic solvent such as methanol, ethanol, acetone, dichloromethane, acetonitrile, and adding an organic acid or inorganic acid
  • an organic solvent such as methanol, ethanol, acetone, dichloromethane, acetonitrile
  • the resulting precipitate can be prepared by filtration and drying, or by distilling the solvent and excess acid under reduced pressure and drying to crystallize under an organic solvent.
  • bases can be used to make pharmaceutically acceptable metal salts.
  • the alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the inexpensive compound salt, and evaporating and drying the filtrate. At this time, it is suitable to manufacture sodium, potassium or calcium salts as metal salts. Further, the corresponding salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg, silver nitrate).
  • a suitable negative salt eg, silver nitrate
  • the present invention includes all of the complex compounds represented by Formula 1 or Formula 2 and pharmaceutically acceptable salts thereof, as well as solvates, optical isomers, and hydrates that can be prepared therefrom.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Formula 1 above.
  • the preparation method in one aspect, can be performed as in the Reaction Scheme 1'.
  • Step (a) is 1, 10-phenanthroline-5,6-dione, step (a) if the method in which the target compound can be prepared, including this without limitation, but in one embodiment, fluorene-2-car It may proceed to refluxing the voxaldehyde, ammonium acetate, glacial acetic acid.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably, the reaction time may be performed in 3 to 8 hours.
  • step (b) can be carried out by reacting the compound prepared in step (a), cis-[Ru(bpy) 2 Cl 2 ].2H 2 O in ethylene glycol.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably at 90 to 150° C. under an N 2 atmosphere, the reaction time may be performed from 5 hours to 10 hours.
  • step (c) of the scheme 1' is 1, 10-phenanthroline-5,6-dione, if the method in which the target compound can be prepared in step (c), it includes without limitation, but in one embodiment , 4-(dimethylamino)-1-naphthaldehyde, fluorene-2-carboxaldehyde, ammonia acetate, glacial acetic acid.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably, the reaction time may be performed in 3 to 8 hours.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Chemical Formula 2.
  • the method may be performed as in the method represented by scheme 2'below.
  • Step (a) is 1, 2,4,6-trichloro-1,3,5-triazine from step (a) if the method in which the target compound can be prepared, including without limitation, but in one embodiment, And reacting with N,N-diethylaniline.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation
  • the reaction temperature may be 50 to 90°C
  • the reaction time may be performed in 5 to 12 hours.
  • step (b) can be carried out by refluxing the compound prepared in step (a), 3,5-dimethylpyrazole, K metal in THF.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation
  • the reaction time may be performed from 5 hours to 12 hours.
  • step (c) of the scheme 2' is 2,2':6',2''-terpyridine (Terpyridine) step (c), if the method in which the target compound can be prepared, including this without limitation, in one embodiment, it may be done by reflux for a hotel pyridine, RuCl 3 .3H 2 O in ethanol.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably, the reaction time may be performed in 1 hour to 5 hours.
  • step (d) is a compound prepared in step (c) and the compound prepared in step (b), the final target compound, a method for preparing the Ru complex of the present invention, the present invention without limitation
  • the compound prepared in step (c) and the compound prepared in step (b) may proceed to react in ethylene glycol.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably under reflux under N 2 atmosphere, the reaction time can be carried out from 12 hours to 36 hours, or overnight.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of cancer containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the pharmaceutical composition contains the Ru complex of the present invention, that is, the complex compound represented by Formula 1 or Formula 2 as an active ingredient, and in particular, as shown in the experimental examples of the present invention, anticancer activity (cancer Or cancer stem cell killing effect, ROS production inducing effect), and an effect of significantly inhibiting the expression of enzymatic and non-enzymatic antioxidant proteins that are ROS defense mechanisms of cancer or cancer stem cells.
  • anticancer activity cancer Or cancer stem cell killing effect, ROS production inducing effect
  • the pharmaceutical composition for preventing or treating cancer using the Ru complex of the present invention as an active ingredient was confirmed that the Ru complex of the present invention is excellent in cell entry into cancer or cancer stem cells, and in particular, it is ionized under weakly acidic conditions of the cytoplasm to mitochondria , Or was confirmed to accumulate in ER, from which it was confirmed that ROS generation was remarkable. In addition, it significantly inhibits the expression of enzymatic and non-enzymatic antioxidant proteins, and significantly increases pro-apotopsis protein expression, induces irreversible oxidative stress in cancer or cancer stem cells, and is excellent therefrom. The apoptosis effect was demonstrated.
  • cancer cell lines and cancer stem cells (CSC) of colorectal cancer or breast cancer in animal model experiments in vivo, it is proved that it can be used as an excellent anticancer agent. It can be seen that the pharmaceutical composition for the prevention or treatment of cancer is useful.
  • the cancer is pseudoplastic myxoma, intrahepatic biliary cancer, hepatoblastoma , Liver cancer, thyroid cancer, colon cancer, testicular cancer, myelodysplastic syndrome, glioblastoma, oral cancer, cleft lip cancer, mycosis of the fungus, acute myeloid leukemia, acute lymphocytic leukemia, basal cell carcinoma, ovarian epithelial cancer, ovarian reproductive cell cancer, male breast cancer, brain cancer , Pituitary adenoma, multiple myeloma, gallbladder cancer, biliary tract cancer, colon cancer, chronic myelogenous leukemia, chronic lymphocytic leukemia, retinoblastoma, choroidal melanoma, diffuse giant B cell lymphoma, Barter
  • the cancer is acute myeloid leukemia (AML); Chronic myelogenous leukemia (CML); Acute lymphoblastic leukemia (ALL); Chronic lymphocytic leukemia (CLL); Hodgkin's disease (HD); Non-Hodgkin's lymphoma (NHL); B-cell lymphoma; T-cell lymphoma; Multiple myeloma (MM); Amyloidosis; Waldenstrom megaglobulinemia; Myelodysplastic syndrome (MDS); Small lymphocyte lymphoma (SLL); Marginal zone lymphoma; Asymptomatic multiple myeloma; And it may be one or more selected from the group consisting of myeloproliferative syndrome.
  • AML acute myeloid leukemia
  • CML Chronic myelogenous leukemia
  • ALL Acute lymphoblastic leukemia
  • CLL Chronic lymphocytic leukemia
  • HD Hodgkin's disease
  • NHL Non-Hodgkin's lymph
  • cancer establishes unregulated or dysregulated cell proliferation, reduced cellular differentiation, inadequate ability to invade surrounding tissue, and/or establishes new growth at ectopic sites.
  • a cellular disorder characterized by the ability to.
  • the term “cancer” includes, but is not limited to, solid tumors and blood-borne tumors (hematologic malignancy).
  • the term “cancer” includes diseases of the skin, tissues, organs, bone, cartilage, blood, and blood vessels.
  • cancer further includes primary and metastatic cancer.
  • the solid tumor is pancreatic cancer; Bladder cancer, including invasive bladder cancer; Colorectal cancer; Breast cancer, including thyroid cancer, stomach cancer, and metastatic breast cancer; Prostate cancer, including androgen-dependent and androgen-independent prostate cancer; Kidney cancer, including, for example, metastatic kidney cell carcinoma; Liver cancer, including, for example, hepatocellular carcinoma and intrahepatic bile ducts; Lung and bronchial cancers including non-small cell lung cancer (NSCLC), squamous epithelial lung cancer, bronchoalveolar carcinoma (BAC), adenocarcinoma of the lung, and small cell lung cancer (SCLC); Ovarian cancer, including, for example, advanced epithelial or primary peritoneal cancer; Cervical cancer; Uterine cancer including, for example, the uterine body and cervix; Endometrial cancer; Stomach cancer; Esophageal cancer; Head and neck cancers including, for example, squamous cell carcinoma of the head and neck
  • the hematologic malignancy is acute myeloid leukemia (AML); Chronic myelogenous leukemia (CML) (including accelerated CML and CML subcellular phase (CML-BP)); Acute lymphoblastic leukemia (ALL); Chronic lymphocytic leukemia (CLL); Hodgkin's disease (HD); Non-Hodgkin's lymphoma (NHL) (including follicular lymphoma and mantle cell lymphoma); B-cell lymphoma (including diffuse large B-cell lymphoma (DLBCL)); T-cell lymphoma; Multiple myeloma (MM); Amyloidosis; Waldenstrom megaglobulinemia; Myelodysplastic syndrome (MDS) (including refractory anemia (RA), refractory anemia with coronary blasts (RARS) (excessive blast cells (RAEB), and refractory anemia with RAEB (RAEB-T) with transformation) ; Small lymphocyte lymph
  • the present invention provides a composition for inhibiting anti-cancer agent resistance containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the novel Ru complex of the present invention has the effect as an anti-cancer agent as described above, a mechanism for generating cancer anti-cancer drug resistance, expression of GRP-78 of CSC (cancer stem cell), and resistance through increased activity It has been experimentally demonstrated that the occurrence can be suppressed excellently. In particular, as well as having demonstrated a proportional inhibitory activity with increasing concentration, it was experimentally demonstrated that it is possible to excellently inhibit the expression and activity of significant GRP-78 even at a very small concentration. It can be used as a composition for inhibiting resistance useful for cancer or cancer stem cells resistant to anticancer agents.
  • a conventional chemotherapeutic agent is a mechanism for generating resistance of cancer stem cells (CSC), and the resistance is no longer applied or the drug treatment effect disappears.
  • CSC cancer stem cells
  • the inhibitory effect of the novel Ru complex compound demonstrated by the present invention on the mechanism of resistance to CSC resistance is very important, and from this, the present invention Ru complex compound can be used in combination with a conventional chemotherapeutic agent, without limitations such as pre-treatment or post-treatment. It will be useful as a therapeutic agent capable of suppressing cancer or cancer cell anti-cancer drug resistance by a method.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer, including the anti-cancer agent resistance-inhibiting composition and a chemotherapeutic agent.
  • the present invention inhibits GRP-78 expression and activity in a concentration-dependent manner, from which not only the excellent cell killing effect in cancer cells or cancer stem cells was confirmed, but also in animal model experiments.
  • the novel Ru complex of the present invention can be used as an anti-cancer agent by itself, or usefully provided as a therapeutic agent that can be used in combination with a conventional chemotherapeutic agent (anti-cancer agent).
  • cancer includes all carcinomas described as cancers herein, and refers to one or more of them.
  • the complex compound represented by Formula 1 or Formula 2, the stereoisomer thereof, or a pharmaceutically acceptable salt thereof may be administered in various dosage forms, oral and parenteral, during clinical administration.
  • it when formulated, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc., which are usually used.
  • Formulations for oral administration include, for example, tablets, pills, hard/soft capsules, liquids, suspensions, emulsifiers, syrups, granules, elixirs, troches, etc. , Dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycols).
  • lubricants eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycols.
  • Tablets may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and, if desired, a boron such as starch, agar, alginic acid or its sodium salt, etc. It can contain an releasing or boiling mixture and/or absorbent, colorant, flavoring agent, and sweetening agent.
  • a binder such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine
  • boron such as starch, agar, alginic acid or its sodium salt, etc. It can contain an releasing or boiling mixture and/or absorbent, colorant, flavoring agent, and sweetening agent.
  • the pharmaceutical composition containing the complex compound represented by Formula 1 or Formula 2 as an active ingredient may be parenterally administered, and parenteral administration is by subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. .
  • a complex compound represented by Formula 1 or Formula 2 or a pharmaceutically acceptable salt thereof is mixed with water with a stabilizer or a buffer to prepare a solution or suspension, and this is used as an ampoule or vial. It can be prepared in unit dosage form.
  • the composition may be sterile and/or contain preservatives, stabilizers, hydrating or emulsifying accelerators, adjuvants such as salts and/or buffers for osmotic pressure control, and other therapeutically useful substances, conventional methods of mixing, granulation It can be formulated according to the chemical or coating method.
  • the example of the formulation is related to the conventional formulation example, it can be easily understood by those of ordinary skill in the art that the formulation of the present invention is not limited thereto.
  • the dose of the complex represented by Formula 1 or Formula 2 of the present invention or a pharmaceutically acceptable salt thereof to the human body may vary depending on the age, body weight, sex, dosage form, health condition, and degree of disease of the subject. , Based on an adult subject having a weight of 70 Kg, it is generally 0.1-1000 mg/day, preferably 1-500 mg/day, and once a day at regular time intervals according to the judgment of a doctor or pharmacist It can also be administered in multiple doses.
  • the present invention provides a health functional food composition for preventing or improving cancer containing the complex compound represented by Chemical Formula 1 or Chemical Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the cancer refers to all the above-mentioned cancer diseases, non-limiting examples, the cancer is pseudomyxoma, intrahepatic biliary cancer, hepatoblastoma, liver cancer, thyroid cancer, colon cancer, testicular cancer, myelodysplastic syndrome, glioblastoma, oral cancer, cleft cancer , Mycosis, acute myelogenous leukemia, acute lymphocytic leukemia, basal cell carcinoma, ovarian epithelial cancer, ovarian reproductive cell cancer, male breast cancer, brain cancer, pituitary adenoma, multiple myeloma, gallbladder cancer, biliary cancer, colon cancer, chronic myelogenous leukemia, chronic Lymphocytic leukemia, retinoblastoma, choroidal melanoma, diffuse giant B cell lymphoma, barter swelling cancer, bladder cancer, peritoneal cancer, parathyroid cancer, adrenal cancer, nasal sinus cancer, non-small
  • the present invention provides a method for treating cancer comprising administering a complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof to a subject in a therapeutically effective amount. to provide.
  • the therapeutically effective amount refers to an amount sufficient to treat, prevent or improve the symptoms or conditions of a subject when administered into the body according to the administration method.
  • the amount may vary depending on the weight, age, sex, condition, and family history of the subject to be administered, and in the present invention, the treatment method may determine a different amount of dose according to different conditions for each subject.
  • the “effective amount” is an amount effective for treating cancer, for example.
  • the “effective amount” of a compound is an amount that can cause cancer or cancer stem cell death.
  • the complex compounds and compositions according to the methods of the present invention can be administered using any amount and any route of administration effective for treating a disease.
  • the exact amount required will vary from subject to subject, depending on the subject's species, age, and general condition, severity of infection, specific agent, mode of administration, and the like.
  • the complex compounds of the present invention are frequently formulated in dosage unit form for ease of administration and uniformity of dosage.
  • dosage unit form as used herein means a physically discrete unit of agent suitable for the subject to be treated. It will also be understood that the total daily use of the complex compounds and compositions of the present invention will be determined by the attending physician within the scope of sound medical judgment.
  • the specific effective dosage level for any particular subject or organism depends on various factors, including: the disease to be treated and the severity of the disease; The activity of the specific compound employed; Specific composition used; Age, weight, general health, subject's gender and diet; The time of administration, route of administration, and rate of excretion of the specific compound employed; Duration of treatment; The specific compound employed alone or co-administered drugs, and other factors well known in medical technology.
  • subject means an animal, for example a mammal, such as a human.
  • the ruthenium complex of the present invention exhibits anti-cancer activity, and has been confirmed to be a metal complex targeting an intracellular organ for drug-resistant protein and anti-cancer activity, and can overcome multi-drug resistance in cancer stem cells.
  • the cancer tumor microenvironment (pH 6.5-6.8) is more acidic than normal tissue (pH 7.4).
  • PH 7.4 normal tissue
  • protonation of the Ru complex of the present invention is easier under physiological conditions, and it is presumed to lead more easily to the internal mitochondrial membrane (IMM) negative potential.
  • the Ru complex of the present invention coexists in both mitochondria and ER.
  • the accumulation of transition metal complexes in mitochondria or ER can effectively generate reactive oxygen species (ROS) through a Fenton-type redox reaction, which is characterized by the fact that transition metals simultaneously deactivate antioxidant proteins and are free radicals in cancer cells under acidic microenvironments.
  • ROS reactive oxygen species
  • cancer cells can withstand metabolic and pharmacological loads to the limit of ROS toxicity.
  • CSC also exhibits high levels of antioxidant enzymes as well as non-enzymatic antioxidant proteins compared to proliferative cancer cells, allowing CSCs to develop drug resistance to chemotherapy drugs from this survival mechanism.
  • Ruthenium trichloride trihydrate and other reagents or chemicals were purchased from Sigma Aldrich, South Korea.
  • Analytic grade solvents were purchased from Alfa Aesar or Sigma Aldrich South Korea and degassed with 100% dry nitrogen for 20 minutes prior to use in the reaction. Deionized water was used to prepare the sodium chlorate solution.
  • Acetonitrile and toluene commercial solvents were used for column purification and were purchased from Daejung Chemicals, Korea.
  • the resulting crude product was filtered, and neutral alumina was purified twice by column chromatography using a fixed phase, toluene/acetonitrile (40/60, v/v) as a mobile phase solvent. Dark red-orange bands were collected and the solvent was concentrated under reduced pressure. Then the product was added slowly to a saturated (50%) NaClO 4 solution ClO 4 - was obtained in the salt.
  • the resulting crude product was filtered, washed with water, neutral alumina as the stationary phase, and purified twice by column chromatography using toluene/acetonitrile (20/80, v/v) as the mobile phase solvent. The dark red band was collected and the solvent was concentrated under reduced pressure. Then the product was added slowly to a saturated (50%) NaClO 4 solution ClO 4 - was obtained in the salt.
  • Toxicity to cancer cells and cancer stem cells of Example 1-3 Ru complex was evaluated by MTT analysis.
  • the thiazyl blue tetrazolium bromide (MTT) dye based cytotoxicity assay was performed according to the manufacturer's protocol (Vybrant® MTT Cell Proliferation Assay Kit (V-13154), Thermofischer Scientific, USA),
  • MCF-7 cell lines and HCT-116 cell lines were used as cancer cells, and CD44 positive MCF7 cells and CD133 positive HCT116 cells were tested as cancer stem cells (CSC), respectively.
  • CSC cancer stem cells
  • breast cancer cell line MCF-7 and colorectal cancer cell line HCT-116 were purchased from the Korea Cell Line Bank (KCLB, Seoul) and used.
  • CD44 positive MCF7 cells and CD133 positive HCT116 cells which are cancer stem cells (CSC) were separated from the MCF-7 and HCT-116 cell lines using CSC (cancer stem cell) markers.
  • CSC cancer stem cell
  • CD44 was used in the MCF-7 cell line.
  • the markers were used to isolate CSCs using CD133 markers in the HCT-116 cell line (using CD44 and CD133 microbead kits (MACS Miltenyi Biotec)).
  • each cancer cell line or cancer stem cell was individually seeded in a 96-well plate and incubated in DMEM medium supplemented with 10% FBS for 24 hours at 37°C. Thereafter, cells were treated with various concentrations (0 to 100 ⁇ M) of Example 1-3 Ru complex and incubated for 24 hours. Then, DMEM medium was removed and the cells were incubated with 100 ⁇ L of MTT solution at 37° C. for 3 hours. After removing 75 ⁇ L of MTT solution, 50 ⁇ L of DMSO was added to dissolve formazan crystals. Absorbance at 570 nm was measured using a multiplot reader (Molecular Devices, Gemini XS). Cisplatin was used as a positive control, and the IC 50 values of Examples 1-3 and cisplatin for the cancer cell line were calculated, and the results are shown in Table 2 below.
  • Example 2 cytotoxicity was observed for cancer cells and cancer stem cells in the order of Example 1>
  • Example 1 was found to have the best toxicity to cancer cells and cancer stem cells, of Example 1 for MCF-7, CD44 + MCF-7, HCT-116 and CD133 + HCT-116.
  • IC 50 values are identified as 8.9 ⁇ M, 10.1 ⁇ M, 11.9 ⁇ M, and 15.1 ⁇ M, respectively.
  • Example 1 shows 5 to 6 times better cancer cell killing effect on MCF7 cell line and CD44 positive MCF7 cells, and 3 to 4 times better cancer stem cell killing effect on HCT116 cell line and CD133 positive HCT116 cells. It is the result confirmed by showing.
  • the novel ruthenium complex compound according to the present invention has excellent cancer cells, and cancer stem cell killing effect is confirmed.
  • As an active ingredient it is excellent as a pharmaceutical composition for preventing or treating cancer, or as a health functional food for prevention or improvement.
  • the novel ruthenium complex compounds of the present invention also show excellent killing effects against cancer stem cells, which are the main cause of drug resistance, and can be usefully used as chemotherapy drugs used to treat or prevent cancer. have.
  • the efficacy of the successful chemotherapy of the drug depends on the absorption and accumulation in the intracellular organs.
  • Example 1 of the present invention significantly increases at a time point of 30 minutes or more, and reaches a saturation state at a time point of 60 minutes, and Example 1 of the present invention is MCF-7. It was confirmed that it was rapidly absorbed by CSC (cancer stem cell).
  • Example 2 also observed cell influx into cancer stem cells at the time of 90 minutes elapsed, but compared to Example 2 or Example 3, Example 1 was significantly superior cells It can be seen that inflow (permeability) is confirmed (Example 1> Example 2> Example 3).
  • the Ru complex of the present invention is excellent in influx into cancer stem cells, and thus can better induce the killing effect of cancer cells, containing it as an active ingredient, a pharmaceutical composition for preventing or treating cancer, and drug resistance Eggplant can be useful as a chemotherapy aid for the prevention or treatment of cancer.
  • CSC cancer stem cells
  • Cancer stem cells, CD133 positive HCT-116, and CD44 positive MCF-7 were placed in a cover glass and incubated at 37° C. for 24 hours. Thereafter, the cells were treated with a 10 ⁇ M inventive example 1 ruthenium complex and incubated at 37° C. for 2 hours. After drug treatment, cells are washed with 1 ⁇ PBS and MitoTracker® Red CMXRos (Thermofischer scientific, USA) or ER-ID® Red (Enzo Life Sciences, Inc., USA), USA with Hoechst 33258 nuclear dye (Sigma Aldrich) ), and incubated for 30 minutes. Finally, cells were fixed with 4% formaldehyde for 15 minutes at room temperature.
  • Example 1 complex is mainly distributed in the cytoplasmic mitochondria (A in FIG. 2) and ER (vesicles) of CD133 positive HCT-116 (B in FIG. 2 ). Is clearly confirmed. In addition, it was confirmed that the complex of Example 1 is effectively distributed in mitochondria and ER in CD44 positive MCF-7.
  • Example 2 Similar to the above ⁇ 3-1>, intracellular location analysis was performed for Example 2 or Example 3 using CD44 positive MCF-7, and as a result, Example 2 was relatively denser to ER than mitochondria. Although it was confirmed that it was distributed, Example 3 showed an even distribution in both ER and mitochondria.
  • the Ru complex of the present invention acts through a cell death pathway that mediates ER and mitochondria.
  • CSC cancer stem cells
  • MCF-7 and HCT-116 cells were seeded in 12-well culture plates and incubated overnight at 37° C., 5% CO 2 .
  • the cells were treated with or without the Ru complex of the present invention (Example 1 treated with 1 ⁇ M, 5 ⁇ M, 10 ⁇ M) for 6 hours, and then cultured in a 37° C., 5% CO 2 environment. Did.
  • cells were fixed with 4% formaldehyde and incubated for 10 minutes at room temperature.
  • DCFDA 2′,7′-dichlorofluoresine 2 acetate
  • ROS induced 2′,7′-dichloro Fluorescence intensity of fluorescein was measured at excitation and emission wavelengths of 495 and 529 nm, and the results are shown in FIGS. 3A and 3B.
  • Example 1 of the present invention induces ROS production in a concentration proportional manner (0, 1, 5 and 10 ⁇ M) in CSC (cancer stem cells).
  • DCFH-DA which is sensitive to oxidation, produces green fluorescence when ROS is produced.
  • 3B is a bar graph showing the average fluorescence intensity of DCFH-DA staining in cells treated with Example 1 at concentrations of 1 ⁇ M, 5 ⁇ M, and 10 ⁇ M, and it is confirmed that the fluorescence intensity increases proportionally.
  • Example 2 and Example Example 3 are confirmed to induce ROS production in a concentration-dependent manner, it can be confirmed that the maximum ROS production is induced at 12 and 60 ⁇ M, respectively.
  • the ruthenium complex of the present invention significantly induces ROS production from redox circulation, and from this, it is possible to excel in oxidative stress and cell death effects of cells, which is contained as an active ingredient It can be usefully used as a pharmaceutical composition for preventing or treating cancer, and as a chemotherapy adjuvant for preventing or treating cancer having drug resistance.
  • CSC Cancer stem cells of HCT-116 and MCF-7 were cultured in 12-well culture flasks, respectively, and maintained in DMEM medium supplemented with 10% FBS for 24 hours at 37°C and 5% CO 2 atmosphere. Next, the cells were maintained for 16 hours without treatment with or without treatment of the present invention Ru complex example 1 (by concentrations of 1, 5 and 10 ⁇ M). After washing with 1 ⁇ PBS buffer, cells were incubated with calcium indicator orange (Invitrogen, CA, USA) for 45 minutes at room temperature in the dark. Cells were washed with 1 ⁇ PBS and incubated with calcein-AM (acetoxymethyl ester, Invitrogen, CA, USA) for 30 minutes at 37°C.
  • Ru complex example 1 by concentrations of 1, 5 and 10 ⁇ M
  • the fluorescence emission of calcein AM, calcium orange and magic red caspase 3/7 was monitored at 525 nm, 580 nm and 630 nm, respectively, using AOTF.
  • the green fluorescence image corresponds to the cell image of MPT
  • the orange fluorescence image represents cytoplasmic calcium
  • the red fluorescence image represents caspase 3/7.
  • the bar graph in (b) shows the average fluorescence intensity of calcein AM, calcium indicator orange and caspase 3/7.
  • Example 1 treatment significantly reduced the fluorescence intensity of calcein-AM accumulated in the mitochondria of CSC compared to the control group (p ⁇ 0.01).
  • a sharp decrease in fluorescence intensity of calcein-AM accumulated in mitochondria was observed in 2 ⁇ M of Example 1 treatment and saturated in 4 ⁇ M of Example 1 treatment.
  • Example 1 complexes were mostly distributed in mitochondria and ER.
  • the ROS induced by Example 1 can mediate calcium release from ER, which may play a role in the activation of caspase-mediated cell death.
  • MPTP mitochondrial permeable transition pores
  • Example 2 and Example 3 Performed in the same manner as in ⁇ 5-1>, but was performed using Example 2 and Example 3 in MCF-7 cancer stem cells (CD44(+) MCF-7). As a result, Example 2 and Example 3 Again, it appears that the shape following the cell death mechanism appears, but it was confirmed that Example 1 responds most sensitively to the treatment concentration.
  • Figure 5 shows the induction of apoptosis and expression of anti-cell death protein in CD133 positive HCT116 cells treated with Example 1.
  • FIG. 5A shows immunofluorescence analysis of Bcl-2 expression in control and Example 1 treated HCT-116 CSC.
  • the protein level of Bcl-2 was further evaluated by Western blot method and is shown in Figure 5D.
  • FIGS. 5B and 5C show the expression of Bax and Bak in the control and Example 1 treated CSC, respectively.
  • the oligomer structure of Bax and Bak was observed in Example 1 treated cells. However, oligomerization of Bax and Bak was not well observed in control cells.
  • the apoptosis-inducing proteins Bax and Bak are generally present in the cytoplasm, but during cell death, they oligomerize the outer membrane of the mitochondria to cause MOMP.
  • Bak/Bax leads to mitochondrial outer membrane permeability (MOMP) causing release of cytochrome c (Cyt c).
  • MOMP mitochondrial outer membrane permeability
  • 5D shows Western blot analysis of Bak and Bax, and it was confirmed that Bax and Bak levels were significantly increased in CSC cells treated in Example 1 compared to the control group (p ⁇ 0.01).
  • Example 1 treatment of the present invention activation of Bak and Bax inducing cell death is observed, and the oligomerization of Bak/Bax causes mitochondrial outer membrane permeability (MOMP) causing release of cytochrome c (Cyt c). Leads to Cyt c in the cytoplasm forms apoptosome with protease activating factor 1 (Apaf1) and protease caspase-9. This multimeric apotosomal complex activates caspase-3 and caspase-7.
  • MOMP mitochondrial outer membrane permeability
  • ⁇ MOMP is irreversible for cell survival, furthermore, the reduced anti-cell death Bcl-2 expression observed in Example 1 treated cells maintains Cyt-c release from mitochondria.
  • the ruthenium complex of the present invention induces MPTP and MOMP formation in mitochondria of cancer cells and confirms effective intrinsic cell death-mediated action of cancer cells.
  • Example 1 is ARPase domain binding of GRP 78;
  • Example 1 It could not be accommodated in the ATP domain of the first scenario, and the size of the complex of Example 1 was successfully modeled as the dimer interface of GRP 78 in the second scenario.
  • the corresponding docking result is a 3D view of the interaction between Example 1 and GRP 78 in FIG. 6.
  • Example 1 of the present invention intercalates the dimeric structure of GRP-78 by forming a strong non-covalent interaction with a specific amino acid residue of GRP-78 at the interface of the dimeric structure of the protein.
  • Genomic DNA from the control human sample was isolated using the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.
  • GRP-78 forward (50 pmol; 5'-AAAGCTTTTATGAAGCTCTCCCTGGTGG-3') and
  • GRP-78 reverse (50 pmol; 5'-AGGATCCCTACAACTCATCTTTTTCTGCTG-3') or
  • ATR forward (50 pmol, 5'-AAGCTTATGGCCACGGCGGAGC-3')
  • ATR Reverse (50 pmol; 5'-GGATCCTTTTATTTTATTTTCCTCACTCTCCT -3')
  • GRP78, CLU and ATR primers were designed to amplify the GRP78, CLU and ATR transcripts of each gene.
  • PCR amplification was confirmed by analyzing 1.9 kb GRP78, 1.5 kb CLU and 850 bp ATR fragments using a 1.2% agarose gel with standard molecular weight markers.
  • PCR amplified GRP78, CLU and ATR fragments were restricted to the HindIII/BamHI enzyme. Restricted GRP78, CLU and ATR fragments were pTag-YFP-C (4.7 kb; Evrogen, Moscow, Russia), pDs-Red2-N1 (4.7 kb; Clontech, USA) and pAC-GFP1-N1 (4.7 kb; Clontech, respectively). USA).
  • the conjugated fusion gene vector was individually transformed into E. coli E. coli DH5 ⁇ cells through chemical modification as suggested by the manufacturer (Invitrogen, Carlsbad, CA).
  • Transformants (pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 and pAC-ATR-GFP1-N1) were selected on LB agar plates added with kanamycin (30 ⁇ g/mL). Plasmids from resistant colonies were isolated using a plasmid midi kit (Qiagen). Plasmids cloned with GRP78, CLU and ATR genes were co-transfected into HEK-293 cells.
  • HEK-293 human embryonic kidney cells
  • KCLB1 Korean cell line bank
  • FBS 10% FBS
  • HEK-293 cells 5x10 5 cells/well
  • plasmid DNA GFP78, CLU and ATR
  • Lipofectamine 2000 Invitrogen
  • HEK293 cells were treated in Example 1 for 16 hours, and then maintained in a CO 2 incubator in DMEM medium at 37°C. Then, total RNA was extracted according to the manufacturer's protocol (Dynabeads® MRNA Purification Kit, Invitrogen, USA). The integrity of the isolated RNA was evaluated qualitatively by the ratio of absorbance at 260/280 nm and then qualitatively by 1% agarose RNA gel electrophoresis.
  • RNA concentration was measured at 260 nm using Nanodrop (Thermo Scientific, U.S.A).
  • Total RNA, GAPDH-specific cDNA and GRP78 were prepared using the QuantiTect Reverse Transcription Kit (Qiagen, USA) according to the manufacturer's protocol. Two picomolar primers were used for amplification of the target m-RNA. After determining the starting template amount of the sample using GAPDH expression, a quantitative PCR reaction was performed.
  • GAPDH sense CATGAGAAGTATGACAACAGCCT, antisense AGTCCTTCCACGATACCAAAGT; GRP78 sense TGCCGCTTTGCAGGTGTATT, antisense CCGATGCTCAGAGCTTTCTCC.
  • RT-PCR SYBR green qPCR kit, Thermo Scientific, USA. RT-PCR was run using Applied BiosystemsTM Real-Time PCR instrument (7300).
  • Antibodies specific to GRP78 were conjugated with Q-dot 705 (Quantum Dot Conjugation Kit; Invitrogen, Carlsbad, CA, USA), respectively.
  • Q-dot 705 Quantum Dot Conjugation Kit; Invitrogen, Carlsbad, CA, USA
  • DTT dithiothreitol
  • the antibody was then incubated with maleimide-functionalized quantum dot for 1 hour at room temperature.
  • conjugate was then treated with 2-mercaptoethanol to remove maleimide groups. Unconjugated quantum dots were eluted using the column provided in the kit.
  • the Q-dot antibody conjugate was diluted 1:200 with 1% BSA for immunofluorescence analysis.
  • the excitation and emission used for fluorescence analysis were 405/705 nmdl, respectively.
  • Example 1 shows that the binding of Example 1 with GRP-78 can lead to structural changes in GRP-78 that induce ubiquitin-mediated degradation.
  • Example 1 Western blot analysis also confirmed that the Example 1 dose decreased the protein level of GRP-78 dependently.
  • Example 1 the inhibitory effect of Example 1 on GRP-78 is a very useful property that reduces the likelihood of tumor recurrence in cancer treatment and overcomes drug resistance of cancer.
  • mice This in vivo animal experiment was conducted with the approval of the Institutional Animal Care and Use Committee of the Seoul National University, and a 7-week-old Swiss female athymic mouse was purchased and used from Daehan Biolink (Seoul, Korea). All mice were adapted to be free of specific pathogens at the Seoul National University College of Pharmacy's Zoo Center (Seoul, Korea), and maintained by maintaining a dark cycle of 12 hours at 24-26°C.
  • CD133 positive HCT-116 cells (3 ⁇ 10 6 cells) isolated from HCT-116 cell culture were mixed with 100 ⁇ l of LDEV-Free reduced growth factor basement membrane matrix (Geltrex; Thermofischer Scientific, USA), followed by the right flank of the mouse. It was injected subcutaneously. When the tumors reached a volume of 100 mm 3 , the mice were divided into three groups of 6 animals each.
  • control group was injected intraperitoneally with 1 ⁇ PBS containing 4% DMSO;
  • mice were injected intraperitoneally with Example 1 (Example 1 dissolved in DMSO and diluted with 1 ⁇ PBS) at a dose of 0.03 mg/kg/body weight or 0.06 mg/kg/body weight daily.
  • Treatment was repeated for 2 weeks, and the experiment was stopped when the tumor size of the control reached about 1500 mm 3 .
  • Tumor size and weight were monitored daily during the treatment.
  • Tumor volume (mm 3 ) was calculated as follows:
  • Example 1 As described above, the possibility of chemotherapy in vivo of the complex of Example 1 for xenograft derived from CD133 + HCT-116 cells in athymic nude mice was investigated.
  • Example 1 Ru complex/kg/body weight was administered daily to the experimental group, and as a result, tumor weight and volume of the mouse group of the Example 1 treated experimental group were compared with that of the control mouse group. It was confirmed that it was significantly reduced (Figs. 8B and C).
  • Tumor weight was significantly reduced from 55% to 80% compared to the control (FIG. 8D).
  • the tumor weight in the control group, the experimental group (low dose), and the experimental group (high dose) was confirmed to be 3.2 g, 1.6 g, and 1.15 g, respectively, indicating the remarkable anticancer efficacy of Example 1 (FIG. 8E ).
  • mice of the experimental group treated in Example 1 maintained normal body weight during the entire treatment process, and the mortality rate was not observed. As a result, it was confirmed that the Ru complex of the present invention was not toxic to normal cells.
  • CSC cancer stem cells
  • Example 1 It was confirmed that the experimental mice treated with Example 1 exhibited 2 and 4 fold reduction in fluorescence intensity in the low- and high-dose treatment groups, respectively, compared to the control group (Fig. 8G). It demonstrates that it shows excellent cytotoxicity against CSC and excellent cell death effect.
  • the Ru complex of the present invention can be usefully used as an anticancer agent and an adjuvant (a composition for inhibiting resistance) of conventional chemotherapy. Furthermore, the Ru complex of the present invention was confirmed as an excellent in vivo treatment potential for a colon cancer xenograft model, and the Ru complex of the present invention is excellent as an alternative to conventional chirogens, such as platinum-based chemotherapy, which had problems such as resistance and side effects. It can be seen that can be used.
  • novel Ru complex according to the present invention a pharmaceutical composition for preventing or treating cancer containing it as an active ingredient, or a composition for inhibiting anticancer drug resistance, and other chemotherapeutic agents in combination with the existing anticancer drug resistance problem is improved It can be useful as a pharmaceutical composition for the prevention or treatment of cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물에 관한 것으로, 본 발명에 따른 신규 Ru 착화합물은 암 세포에 대하여 우수한 사멸 효과를 나타낼 뿐 아니라, 암줄기세포의 내성 발생 기작을 우수하게 저해할 수 있는 바, 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물, 또는 항암제 내성 억제용 조성물, 및 이를 여타의 화학 요법제와 병용하여 기존의 항암제 내성 문제가 개선된 암의 예방 또는 치료용 약학적 조성물로 유용하게 사용될 수 있다.

Description

신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
본 발명은 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
백금 기반 시스플라틴 유도체는 현재 암 치료에 사용되는 가장 유망한 화학 요법 약물이다. 그러나 백금 유도체의 장기간 투여는 부작용뿐만 아니라 약물 내성과 암의 재발을 초래하는 것으로 보고되었다(비특허문헌 1: Shen D-W, Pouliot LM, Hall MD, Gottesman MM. 2012. Pharmacological reviews 64:706-721).
이에, 백금 유도체의 대안으로 루테늄 기반의 금속 착체가 제안되고 있으며, 최근 루테늄 금속 착화합물에 대한 in-vitro 및 in vivo 연구에서 루테늄 착화합물이 Fe와 비슷하게 혈청 알부민과 트랜스페린에 대해 강한 친화성을 나타내며, 혈관계를 가로 지르는 Ru 착화합물 수송이 가능한 것으로 보고되었다.
한편, 세포의 빠른 분열은 높은 농도의 철분을 필요로하는데, Fe와 유사한 특성의 루테늄 착화합물은 정상세포 대비 분열이 빠른 암 조직에 축적될 가능성이 크고, 전이 암에서 트랜스페린과 페리틴과 같은 Fe 수송 단백질의 발현이 증가하는 것으로 보고되었다(비특허문헌 2: Brookes et al., 2006; Kwok and Richardson 2002).
한편, 미토콘드리아 또는 ER에서 전이 금속 착화합물이 축적되면 펜톤(fenton)형 산화, 환원 반응을 통해 활성산소종(ROS)이 효과적으로 생성되고, 때문에 산화 환원 순환은 전이 금속의 중요한 특성이며, 이 특성은 전이 금속이 항산화 단백질을 동시에 비활성화시키고 산성 미세 환경 하에서 암세포에서 자유 라디칼을 생성 할 수있게 한다.
과도한 ROS 생성은 암세포의 특징 중 하나이고, 퍼옥시좀과 미토콘드리아의 증가된 대사 활동은 종양에서 ROS 생성의 주요 원인이다. 암세포는 세포 증식, 혈관 신생 및 전이 진행에 ROS를 효과적으로 사용하는데, 암세포는 글루타티온과 티 오레독신(thioredoxin)과 같은 항산화 단백질의 발현을 증가시켜 과량의 ROS를 정교하게 조절할 수 있어, 암 세포는 ROS 독성의 한계점까지 견딜 수 있다.
또한, 암줄기세포(Cancer Stem Cell)는 증식성 암 세포와 비교하여 비효소 항산화 단백질뿐 아니라 항산화 효소의 단백질을 높은 수준을 발현시킨다는 것이 잘 입증되어있다(비특허문헌 3: Nagano et al., 2013; Trachootham et al., 2009). 상술된 암 세포의 생존 메커니즘은 CSC가 화학 요법 약물에 대한 약물 내성을 개발할 수있게 한다.
이에, 암세포의 항산화 능을 억제하는 것뿐만 아니라 ROS 생성을 동시에 증가시키는 것과 같은 치료 전략이, 비가역적 산화 스트레스와 후속 세포 사멸을 유도 할 수 있을 것으로 기대되고 있다.
이전의 연구에 따르면, 특정 항산화 단백질 발현을 억제하여, ROS 수준을 암세포의 한계치를 넘어서서 세포 사멸 메커니즘을 통해 암세포를 효과적으로 죽일 수 있음이 확인된 바 있으나(비특허문헌 4: Dharmaraja 2017, Sznarkowska et al., 2017), 아직까지 이렇다 할 항암제, 또는 암과 암줄기세포의 내성 발생을 효과적으로 억제시킬 수 있는 치료제 개발은 이루어지지 못하고 있어, 지속적인 연구와 노력이 요구된다.
이에, 본 발명자들은 종래 백금계 화학 요법제로 암의 내성, 부작용 발생 등의 문제를 해결할 수 있으며, 특히, 암줄기세포의 내성 발생 기작을 우수하게 저해할 수 있고, 나아가, 항암제로서도 우수한 세포 사멸 효과를 달성할 수 있는 치료제를 개발하기 위하여 노력하던 중, 본 발명에 따른 신규 Ru 착화합물이 암줄기세포의 내성 발생 기작을 우수하게 억제할 뿐 아니라, ROS 생성을 현저하게 유도하여, 우수한 암세포 사멸 효과가 있음을 규명한 바, 본 발명을 완성하였다.
본 발명의 목적은 암세포 사멸 효과가 있는 항암제의 유효성분으로 사용될 수 있거나, 또는 암 내성 발생 기작을 우수하게 저해하여, 내성 발생 저해제의 유효성분으로 제공될 수 있는 신규 전이금속 착화합물을 제공하는 것이다.
본 발명의 다른 목적은 상기 전이금속 착화합물의 제조방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 전이금속 착화합물을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 전이금속 착화합물을 유효성분으로 함유하는 항암제 내성 억제용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 전이금속 착화합물을 유효성분으로 함유하는 암의 예방 또는 개선용 건강기능식품을 제공하는 것이다.
상기 목적을 해결하기 위해,
본 발명은 하기 화학식 1로 표시되는 착화합물, 이의 입체 이성질체, 또는 이의 약학적으로 허용 가능한 염을 제공한다.
[화학식 1]
Figure PCTKR2018016898-appb-I000001
상기 화학식 1에 있어서,
X는 Cl-, PF6 -, Br-, BF4 -, ClO4 -, CF3SO3 - 및 SO4 -2로 이루어진 군으로 부터 선택되는 1종 이상이고;
상기 n은 0 내지 5의 정수이고;
y는 1 내지 3의 정수이고;
z는 0 내지 3이고;
Lig는 각각 독립적으로, 하기로 이루어진 군으로부터 선택되는 리간드이고,
Figure PCTKR2018016898-appb-I000002
,
Figure PCTKR2018016898-appb-I000003
,
Figure PCTKR2018016898-appb-I000004
,
Figure PCTKR2018016898-appb-I000005
,
Figure PCTKR2018016898-appb-I000006
,
Figure PCTKR2018016898-appb-I000007
, 및
Figure PCTKR2018016898-appb-I000008
;
R1
Figure PCTKR2018016898-appb-I000009
또는
Figure PCTKR2018016898-appb-I000010
이고;
R2a, R2b, R2c, R2d, R2e 및 R2f는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고;
상기 R3a, R3b, R3c, R3d, R3e, R3f, R3g, R3h, R3i 및 R3j는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고,
상기 R4a, R4b, R4c, R4d, R4e, R4f, R4g, 또는 R4h는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환된다.
또한, 본 발명은 하기 화학식 2로 표시되는 착화합물, 이의 입체 이성질체, 또는 이의 약학적으로 허용 가능한 염을 제공한다.
[화학식 2]
Figure PCTKR2018016898-appb-I000011
상기 화학식 2에 있어서,
X는 Cl-, PF6 -, Br-, BF4 -, ClO4 -, CF3SO3 - 및 SO4 -2로 이루어진 군으로 부터 선택되는 1종 이상이고;
상기 n은 0 내지 5의 정수이고;
y는 1 내지 2의 정수이고;
z는 0 내지 1이고;
Lig는 각각 독립적으로, 하기로 이루어진 군으로부터 선택되는 리간드이고,
Figure PCTKR2018016898-appb-I000012
,
Figure PCTKR2018016898-appb-I000013
,
Figure PCTKR2018016898-appb-I000014
,
Figure PCTKR2018016898-appb-I000015
,
Figure PCTKR2018016898-appb-I000016
,
Figure PCTKR2018016898-appb-I000017
, 및
Figure PCTKR2018016898-appb-I000018
;
R1
Figure PCTKR2018016898-appb-I000019
또는
Figure PCTKR2018016898-appb-I000020
이고;
R2a, R2b, R2c, R2d, R2e 및 R2f는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고;
상기 R3a, R3b, R3c, R3d, R3e, R3f, R3g, R3h, R3i, R3j, 및 R3k는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고,
상기 R4a, R4b, R4c, R4d, R4e, R4f, R4g, 또는 R4h는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환된다.
나아가, 본 발명은 하기 반응식 1에 나타난 바와 같이,
화학식 3으로 표시되는 화합물로부터 화학식 4로 표시되는 화합물을 제조하는 단계;
상기 단계에서 제조된 화학식 4로 표시되는 화합물로부터 화학식 1로 표시되는 착화합물을 제조하는 단계;를 포함하는 상기 화학식 1로 표시되는 착화합물의 제조방법을 제공한다:
[반응식 1]
Figure PCTKR2018016898-appb-I000021
상기 반응식 1에 있어서,
X, n, y, z, Lig, R1, R2a, R2b, R2c, R2d, R2e 및 R2f는 상기 화학식 1에서 정의한 바와 같다.
또한, 본 발명은 하기 반응식 2에 나타난 바와 같이,
화학식 5로 표시되는 화합물로부터 화학식 6으로 표시되는 화합물을 제조하는 단계;
상기 단계에서 제조된 화학식 6으로 표시되는 화합물로부터 화학식 2로 표시되는 착화합물을 제조하는 단계;를 포함하는 상기 화학식 2로 표시되는 착화합물의 제조방법:
[반응식 2]
Figure PCTKR2018016898-appb-I000022
상기 반응식 2에 있어서,
X, n, y, z, Lig, R1, R2a, R2b, R2c, R2d, R2e 및 R2f는 상기 화학식 2에서 정의한 바와 같다.
나아가, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 항암제 내성 억제용 조성물을 제공한다.
나아가, 본 발명은 상기 항암제 내성 억제용 조성물, 및 화학 요법제를 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에 따른 신규 Ru 착화합물은 암 세포에 대하여 우수한 사멸 효과를 나타낼 뿐 아니라, 암줄기세포의 내성 발생 기작을 우수하게 저해할 수 있는 바, 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물, 또는 항암제 내성 억제용 조성물, 및 이를 여타의 화학 요법제와 병용하여 기존의 항암제 내성 문제가 개선된 암의 예방 또는 치료용 약학적 조성물로 유용하게 사용될 수 있다.
도 1a의 FACS 분석은 10 μM의 본 발명 실시예 1 처리 후, 서로 다른 시점(30, 60 및 90 분)에서의 CD44 양성 MCF7 세포에 의한 흡수도를 나타낸 그래프이고, 도 1b의 FACS 분석은 10 μM의 본 발명 실시예 2(RU-2) 처리 후, 서로 다른 시점(30, 60 및 90 분)에서의 CD44 양성 MCF7 세포에 의한 흡수도를 나타낸 그래프이고, 도 1c의 FACS 분석은 10 μM의 본 발명 실시예 3(RU-3) 처리 후, 서로 다른 시점(30, 60 및 90 분)에서의 CD44 양성 MCF7 세포에 의한 흡수도를 나타낸 그래프이다.
도 2는 Cd133 양성 HCT-116 세포에서의 본 발명 실시예 1 처리 후, 공초점 현미경으로 관측된 세포 내 국소화 위치(localization)를 나타낸다: (도 2A) 미토콘드리아에서의 국소화 위치 - (a) 핵 염색 (b) 실시예 1의 발광 (c) Mito-tracker red 의 발광 (d) 중첩 이미지; (도 2B) 소포체에서의 국소화 위치 - (a) 핵 염색 (b) 실시예 1의 발광 (c) ER-tracker red의 발광 (d) 중첩 이미지.
도 3은 1, 5 및 10μM의 다른 농도의 실시예 1로 처리된 CD44 양성 MCF7 및 CD133 양성 HCT-116 세포에서의 세포 내 ROS 발생 정도를 나타내는 형광 이미지(도 3a) 및 1, 5 및 10μM의 다른 농도의 실시예 1로 처리된 CD44 양성 MCF7 및 CD133 양성 HCT-116 세포에서의 세포 내 ROS 발생 정도를 나타낸 그래프(도 3b)이다. 막대 그래프는 2',7'-디클로로플루오레신 디아세테이트의 평균 형광 강도를 나타낸다. 오차 막대는 세번의 독립적인 측정의 표준 편차를 나타낸다(**P<0.01, ***P<0.001 Vs 대조군(Control)).
도 4는 AOTF를 사용하여 수행한 본 발명 실시예 1 처리된 CD133 양성 HCT-116 세포에서의 MPTP, 세포질 칼슘 및 카스파제 3/7을 찾아내기 위한, 고함량 분석 결과를 도시한 이미지(도 4a) 및 그래프(도 4b)이다. 암 세포를 5 % CO2의 가습 분위기에서 37 시간 동안 16 시간 동안 Ru-1 (1, 5 및 10μM)의 다른 농도로 처리 하였고, 칼세인 AM, 칼슘 오렌지 및 매직 레드 카스파제 3/7의 형광 방출은 AOTF를 사용하여 각각 525nm, 580nm 및 630nm에서 모니터링되었다. 녹색 형광 이미지는 MPT의 세포 이미지에 해당하고 주황색 형광 이미지(도 4a)는 세포질 칼슘을 나타내며 적색 형광 이미지는 카스파제 3/7을 나타낸다. 막대 그래프(도 4b)는 칼세인 AM, 칼슘 지시약 오렌지 및 카스파제 3/7의 평균 형광 강도를 나타낸다.
도 5는 본 발명 실시예 1 처리된 CD133 양성 HCT116 세포에서의 세포 사멸 유도 및 항-세포 사멸 단백질의 발현을 나타낸 이미지 및 그래프이다: 도 5a. Bax(1열-DAPI, 2열-Bax, 3열-중첩)의 발현; 도 5b. Bak(1열-DAPI, 2열-Bak, 3열-중첩)의 발현; 도 5c. Bcl-2(1열-DAPI, 2열-Bcl-2, 3열-중첩)의 발현; 도 5d. 대조군 또는 실시예 1 처리된 세포에서의, Bcl-2, Bax 및 Bak의 웨스턴 블롯 분석; 및 도 5e. 그래프는 대조군 대비 실시예 1 처리에 따른 Bcl-2, Bax 및 Bak의 상대적인 발현을 도시한 그래프이다. 오차 막대는 세번의 독립적인 측정의 표준 편차를 나타낸다(* P <0. ** P <0.01, Vs Control).
도 6은 Discovery Studio의 CDOCKER 프로그램으로부터 얻어진 GRP 78로 도킹된 본 발명 실시예 1의 이미지이다.
도 7: 도 7a는 pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 및 pAC-ATR-GFP1-N1으로 형질감염된 HEK293 세포에서 본 발명 실시예 1의 상이한 농도에 따른 (a) GRP78, (b) 클루스테린(Clusterin), (c) ATR의 발현을 나타낸 이미지이고; 도 7b는 본 발명 실시예 1의 각각의 상이한 농도에서의 플라스미드 형질감염된 HEK293 세포에서의 GFP,RFP 및 GFP의 평균 형광 강도를 나타낸 막대 그래프이고; 도 7c는 본 발명 실시예 1로 처리된 CD133 양성 HCT116 세포에서 GRP78의 mRNA 발현을 나타낸 그래프이다. 여기서, mRNA 발현은 RT-PCR로 분석되었다; 도 7d는 대조군 또는 본 발명 실시예 1(0, 6, 및 12μM)로 처리된 CD133 양성 HCT116 세포에서의 GRP78의 발현을 나타낸다. GRP-78의 발현 형광은 ER tracker red의 형광과 일치된다; 도 7e는 각각 다른 농도의 실시예 1로 처리된 CD133 양성 HCT 암 세포에서 GRP-78의 평균 형광 강도를 나타낸 막대 그래프이고; 도 7f는 대조군 또는 실시예 1 처리된 CD133 양성 HCT116 세포에서 GRP78의 발현을 나타낸 웨스턴 블롯이고; 및 도 7g는 대조군 대비 GRP-78의 상대적 발현을 나타낸 막대 그래프이다. 오차 막대는 세번의 독립적인 측정의 표준 편차를 나타낸다(** P <0.01, Vs Control).
도 8: 도 8a. 처치 프로토콜: 마우스에 CD133 양성 HCT116 세포를 0일 시점에 정맥 주사하였고, 14-18일의 시점에서 본 발명 실시예 1을 마우스에 처치하여 치료하였다. 마우스는 실험 마지막 날에 희생되었다; 도 8b. 실험용 마우스의 사진(대조군, 저용량 및 고용량 처치); 도 8c. 실험용 마우스에서 분리한 종양의 사진대조군, 저용량 및 고용량 처치); 도 8d. 치료 기간 동안의 실험용 마우스의 종양 부피; 도 8e. 실험용 마우스로부터 분리된 종양 이종이식된 종양의 무게; 도 8f. 대조군 또는 본 발명 실시예 1 처리된 실험용 마우스에서 Alexaflour680으로 표지된 CD133 항체의 형광 방출을 나타낸 이미지이고; 및 도 8g는 Alexaflour680으로 표지된 CD133 항체의 형광 강도를 나타낸 그래프이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 하기 화학식 1로 표시되는 착화합물, 이의 입체 이성질체, 또는 이의 약학적으로 허용 가능한 염을 제공한다.
[화학식 1]
Figure PCTKR2018016898-appb-I000023
상기 화학식 1에 있어서,
X는 Cl-, PF6 -, Br-, BF4 -, ClO4 -, CF3SO3 - 및 SO4 -2로 이루어진 군으로 부터 선택되는 1종 이상이고;
상기 n은 0 내지 5의 정수이고;
y는 1 내지 3의 정수이고;
z는 0 내지 3이고;
Lig는 각각 독립적으로, 하기로 이루어진 군으로부터 선택되는 리간드이고,
Figure PCTKR2018016898-appb-I000024
,
Figure PCTKR2018016898-appb-I000025
,
Figure PCTKR2018016898-appb-I000026
,
Figure PCTKR2018016898-appb-I000027
,
Figure PCTKR2018016898-appb-I000028
,
Figure PCTKR2018016898-appb-I000029
, 및
Figure PCTKR2018016898-appb-I000030
;
R1
Figure PCTKR2018016898-appb-I000031
또는
Figure PCTKR2018016898-appb-I000032
이고;
R2a, R2b, R2c, R2d, R2e 및 R2f는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고;
상기 R3a, R3b, R3c, R3d, R3e, R3f, R3g, R3h, R3i 및 R3j는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고,
상기 R4a, R4b, R4c, R4d, R4e, R4f, R4g, 또는 R4h는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환된다.
본 발명의 일 양태에서, 상기 화학식 1로 표시되는 착화합물은 하기 화학식 1'의 착화합물일 수 있다.
[화학식 1']
Figure PCTKR2018016898-appb-I000033
여기서, 상기 R1, X, n은 상기 화학식 1에서 정의한 바와 같다.
본 발명의 일 구체예에서, 상기 화학식 1로 표시되는 착화합물은,
Figure PCTKR2018016898-appb-I000034
; 또는
Figure PCTKR2018016898-appb-I000035
일 수 있다.
한편, 상기 화학식 1로 표시되는 착화합물에 있어서, 본 발명의 Ru 착화합물의 Lig(리간드)는 이좌배위자(bidentate)의 리간드를 사용할 수 있다.
본 발명의 일 측면에서, 상기 Ru 착화합물은 세포질의 약산성 상태에서 이온화 되고, 이로부터 Ru(II) 착화합물은 특히 암 세포의 미토콘드리아 또는 ER에 축적된다. 이러한 축적은 계속해서 ROS(활성산소종)의 생성을 유도하게 되는 것이다. 보통 이러한 ROS 생성을 암세포는 항산화 단백질 발현을 조절하여 억제하거나 조절하게 되는데, 본 발명 Ru 착화합물은 ROS 생성 외에도, 이러한 항산화 단백질 발현 자체를 억제하는 바, 세포에 부하되는 산화 스트레스를 크게 상승시키고, 또한 암세포의 사멸 아포톱시스를 적극적으로 유도하여, 결국 암과 암줄기세포를 사멸시키는 효과를 나타낸다.
따라서, 본 발명의 Ru 착화합물은 암의 예방 또는 치료용 약학적 조성물의 유효성분으로 유용하고, 나아가, 본 발명에서 규명한 바와 같이, 특히 세포 유입이 용이하고 신속한 바, 더욱 우수한 항암제로 사용될 수 있다.
한편, 본 발명의 일 측면에서, 본 발명의 신규 Ru 착화합물은 암과 암줄기세포에 대한 사멸효과 외에, 암의 내성 발생 기작을 억제하는 우수한 효과를 나타낸다. 구체적으로, 종래 암 내성 발생기작으로, 암줄기세포(CSC)에 의한 GRP-78의 발현 증대로부터 항암제에 대한 내성이 발생되는 것으로 규명된 바 있다. 때문에 GRP-78에 대한 억제 활성은 항암제 내성 발생을 억제 또는 방지할 수 있는 중요한 경로이다.
본 발명의 일 구체예에서는, 본 발명의 신규 Ru 착화합물이 GRP-78 발현과 활성을 현저하게 억제시키는 것을 확인하였다. 특히, 본 발명 Ru 착화합물이 GRP-78의 발현을 억제할 뿐 아니라, GRP-78 이량체에 결합(binding)되어, 이의 활성이 억제됨을 실험적으로 확인한 바, 그 의미가 있고, 이를 암 세포주에서 CSC만을 분리하여 대상으로 확인한 바, 암줄기세포의 내성 발생 기작이 현저히 억제됨을 규명한 것이다. 따라서, 본 발명의 신규 Ru 착화합물은 항암제 내성 억제용 조성물로 사용될 수 있고, 특히 종래 화학 요법제, 예를 들어 백금계 화학 요법제의 내성을 나타내는 암에 있어서, 병용 처치할 수 있는 항암용 보조제로 유용하게 사용될 수 있다.
또한, 본 발명은 하기 화학식 2로 표시되는 착화합물, 이의 입체 이성질체, 또는 이의 약학적으로 허용 가능한 염을 제공한다.
[화학식 2]
Figure PCTKR2018016898-appb-I000036
상기 화학식 2에 있어서,
X는 Cl-, PF6 -, Br-, BF4 -, ClO4 -, CF3SO3 - 및 SO4 -2로 이루어진 군으로 부터 선택되는 1종 이상이고;
상기 n은 0 내지 5의 정수이고;
y는 1 내지 2의 정수이고;
z는 0 내지 1이고;
Lig는 각각 독립적으로, 하기로 이루어진 군으로부터 선택되는 리간드이고,
Figure PCTKR2018016898-appb-I000037
,
Figure PCTKR2018016898-appb-I000038
,
Figure PCTKR2018016898-appb-I000039
,
Figure PCTKR2018016898-appb-I000040
,
Figure PCTKR2018016898-appb-I000041
,
Figure PCTKR2018016898-appb-I000042
, 및
Figure PCTKR2018016898-appb-I000043
;
R1
Figure PCTKR2018016898-appb-I000044
또는
Figure PCTKR2018016898-appb-I000045
이고;
R2a, R2b, R2c, R2d, R2e 및 R2f는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고;
상기 R3a, R3b, R3c, R3d, R3e, R3f, R3g, R3h, R3i, R3j, 및 R3k는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고,
상기 R4a, R4b, R4c, R4d, R4e, R4f, R4g, 또는 R4h는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환된다.
본 발명의 일 측면에서, 상기 화학식 2로 표시되는 착화합물은, 하기 화학식 2'의 착화합물일 수 있다.
[화학식 2']
Figure PCTKR2018016898-appb-I000046
여기서, 상기 R1, X, n은 상기 화학식 2에서 정의한 바와 같다.
본 발명의 일 구체예에 있어서, 상기 화학식 2로 표시되는 착화합물은,
Figure PCTKR2018016898-appb-I000047
일 수 있다.
한편, 상기 화학식 2로 표시되는 착화합물에 있어서, 본 발명의 Ru 착화합물의 Lig(리간드)는 삼좌배위자(tridentate)의 리간드를 사용할 수 있다. 특히, 상기 화학식 2로 표시되는 착화합물에 있어서, Lig로 표시되는 리간드는 삼좌배위자 리간드이면 제한 없이 사용될 수 있고, 본 발명은 이를 포함한다.
본 발명의 일 측면에서, 상기 Ru 착화합물은 세포질의 약산성 상태에서 이온화 되고, 이로부터 Ru(II) 착화합물은 특히 암 세포의 미토콘드리아 또는 ER에 축적된다. 이러한 축적은 계속해서 ROS(활성산소종)의 생성을 유도하게 되는 것이다. 보통 이러한 ROS 생성을 암세포는 항산화 단백질 발현을 조절하여 억제하거나 조절하게 되는데, 본 발명 Ru 착화합물은 ROS 생성 외에도, 이러한 항산화 단백질 발현 자체를 억제하는 바, 세포에 부하되는 산화 스트레스를 크게 상승시키고, 또한 암세포의 사멸 아포톱시스를 적극적으로 유도하여, 결국 암과 암줄기세포를 사멸시키는 효과를 나타낸다. 특히, 종래의 백극 화학 요법제(항암제)인 시스플라틴의 암세포 사멸 효과에 비하여, 보다 우수한 사멸 효과가 나타남을 본 발명에서 입증하였다(하기 실험예 1, 표 2 참조).
따라서, 본 발명의 Ru 착화합물은 암의 예방 또는 치료용 약학적 조성물의 유효성분으로 유용하고, 나아가, 본 발명에서 규명한 바와 같이, 특히 세포 유입이 용이하고 신속한 바, 더욱 우수한 항암제로 사용될 수 있다.
한편, 본 발명의 일 측면에서, 본 발명의 신규 Ru 착화합물은 암과 암줄기세포에 대한 사멸효과 외에, 암의 내성 발생 기작을 억제하는 우수한 효과를 나타낸다. 구체적으로, 종래 암 내성 발생기작으로, 암줄기세포(CSC)에 의한 GRP-78의 발현 증대로부터 항암제에 대한 내성이 발생되는 것으로 규명된 바 있다. 때문에 GRP-78에 대한 억제 활성은 항암제 내성 발생을 억제 또는 방지할 수 있는 중요한 경로이다.
본 발명의 일 구체예에서는, 본 발명의 신규 Ru 착화합물이 GRP-78 발현과 활성을 현저하게 억제시키는 것을 확인하였다. 특히, 본 발명 Ru 착화합물이 GRP-78의 발현을 억제할 뿐 아니라, GRP-78 이량체에 결합(binding)되어, 이의 활성이 억제됨을 실험적으로 확인한 바, 그 의미가 있고, 이를 암 세포주에서 CSC만을 분리하여 대상으로 확인한 바, 암줄기세포의 내성 발생 기작이 현저히 억제됨을 규명한 것이다. 따라서, 본 발명의 신규 Ru 착화합물은 항암제 내성 억제용 조성물로 사용될 수 있고, 특히 종래 화학 요법제, 예를 들어 백금계 화학 요법제의 내성을 나타내는 암에 있어서, 병용 처치할 수 있는 항암용 보조제로 유용하게 사용될 수 있다.
본 발명의 일 측면에서, 본 발명의 화학식 1 또는 화학식 2로 표시되는 착화합물은 약학적으로 허용 가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용 가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산, 아인산 등과 같은 무기산류, 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류 등과 같은 무독성 유기산, 아세트산, 안식향산, 구연산, 젖산, 말레인산, 글루콘산, 메탄설폰산, 4-톨루엔설폰산, 주석산, 푸마르산 등과 같은 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염의 종류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 다이하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트, 만델레이트 등을 포함한다.
본 발명에 따른 산 부가염은 통상의 방법으로 제조할 수 있으며, 예를 들면 화학식 1 또는 화학식 2의 유도체를 메탄올, 에탄올, 아세톤, 디클로로메탄, 아세토니트릴 등과 같은 유기용매에 녹이고 유기산 또는 무기산을 가하여 생성된 침전물을 여과, 건조시켜 제조하거나, 용매와 과량의 산을 감압 증류한 후 건조시켜 유기용매 하에서 결정화시켜서 제조할 수 있다.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 음염(예, 질산은)과 반응시켜 얻는다.
나아가, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물 및 이의 약학적으로 허용가능한 염뿐만 아니라, 이로부터 제조될 수 있는 용매화물, 광학 이성질체, 수화물 등을 모두 포함한다.
나아가, 본 발명은 하기 반응식 1에 나타난 바와 같이,
화학식 3으로 표시되는 화합물로부터 화학식 4로 표시되는 화합물을 제조하는 단계;
상기 단계에서 제조된 화학식 4로 표시되는 화합물로부터 화학식 1로 표시되는 착화합물을 제조하는 단계;를 포함하는 상기 화학식 1로 표시되는 착화합물의 제조방법을 제공한다:
[반응식 1]
Figure PCTKR2018016898-appb-I000048
상기 반응식 1에 있어서,
X, n, y, z, Lig, R1, R2a, R2b, R2c, R2d, R2e 및 R2f는 상기 화학식 1에서 정의한 바와 같다.
본 발명의 반응식 1 제조방법에 있어서, 일 측면에서 상기 제조방법은 하기 반응식 1'로 표시되는 제조방법과 같이 수행될 수 있다.
[반응식 1']
Figure PCTKR2018016898-appb-I000049
이하, 본 발명 화학식 1로 표시되는 착화합물의 제조방법을 단계별로 상세히 설명한다.
상기 반응식 1에 있어서,
단계 (a)는 1, 10-페난스롤린-5,6-디온으로부터 단계 (a) 목적 화합물이 제조될 수 있는 방법이라면, 이를 제한없이 포함하나, 일 구체예로, 플루오렌-2-카복스알데히드, 암모늄 아세테이트, 빙초산을 환류시키는 것으로 진행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 바람직하게 반응 시간은 3시간 내지 8시간으로 수행될 수 있다.
또한, 단계 (b)는 단계(a)에서 제조된 화합물, cis-[Ru(bpy)2Cl2].2H2O을 에틸렌 글리콜에서 반응시키는 것으로 수행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 바람직하게 N2 분위기하에 90 내지 150℃에서, 반응 시간은 5시간 내지 10시간으로 수행될 수 있다.
한편, 상기 반응식 1'의 단계 (c)는 1, 10-페난스롤린-5,6-디온으로부터 단계 (c) 목적 화합물이 제조될 수 있는 방법이라면, 이를 제한없이 포함하나, 일 구체예로, 4-(디메틸아미노)-1-나프트알데히드, 플루오렌-2-카복스알데히드, 암모니아 아세테이트, 빙초산을 환류시키는 것으로 진행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 바람직하게 반응 시간은 3시간 내지 8시간으로 수행될 수 있다.
또한, 본 발명은 하기 반응식 2에 나타난 바와 같이,
화학식 5로 표시되는 화합물로부터 화학식 6으로 표시되는 화합물을 제조하는 단계;
상기 단계에서 제조된 화학식 6으로 표시되는 화합물로부터 화학식 2로 표시되는 착화합물을 제조하는 단계;를 포함하는 상기 화학식 2로 표시되는 착화합물의 제조방법:
[반응식 2]
Figure PCTKR2018016898-appb-I000050
상기 반응식 2에 있어서,
X, n, y, z, Lig, R1, R2a, R2b, R2c, R2d, R2e 및 R2f는 상기 화학식 2에서 정의한 바와 같다.
본 발명의 반응식 2 제조방법에 있어서, 일 측면에서 상기 제조방법은 하기 반응식 2'로 표시되는 제조방법과 같이 수행될 수 있다.
[반응식 2']
Figure PCTKR2018016898-appb-I000051
이하, 본 발명 화학식 2로 표시되는 착화합물의 제조방법을 단계별로 상세히 설명한다.
상기 반응식 2에 있어서,
단계 (a)는 1, 2,4,6-트리클로로-1,3,5-트리아진으로부터 단계 (a) 목적 화합물이 제조될 수 있는 방법이라면, 이를 제한없이 포함하나, 일 구체예로, N,N-디에틸아닐린과 반응시키는 것으로 진행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 바람직하게 반응 온도는 50 내지 90℃일 수 있고, 반응 시간은 5시간 내지 12시간으로 수행될 수 있다.
또한, 단계 (b)는 단계(a)에서 제조된 화합물, 3,5-디메틸피라졸, K 메탈을 THF에서 환류시키는 것으로 수행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 반응 시간은 5시간 내지 12시간으로 수행될 수 있다.
한편, 상기 반응식 2'의 단계 (c)는 2,2':6',2''-테르피리딘(Terpyridine)으로부터 단계 (c) 목적 화합물이 제조될 수 있는 방법이라면, 이를 제한없이 포함하나, 일 구체예로, 테르피리딘, RuCl3.3H2O를 에탄올에서 환류시키는 것으로 진행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 바람직하게 반응 시간은 1시간 내지 5시간으로 수행될 수 있다.
또한, 단계 (d)는 상기 단계(c)에서 제조한 화합물과, 상기 단계(b)에서 제조한 화합물로부터 최종 목적 화합물인, 본 발명 Ru 착화합물을 제조할 수 있는 방법이라면, 제한 없이 본 발명에 포함되나, 일 구체예로, 상기 단계(c)에서 제조한 화합물과, 상기 단계(b)에서 제조한 화합물을 에틸렌 글리콜에서 반응시키는 것으로 진행될 수 있다.
여기서, 반응 조건, 예를 들어, 용매, 반응 온도 및 반응 시간은 특별한 제약 없이, 통상의 기술자가 제조되는 목적 화합물의 수율 및 부반응 정도 등을 고려하여, 조절할 수 있고, 본 발명은 이를 제한 없이 포함하나, 바람직하게 N2 분위기하에 환류시켜, 반응 시간은 12시간 내지 36시간으로, 또는 밤새도록 수행될 수 있다.
나아가, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 일 측면에서, 상기 약학적 조성물은 본 발명 Ru 착화합물, 즉 화학식 1 또는 화학식 2로 표시되는 착화합물을 유효성분으로 함유하며, 특히, 본 발명의 실험예에서 보인 바와 같이, 항암 활성(암 또는 암 줄기세포의 사멸 효과, ROS 생성 유도 효과)을 나타내고, 암 또는 암 줄기세포의 ROS 방어 기작인 효소적, 비효소적 항산화 단백질 발현을 유의미하게 억제하는 효과를 나타낸다.
이에, 본 발명의 Ru 착화합물을 유효성분으로 하는 암의 예방 또는 치리용 약학적 조성물은 본 발명의 Ru 착화합물이 암 또는 암줄기세포로 세포 유입이 우수함을 확인하였고, 특히 세포질의 약산성 조건에서 이온화 되어 미토콘드리아, 또는 ER에 축적됨을 확인하였으며, 이로부터 ROS 생성이 현저함을 확인하였다. 또한, 효소적, 비효소적 항산화 단백질 발현을 유의미하게 억제하고, 사멸 유도(pro-apotopsis) 단백질 발현이 유의미하게 증가되는 것으로부터, 암 또는 암줄기세포에 비가역적 산화 스트레스를 유발하고, 이로부터 우수한 세포 사멸(apotopsis) 효과를 입증하였다. 나아가, 대장암 또는 유방암의 암세포주, 암줄기세포(CSC)의 In vitro 실험 외에도, 생체 내 동물 모델 실험에서, 항암제로 우수하게 사용될 수 있음이 입증되는 바, 본 발명의 Ru 착화합물을 유효성분으로 하는 암의 예방 또는 치리용 약학적 조성물의 유용함을 알 수 있다.
한편, 상기 암에 있어서, 본 발명이 상술한 바와 같이, 실험적으로 입증한 효과를 기반으로 치료될 수 있는 암이라면, 제한 없이 포함되나, 바람직하게 상기 암은, 가성점액종, 간내 담도암, 간모세포종, 간암, 갑상선암, 결장암, 고환암, 골수이형성증후군, 교모세포종, 구강암, 구순암, 균상식육종, 급성골수성백혈병, 급성림프구성백혈병, 기저세포암, 난소상피암, 난소생식세포암, 남성유방암, 뇌암, 뇌하수체선종, 다발성골수종, 담낭암, 담도암, 대장암, 만성골수성백혈병, 만성림프구백혈병, 망막모세포종, 맥락막흑색종, 미만성거대B세포림프종, 바터팽대부암, 방광암, 복막암, 부갑상선암, 부신암, 비부비동암, 비소세포폐암, 비호지킨림프종, 설암, 성상세포종, 소세포폐암, 소아뇌암, 소아림프종, 소아백혈병, 소장암, 수막종, 식도암, 신경교종, 신경모세포종, 신우암, 신장암, 심장암, 십이지장암, 악성 연부조직 암, 악성골암, 악성림프종, 악성중피종, 악성흑색종, 안암, 외음부암, 요관암, 요도암, 원발부위불명암, 위림프종, 위암, 위유암종, 위장관간질암, 윌름스암, 유방암, 육종, 음경암, 인두암, 임신융모질환, 자궁경부암, 자궁내막암, 자궁육종, 전립선암, 전이성 골암, 전이성뇌암, 종격동암, 직장암, 직장유암종, 질암, 척수암, 청신경초종, 췌장암, 침샘암, 카포시 육종, 파제트병, 편도암, 편평상피세포암, 폐선암, 폐암, 폐편평상피세포암, 피부암, 항문암, 횡문근육종, 후두암, 흉막암, 및 흉선암으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다.
나아가, 바람직하게 상기 암은 급성 골수 백혈병(AML); 만성적 골수성 백혈병(CML); 급성 림프아구성 백혈병(ALL); 만성적 림프구성 백혈병(CLL); 호지킨 질환(HD); 비-호지킨 림프종(NHL); B-세포 림프종; T-세포 림프종; 다발성 골수종(MM); 아밀로이드증; 발덴스트롬 거대글로불린혈증; 골수이형성 증후군(MDS); 작은 림프구 림프종(SLL); 변연부 림프종; 무증상 다발성 골수종; 및 골수증식성 증후군으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다.
본 명세서에서 사용된 바와 같이, 용어 "암"은 조절되지 않는 또는 이상조절된 세포 증식, 감소된 세포성 분화, 주위의 조직에 침입하는 부절적한 능력, 및/또는 이소성 부위에서 신규 성장을 확립하는 능력을 특징으로 하는 세포성 장애를 의미한다. 용어 "암"은 비제한적으로, 고형 종양 및 혈액매개 종양 (혈액성 악성종양)을 포함한다. 용어 "암"은 피부, 조직, 기관, 골, 연골, 혈액, 및 혈관의 질환을 포함한다. 용어 "암"은 추가로, 1차 및 전이암을 포함한다.
상기 고형 종양은 췌장암; 침습성 방광암 포함하는 방광암; 결장직장암; 갑상선암, 위암, 전이성 유방암을 포함하는 유방암; 안드로겐-의존적 및 안드로겐-독립적인 전립선암을 포함하는 전립선암; 예를 들면, 전이성 신장 세포 암종을 포함하는 신장암; 예를 들면 간세포 암 및 간내 담관을 포함하는 간암; 비-소세포 폐암 (NSCLC), 편평상피 폐암, 세기관지폐포 암종 (BAC), 폐의 선암종, 및 소세포 폐암 (SCLC)을 포함하는 폐 및 기관지 암; 예를 들면, 진행성 상피성 또는 1차 복막 암을 포함하는 난소암; 자궁경부암; 예를 들면 자궁 체부 및 자궁 경부를 포함하는 자궁암; 자궁내막 암; 위암; 식도암; 예를 들면, 두경부의 편평상피 세포 암종, 비인두 암, 구강 및 인두를 포함하는 두경부 암; 흑색종; 전이성 신경내분비 종양을 포함하는 신경내분비 암; 예를 들면, 신경아교종/교모세포종, 역형성 희소돌기아교세포종, 성인 교모세포종 다형성, 및 성인 역형성 별아교세포종을 포함하는 뇌암; 전이성 신경내분비 종양; 골 암이고; 그리고 연조직 육종을 포함하는 신경내분비를 포함한다.
상기 혈액성 악성종양은 급성 골수 백혈병 (AML); 만성적 골수성 백혈병 (CML) (가속화된 CML 및 CML 아세포기 (CML-BP) 포함); 급성 림프아구성 백혈병 (ALL); 만성적 림프구성 백혈병 (CLL); 호지킨 질환 (HD); 비-호지킨 림프종 (NHL) (여포성 림프종 및 외투 세포 림프종 포함); B-세포 림프종 (미만성 큰 B-세포 림프종 (DLBCL) 포함); T-세포 림프종; 다발성 골수종 (MM); 아밀로이드증; 발덴스트롬 거대글로불린혈증; 골수이형성 증후군 (MDS) (난치의 빈혈 (RA), 관상 철아구 (RARS)를 갖는 난치의 빈혈 (과다 모세포 (RAEB), 및 형질전환 동반 RAEB (RAEB-T)를 갖는 난치의 빈혈) 포함); 작은 림프구 림프종 (SLL); 변연부 림프종; 무증상 다발성 골수종; 및 골수증식성 증후군을 포함한다.
또한, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 항암제 내성 억제용 조성물을 제공한다.
본 발명의 일 측면에서, 본 발명의 신규 Ru 착화합물은 상술한 항암제로서의 효과와 함께, 암의 항암제 내성을 발생시키는 기작인, CSC(암줄기세포)의 GRP-78의 발현, 및 활성 증가를 통하는 내성 발생을 우수하게 억제할 수 있음을 실험적으로 입증하였다. 특히 농도 증가에 따라 비례적 억제 활성을 입증하였을 뿐 아니라, 매우 적은 농도로도 유의미한 GRP-78의 발현, 및 활성을 우수하게 억제할 수 있음이 실험적으로 입증되는 바, 본 발명 신규 Ru 착화합물을 기존 항암제에 대한 내성을 가지는 암, 또는 암줄기세포를 대상으로 유용한 내성 억제용 조성물로 사용될 수 있다.
본 발명의 또 다른 측면에서, 배경기술에서 기술한 바와 같이, 종래 화학 요법제(항암제)는 암줄기세포(CSC)의 내성 발생 기작으로, 내성이 생겨 더 이상 약물 치료 효과가 없어지거나, 적어지는 것 등의 문제가 있었고, 또한 약물 부작용 문제가 있었다. 종래 화합 요법제 중 특히, 전이금속 착화합물, 예를 들어 백금 착화합물의 내성과 부작용 문제는 CSC의 내성 작용으로부터 한계를 들어내는 것으로 보고되었다.
이러한 관점에서, 본 발명이 입증한 신규 Ru 착화합물의 CSC의 내성 발생 기작의 억제 효과는 매우 중요한 것이고, 이로부터 본 발명 Ru 착화합물을 종래 화학 요법제와 함께 병용, 전 처리 또는 후 처리 등의 제한 없는 방법으로 암, 또는 암줄기세포의 항암제 내성을 억제할 수 있는 치료제로서 유용할 것이다.
따라서, 본 발명은 상기 항암제 내성 억제용 조성물, 및 화학 요법제를 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
상술된 바와 같이, 본 발명이 GRP-78 발현 및 활성을 농도 의존적으로 억제함이 입증되었고, 이로부터 실제 암세포, 또는 암줄기세포에서 우수한 세포 사멸 효과를 확인하였을 뿐 아니라, 동물 모델 실험에서도, 그 효과를 입증한 바, 본 발명 신규 Ru 착화합물은 그 자체로 항암제로 사용될 수 있고, 또는 종래 화학 요법제(항암제)와 병용 처리될 수 있는 치료제로서 유용하게 제공된다.
여기서, 상기 암은 본 명세서에 암으로 설명되는 모든 암종을 포함하며, 이의 1종 또는 1종 이상을 말한다.
상술된 본 발명에 따른 약학적 조성물에 있어서, 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염은 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충전제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 제조될 수 있다.
경구 투여용 제형으로는 예를 들면 정제, 환제, 경/연질 캅셀제, 액제, 현탁제, 유화제, 시럽제, 과립제, 엘릭시르제, 트로키제 등이 있는데, 이들 제형은 유효성분 이외에 희석제(예: 락토즈, 덱스트로즈, 수크로즈, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신), 활택제(예: 실리카, 탈크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/또는 폴리에틸렌 글리콜)를 함유하고 있다. 정제는 마그네슘 알루미늄 실리케이트, 전분 페이스트, 젤라틴, 메틸셀룰로즈, 나트륨 카복시메틸셀룰로즈 및/또는 폴리비닐피롤리딘 등과 같은 결합제를 함유할 수 있으며, 경우에 따라 전분, 한천, 알긴산 또는 그의 나트륨 염 등과 같은 붕해제 또는 비등 혼합물 및/또는 흡수제, 착색제, 향미제, 및 감미제를 함유할 수 있다.
상기 화학식 1 또는 화학식 2로 표시되는 착화합물을 유효 성분으로 하는 약학적 조성물은 비경구 투여할 수 있으며, 비경구 투여는 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내 주사를 주입하는 방법에 의하였다.
이때, 비경구 투여용 제형으로 제제화하기 위하여 상기 화학식 1 또는 화학식 2로 표시되는 착화합물 또는 이의 약학적으로 허용 가능한 염을 안정제 또는 완충제와 함께 물에 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알 단위 투여형으로 제조할 수 있다. 상기 조성물은 멸균되고/되거나 방부제, 안정화제, 수화제 또는 유화 촉진제, 삼투압 조절을 위한 염 및/또는 완충제 등의 보조제, 및 기타 치료적으로 유용한 물질을 함유할 수 있으며, 통상적인 방법인 혼합, 과립화 또는 코팅 방법에 따라 제제화할 수 있다.
상기 제제화의 예시는 통상적인 제제예에 관한 것일 뿐, 본 발명의 제제화가 이에 제한되지는 않음을 통상의 기술지식을 가진 자라면 용이하게 이해할 수 있다.
나아가, 본 발명의 상기 화학식 1 또는 화학식 2로 표시되는 착화합물 또는 이의 약학적으로 허용 가능한 염의 인체에 대한 투여량은 대상의 나이, 몸무게, 성별, 투여형태, 건강상태 및 질환 정도에 따라 달라질 수 있으며, 몸무게가 70Kg인 성인 대상를 기준으로 할 때, 일반적으로 0.1-1000 mg/일이며, 바람직하게는 1-500 mg/일이며, 또한 의사 또는 약사의 판단에 따라 일정시간 간격으로 1일 1회 내지 수회로 분할 투여할 수도 있다.
나아가, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 암의 예방 또는 개선용 건강기능식품 조성물을 제공한다.
이때, 상기 암은 상술된 모든 암 질환을 말하며, 비제한적인 예로, 상기 암은 가성점액종, 간내 담도암, 간모세포종, 간암, 갑상선암, 결장암, 고환암, 골수이형성증후군, 교모세포종, 구강암, 구순암, 균상식육종, 급성골수성백혈병, 급성림프구성백혈병, 기저세포암, 난소상피암, 난소생식세포암, 남성유방암, 뇌암, 뇌하수체선종, 다발성골수종, 담낭암, 담도암, 대장암, 만성골수성백혈병, 만성림프구백혈병, 망막모세포종, 맥락막흑색종, 미만성거대B세포림프종, 바터팽대부암, 방광암, 복막암, 부갑상선암, 부신암, 비부비동암, 비소세포폐암, 비호지킨림프종, 설암, 성상세포종, 소세포폐암, 소아뇌암, 소아림프종, 소아백혈병, 소장암, 수막종, 식도암, 신경교종, 신경모세포종, 신우암, 신장암, 심장암, 십이지장암, 악성 연부조직 암, 악성골암, 악성림프종, 악성중피종, 악성흑색종, 안암, 외음부암, 요관암, 요도암, 원발부위불명암, 위림프종, 위암, 위유암종, 위장관간질암, 윌름스암, 유방암, 육종, 음경암, 인두암, 임신융모질환, 자궁경부암, 자궁내막암, 자궁육종, 전립선암, 전이성 골암, 전이성뇌암, 종격동암, 직장암, 직장유암종, 질암, 척수암, 청신경초종, 췌장암, 침샘암, 카포시 육종, 파제트병, 편도암, 편평상피세포암, 폐선암, 폐암, 폐편평상피세포암, 피부암, 항문암, 횡문근육종, 후두암, 흉막암, 및 흉선암으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다.
나아가, 본 발명은 상기 화학식 1 또는 화학식 2로 표시되는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 치료학적으로 유효한 양으로 대상(subject)에게 투여하는 단계를 포함하는 암의 치료 방법을 제공한다.
이때, 상기 치료학적 유효량은 투여 방법에 따라, 체내로 투여시 대상(subject)의 증상 또는 상태를 치료, 예방 또는 개선시킬 수 있을 정도의 양을 말한다. 또한 상기 양은 투여하는 대상의 체중, 나이, 성별, 상태, 가족력에 따라 상이할 수 있고, 본 발명에서 상기 치료 방법은 이처럼 대상별로 상이한 조건에 따라 다른 양의 투여량을 정할 수 있다.
상기 "유효한 양"은, 예를 들어 암을 치료하는데 유효한 양이다. 다른 구체예에서, 화합물의 "유효한 양"은 암 또는 암줄기세포 사멸을 야기시킬수 있는 양이다.
본 발명의 방법에 따른 착화합물 및 조성물은 질환을 치료하는데 유효한 임의의 양 및 임의의 투여 경로를 사용하여 투여될 수 있다. 필요한 정확한 양은 대상(subject)의 종, 연령, 및 일반적인 병태, 감염의 중증도, 특정한 제제, 그것의 투여 방식, 등에 따라 대상별로 변할 것이다. 본 발명의 착화합물은 복용량의 투여 용이성 및 균일성에 대해 투약량 단위 형태로 빈번하게 제형화된다. 표현 "투약량 단위 형태"는, 본 명세서에서 사용된 바와 같이 치료될 대상에 적절한 제제의 물리적으로 별개의 단위를 의미한다. 또한, 본 발명의 착화합물 및 조성물의 총 일일 사용량이 건전한 의료 판단의 범위 내에 주치의에 의해 결정될 것으로 이해될 것이다. 임의의 특정한 대상 또는 유기체에 대한 특정 유효한 투여 수준은 하기를 포함하는 다양한 인자에 의존된다: 치료될 질환 및 질환의 중증도; 이용된 특정 화합물의 활성; 특정 조성물 이용된; 연령, 체중, 일반적인 건강, 대상의 성별 및 다이어트; 투여 시간, 투여 경로, 및 이용된 특정 화합물의 배출 속도; 치료의 지속시간; 이용된 특정 화합물 단독 또는 공동투여된 약물, 및 의료 기술에서 잘 알려진 이 외의 요인.
용어 "대상(subject)"은, 본 명세서에서 사용된 바와 같이, 동물, 예를 들면 포유동물, 예컨대 인간을 의미한다.
본 발명 루테늄 착화합물은 항암 활성을 나타내고, 약제 내성 단백질과 항암 활성을 위한 세포 내 소기관을 표적으로하는 금속 착체인 것으로 확인된 바, 암줄기세포에서 다제 내성을 극복할 수 있다.
일반적으로 암 종양 미세 환경(pH 6.5-6.8)은 정상 조직(pH 7.4)에 비해 더 산성입니다. 이 종양 산성 pH에서, 생리 학적 조건에서 본 발명 Ru 착화합물의 양성자화는 보다 용이하며, 내부 미토콘드리아 막(IMM) 음전위에 보다 쉽게 이끌어지는 것으로 추측된다.
놀랍게도, 본 발명 Ru 착화합물은 미토콘드리아와 ER 모두에 공존한다. 미토콘드리아 또는 ER에서 전이 금속 착화합물이 축적되면 펜톤형 산화 환원 반응을 통해 활성 산소 종(ROS)을 효과적으로 생성 할 수 있고, 이 특성은 전이 금속이 항산화 단백질을 동시에 비활성화시키고 산성 미세 환경 하에서 암세포에서 자유 라디칼을 생성 할 수 있게하는 바, 암 세포는 신진 대사 및 약리학적 부하를 ROS 독성의 한계점까지 견딜 수 있습니다. 또한 CSC는 증식성 암 세포와 비교하여 비효소 항산화 단백질뿐만 아니라 항산화 효소의 높은 수준을 나타내어, 이 생존 메커니즘으로부터 CSC가 화학 요법 약물에 대한 약물 내성을 개발할 수 있게 한다.
따라서, 암세포의 항산화 능을 억제하는 것뿐만 아니라 ROS 생성을 동시에 증가시키는 것과 같은 치료 전략은 비가역 산화 스트레스와 후속 세포 사멸을 유도 할 수 있는 바, 본 발명 Ru 착화합물은 처리 6 시간 이내에 농도 의존적으로 HCT-116 및 MCF-7 세포의 CSC에서 상승된 ROS 생성을 나타내고, 우수한 세포 독성을 나타내는 것이 확인되었다.
이하, 본 발명을 실시예 및 실험예에 의하여 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 이에 한정되는 것은 아니다.
루테늄 트리클로라이드 트리하이드레이트 및 기타 시약 또는 화학 물질은 Sigma Aldrich, South Korea에서 구입했습니다. 분석 등급 용매는 Alfa Aesar 또는 Sigma Aldrich South Korea에서 구입하여 반응에 사용하기 전에 20 분 동안 100 % 건조 질소로 탈기시켰다. 염소산 나트륨 용액의 제조에는 탈 이온수를 사용 하였다. 컬럼 정제를 위해 아세토 니트릴 및 톨루엔 상업용 용매를 사용하였고 한국 대정 화학 (Daejung Chemicals, Korea)에서 구입하였다.
<실시예 1> 루테늄 착화합물-1(RU-1)의 합성: [Ru(bdpta)(tpy)](ClO2)2
Figure PCTKR2018016898-appb-I000052
무수 에탄올(80 ml) 중 테르피리딘 2(300 mg, 1.29 mmol) 및 0.336 g의 RuCl3·3H2O(1.29 mmol)의 혼합물을 80℃에서 3시간 동안 환류시켰다. 과량의 에탄올을 회전 증발기로 농축시켜 적색 고체를 얻었으며,이를 디에틸에테르 및 헥산으로 세척하였다. 적색 고체 [Ru(tpy)Cl3]가 수득되었고, 건조시켜서, 추가의 스펙트럼 분석없이 합성의 다음 단계에 사용하였다. 400 mg의 [Ru(tpy)Cl3] 물질, 25 ml의 건조 에틸렌 글리콜 및 0.9 mmol의 bdpta 리간드를 넣고 N2 대기 하에서 밤새 170℃에서 환류시켰다. 이어서, 반응 혼합물을 실온으로 냉각시키고 1M NaClO4를 첨가하였다. 이어서, 회전 증발기에서 용매를 증발시켰다. 조질의 루테늄 착화합물을 중성 알루미나(CH3CN/톨루엔, 40/60, v/v)상에서 컬럼 크로마토그래피로 2회 정제하였다. 어두운 적갈색의 색 띠가 수집되었고, 포화 NaClO4를 첨가 한 다음, 용매를 증류시켜 ClO4 - 염으로서 생성물을 수득하였다. 이어서, 고체를 디에틸 에테르, 헥산으로 세척하고 진공하에 건조시켰다.
수율: 400 mg, 51.4%. Anal. Calcd for C38H39N11Ru (%): C, 60.78; H, 5.24; N, 20.52. Found: C, 60.82; H, 5.40; N, 20.75. . 1H NMR (400 MHz, Methanol-d4) δ 10.38 - 10.31 (m, 1H, tpy), 8.84 (dd, 1H, tpy), 8.69 (dd, J = 8.2, 1.4 Hz, 1H, tpy), 8.43 - 8.36 (m, 2H, aniline ring Ar proton), 8.35 - 8.25 (m, 2H, tpy), 7.98 (t, J = 7.9 Hz, 1H, tpy), 7.89 (ddd, J = 7.1, 5.7, 1.3 Hz, 1H, tpy), 7.66 (td, J = 7.7, 1.8 Hz, 1H, tpy), 7.20 - 7.10 (m, 2H, tpy), 6.97 - 6.89 (m, 2H, aniline ring Ar proton), 6.52 (dd, J = 7.7, 1.1 Hz, 1H, tpy), 6.31 (s, 2H, pyrazole CH proton), 3.61 (q, J = 7.1 Hz, 4H, alkyl CH2), 3.34 (s, 6H, pyrazole ring 2-CH3), 3.07 (s, 6H, pyrazole ring 2-CH3), 1.34 - 1.21 (m, 6H, alkyl CH3). 13C NMR (600 MHz, DMSO-d6): δ 12.68, 14.05, 16.18, 110.81, 111.45, 121.07, 121.24, 123.82, 131.60, 136.91, 137.98, 144.02, 149.23, 151.70, 152.59, 155.45, 156.34, 164.01. MALDI-TOF mass spectra: 752.07 (C38H39N11Ru), UV-Visible spectrum (CH3CN): λmax 380 nm and 515 nm. HRMS (ESI): Calcd for C38H39N11Ru: 750.8770, found: 750.8780.
<실시예 2> 루테늄 착화합물-2(RU-2)의 합성: [Ru(bpy)2(Fip)](ClO2)2
Figure PCTKR2018016898-appb-I000053
중간체 2-(9H-플루오렌-2-일)-1H-이미다조[4,5-f][1,10]페난트롤린(250 mg, 0.65 mmol) 및 시스-[Ru(bpy)2 Cl2]. 2H2O(315 mg, 0.65 mmol)를 혼합하고 40 ml의 에틸렌 글리콜에 용해시켰다. 그런 다음 반응 혼합물을 N2 환경 하에서 120℃에서 7시간 동안 환류시켰다. TLC로 반응 완결을 확인했다. 이어서, 반응 혼합물을 실온으로 냉각시키고 100 ml의 DI 수로 희석시켰다. 이 혼합물에 포화 NaClO4 용액을 첨가 한 후, 천천히 교반하여 진한 적색을 띤 오렌지색 고체를 얻었다. 생성된 조 생성물을 여과하고, 중성 알루미나를 고정상, 톨루엔/아세토니트릴 (40/60, v/v)을 이동상 용매로하여 컬럼 크로마토그래피로 2회 정제하였다. 어두운 붉은색 오렌지색 밴드가 수집되었고, 용매는 감압하에 농축되었다. 그런 다음 포화된(50%) NaClO4 용액을 천천히 첨가하여 생성물을 ClO4 - 염으로 수득하였다.
수율: 450 mg. 아세톤/DMSO 혼합물 중의 [Ru(bpy)2(Fip)](ClO2)2을 천천히 증발시켜 X-선 결정 구조를 결정하였다. Anal. Calcd for C46H32N8Ru(%): C, 69.25; H, 4.04; N, 14.04. Found: C, 69.55; H, 4.24; N, 14.10. 1H NMR (400 MHz, DMSO-d6) δ 14.36 (s, 1H, NH), 9.13 (d, J = 8.3 Hz, 2H), 8.86 (dd, J = 15.5, 8.2 Hz, 4H), 8.55 (s, 1H), 8.42 - 8.35 (m, 1H), 8.27 - 8.16 (m, 3H), 8.16 - 7.89 (m, 7H), 7.85 (d, J = 5.2 Hz, 2H), 7.72 - 7.55 (m, 5H), 7.51 - 7.38 (m, 2H), 7.35 (t, J = 6.7 Hz, 2H), 4.15 (s, 2H, CH2). 13C NMR (600 MHz, DMSO-d6): δ 36.94, 121.23, 121.77, 123.73, 124.95, 125.85, 126.13, 126.77, 127.00, 127.59, 128.21, 128.44, 138.41, 140.82, 143.80, 144.32, 144.50, 151.97, 153.62, 157.11. MALDI-TOF mass spectra: 797.10 (C46H32N8Ru), UV-Visible spectrum (CH3CN): λmax 337 nm and 463 nm. HRMS (ESI) Calcd for C46H32N8Ru: 797.8880, found: 797.8889.
<실시예 3> 루테늄 착화합물-3(RU-3)의 합성: [Ru(bpy)2(Ipna)](ClO2)2
Figure PCTKR2018016898-appb-I000054
중간체 4-(1H-이미다조[4,5-f][1,10]페난트롤린-2-일)-N,N-디메틸나프탈렌-1-아민 (200 mg, 0.51 mmol) 및 시스-[Ru(bpy)2Cl2]. 2H2O(250 mg, 0.51 mmol)를 혼합하고 40 ml의 에틸렌 글리콜에 용해시켰다. 그런 다음 반응 혼합물을 N2 환경 하에 120℃에서 7시간 동안 환류시켰다. 반응 완결은 TLC로 확인하였다. 이어서, 반응 혼합물을 실온으로 냉각시키고 100 ml의 DI 수로 희석시켰다. 이 혼합물에 포화 NaClO4 용액을 첨가한 후, 천천히 교반하여 진한 적색을 띤 오렌지색 고체를 얻었다. 생성된 조 생성물을 여과하고 물로 세척하고, 중성 알루미나를 고정상으로하고, 톨루엔/아세토니트릴 (20/80, v/v)을 이동상 용매로하여 컬럼 크로마토 그래피로 2회 정제하였다. 어두운 붉은 색의 밴드를 수집하고, 용매를 감압하에 농축시켰다. 그런 다음 포화된(50 %) NaClO4 용액을 천천히 첨가하여 생성물을 ClO4 - 염으로 수득하였다.
수율: 350 mg, Anal. Calcd for C45H35N9Ru(%): C, 67.32; H, 4.39; N, 15.70. Found: C, 67.72; H, 4.45; N, 15.72. 1H NMR (400 MHz, DMSO-d6) δ 14.37 (s, 1H), 9.16 (dd, J = 8.2, 1.3 Hz, 1H), 9.09 (dd, J = 8.3, 1.3 Hz, 1H), 9.05 - 8.99 (m, 1H), 8.87 (dd, J = 14.6, 8.2 Hz, 4H), 8.35 - 8.29 (m, 1H), 8.26 - 8.19 (m, 2H), 8.16 - 7.99 (m, 5H), 7.98 - 7.90 (m, 2H), 7.87 (d, J = 5.6 Hz, 2H), 7.68 - 7.56 (m, 6H), 7.35 (td, J = 7.9, 3.6 Hz, 3H), 2.96 (s, 6H). 13C NMR (600 MHz, DMSO-d6): δ 45.21, 113.42, 121.21, 121.76, 124.93, 126.15, 127.64, 128.30, 129.33, 132.31, 138.48, 150.31, 152.00, 153.38, 157.10, and 157.32. MALDTI-TOF mass spectra: 802.2(C45H35N9Ru), UV-Visible spectrum (CH3CN): λmax 365nm and 464nm, HRMS (ESI) Calcd for C45H35N9RuClO4: 903.2059, found: 903.2065.
상기 실시예 1-3에서 제조한 본 발명 루테늄 착화합물의 화학 구조식을 하기 표 1에 나타냈다.
실시예 화학 구조식
1
Figure PCTKR2018016898-appb-I000055
2
Figure PCTKR2018016898-appb-I000056
3
Figure PCTKR2018016898-appb-I000057
<실험예 1> 암 세포 및 암줄기세포에 대한 독성 평가
본 발명 Ru 착화합물의 암 세포 및 암줄기세포에 대한 독성을 평가하기 위하여, 다음과 같이 실험하였다.
MTT 분석으로 실시예 1-3 Ru 착화합물의 암 세포, 및 암줄기세포에 대한 독성을 평가하였다.
구체적으로, 여기서, 티아졸일 블루 테트라졸륨 브로마이드(MTT) 염료 기초 세포 독성 분석은 제조원의 프로토콜(Vybrant® MTT Cell Proliferation Assay Kit (V-13154), Thermofischer Scientific, USA)에 따라 수행하였고,
암 세포로는 MCF-7 세포주, HCT-116 세포주를 사용하였고, 암줄기세포(CSC)로는 CD44 양성 MCF7 세포, CD133 양성 HCT116 세포를 각각 사용하여 실험하였다.
여기서, 상기 유방암 세포주 MCF-7 및 대장암 세포주 HCT-116은 한국 세포주 은행(KCLB, 서울)에서 구입하여 사용하였고,
이의 암줄기세포(CSC)인 CD44 양성 MCF7 세포 및 CD133 양성 HCT116 세포는 MCF-7 및 HCT-116 세포주에서 CSC(암줄기세포) 마커를 사용하여 분리한 것을 사용하였는데, 구체적으로, MCF-7 세포주에서는 CD44 마커를, HCT-116 세포주에서는 CD133 마커를 사용하여 CSC를 분리하여 사용하였다(CD44 및 CD133 마이크로 비드 키트(MACS Miltenyi Biotec)를 사용).
상술된 과정으로부터 준비된, 각각의 암 세포주 또는 암줄기세포를 96-웰 플레이트에 개별적으로 시딩하고 10% FBS가 보충 된 DMEM 배지에 37℃에서 24시간 동안 항온 배양하였다. 그 후, 세포를 다양한 농도(0 내지 100 μM)의 실시예 1-3 Ru 착화합물로 처리하고 24시간 동안 배양하였다. 이어서, DMEM 배지를 제거하고 세포를 100 μL의 MTT 용액과 함께 37℃에서 3시간 동안 배양하였다. 75 μL의 MTT 용액을 제거한 후 50 μL의 DMSO를 첨가하여 포르 마잔 결정을 용해시켰다. 멀티 플롯 판독기(Molecular Devices, Gemini XS)를 사용하여 570 nm에서의 흡광도를 측정하였다. 시스플라틴을 양성 대조군으로 사용하였고, 상기 암 세포주에 대한 실시예 1-3 및 시스플라틴의 IC50 값을 산출하여, 그 결과를 하기 표 2에 나타냈다.
IC50 (μM) IC50 (μM) IC50 (μM) IC50 (μM)
처리 화합물 MCF-7 CD44 + MCF-7 HCR-116 CD133 + HCR-116
실시예 1 8.9±0.72 10.1±1.03 11.9±0.16 15.1±0.13
실시예 2 19.3±2.84 27.67±4.12 22.3±1.32 30.6±3.71
실시예 3 67±7.67 72.35±9.17 65.6±6.4 77.9±4.26
양성 대조군(시스플라틴) 44.47±5.09 62.18±8.48 39.45±5.16 59.34±6.52
표 2에서 확인되는 바와 같이, 실시예 1 > 실시예 2 > 시스플라틴 > 실시예 3의 순서로 암 세포, 및 암줄기세포에 대한 세포 독성이 관찰되었다.
특히, 루테늄 금속 착체 중에서 실시예 1이 암 세포, 암줄기세포에 대한 독성이 가장 우수한 것으로 확인되었는데, MCF-7, CD44 + MCF-7, HCT-116 및 CD133 + HCT-116에 대한 실시예 1의 IC50 값은 각각 8.9 μM, 10.1 μM, 11.9 μM, 15.1 μM으로 확인된다.
이는, 시스플라틴과 비교하여, 실시예 1이 MCF7 세포주 및 CD44 양성 MCF7 세포에 대해 5 내지 6 배의 우수한 암세포 사멸 효과를 나타내고, HCT116 세포주 및 CD133 양성 HCT116 세포에서도 3 내지 4 배의 우수한 암줄기세포 사멸 효과를 나타내는 것으로 확인되는 결과이다.
따라서, 본 발명에 따른 신규 루테늄 착화합물은 우수한 암 세포, 및 암줄기세포 사멸 효과가 확인되는 바, 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물, 또는 예방 또는 개선용 건강기능식품으로서 우수하게 사용될 수 있을 뿐 아니라, 본 발명 신규 루테늄 착화합물은 약물 내성을 발생시키는 주요 원인인 암줄기세포에 대하여 역시 우수한 사멸 효과를 나타내는 바, 암의 치료 또는 예방에 사용되는 화학 요법의 약물로서도 유용하게 사용될 수 있다.
<실험예 2> 세포 유입 평가
약물의 성공적인 화학 요법의 효능은 세포 내 기관에서의 흡수 및 축적에 의존하는 바, 본 발명 루테늄 착화합물의 세포 유입을 평가하기 위하여, 다음과 같이 실험하였다.
<2-1> 실시예 1의 세포 유입 평가
본 발명 Ru 착화합물의 세포 흡수 수준을 평가하기 위해, 암줄기세포인, CD44 양성 MCF-7 세포를 10 μM의 실시예 1로 처리한 후, 620 nm에서 루테늄 착화합물의 세포 내 형광 강도를 FACS을 사용하여, 시간 간격(30, 60, 90 분)을 두어 측정하였고, 그 결과를 도 1a에 나타냈다.
도 1a를 살펴보면, 본 발명 실시예 1 루테늄 착화합물의 형광 강도가 30분 이상의 시점에서 유의미하게 증가하고, 60분의 시점에서 포화 상태에 도달함을 확인할 수 있고, 본 발명 실시예 1이 MCF-7의 CSC(암줄기세포)로 빠르게 흡수되었음이 확인된다.
<2-2> 실시예 2 및 실시예 3의 세포 유입 평가
CD44 양성 MCF-7 세포(CSC)에서 상기 <2-1>과 동일한 조건으로 실험을 수행하되, 본 발명 실시예 2 또는 실시예 3을 사용하였고, FACS 분석 결과를 도 1b 및 도 1c에 도시하였다.
도 1b 및 도 1c에서 확인되는 바와 같이, 90분 경과 시점에 실시예 2 역시 암줄기세포로의 세포 유입이 관찰되나, 실시예 2 또는 실시예 3에 비하여 상대적으로, 실시예 1이 현저하게 우수한 세포 유입(침투성)이 확인되는 것을 알 수 있다(실시예 1 > 실시예 2 > 실시예 3).
따라서, 본 발명 Ru 착화합물은 암줄기세포로의 유입이 우수하여 암 세포의 사멸 효과를 보다 우수하게 유도할 수 있는 바, 이를 유효성분으로 함유하는, 암의 예방 또는 치료용 약학적 조성물 및 약물 내성을 가지는 암의 예방 또는 치료용 화학 요법 보조제로 유용하게 사용될 수 있다.
<실험예 3> 약물의 세포 내 국소화 위치 분석
본 발명 Ru 착화합물의 작용 메커니즘을 분석하기 위해, 세포 내 국소화 위치 분석을 실시하였고, 세포 특이적 염료를 사용하여 CD44 양성 MCF-7 및 HCT-116 세포의 암줄기세포(CSC)에서 수행하였다.
<3-1> 실시예 1의 세포 내 국소화 위치 분석
암줄기세포, CD133 양성 HCT-116, 및 CD44 양성 MCF-7를 커버 글래스에 위치시키고 37℃에서 24시간 동안 배양하였다. 이후, 세포를 10 μM의 본 발명 실시예 1 루테늄 착화합물로 처리하고 37℃에서 2시간 동안 배양하였다. 약물 처리 후, 세포를 1×PBS로 세척하고 Hoechst 33258 핵 염료(Sigma Aldrich)와 함께 MitoTracker® Red CMXRos(Thermofischer scientific, USA) 또는 ER-ID® Red(Enzo Life Sciences, Inc., USA) , USA)를 사용하여, 30분 동안 배양하였다. 마지막으로, 세포를 실온에서 15분 동안 4% 포름알데히드로 고정시켰다.
이를 공초점 현미경(Nikon, Eclipse Ti-U / Yokogawa, CSU-X1)을 사용하여 트래커 염료 및 본 발명 실시에 1 루테늄 착화합물의 형광 강도를 관찰하였고, 그 결과를 도 2에 나타냈다.
도 2의 A 및 B를 살펴보면, 중첩 공초점 형광 현미경 이미지는 CD133 양성 HCT-116의 세포질의 미토콘드리아(도 2의 A) 및 ER(소포체)(도 2의 B)에 실시예 1 착화합물이 주로 분포하고 있음이 명확하게 확인된다. 또한, CD44 양성 MCF-7에서도 실시예 1 착화합물이 미토콘드리아 및 ER에 효과적으로 분포함이 확인된다.
<3-2> 실시예 2 및 실시예 3의 세포 내 국소화 위치 분석
상기 <3-1>과 유사하게, CD44 양성 MCF-7을 사용하여 실시예 2 또는 실시예 3에 대하여 세포 내 위치 분석을 수행하였고, 그 결과, 실시예 2는 미토콘드리아 보다 상대적으로 ER에 밀도있게 분포되어 있음이 확인되나, 실시예 3은 ER과 미토콘드리아 모두에서 고른 분포를 보였다.
이러한 결과로부터 본 발명 Ru 착화합물이 ER, 및 미토콘드리아를 매개하는 세포 사멸 경로를 통하여 작용됨을 알 수 있다.
<실험예 4> 암 세포에서의 ROS 생성 평가
본 발명 Ru 착화합물의 암줄기세포에서의 ROS 생성을 평가하기 위하여, 다음과 같이 실험하였다.
<4-1> 실시예 1의 ROS 생성 평가
MCF-7 및 HCT-116 세포의 CSC(암줄기세포)를 12-웰 배양 플레이트에 시딩하고 37℃, 5% CO2에서 밤새 배양하였다. 이어서, 세포를 본 발명 Ru 착화합물(실시예 1을 1 μM, 5 μM, 10 μM로 처리)를 사용하거나, 또는 사용하지 않고, 6시간 동안 처리한 후, 37℃, 5% CO2 환경에서 배양하였다. 처리 종료시, 세포를 4% 포름알데히드로 고정시키고 실온에서 10분 동안 배양하였다. 1×PBS로 세척한 후, 세포를 20 μM의 2',7'-디클로로플루오레신 2 아세테이트(DCFDA)로 처리하고 실온에서 15분 동안 항온 배양하였다.ROS 유도된 2',7'-디클로로플루오레신의 형광 세기는 495 및 529 nm의 여기 및 방출 파장에서 측정되었고, 그 결과를 도 3a 및 도 3b에 나타냈다.
도 3a 및 도 3b를 살펴보면, 본 발명 실시예 1은 CSC(암줄기세포)에서 농도 비례적(0, 1, 5 및 10 μM)으로 ROS 생성을 유도하는 것으로 확인된다. 산화에 민감한 DCFH-DA는 ROS가 생성되면 녹색 형광을 생성한다. 도 3b는 1 μM, 5 μM, 및 10 μM 농도의 실시예 1로 처리된 세포에서의 DCFH-DA 염색의 평균 형광 강도를 나타낸 막대 그래프이고, 농도 비례적으로 형광 강도가 상승됨이 확인된다.
<4-2> 실시예 2 및 실시예 3의 ROS 생성 평가
상기 <4-1>과 동일하게 실험하되, MCF-7 세포의 CSC(암줄기세포)에서 실시예 2 또는 실시예 3을 농도별로 사용하여, ROS 생성을 평가하였고, 그 결과, 실시예 2 및 실시예 3은 농도 의존적으로 ROS 생성을 유도하는 것으로 확인되며, 각각 12 및 60 μM에서 최대 ROS 생성이 유도됨을 확인할 수 있다.
따라서, 암 세포, 및 암줄기세포에서 본 발명 루테늄 착화합물은 산화 환원 순환 작용으로부터 ROS 생성을 현저히 유도하고, 이로부터 세포의 산화 스트레스, 세포 사멸 효과를 우수하게 달성할 수 있는 바, 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물, 및 약물 내성을 가지는 암의 예방 또는 치료용 화학 요법 보조제로 유용하게 사용될 수 있다.
<실험예 5> 고 함량 MPT, 세포질 Ca2+ 및 카스파제 3/7 스크리닝 분석
고함량 분석은 내부 미토콘드리아 막에 미토콘드리아 투과성 전이 공극(MPTP)의 유도, 세포질 칼슘 수준 및 카스파제-3의 활성화를 평가하기 위해 수행되었으며, 이를 토대로 세포 사멸 메카니즘을 분석하였다.
<5-1> 실시예 1의 MPT, 세포질 Ca2+ 및 카스파제 3/7 스크리닝 분석
HCT-116과 MCF-7의 암줄기세포(CSC)는 각각 12 웰 배양 플라스크에서 배양하고, 37℃, 5% CO2 분위기에서 24시간 동안 10% FBS가 보충된 DMEM 배지에 유지되었다. 다음, 세포는 본 발명 Ru 착화합물 실시예 1(1, 5 및 10μM 농도별) 처리, 또는 처리 없이 16시간 동안 유지되었다. 1×PBS 완충액으로 세척한 후, 세포를 칼슘 지시약 오렌지(Invitrogen, CA, USA)와 함께 암실에서 실온에서 45분 동안 배양하였다. 세포를 1×PBS로 세척하고 37℃에서 30분 동안 칼세인-AM(칼세인acetoxymethyl ester, Invitrogen, CA, USA)와 함께 배양하였다. 이어서, 카스파제-3 기질을 첨가하고, 세포를 어두운 37℃에서 6분 동안 배양하였다. 이어서, CoCl2를 첨가하고 37℃에서 10분 동안 암실 배양하였다. 마지막으로, 세포를 1×PBS로 세척하고 이전에 기술된 바와 같이(Kim et al), 현미경 장치가 장착된 음향-광학변조필터(AOTF)를 사용하여 영상 분석을 수행하였다. 상업적으로 이용 가능한 소프트웨어(MetaMorph, 버전 7.7, Molecular Devices, CA, USA)를 사용하여 이미지를 분석하였고, 그 결과를 도 4 (a) 및 (b)에 나타냈다.
도 4 (a) 및 (b)를 살펴보면, 칼세인 AM, 칼슘 오렌지 및 매직 레드 카스파제 3/7의 형광 방출은 AOTF를 사용하여 각각 525nm, 580nm 및 630nm에서 모니터링되었다. 녹색 형광 이미지는 MPT의 세포 이미지에 해당하고 주황색 형광 이미지는 세포질 칼슘을 나타내며 적색 형광 이미지는 카스파제 3/7을 나타낸다. (b)의 막대 그래프는 칼세인 AM, 칼슘 지시약 오렌지 및 카스파제 3/7의 평균 형광 강도를 나타낸다.
MPTP는 미토콘드리아로 이동된 칼세인 AM의 형광 강도를 측정함으로써 평가되었다. 관찰된 결과는 실시예 1 처리가 CSC의 미토콘드리아에 축적된 칼세인-AM의 형광 강도를 농도 의존적으로 대조군에 비해 현저하게 감소 시켰다는 것을 보여준다(p <0.01). 미토콘드리아에 축적된 칼세인-AM의 형광 강도의 급격한 감소가 2 μM의 실시예 1 처리에서 관찰되었으며 4 μM의 실시예 1 처리에서 포화되었다.
또한, 루테늄 착화합물 처리에 반응하여 농도 의존적으로 증가된 수준의 세포질 칼슘 및 카스파제-3 활성화가 관찰되었다.
상술된 결과로부터, HCT-116과 MCF-7의 CSC에서의 실시예 1의 세포 사멸 메커니즘을 알 수 있다.
세포질 국소화 연구는 실시예 1 착화합물이 대부분 미토콘드리아와 ER에 분포되어 있음을 분명히 나타냈다. 따라서, 실시예 1에 의해 유도된 ROS는 ER로부터 칼슘 방출을 매개할 수 있으며, 이것은 카스파제 매개 세포 사멸의 활성화에 역할을 할 수 있다.
또한 증가 된 ROS와 세포질 칼슘은 미토콘드리아 투과성 전이 공극(MPTP) 형성에 관여한다. 내부 미토콘드리아 막의 MPTP 형성은 막 탈분극, 매트릭스 팽윤 및 외부 막의 파열을 유발한다. 그것은 총체적으로 Cyt-c의 방출과 카스파제-3의 후속 활성화를 일으킨다. 이 실험에서 수행된 고 함량 분석은 HCT-116 및 MCF-7 세포의 CSC에서 실시예 1의 처리에 비례하여 MPTP 형성, 세포질 칼슘 및 활성 카스파제 3이 증가함을 명확하게 나타내는 바, 세포 사멸이 유도된다.
<5-2> 실시예 2 및 3의 MPT, 세포질 Ca2+ 및 카스파제 3/7 스크리닝 분석
상기 <5-1>과 동일하게 수행하되, MCF-7의 암줄기세포(CD44(+) MCF-7)에서 실시예 2 및 실시예 3을 사용하여 수행하였고 그 결과, 실시예 2 및 실시예 3 역시 세포 사멸 메카니즘을 따르는 형상이 나타나는 것으로 보이나, 실시예 1이 가장 처리 농도에 민감하게 반응하는 것으로 확인되었다.
<실험예 6> 세포 사멸 유도, 항-세포 사멸 단백질의 발현 분석
본 발명 Ru 착화합물의 처리에 따른 암 세포 사멸 효과를 평가하기 위하여, 세포 사멸 유도 또는 항-세포 사멸 단백질의 발현을 분석하였다.
구체적으로, Bcl-2, Bax, Bak 및 GRP78에 대한 면역 형광 분석을 실시하였고, 이전에 기술된 바에 따라 수행하였다(Ahn et al., 2014). 형광 이미지는 Olympus FLUOVIEW 500 공초점 현미경을 사용하여 얻어졌다.
또한, 이전에 기술된 바와 같이 웨스턴 블랏 분석을 수행하였다(Parthasarathy et al., 2013).
<6-1> 실시예 1 처리된 HCT-116 CSC에서의 세포 사멸 유도 단백질의 발현 분석
도 5는 실시예 1이 처리 된 CD133 양성 HCT116 세포에서의 세포 사멸 유도, 및 항-세포 사멸 단백질의 발현을 나타낸다.
도 5 A는 대조군 및 실시예 1 처리된 HCT-116 CSC에서 Bcl-2 발현의 면역 형광 분석을 나타낸다. Bcl-2의 단백질 수준을 웨스턴 블랏 방법으로 추가로 평가하고 도 5 D에 나타냈다.
그 결과, 대조군에 비해 Bcl-2 발현이 실시예 1 처리 CSC에서 유의하게 억제되었음이 확인된다.
한편, 도 5 B 및 5 C는 각각 대조군 및 실시예 1 처리된 CSC에서의 Bax 및 Bak의 발현을 나타낸다. Bax와 Bak의 올리고머 구조가 실시예 1 처리 세포에서 관찰되었다. 그러나, Bax 및 Bak의 올리고머화는 대조군 세포에서 잘 관찰되지 않았다. 세포 사멸 유도 단백질 Bax와 Bak는 일반적으로 세포질에 존재하지만, 세포 사멸 중에 그들은 미토콘드리아의 외막을 올리고머화 하여 MOMP를 야기한다.
즉, 이러한 Bak/Bax의 올리고머화는 사이토크롬 c(Cyt c)의 방출을 일으키는 미토콘드리아 외막 투과성화(MOMP)로 이어진다.
도 5 D는 Bak 및 Bax의 웨스턴 블랏 분석을 나타낸 것으로, 대조군에 비해 실시예 1 처리된 CSC 세포에서 Bax 및 Bak 수준이 유의하게 증가되었음이 확인된다(p <0.01).
따라서, 본 발명 실시예 1 처리에 따라 세포 사멸을 유도하는 Bak과 Bax의 활성화가 관찰되고, 이러한 Bak/Bax의 올리고머화는 사이토크롬 c(Cyt c)의 방출을 일으키는 미토콘드리아 외막 투과성화(MOMP)로 이어진다. 세포질에서 Cyt c는 프로테아제 활성 인자 1(Apaf1)과 프로테아제 카스파제-9와 함께 아포토좀(apoptosome)를 형성한다. 이 다합체 아포토좀 착화합물은 카스파제-3와 카스파제-7을 활성화시킨다.
\MOMP는 세포 생존을 위하여 되돌리 수 없고, 더욱이, 실시예 1 처리된 세포에서 관찰된 감소된 항-세포 사멸 Bcl-2 발현은 미토콘드리아로부터의 Cyt-c 방출을 유지시킨다.
또한, 활성화된 Bax가 ER에서 칼슘 방출을 적극적으로 조절하는 바, Bax의 일시적인 과다 발현은 미토콘드리아의 Ca2+ 및 사이토 크롬 c 방출의 증가와 함께 ER Ca2+의 방출을 초래하는 바, 결과적으로 세포 사멸은 유도되며, 항-세포 사멸은 억제되어, 암 세포의 현저한 사멸 효과가 나타나는 것이다.
이로부터, 본 발명의 루테늄 착화합물이 암세포의 미토콘드리아에서 MPTP와 MOMP 형성을 유도하고 암세포의 효과적인 내재적 세포 사멸 매개 작용을 확인하였다.
<실험예 7> 분자 도킹
분자 모델링 연구는 본 발명 Ru 착화합물이 GRP 78에 결합하는 방식에 대한 더 많은 정보를 제공하기 위해 수행되었다.
먼저, 두 가지 가능성이 GRP 78과 함께 리간드 실시예 1의 도킹에 대해 고려되었다:
1) 실시예 1은 GRP 78의 ATPase 도메인 결합; 또는
2) 단량체 유니트 A 및 B 둘 다의 아미노산 잔기를 이용하여 이량체 인터페이스에 결합
첫 번째 시나리오의 ATP 도메인에는 수용될 수 없었고, 실시예 1 착화합물의 크기가 큰만큼 두 번째 시나리오의 GRP 78의 이량체 인터페이스로 성공적으로 모델링되었다.
이에 상응하는 도킹 결과는 실시예 1과 GRP 78의 상호 작용의 3D 도를 도 6에 도시하였다.
이러한 컴퓨터 시뮬레이션 도킹 결과는 본 발명 Ru 착화합물의 생물학적 활성 으로, 강력한 항암 활성을 갖는 GRP 78 억제제인 것으로 확인되었다.
ROS로 유도된 산화 과정이 단백질의 구조적 변화를 유도하여 유비퀴틴화 되기 쉬운 것으로 보고되었고, 이를 확인하기 위해 Accelrys Discovery Studio(v 4.0)를 사용하여 GRP 78(PDB : 3ldl)의 X 선 결정 구조로 분자 도킹 결과, 본 발명실시예 1은 단백질의 이량체 구조의 계면에서 GRP-78의 특정 아미노산 잔기와 강한 비공유 상호 작용을 형성하여 GRP-78의 이량체 구조를 인터칼레이팅 한다.
관찰된 도킹 결과는 실시예 1 및 GRP-78 계면 부근에서 생성된 ROS가 GRP-78의 구조를 변형시키고, 이어서 유비퀴틴 매개 융합을 변형시킬 수 있음을 암시한다.
<실험예 8> 암의 내성 발생 억제 평가
본 발명에 따른 신규 Ru 착화합물의 항암제에 대한 암의 내성 발생을 억제하는 효과에 있어서, 평가하기 위하여 다음과 같이 실험하였다.
암 세포의 항암제에 대한 내성 발생은 암줄기세포(CSC)의 GAP-78 발현 증가, 활성 증가와 같은 경로를 통하여 이루어지는 것으로 보고되어 있고, 이에 본 발명의 신규 Ru 착화합물이 어떠한 효과를 보이는지 평가하기로 하였다.
<8-1> GRP-78, CLU 및 ATR의 플라스미드 제작 및 형질 감염
대조군 인간 샘플의 게놈 DNA는 QIAamp DNA Blood Mini Kit(Qiagen, Valencia, CA)를 사용하여 제조자의 지시에 따라 분리 하였다.
GRP-78: 정방향(50 pmol; 5'-AAAGCTTTTATGAAGCTCTCCCTGGTGG-3') 및
GRP-78: 역방향(50 pmol; 5'-AGGATCCCTACAACTCATCTTTTTCTGCTG-3') 또는
CLU: 정방향(50 pmol; 5'-AAAGCTTATGCAGGTTTGCAGCCAGC-3') 및
CLU: 역방향(50 pmol; 5'-GGATCCTTTTATTTTATTTTCCTCACTCTCCT-3')
ATR: 정방향(50 pmol, 5'-AAGCTTATGGCCACGGCGGAGC-3') 및
ATR: 역방향(50 pmol; 5'-GGATCCTTTTATTTTATTTTCCTCACTCTCCT -3')
의 특이 프라이머로 DNA 200ng을 증폭시켰고,
다음의 온도 프로파일을 갖는다: 95℃에서 4 분; 95℃ 30 초, 59 초 66℃ 30 초, 72℃ 1분 30 사이클; 마지막 연장은 72℃에서 5 분간이다.
GRP78, CLU 및 ATR 프라이머는 각각의 유전자의 GRP78, CLU 및 ATR 전사체를 증폭하도록 설계되었다.
PCR 증폭은 1.9kb GRP78, 1.5kb CLU 및 850bp ATR 단편을 표준 분자량 마커를 가진 1.2 % 아가로오스 겔을 사용하여 분석함으로써 확인되었다.
PCR 증폭된 GRP78, CLU 및 ATR 단편은 HindIII/BamHI 효소로 제한되었다. 제한된 GRP78, CLU 및 ATR 단편을 각각 pTag-YFP-C (4.7 kb; Evrogen, Moscow, Russia), pDs-Red2-N1 (4.7 kb; Clontech, USA) 및 pAC-GFP1-N1 (4.7 kb; Clontech, USA)로 접합하였다.
접합된 융합 유전자 벡터를 제조자(Invitrogen, Carlsbad, CA)에 의해 제안 된 바와 같이 화학적 변형을 통해 E. coli 대장균 DH5α 세포로 개별적으로 형질전환시켰다.
형질전환체(pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 및 pAC-ATR-GFP1-N1)를 카나마이신(30 ㎍/mL)을 첨가한 LB 한천 플레이트에서 선별하였다. 플라스미드 미디 키트(Qiagen)를 사용하여 내성 콜로니로부터의 플라스미드를 분리하였다. GRP78, CLU 및 ATR 유전자로 클로닝된 플라스미드를 HEK-293 세포에 동시 형질감염시켰다.
구체적으로, 인간 배아 신장 세포(HEK-293)를 한국 세포주 은행 (KCLB1, Seoul, Korea)으로부터 얻고 10% FBS가 첨가된 DMEM에서 배양 하였다. 먼저, HEK-293 세포(5x105 세포/웰)를 24 시간 동안 항생제가 없는 DMEM 및 FBS를 함유한 24-웰 배양 플레이트에 시딩하였다. 다음날, 제조사의 지시에 따라 Lipofectamine 2000(Invitrogen)을 사용하여 HEK-293 세포에 플라스미드 DNA(GRP78, CLU 및 ATR)를 동시 형질감염시켰다.
세포 배양 플레이트를 CO2 배양기에서 37℃에서 6시간 동안 유지하였다. 그런 다음 세포를 세척하고 CO2 배양기 37℃에서 48시간 동안 배지에서 성장시켰다. GRP78, CLU 및 ATR 증폭 세포를 5% CO2 배양기 37℃에서 16시간 동안 10 μM의 실시예 1과 배양하였다. 그 다음, HEK-293 세포의 형광 현미경 사진을 정량 분석을 위해 관측하였다. 데이터 수집 및 정량 분석은 이전에 기술 된 바와 같이 수행되었다(Naoghare et al., 2008).
<8-2> 정량적 RT-PCR
HEK293 세포는 실시예 1을 16 시간 처리 한 후 37℃의 DMEM 배지에서 CO2 배양기로 유지시켰다. 그 후, 제조사의 프로토콜(Dynabeads® MRNA Purification Kit, Invitrogen, USA)에 따라 전체 RNA를 추출하였다. 분리된 RNA의 무결성은 260/280 nm에서 흡광도의 비율에 의해 정성적으로 평가된 다음 1% 아가로즈 RNA 겔 전기 영동에 의해 정성적으로 평가되었다.
RNA의 농도는 Nanodrop(Thermo Scientific, U.S.A)을 사용하여 260 nm에서 측정하였다. 총 RNA, GAPDH에 특이적인 cDNA 및 GRP78은 제조사의 프로토콜에 따라 QuantiTect Reverse Transcription Kit(Qiagen, USA)를 사용하여 준비하였다. 2개의 피코몰 프라이머를 표적 m-RNA의 증폭에 사용하였다. GAPDH 발현을 이용하여 샘플의 시작 템플레이트 양을 결정한 후, 정량적 PCR 반응을 수행 하였다.
다음의 프라이머를 사용 하였다: GAPDH 센스 CATGAGAAGTATGACAACAGCCT, 안티센스 AGTCCTTCCACGATACCAAAGT; GRP78 센스 TGCCGCTTTGCAGGTGTATT, 안티센스 CCGATGCTCAGAGCTTTCTCC.
RT-PCR(SYBR green qPCR kit, Thermo Scientific, USA)을 수행하기 위해 SYBR green 방법을 사용 하였다. Applied Biosystems ™ Real-Time PCR 장비 (7300)를 사용하여 RT-PCR을 실행했다.
데이터를 GAPDH로 표준화하고, 2-ΔΔCT 방법으로 분석하였다.
<8-3> 퀀텀닷-항체 접합
GRP78에 특이적인 항체를 Q-dot 705(Quantum Dot Conjugation Kit; Invitrogen, Carlsbad, CA, USA)와 각각 접합시켰다. 항체와 퀀텀닷 접합을 개시하기 위해, 먼저 항체를 디설파이드 결합 붕괴를 유도하는 디티오트레이톨(DTT)으로 처리하고 항체를 환원 상태로 전환시켰다. 이어서, 항체를 실온에서 1시간 동안 말레이미드-작용화된 퀀텀닷과 함께 인큐베이션 하였다.
이어서, 말레이미드 기를 제거하기 위해 접합체를 2-머캅토에탄올로 처리하였다. 비 접합된 퀀텀닷은 키트에 제공된 컬럼을 사용하여 용리되었다.
Q-dot 항체 접합체를 면역 형광 분석을 위해 1% BSA로 1:200으로 희석 하였다. 형광 분석에 사용 된 여기 및 방출은 각각 405/705 nmdl었다.
그 결과, 공초점 분석은 ER 영역 내에서 GRP-78 발현의 최대가 중첩되었음을 확인했다. 또한, 실시예 1의 농도에 따라 GRP78의 발현이 감소함을 확인하였다. ROS의 수명은 마이크로 초이며, 따라서 ROS의 수명은 본 발명 루테늄 착화합물이 존재했던 부근에서 더 많이 일어난다.
이는 실시예 1과 GRP-78의 결합이 유비퀴틴 매개 분해를 유도하는 GRP-78의 구조 변화를 일으킬 수 있다고 결론내릴 수 있다.
또한, 웨스턴 블랏 분석은 또한 실시예 1 용량이 GRP-78의 단백질 수준을 의존적으로 감소시킨다는 것을 확인하였다.
GRP-78 발현의 상승은 CD44+ MCF-7 세포에서 나타나는데, 이저에도 CD24-CD44+ Grp78+ 세포가 두 경부암 세포주에서 CD24-CD44 + 세포보다 우수한 화학 요법 및 내성을 보이는 것으로 보고된 바 있다. 마찬가지로, GRP78의 녹다운은 시스플라틴 및 방사선 치료에 대하여 향상된 민감성을 나타내는 것으로 보고된 바 있다.
따라서, GRP-78에 대한 실시예 1의 억제 효과가 암 치료에서 종양 재발의 가능성을 감소시키고, 암의 약물 내성을 극복할 수 있는 매우 유용한 특성임을 명확하게 제시하는 것이다.
<실험예 9> 인간 대장 암종 이종 이식 모델
본 발명 Ru 착화합물의 암 세포 사멸 효과를 평가하기 위하여, 인간 대장 암종 이종 이식 동물 모델을 대상으로 다음과 같은 실험을 실시하였다.
본 생체 내(in vivo) 동물 실험은 서울 대학교 기관 동물 보호 및 이용 위원회의 승인을 받아 수행되었고, Daehan Biolink(서울, 대한민국)에서 7 주생 스위스 암컷 무흉선 마우스를 구입하여 사용하였다. 모든 마우스는 서울 대학교 약학 대학 동물원 센터(서울, 대한민국)에서 특정 병원균이 없는 상태로 적응시키고, 24 - 26℃에서 12시간의 명암 사이클을 유지 하여 관리하였다.
HCT-116 세포 배양으로부터 분리된 CD133 양성 HCT-116 세포(3 × 106 세포)를 100μl의 LDEV-Free 감소 성장 인자 기저막 매트릭스(Geltrex; Thermofischer Scientific, USA)와 혼합한 후, 마우스의 오른쪽 옆구리로 피하 주사하였다. 종양이 100 mm3의 부피에 도달하면 마우스를 각각 6 마리 세 그룹으로 나누었다.
먼저, 대조군은 4 % DMSO를 함유하는 1×PBS를 복강내 주사하고;
다른 2 군의 마우스는 매일 0.03 mg/kg/체중 또는 0.06 mg/kg/체중의 용량으로 실시예 1(실시예 1을 DMSO에 용해시키고 1×PBS로 희석한 것)을 복강내 주사하였다.
치료는 2주 동안 반복하였고, 대조군의 종양 크기가 약 1500 mm3에 도달하면실험을 중단하였다.
치료 과정에서 종양의 크기와 무게를 매일 모니터하여 관찰하였다.
종양 체적(mm3)은 다음과 같이 계산 하였다:
부피 = (최대 직경(mm)) (수직 직경(mm))2 × 0.5.
<9-1> 실시예 1의 생체 내 항암 활성
상술된 바와 같이, 무흉선 누드 마우스에서 CD133 + HCT-116 세포 유래 이종 이식에 대한 실시예 1 착화합물의 생체 내 화학 요법 가능성을 조사하였다.
도 8A는 이종 이식 모델의 실험 진행 프로토콜을 기술한다. 2 주간의 치료 기간 동안 실험군에 매일 0.03 mg 또는 0.06 mg의 실시예 1 Ru 착화합물/kg/체중 를 투여시켰고, 그 결과, 실시예 1 처리 실험군 마우스 그룹의 종양 무게 및 부피는 대조군 마우스 그룹과 비교하여 현저하게 감소되었음이 확인된다(도 8 B 및 C).
종양 무게는 대조군에 비해 55% 내지 80%로 현저히 감소하였다(도 8D).
또한, 대조군, 실험군(저용량), 실험군(고용량)에서의 종양 무게는 각각 3.2g, 1.6g, 1.15g으로 확인되었고, 이는 실시예 1의 현저한 항암 효능을 나타낸다(도 8E).
한편, 실시예 1 처리된 실험군의 마우스는 전체 치료 과정 동안 정상 체중을 유지하였고, 사망률은 관찰되지 않은 바, 본 발명 Ru 착화합물은 정상 세포에 있어서독성이 없는 것으로 확인되었다.
주로, 항암 치료의 실패 및 암의 재발은 암줄기세포(CSC)와 그의 숫자에 의존하는데, 특히, 이러한 관점에서 상술된 본 발명 Ru 착화합물의 CSC에 대한 우수한 항암 활성은, 새로운 항암제, 및 화학 요법 보조제로서 유용할 수 있음을 암시하는 것이다.
실시예 1 처리된 실험용 마우스는 대조군과 비교하여 저용량 및 고 복용량 처리군에서 각각 2배 및 4배의 형광 강도 감소가 나타나는 것으로 확인되는데(도 8G), 이는 본 발명 Ru 착화합물이 GRP78 억제 활성으로부터, CSC에 대하여 우수한 세포 독성을 보이고, 우수한 세포 사멸 효과가 나타나는 것임을 입증하는 것이다.
따라서, 본 발명의 Ru 착화합물은 항암제, 및 기존 화학 요법의 보조제(내성 억제용 조성물)로서 유용하게 사용될 수 있다. 나아가, 본 발명 Ru 착화합물은 대장암 이종 이식 모델에 대하여 우수한 생체 내 치료 가능성을 확인한 바, 본 발명 Ru 착화합물이 내성, 부작용 등의 문제가 있었던 백금 기반 화학 치료제와 같은 기존의 치로제의 대안으로 우수하게 사용될 수 있음을 알 수 있다.
본 발명에 따른 신규 Ru 착화합물은, 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물, 또는 항암제 내성 억제용 조성물, 및 이를 여타의 화학 요법제와 병용하여 기존의 항암제 내성 문제가 개선된 암의 예방 또는 치료용 약학적 조성물로 유용하게 사용될 수 있다.

Claims (12)

  1. 하기 화학식 1로 표시되는 착화합물, 이의 입체 이성질체, 또는 이의 약학적으로 허용 가능한 염:
    [화학식 1]
    Figure PCTKR2018016898-appb-I000058
    상기 화학식 1에 있어서,
    X는 Cl-, PF6 -, Br-, BF4 -, ClO4 -, CF3SO3 - 및 SO4 -2로 이루어진 군으로 부터 선택되는 1종 이상이고;
    상기 n은 0 내지 5의 정수이고;
    y는 1 내지 3의 정수이고;
    z는 0 내지 3이고;
    Lig는 각각 독립적으로, 하기로 이루어진 군으로부터 선택되는 리간드이고,
    Figure PCTKR2018016898-appb-I000059
    ,
    Figure PCTKR2018016898-appb-I000060
    ,
    Figure PCTKR2018016898-appb-I000061
    ,
    Figure PCTKR2018016898-appb-I000062
    ,
    Figure PCTKR2018016898-appb-I000063
    ,
    Figure PCTKR2018016898-appb-I000064
    , 및
    Figure PCTKR2018016898-appb-I000065
    ;
    R1
    Figure PCTKR2018016898-appb-I000066
    또는
    Figure PCTKR2018016898-appb-I000067
    이고;
    R2a, R2b, R2c, R2d, R2e 및 R2f는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고;
    상기 R3a, R3b, R3c, R3d, R3e, R3f, R3g, R3h, R3i 및 R3j는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고,
    상기 R4a, R4b, R4c, R4d, R4e, R4f, R4g, 또는 R4h는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환된다.
  2. 제1항에 있어서,
    상기 화학식 1로 표시되는 착화합물은, 하기 화학식 1'의 착화합물인 것을 특징으로 하는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염:
    [화학식 1']
    Figure PCTKR2018016898-appb-I000068
    여기서, 상기 R1, X, n은 상기 화학식 1에서 정의한 바와 같다.
  3. 하기 화학식 2로 표시되는 착화합물, 이의 입체 이성질체, 또는 이의 약학적으로 허용 가능한 염:
    [화학식 2]
    Figure PCTKR2018016898-appb-I000069
    상기 화학식 2에 있어서,
    X는 Cl-, PF6 -, Br-, BF4 -, ClO4 -, CF3SO3 - 및 SO4 -2로 이루어진 군으로 부터 선택되는 1종 이상이고;
    상기 n은 0 내지 5의 정수이고;
    y는 1 내지 2의 정수이고;
    z는 0 내지 1이고;
    Lig는 각각 독립적으로, 하기로 이루어진 군으로부터 선택되는 리간드이고,
    Figure PCTKR2018016898-appb-I000070
    ,
    Figure PCTKR2018016898-appb-I000071
    ,
    Figure PCTKR2018016898-appb-I000072
    ,
    Figure PCTKR2018016898-appb-I000073
    ,
    Figure PCTKR2018016898-appb-I000074
    ,
    Figure PCTKR2018016898-appb-I000075
    , 및
    Figure PCTKR2018016898-appb-I000076
    ;
    R1
    Figure PCTKR2018016898-appb-I000077
    또는
    Figure PCTKR2018016898-appb-I000078
    이고;
    R2a, R2b, R2c, R2d, R2e 및 R2f는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고;
    상기 R3a, R3b, R3c, R3d, R3e, R3f, R3g, R3h, R3i, R3j, 및 R3k는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환되고,
    상기 R4a, R4b, R4c, R4d, R4e, R4f, R4g, 또는 R4h는 각각 독립적으로 수소, 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알킬, 또는 치환 또는 비치환된 C1-6 측쇄 또는 직쇄 알콕시이되, 여기서, 상기 치환된 알킬, 및 치환된 알콕시는 할로젠, 옥소, 니트로, 및 시아노로 이루어진 군으로부터 선택되는 1종 이상의 치환기로 치환된다.
  4. 제3항에 있어서,
    상기 화학식 2로 표시되는 착화합물은, 하기 화학식 2'의 착화합물인 것을 특징으로 하는 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염:
    [화학식 2']
    Figure PCTKR2018016898-appb-I000079
    여기서, 상기 R1, X, n은 상기 화학식 2에서 정의한 바와 같다.
  5. 하기 반응식 1에 나타난 바와 같이,
    화학식 3으로 표시되는 화합물로부터 화학식 4로 표시되는 화합물을 제조하는 단계;
    상기 단계에서 제조된 화학식 4로 표시되는 화합물로부터 화학식 1로 표시되는 착화합물을 제조하는 단계;를 포함하는 제1항의 화학식 1로 표시되는 착화합물의 제조방법:
    [반응식 1]
    Figure PCTKR2018016898-appb-I000080
    상기 반응식 1에 있어서,
    X, n, y, z, Lig, R1, R2a, R2b, R2c, R2d, R2e 및 R2f는 제1항의 화학식 1에서 정의한 바와 같다.
  6. 하기 반응식 2에 나타난 바와 같이,
    화학식 5로 표시되는 화합물로부터 화학식 6으로 표시되는 화합물을 제조하는 단계;
    상기 단계에서 제조된 화학식 6으로 표시되는 화합물로부터 화학식 2로 표시되는 착화합물을 제조하는 단계;를 포함하는 제3항의 화학식 2로 표시되는 착화합물의 제조방법:
    [반응식 2]
    Figure PCTKR2018016898-appb-I000081
    상기 반응식 2에 있어서,
    X, n, y, z, Lig, R1, R2a, R2b, R2c, R2d, R2e 및 R2f는 제3항의 화학식 2에서 정의한 바와 같다.
  7. 제1항 또는 제3항의 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물.
  8. 제7항에 있어서,
    상기 암은 가성점액종, 간내 담도암, 간모세포종, 간암, 갑상선암, 결장암, 고환암, 골수이형성증후군, 교모세포종, 구강암, 구순암, 균상식육종, 급성골수성백혈병, 급성림프구성백혈병, 기저세포암, 난소상피암, 난소생식세포암, 남성유방암, 뇌암, 뇌하수체선종, 다발성골수종, 담낭암, 담도암, 대장암, 만성골수성백혈병, 만성림프구백혈병, 망막모세포종, 맥락막흑색종, 미만성거대B세포림프종, 바터팽대부암, 방광암, 복막암, 부갑상선암, 부신암, 비부비동암, 비소세포폐암, 비호지킨림프종, 설암, 성상세포종, 소세포폐암, 소아뇌암, 소아림프종, 소아백혈병, 소장암, 수막종, 식도암, 신경교종, 신경모세포종, 신우암, 신장암, 심장암, 십이지장암, 악성 연부조직 암, 악성골암, 악성림프종, 악성중피종, 악성흑색종, 안암, 외음부암, 요관암, 요도암, 원발부위불명암, 위림프종, 위암, 위유암종, 위장관간질암, 윌름스암, 유방암, 육종, 음경암, 인두암, 임신융모질환, 자궁경부암, 자궁내막암, 자궁육종, 전립선암, 전이성 골암, 전이성뇌암, 종격동암, 직장암, 직장유암종, 질암, 척수암, 청신경초종, 췌장암, 침샘암, 카포시 육종, 파제트병, 편도암, 편평상피세포암, 폐선암, 폐암, 폐편평상피세포암, 피부암, 항문암, 횡문근육종, 후두암, 흉막암, 및 흉선암으로 이루어진 군으로부터 선택되는 1종 이상인 것을 특징으로 하는 약학적 조성물.
  9. 제1항 또는 제3항의 착화합물, 이의 입체 이성질체 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 함유하는 항암제 내성 억제용 조성물.
  10. 제9항의 항암제 내성 억제용 조성물, 및 화학 요법제를 포함하는 암의 예방 또는 치료용 약학적 조성물.
  11. 제10항에 있어서,
    상기 화학 요법제는 백금계 화학 요법제인 것을 특징으로 하는 약학적 조성물.
  12. 제11항에 있어서,
    상기 백금계 화학 요법제는 시스플라틴(cisplatin), 카보플라틴(carboplatin), 이프로플라틴(iproplatin), 또는 옥살리플라틴(oxaliplatin) 또는 이의 약제학적으로 허용 가능한 염인 것을 특징으로 하는 약학적 조성물.
PCT/KR2018/016898 2018-12-28 2018-12-28 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물 Ceased WO2020138570A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2018/016898 WO2020138570A1 (ko) 2018-12-28 2018-12-28 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2018/016898 WO2020138570A1 (ko) 2018-12-28 2018-12-28 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Publications (1)

Publication Number Publication Date
WO2020138570A1 true WO2020138570A1 (ko) 2020-07-02

Family

ID=71127076

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/016898 Ceased WO2020138570A1 (ko) 2018-12-28 2018-12-28 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Country Status (1)

Country Link
WO (1) WO2020138570A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8193175B2 (en) * 2004-07-13 2012-06-05 Universite De Strasbourg Ruthenium complexes for treating cancers
CN102942595A (zh) * 2012-11-22 2013-02-27 中山大学 一类钌配合物及其制备方法和应用
KR20190074542A (ko) * 2017-12-20 2019-06-28 서울대학교산학협력단 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8193175B2 (en) * 2004-07-13 2012-06-05 Universite De Strasbourg Ruthenium complexes for treating cancers
CN102942595A (zh) * 2012-11-22 2013-02-27 中山大学 一类钌配合物及其制备方法和应用
KR20190074542A (ko) * 2017-12-20 2019-06-28 서울대학교산학협력단 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SHILPA, M.: "DNA-interactions of ruthenium (II) & cobalt (III) phenanthroline and bipyridine complexes with a planar aromatic ligand 2-(2-fluronyl) IH-imidazo [4, 5-f][1, 10-Phenanthroline", JOURNAL OF INCLUSION PHENOMENA AND MACROCYCLIC CHEMISTRY, 2011, pages 187 - 195, XP019900486 *
TAN, L.-F.: "Nucleic acid binding behaviors and cytotoxic properties of a Ru (II) complex", DNA AND CELL BIOLOGY, vol. 30, no. 5, 2011, pages 277 - 285, XP055721474 *

Similar Documents

Publication Publication Date Title
WO2016200101A2 (ko) 트리사이클릭 유도체 화합물, 이의 제조방법 및 이를 포함하는 약학적 조성물
WO2021145655A1 (ko) 신규한 피라졸 유도체
WO2017188694A1 (ko) 질소를 포함하는 헤테로아릴 화합물 및 이의 용도
WO2021162451A1 (ko) 담즙산 또는 이의 유도체, 바이구아나이드 계열 화합물 및 항바이러스제 중 2종 이상을 유효성분으로 함유하는 암 예방 또는 치료용 약학적 조성물
WO2021075691A1 (ko) 피리미딘 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2018012907A1 (ko) Pi3k를 억제하는 신규한 퀴나졸리논 유도체 및 이를 포함하는 약학적 조성물
WO2018004213A1 (ko) Smo 저해 활성을 갖는 신규 화합물 및 이를 유효성분으로 포함하는 암 예방 또는 치료용 조성물
WO2019168237A1 (ko) 신규 화합물 및 이를 유효성분으로 함유하는 섬유증 또는 비알코올성 지방간염의 예방, 개선 또는 치료용 조성물
WO2016108489A1 (ko) 신규한 루테늄 화합물 및 이를 유효성분으로 함유하는 암 질환 예방 또는 치료용 약학 조성물
WO2020222461A1 (ko) 면역항암 보조제
WO2021149900A1 (ko) 이치환 아다만틸 유도체, 이의 약학적으로 허용가능한 염 및 이를 유효성분으로 포함하는 암 성장 억제용 약학적 조성물
WO2018021826A1 (ko) 신규한 피리미딘-2,4-디아민 유도체 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2021096112A1 (ko) 피롤로피리미딘, 피롤로피리딘, 인다졸 화합물 유도체 및 이를 포함하는 치료용 약학 조성물
WO2016093554A2 (ko) 신규한 4-(아릴)-n-(2-알콕시티에노[3,2-b]피라진-3-일)-피페라진-1-카복스아미드 유도체 및 이의 항증식 효과
WO2021101268A1 (ko) 벤즈아미드 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2018056621A1 (ko) 신규한 이미다졸일 피리미딘 유도체, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2018164549A1 (ko) 말릭산 탈수소효소 저해 활성을 갖는 신규 화합물 및 이를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물
WO2023287128A1 (ko) 인다졸일 벤즈이미다졸 유도체 또는 이의 약학적으로 허용가능한 염 및 이의 용도
WO2025034034A1 (ko) 신규한 화합물, 및 이를 포함하는 암 또는 종양의 예방 또는 치료용 약학적 조성물
WO2025135292A1 (ko) 신규 베타-카볼린 유도체 및 이를 포함하는 약물 내성 암 예방 또는 치료용 조성물
WO2022103149A1 (ko) 신규한 카바졸 유도체 및 이를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물
KR102016699B1 (ko) 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물
WO2024072075A1 (ko) 단백질 키나아제 저해 활성을 갖는 피리미딘 유도체 및 이를 포함하는 치료용 약학 조성물
WO2023204631A1 (ko) Ddx5 단백질에 결합하는 캄토테신 유도체 및 이의 프로드럭
WO2022086110A1 (ko) 티오벤즈이미다졸 유도체 또는 이의 약학적으로 허용가능한 염 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18944318

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18944318

Country of ref document: EP

Kind code of ref document: A1