WO2020138570A1 - Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer - Google Patents

Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer Download PDF

Info

Publication number
WO2020138570A1
WO2020138570A1 PCT/KR2018/016898 KR2018016898W WO2020138570A1 WO 2020138570 A1 WO2020138570 A1 WO 2020138570A1 KR 2018016898 W KR2018016898 W KR 2018016898W WO 2020138570 A1 WO2020138570 A1 WO 2020138570A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
substituted
formula
complex compound
compound represented
Prior art date
Application number
PCT/KR2018/016898
Other languages
English (en)
Korean (ko)
Inventor
송준명
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Priority to PCT/KR2018/016898 priority Critical patent/WO2020138570A1/fr
Publication of WO2020138570A1 publication Critical patent/WO2020138570A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/555—Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F15/00—Compounds containing elements of Groups 8, 9, 10 or 18 of the Periodic Table

Definitions

  • the present invention relates to a novel ruthenium complex compound, a method for manufacturing the same, and a pharmaceutical composition for preventing or treating cancer containing the same as an active ingredient.
  • Non-Patent Document 1 Shen DW, Pouliot LM, Hall MD, Gottesman MM. 2012. Pharmacological reviews 64:706-721) .
  • ruthenium-based metal complex has been proposed as an alternative to platinum derivatives.
  • ruthenium complexes have strong affinity for serum albumin and transferrin similar to Fe, and the vasculature It has been reported that it is possible to transport Ru complexes across.
  • Non-Patent Document 2 Brookes et al., 2006; Kwok and Richardson 2002.
  • transition metal complex compound when the transition metal complex compound accumulates in mitochondria or ER, reactive oxygen species (ROS) are effectively generated through fenton-type oxidation and reduction reactions, and thus the redox cycle is an important characteristic of transition metals.
  • ROS reactive oxygen species
  • ROS production is one of the characteristics of cancer cells, and increased metabolic activity of peroxisomes and mitochondria is a major cause of ROS production in tumors.
  • Cancer cells effectively use ROS for cell proliferation, angiogenesis, and metastasis progression, and cancer cells can precisely regulate excess ROS by increasing the expression of antioxidant proteins such as glutathione and thioredoxin, so cancer cells can ROS It can withstand the limits of toxicity.
  • cancer stem cells (Cancer Stem Cell) is well-proven that it expresses a high level of protein of antioxidant enzymes as well as non-enzymatic antioxidant proteins compared to proliferative cancer cells (Non-Patent Document 3: Nagano et al., 2013 ; Trachootham et al., 2009).
  • Non-Patent Document 3 Nagano et al., 2013 ; Trachootham et al., 2009.
  • the cancer cell survival mechanism described above allows CSCs to develop drug resistance to chemotherapy drugs.
  • a therapeutic strategy such as suppressing the antioxidant capacity of cancer cells as well as simultaneously increasing ROS production may induce irreversible oxidative stress and subsequent cell death.
  • Non-Patent Document 4 Dharmaraja 2017, Sznarkowska et al ., 2017
  • the development of anti-cancer drugs, or therapeutic agents that can effectively suppress the development of cancer and cancer stem cell resistance has not been developed, and thus requires continuous research and effort.
  • the present inventors can solve the problems of cancer resistance, side effects, etc. with conventional platinum-based chemotherapeutic agents, in particular, can excellently inhibit the mechanism of resistance development of cancer stem cells, and further, have excellent cell killing effect as an anti-cancer agent.
  • the novel Ru complex according to the present invention While trying to develop a therapeutic agent that can be achieved, the novel Ru complex according to the present invention not only excellently suppresses the mechanism of resistance development of cancer stem cells, but also induces ROS generation remarkably, and has an excellent cancer cell killing effect. As it turned out, the present invention has been completed.
  • Another object of the present invention is to provide a method for preparing the transition metal complex compound.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer containing the transition metal complex compound as an active ingredient.
  • Another object of the present invention is to provide a composition for inhibiting anticancer agent resistance containing the transition metal complex compound as an active ingredient.
  • Another object of the present invention is to provide a health functional food for preventing or improving cancer containing the transition metal complex compound as an active ingredient.
  • the present invention provides a complex compound represented by Formula 1 below, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 3;
  • z is 0 to 3;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i and R 3j are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, Or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano. ,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • the present invention provides a complex compound represented by the following Chemical Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 2;
  • z is 0 to 1;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i , R 3j , and R 3k are each independently hydrogen, substituted or unsubstituted C 1-6 side chain Or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are one or more selected from the group consisting of halogen, oxo, nitro, and cyano. Substituted with a substituent,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Formula 1 above.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Chemical Formula 2.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of cancer containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a composition for inhibiting anti-cancer agent resistance containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the present invention provides a composition for inhibiting the anti-cancer agent resistance and a pharmaceutical composition for preventing or treating cancer, including a chemotherapeutic agent.
  • the novel Ru complex according to the present invention not only exhibits an excellent killing effect against cancer cells, but also can excellently inhibit the mechanism of occurrence of resistance of cancer stem cells, and a pharmaceutical composition for preventing or treating cancer containing it as an active ingredient Or, it can be usefully used as a pharmaceutical composition for preventing or treating cancer in which an existing anticancer drug resistance problem is improved by using the composition for inhibiting anticancer drug resistance and other chemotherapeutic agents.
  • FACS analysis of Figure 1a is a graph showing the uptake by CD44 positive MCF7 cells at different time points (30, 60 and 90 minutes) after treatment with Example 1 of the invention at 10 ⁇ M
  • FACS analysis of Figure 1b is 10 A graph showing the uptake by CD44 positive MCF7 cells at different time points (30, 60 and 90 minutes) after treatment with Example 2 (RU-2) of the present invention of ⁇ M
  • the FACS analysis in FIG. 1C shows 10 ⁇ M A graph showing the uptake by CD44 positive MCF7 cells at different time points (30, 60 and 90 minutes) after Example 3 (RU-3) treatment of the present invention.
  • FIG. 2 shows the localization in cells observed with confocal microscopy after treatment of Example 1 of the invention in Cd133 positive HCT-116 cells:
  • FIG. 2A Location of localization in mitochondria-(a) nuclear staining
  • b light emission of Example 1
  • c light emission of Mito-tracker red
  • FIG. 2B Location of localization in endoplasmic reticulum-(a) Nuclear staining
  • b Luminescence of Example 1
  • Luminescence of ER-tracker red (d) Overlapping image.
  • FIG. 3 is a fluorescence image showing the degree of intracellular ROS in CD44 positive MCF7 and CD133 positive HCT-116 cells treated with Example 1 at different concentrations of 1, 5 and 10 ⁇ M (FIG. 3A) and 1, 5 and 10 ⁇ M.
  • FIG. 4 is an image showing the results of high-content analysis to find MPTP, cytoplasmic calcium and caspase 3/7 in Example 1 treated CD133 positive HCT-116 cells of the present invention performed using AOTF (FIG. 4A ). ) And graphs (FIG. 4B ). Cancer cells were treated with different concentrations of Ru-1 (1, 5 and 10 ⁇ M) for 16 hours for 37 hours in a humidified atmosphere of 5% CO 2 , fluorescence of calcein AM, calcium orange and magic red caspase 3/7 Emissions were monitored using AOTF at 525nm, 580nm and 630nm, respectively. The green fluorescence image corresponds to the MPT cell image, the orange fluorescence image (FIG. 4A) represents cytoplasmic calcium, and the red fluorescence image represents caspase 3/7. Bar graphs (FIG. 4B) show the average fluorescence intensity of calcein AM, calcium indicator orange and caspase 3/7.
  • Figure 5 is an image and graph showing the expression of the cell death induction and anti-cell death protein in Example 1 of the present invention treated CD133 positive HCT116 cells:
  • Figure 5a Expression of Bax (row 1-DAPI, row 2-Bax, row 3-overlapping);
  • Figure 5b Expression of Bak (row 1-DAPI, row 2-Bak, row 3-overlapping);
  • Figure 5c Expression of Bcl-2 (row 1-DAPI, row 2-Bcl-2, row 3-overlapping);
  • Fig. 5d Western blot analysis of Bcl-2, Bax and Bak in control or Example 1 treated cells;
  • Figure 5e The graph is a graph showing the relative expression of Bcl-2, Bax and Bak according to Example 1 treatment compared to the control group. Error bars represent standard deviation of three independent measurements (* P ⁇ 0.** P ⁇ 0.01, Vs Control).
  • Example 6 is an image of Example 1 of the present invention docked with GRP 78 obtained from the CDOCKER program of Discovery Studio.
  • FIG. 7A shows (A) GRP78 according to different concentrations of Example 1 of the invention in HEK293 cells transfected with pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 and pAC-ATR-GFP1-N1.
  • mRNA expression was analyzed by RT-PCR; 7D shows the expression of GRP78 in CD133 positive HCT116 cells treated with control or inventive example 1 (0, 6, and 12 ⁇ M).
  • the expression fluorescence of GRP-78 is consistent with that of ER tracker red; 7E is a bar graph showing the mean fluorescence intensity of GRP-78 in CD133 positive HCT cancer cells treated with different concentrations of Example 1; 7F is a Western blot showing the expression of GRP78 in CD133 positive HCT116 cells treated with control or Example 1; And Figure 7g is a bar graph showing the relative expression of GRP-78 compared to the control group. Error bars represent standard deviation of three independent measurements (** P ⁇ 0.01, Vs Control).
  • Figure 8 Figure 8a. Treatment Protocol: CD133 positive HCT116 cells were injected intravenously into mice at day 0, and Example 1 of the present invention was treated with mice at days 14-18. Mice were sacrificed on the last day of the experiment; Figure 8b. Photographs of experimental mice (control, low and high dose treatment); Fig. 8c. Photocontrol, low- and high-dose treatment of tumors isolated from experimental mice); Fig. 8d. Tumor volume of experimental mice during the treatment period; Fig. 8e. Weight of tumor xenograft isolated from experimental mice; Fig. 8f.
  • FIG. 8g An image showing fluorescence emission of a CD133 antibody labeled with Alexaflour680 in a control or experimental mouse treated with Example 1 of the present invention.
  • Figure 8g is a graph showing the fluorescence intensity of the CD133 antibody labeled with Alexaflour680.
  • the present invention provides a complex compound represented by Formula 1 below, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 3;
  • z is 0 to 3;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i and R 3j are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, Or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano. ,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • the complex compound represented by Chemical Formula 1 may be a complex compound of Chemical Formula 1'.
  • R 1 , X, n are as defined in Chemical Formula 1.
  • Lig (ligand) of the Ru complex of the present invention may be a ligand of a bidentate.
  • the Ru complex is ionized in a weakly acidic state of the cytoplasm, from which Ru(II) complex is accumulated in mitochondria or ER of cancer cells. This accumulation continues to induce the production of ROS (active oxygen species). Normally, such ROS production is inhibited or controlled by cancer cells by regulating antioxidant protein expression. In addition to ROS production, the Ru complex of the present invention inhibits the expression of these antioxidant proteins itself, which greatly increases the oxidative stress applied to the cells. Killing cancer cells Actively induces apoptosis, and eventually shows the effect of killing cancer and cancer stem cells.
  • ROS active oxygen species
  • the Ru complex of the present invention is useful as an active ingredient of a pharmaceutical composition for the prevention or treatment of cancer, and furthermore, as described in the present invention, it can be used as a more excellent anti-cancer agent, especially because it is easy to enter cells and rapidly. .
  • the novel Ru complex of the present invention exhibits an excellent effect of suppressing the mechanism of cancer resistance development, in addition to the killing effect on cancer and cancer stem cells.
  • a conventional cancer resistance generating mechanism it has been found that resistance to anticancer agents is generated from increased expression of GRP-78 by cancer stem cells (CSC). Therefore, inhibitory activity against GRP-78 is an important pathway that can inhibit or prevent the development of anticancer drug resistance.
  • the novel Ru complex of the present invention significantly inhibits GRP-78 expression and activity.
  • the Ru complex of the present invention not only inhibits the expression of GRP-78, but also binds to GRP-78 dimers, it was experimentally confirmed that its activity is inhibited, which is meaningful, and it is meaningful for CSC in cancer cell lines. After separating the bay, it was found that the mechanism of resistance development of cancer stem cells is significantly suppressed.
  • the novel Ru complex of the present invention can be used as a composition for inhibiting anti-cancer agent resistance, and especially in cancers showing resistance to conventional chemotherapeutic agents, such as platinum-based chemotherapeutic agents, as an adjuvant for anti-cancer treatment that can be used in combination It can be useful.
  • the present invention provides a complex compound represented by the following Chemical Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.
  • X is Cl -, PF 6 -, Br -, BF 4 -, ClO 4 -, CF 3 SO 3 - and SO 4 at least one member selected from the group consisting of and -2;
  • N is an integer from 0 to 5;
  • y is an integer from 1 to 2;
  • z is 0 to 1;
  • Lig are each independently a ligand selected from the group consisting of:
  • R 1 is or ego
  • R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are each independently hydrogen, substituted or unsubstituted C 1-6 side chain or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain Alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano;
  • R 3a , R 3b , R 3c , R 3d , R 3e , R 3f , R 3g , R 3h , R 3i , R 3j , and R 3k are each independently hydrogen, substituted or unsubstituted C 1-6 side chain Or straight chain alkyl, or substituted or unsubstituted C 1-6 side chain or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are one or more selected from the group consisting of halogen, oxo, nitro, and cyano. Substituted with a substituent,
  • R 4a , R 4b , R 4c , R 4d , R 4e , R 4f , R 4g , or R 4h are each independently hydrogen, substituted or unsubstituted C 1-6 branched or straight chain alkyl, or substituted or unsubstituted C 1-6 branched or straight chain alkoxy, wherein the substituted alkyl and substituted alkoxy are substituted with one or more substituents selected from the group consisting of halogen, oxo, nitro, and cyano.
  • the complex compound represented by Chemical Formula 2 may be a complex compound of Chemical Formula 2′.
  • R 1 , X, n are as defined in Chemical Formula 2.
  • Lig (ligand) of the Ru complex of the present invention may be a ligand of a tridentate.
  • the ligand represented by Lig may be used without limitation as long as it is a tridentate ligand, and the present invention includes it.
  • the Ru complex is ionized in a weakly acidic state of the cytoplasm, from which Ru(II) complex is accumulated in mitochondria or ER of cancer cells. This accumulation continues to induce the production of ROS (active oxygen species). Normally, such ROS production is inhibited or controlled by cancer cells by regulating antioxidant protein expression. In addition to ROS production, the Ru complex of the present invention inhibits the expression of these antioxidant proteins itself, which greatly increases the oxidative stress applied to the cells. Killing cancer cells Actively induces apoptosis, and eventually shows the effect of killing cancer and cancer stem cells. Particularly, it was proved in the present invention that a superior killing effect was exhibited compared to the cancer cell killing effect of cisplatin, which is a conventional chemotherapy agent (anticancer agent) (see Experimental Example 1 and Table 2 below).
  • the Ru complex of the present invention is useful as an active ingredient of a pharmaceutical composition for the prevention or treatment of cancer, and furthermore, as described in the present invention, it can be used as a more excellent anti-cancer agent, especially because it is easy to enter cells and rapidly. .
  • the novel Ru complex of the present invention exhibits an excellent effect of suppressing the mechanism of cancer resistance development, in addition to the killing effect on cancer and cancer stem cells.
  • a conventional cancer resistance generating mechanism it has been found that resistance to anticancer agents is generated from increased expression of GRP-78 by cancer stem cells (CSC). Therefore, inhibitory activity against GRP-78 is an important pathway that can inhibit or prevent the development of anticancer drug resistance.
  • the novel Ru complex of the present invention significantly inhibits GRP-78 expression and activity.
  • the Ru complex of the present invention not only inhibits the expression of GRP-78, but also binds to GRP-78 dimers, it was experimentally confirmed that its activity is inhibited, which is meaningful, and it is meaningful for CSC in cancer cell lines. After separating the bay, it was found that the mechanism of resistance development of cancer stem cells is significantly suppressed.
  • the novel Ru complex of the present invention can be used as a composition for inhibiting anti-cancer agent resistance, and especially in cancers showing resistance to conventional chemotherapeutic agents, such as platinum-based chemotherapeutic agents, as an adjuvant for anti-cancer treatment that can be used in combination It can be useful.
  • the complex compound represented by Formula 1 or Formula 2 of the present invention can be used in the form of a pharmaceutically acceptable salt, and the salt is an acid formed by a pharmaceutically acceptable free acid.
  • Addition salts are useful. Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid and phosphorous acid, aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes It is obtained from non-toxic organic acids such as dioate, aromatic acids, aliphatic and aromatic sulfonic acids, acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid and the like.
  • the types of pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and eye Odide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, sube Late, sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitro benzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate
  • the acid addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving a derivative of Formula 1 or Formula 2 in an organic solvent such as methanol, ethanol, acetone, dichloromethane, acetonitrile, and adding an organic acid or inorganic acid
  • an organic solvent such as methanol, ethanol, acetone, dichloromethane, acetonitrile
  • the resulting precipitate can be prepared by filtration and drying, or by distilling the solvent and excess acid under reduced pressure and drying to crystallize under an organic solvent.
  • bases can be used to make pharmaceutically acceptable metal salts.
  • the alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the inexpensive compound salt, and evaporating and drying the filtrate. At this time, it is suitable to manufacture sodium, potassium or calcium salts as metal salts. Further, the corresponding salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable negative salt (eg, silver nitrate).
  • a suitable negative salt eg, silver nitrate
  • the present invention includes all of the complex compounds represented by Formula 1 or Formula 2 and pharmaceutically acceptable salts thereof, as well as solvates, optical isomers, and hydrates that can be prepared therefrom.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Formula 1 above.
  • the preparation method in one aspect, can be performed as in the Reaction Scheme 1'.
  • Step (a) is 1, 10-phenanthroline-5,6-dione, step (a) if the method in which the target compound can be prepared, including this without limitation, but in one embodiment, fluorene-2-car It may proceed to refluxing the voxaldehyde, ammonium acetate, glacial acetic acid.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably, the reaction time may be performed in 3 to 8 hours.
  • step (b) can be carried out by reacting the compound prepared in step (a), cis-[Ru(bpy) 2 Cl 2 ].2H 2 O in ethylene glycol.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably at 90 to 150° C. under an N 2 atmosphere, the reaction time may be performed from 5 hours to 10 hours.
  • step (c) of the scheme 1' is 1, 10-phenanthroline-5,6-dione, if the method in which the target compound can be prepared in step (c), it includes without limitation, but in one embodiment , 4-(dimethylamino)-1-naphthaldehyde, fluorene-2-carboxaldehyde, ammonia acetate, glacial acetic acid.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably, the reaction time may be performed in 3 to 8 hours.
  • X, n, y, z, Lig, R 1 , R 2a , R 2b , R 2c , R 2d , R 2e and R 2f are as defined in Chemical Formula 2.
  • the method may be performed as in the method represented by scheme 2'below.
  • Step (a) is 1, 2,4,6-trichloro-1,3,5-triazine from step (a) if the method in which the target compound can be prepared, including without limitation, but in one embodiment, And reacting with N,N-diethylaniline.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation
  • the reaction temperature may be 50 to 90°C
  • the reaction time may be performed in 5 to 12 hours.
  • step (b) can be carried out by refluxing the compound prepared in step (a), 3,5-dimethylpyrazole, K metal in THF.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation
  • the reaction time may be performed from 5 hours to 12 hours.
  • step (c) of the scheme 2' is 2,2':6',2''-terpyridine (Terpyridine) step (c), if the method in which the target compound can be prepared, including this without limitation, in one embodiment, it may be done by reflux for a hotel pyridine, RuCl 3 .3H 2 O in ethanol.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably, the reaction time may be performed in 1 hour to 5 hours.
  • step (d) is a compound prepared in step (c) and the compound prepared in step (b), the final target compound, a method for preparing the Ru complex of the present invention, the present invention without limitation
  • the compound prepared in step (c) and the compound prepared in step (b) may proceed to react in ethylene glycol.
  • reaction conditions for example, the solvent, the reaction temperature and the reaction time can be adjusted without special limitations, considering the yield and side reaction degree of the target compound prepared by a person skilled in the art, and the present invention includes without limitation However, preferably under reflux under N 2 atmosphere, the reaction time can be carried out from 12 hours to 36 hours, or overnight.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of cancer containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the pharmaceutical composition contains the Ru complex of the present invention, that is, the complex compound represented by Formula 1 or Formula 2 as an active ingredient, and in particular, as shown in the experimental examples of the present invention, anticancer activity (cancer Or cancer stem cell killing effect, ROS production inducing effect), and an effect of significantly inhibiting the expression of enzymatic and non-enzymatic antioxidant proteins that are ROS defense mechanisms of cancer or cancer stem cells.
  • anticancer activity cancer Or cancer stem cell killing effect, ROS production inducing effect
  • the pharmaceutical composition for preventing or treating cancer using the Ru complex of the present invention as an active ingredient was confirmed that the Ru complex of the present invention is excellent in cell entry into cancer or cancer stem cells, and in particular, it is ionized under weakly acidic conditions of the cytoplasm to mitochondria , Or was confirmed to accumulate in ER, from which it was confirmed that ROS generation was remarkable. In addition, it significantly inhibits the expression of enzymatic and non-enzymatic antioxidant proteins, and significantly increases pro-apotopsis protein expression, induces irreversible oxidative stress in cancer or cancer stem cells, and is excellent therefrom. The apoptosis effect was demonstrated.
  • cancer cell lines and cancer stem cells (CSC) of colorectal cancer or breast cancer in animal model experiments in vivo, it is proved that it can be used as an excellent anticancer agent. It can be seen that the pharmaceutical composition for the prevention or treatment of cancer is useful.
  • the cancer is pseudoplastic myxoma, intrahepatic biliary cancer, hepatoblastoma , Liver cancer, thyroid cancer, colon cancer, testicular cancer, myelodysplastic syndrome, glioblastoma, oral cancer, cleft lip cancer, mycosis of the fungus, acute myeloid leukemia, acute lymphocytic leukemia, basal cell carcinoma, ovarian epithelial cancer, ovarian reproductive cell cancer, male breast cancer, brain cancer , Pituitary adenoma, multiple myeloma, gallbladder cancer, biliary tract cancer, colon cancer, chronic myelogenous leukemia, chronic lymphocytic leukemia, retinoblastoma, choroidal melanoma, diffuse giant B cell lymphoma, Barter
  • the cancer is acute myeloid leukemia (AML); Chronic myelogenous leukemia (CML); Acute lymphoblastic leukemia (ALL); Chronic lymphocytic leukemia (CLL); Hodgkin's disease (HD); Non-Hodgkin's lymphoma (NHL); B-cell lymphoma; T-cell lymphoma; Multiple myeloma (MM); Amyloidosis; Waldenstrom megaglobulinemia; Myelodysplastic syndrome (MDS); Small lymphocyte lymphoma (SLL); Marginal zone lymphoma; Asymptomatic multiple myeloma; And it may be one or more selected from the group consisting of myeloproliferative syndrome.
  • AML acute myeloid leukemia
  • CML Chronic myelogenous leukemia
  • ALL Acute lymphoblastic leukemia
  • CLL Chronic lymphocytic leukemia
  • HD Hodgkin's disease
  • NHL Non-Hodgkin's lymph
  • cancer establishes unregulated or dysregulated cell proliferation, reduced cellular differentiation, inadequate ability to invade surrounding tissue, and/or establishes new growth at ectopic sites.
  • a cellular disorder characterized by the ability to.
  • the term “cancer” includes, but is not limited to, solid tumors and blood-borne tumors (hematologic malignancy).
  • the term “cancer” includes diseases of the skin, tissues, organs, bone, cartilage, blood, and blood vessels.
  • cancer further includes primary and metastatic cancer.
  • the solid tumor is pancreatic cancer; Bladder cancer, including invasive bladder cancer; Colorectal cancer; Breast cancer, including thyroid cancer, stomach cancer, and metastatic breast cancer; Prostate cancer, including androgen-dependent and androgen-independent prostate cancer; Kidney cancer, including, for example, metastatic kidney cell carcinoma; Liver cancer, including, for example, hepatocellular carcinoma and intrahepatic bile ducts; Lung and bronchial cancers including non-small cell lung cancer (NSCLC), squamous epithelial lung cancer, bronchoalveolar carcinoma (BAC), adenocarcinoma of the lung, and small cell lung cancer (SCLC); Ovarian cancer, including, for example, advanced epithelial or primary peritoneal cancer; Cervical cancer; Uterine cancer including, for example, the uterine body and cervix; Endometrial cancer; Stomach cancer; Esophageal cancer; Head and neck cancers including, for example, squamous cell carcinoma of the head and neck
  • the hematologic malignancy is acute myeloid leukemia (AML); Chronic myelogenous leukemia (CML) (including accelerated CML and CML subcellular phase (CML-BP)); Acute lymphoblastic leukemia (ALL); Chronic lymphocytic leukemia (CLL); Hodgkin's disease (HD); Non-Hodgkin's lymphoma (NHL) (including follicular lymphoma and mantle cell lymphoma); B-cell lymphoma (including diffuse large B-cell lymphoma (DLBCL)); T-cell lymphoma; Multiple myeloma (MM); Amyloidosis; Waldenstrom megaglobulinemia; Myelodysplastic syndrome (MDS) (including refractory anemia (RA), refractory anemia with coronary blasts (RARS) (excessive blast cells (RAEB), and refractory anemia with RAEB (RAEB-T) with transformation) ; Small lymphocyte lymph
  • the present invention provides a composition for inhibiting anti-cancer agent resistance containing the complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the novel Ru complex of the present invention has the effect as an anti-cancer agent as described above, a mechanism for generating cancer anti-cancer drug resistance, expression of GRP-78 of CSC (cancer stem cell), and resistance through increased activity It has been experimentally demonstrated that the occurrence can be suppressed excellently. In particular, as well as having demonstrated a proportional inhibitory activity with increasing concentration, it was experimentally demonstrated that it is possible to excellently inhibit the expression and activity of significant GRP-78 even at a very small concentration. It can be used as a composition for inhibiting resistance useful for cancer or cancer stem cells resistant to anticancer agents.
  • a conventional chemotherapeutic agent is a mechanism for generating resistance of cancer stem cells (CSC), and the resistance is no longer applied or the drug treatment effect disappears.
  • CSC cancer stem cells
  • the inhibitory effect of the novel Ru complex compound demonstrated by the present invention on the mechanism of resistance to CSC resistance is very important, and from this, the present invention Ru complex compound can be used in combination with a conventional chemotherapeutic agent, without limitations such as pre-treatment or post-treatment. It will be useful as a therapeutic agent capable of suppressing cancer or cancer cell anti-cancer drug resistance by a method.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer, including the anti-cancer agent resistance-inhibiting composition and a chemotherapeutic agent.
  • the present invention inhibits GRP-78 expression and activity in a concentration-dependent manner, from which not only the excellent cell killing effect in cancer cells or cancer stem cells was confirmed, but also in animal model experiments.
  • the novel Ru complex of the present invention can be used as an anti-cancer agent by itself, or usefully provided as a therapeutic agent that can be used in combination with a conventional chemotherapeutic agent (anti-cancer agent).
  • cancer includes all carcinomas described as cancers herein, and refers to one or more of them.
  • the complex compound represented by Formula 1 or Formula 2, the stereoisomer thereof, or a pharmaceutically acceptable salt thereof may be administered in various dosage forms, oral and parenteral, during clinical administration.
  • it when formulated, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc., which are usually used.
  • Formulations for oral administration include, for example, tablets, pills, hard/soft capsules, liquids, suspensions, emulsifiers, syrups, granules, elixirs, troches, etc. , Dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycols).
  • lubricants eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycols.
  • Tablets may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and, if desired, a boron such as starch, agar, alginic acid or its sodium salt, etc. It can contain an releasing or boiling mixture and/or absorbent, colorant, flavoring agent, and sweetening agent.
  • a binder such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine
  • boron such as starch, agar, alginic acid or its sodium salt, etc. It can contain an releasing or boiling mixture and/or absorbent, colorant, flavoring agent, and sweetening agent.
  • the pharmaceutical composition containing the complex compound represented by Formula 1 or Formula 2 as an active ingredient may be parenterally administered, and parenteral administration is by subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. .
  • a complex compound represented by Formula 1 or Formula 2 or a pharmaceutically acceptable salt thereof is mixed with water with a stabilizer or a buffer to prepare a solution or suspension, and this is used as an ampoule or vial. It can be prepared in unit dosage form.
  • the composition may be sterile and/or contain preservatives, stabilizers, hydrating or emulsifying accelerators, adjuvants such as salts and/or buffers for osmotic pressure control, and other therapeutically useful substances, conventional methods of mixing, granulation It can be formulated according to the chemical or coating method.
  • the example of the formulation is related to the conventional formulation example, it can be easily understood by those of ordinary skill in the art that the formulation of the present invention is not limited thereto.
  • the dose of the complex represented by Formula 1 or Formula 2 of the present invention or a pharmaceutically acceptable salt thereof to the human body may vary depending on the age, body weight, sex, dosage form, health condition, and degree of disease of the subject. , Based on an adult subject having a weight of 70 Kg, it is generally 0.1-1000 mg/day, preferably 1-500 mg/day, and once a day at regular time intervals according to the judgment of a doctor or pharmacist It can also be administered in multiple doses.
  • the present invention provides a health functional food composition for preventing or improving cancer containing the complex compound represented by Chemical Formula 1 or Chemical Formula 2, a stereoisomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the cancer refers to all the above-mentioned cancer diseases, non-limiting examples, the cancer is pseudomyxoma, intrahepatic biliary cancer, hepatoblastoma, liver cancer, thyroid cancer, colon cancer, testicular cancer, myelodysplastic syndrome, glioblastoma, oral cancer, cleft cancer , Mycosis, acute myelogenous leukemia, acute lymphocytic leukemia, basal cell carcinoma, ovarian epithelial cancer, ovarian reproductive cell cancer, male breast cancer, brain cancer, pituitary adenoma, multiple myeloma, gallbladder cancer, biliary cancer, colon cancer, chronic myelogenous leukemia, chronic Lymphocytic leukemia, retinoblastoma, choroidal melanoma, diffuse giant B cell lymphoma, barter swelling cancer, bladder cancer, peritoneal cancer, parathyroid cancer, adrenal cancer, nasal sinus cancer, non-small
  • the present invention provides a method for treating cancer comprising administering a complex compound represented by Formula 1 or Formula 2, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof to a subject in a therapeutically effective amount. to provide.
  • the therapeutically effective amount refers to an amount sufficient to treat, prevent or improve the symptoms or conditions of a subject when administered into the body according to the administration method.
  • the amount may vary depending on the weight, age, sex, condition, and family history of the subject to be administered, and in the present invention, the treatment method may determine a different amount of dose according to different conditions for each subject.
  • the “effective amount” is an amount effective for treating cancer, for example.
  • the “effective amount” of a compound is an amount that can cause cancer or cancer stem cell death.
  • the complex compounds and compositions according to the methods of the present invention can be administered using any amount and any route of administration effective for treating a disease.
  • the exact amount required will vary from subject to subject, depending on the subject's species, age, and general condition, severity of infection, specific agent, mode of administration, and the like.
  • the complex compounds of the present invention are frequently formulated in dosage unit form for ease of administration and uniformity of dosage.
  • dosage unit form as used herein means a physically discrete unit of agent suitable for the subject to be treated. It will also be understood that the total daily use of the complex compounds and compositions of the present invention will be determined by the attending physician within the scope of sound medical judgment.
  • the specific effective dosage level for any particular subject or organism depends on various factors, including: the disease to be treated and the severity of the disease; The activity of the specific compound employed; Specific composition used; Age, weight, general health, subject's gender and diet; The time of administration, route of administration, and rate of excretion of the specific compound employed; Duration of treatment; The specific compound employed alone or co-administered drugs, and other factors well known in medical technology.
  • subject means an animal, for example a mammal, such as a human.
  • the ruthenium complex of the present invention exhibits anti-cancer activity, and has been confirmed to be a metal complex targeting an intracellular organ for drug-resistant protein and anti-cancer activity, and can overcome multi-drug resistance in cancer stem cells.
  • the cancer tumor microenvironment (pH 6.5-6.8) is more acidic than normal tissue (pH 7.4).
  • PH 7.4 normal tissue
  • protonation of the Ru complex of the present invention is easier under physiological conditions, and it is presumed to lead more easily to the internal mitochondrial membrane (IMM) negative potential.
  • the Ru complex of the present invention coexists in both mitochondria and ER.
  • the accumulation of transition metal complexes in mitochondria or ER can effectively generate reactive oxygen species (ROS) through a Fenton-type redox reaction, which is characterized by the fact that transition metals simultaneously deactivate antioxidant proteins and are free radicals in cancer cells under acidic microenvironments.
  • ROS reactive oxygen species
  • cancer cells can withstand metabolic and pharmacological loads to the limit of ROS toxicity.
  • CSC also exhibits high levels of antioxidant enzymes as well as non-enzymatic antioxidant proteins compared to proliferative cancer cells, allowing CSCs to develop drug resistance to chemotherapy drugs from this survival mechanism.
  • Ruthenium trichloride trihydrate and other reagents or chemicals were purchased from Sigma Aldrich, South Korea.
  • Analytic grade solvents were purchased from Alfa Aesar or Sigma Aldrich South Korea and degassed with 100% dry nitrogen for 20 minutes prior to use in the reaction. Deionized water was used to prepare the sodium chlorate solution.
  • Acetonitrile and toluene commercial solvents were used for column purification and were purchased from Daejung Chemicals, Korea.
  • the resulting crude product was filtered, and neutral alumina was purified twice by column chromatography using a fixed phase, toluene/acetonitrile (40/60, v/v) as a mobile phase solvent. Dark red-orange bands were collected and the solvent was concentrated under reduced pressure. Then the product was added slowly to a saturated (50%) NaClO 4 solution ClO 4 - was obtained in the salt.
  • the resulting crude product was filtered, washed with water, neutral alumina as the stationary phase, and purified twice by column chromatography using toluene/acetonitrile (20/80, v/v) as the mobile phase solvent. The dark red band was collected and the solvent was concentrated under reduced pressure. Then the product was added slowly to a saturated (50%) NaClO 4 solution ClO 4 - was obtained in the salt.
  • Toxicity to cancer cells and cancer stem cells of Example 1-3 Ru complex was evaluated by MTT analysis.
  • the thiazyl blue tetrazolium bromide (MTT) dye based cytotoxicity assay was performed according to the manufacturer's protocol (Vybrant® MTT Cell Proliferation Assay Kit (V-13154), Thermofischer Scientific, USA),
  • MCF-7 cell lines and HCT-116 cell lines were used as cancer cells, and CD44 positive MCF7 cells and CD133 positive HCT116 cells were tested as cancer stem cells (CSC), respectively.
  • CSC cancer stem cells
  • breast cancer cell line MCF-7 and colorectal cancer cell line HCT-116 were purchased from the Korea Cell Line Bank (KCLB, Seoul) and used.
  • CD44 positive MCF7 cells and CD133 positive HCT116 cells which are cancer stem cells (CSC) were separated from the MCF-7 and HCT-116 cell lines using CSC (cancer stem cell) markers.
  • CSC cancer stem cell
  • CD44 was used in the MCF-7 cell line.
  • the markers were used to isolate CSCs using CD133 markers in the HCT-116 cell line (using CD44 and CD133 microbead kits (MACS Miltenyi Biotec)).
  • each cancer cell line or cancer stem cell was individually seeded in a 96-well plate and incubated in DMEM medium supplemented with 10% FBS for 24 hours at 37°C. Thereafter, cells were treated with various concentrations (0 to 100 ⁇ M) of Example 1-3 Ru complex and incubated for 24 hours. Then, DMEM medium was removed and the cells were incubated with 100 ⁇ L of MTT solution at 37° C. for 3 hours. After removing 75 ⁇ L of MTT solution, 50 ⁇ L of DMSO was added to dissolve formazan crystals. Absorbance at 570 nm was measured using a multiplot reader (Molecular Devices, Gemini XS). Cisplatin was used as a positive control, and the IC 50 values of Examples 1-3 and cisplatin for the cancer cell line were calculated, and the results are shown in Table 2 below.
  • Example 2 cytotoxicity was observed for cancer cells and cancer stem cells in the order of Example 1>
  • Example 1 was found to have the best toxicity to cancer cells and cancer stem cells, of Example 1 for MCF-7, CD44 + MCF-7, HCT-116 and CD133 + HCT-116.
  • IC 50 values are identified as 8.9 ⁇ M, 10.1 ⁇ M, 11.9 ⁇ M, and 15.1 ⁇ M, respectively.
  • Example 1 shows 5 to 6 times better cancer cell killing effect on MCF7 cell line and CD44 positive MCF7 cells, and 3 to 4 times better cancer stem cell killing effect on HCT116 cell line and CD133 positive HCT116 cells. It is the result confirmed by showing.
  • the novel ruthenium complex compound according to the present invention has excellent cancer cells, and cancer stem cell killing effect is confirmed.
  • As an active ingredient it is excellent as a pharmaceutical composition for preventing or treating cancer, or as a health functional food for prevention or improvement.
  • the novel ruthenium complex compounds of the present invention also show excellent killing effects against cancer stem cells, which are the main cause of drug resistance, and can be usefully used as chemotherapy drugs used to treat or prevent cancer. have.
  • the efficacy of the successful chemotherapy of the drug depends on the absorption and accumulation in the intracellular organs.
  • Example 1 of the present invention significantly increases at a time point of 30 minutes or more, and reaches a saturation state at a time point of 60 minutes, and Example 1 of the present invention is MCF-7. It was confirmed that it was rapidly absorbed by CSC (cancer stem cell).
  • Example 2 also observed cell influx into cancer stem cells at the time of 90 minutes elapsed, but compared to Example 2 or Example 3, Example 1 was significantly superior cells It can be seen that inflow (permeability) is confirmed (Example 1> Example 2> Example 3).
  • the Ru complex of the present invention is excellent in influx into cancer stem cells, and thus can better induce the killing effect of cancer cells, containing it as an active ingredient, a pharmaceutical composition for preventing or treating cancer, and drug resistance Eggplant can be useful as a chemotherapy aid for the prevention or treatment of cancer.
  • CSC cancer stem cells
  • Cancer stem cells, CD133 positive HCT-116, and CD44 positive MCF-7 were placed in a cover glass and incubated at 37° C. for 24 hours. Thereafter, the cells were treated with a 10 ⁇ M inventive example 1 ruthenium complex and incubated at 37° C. for 2 hours. After drug treatment, cells are washed with 1 ⁇ PBS and MitoTracker® Red CMXRos (Thermofischer scientific, USA) or ER-ID® Red (Enzo Life Sciences, Inc., USA), USA with Hoechst 33258 nuclear dye (Sigma Aldrich) ), and incubated for 30 minutes. Finally, cells were fixed with 4% formaldehyde for 15 minutes at room temperature.
  • Example 1 complex is mainly distributed in the cytoplasmic mitochondria (A in FIG. 2) and ER (vesicles) of CD133 positive HCT-116 (B in FIG. 2 ). Is clearly confirmed. In addition, it was confirmed that the complex of Example 1 is effectively distributed in mitochondria and ER in CD44 positive MCF-7.
  • Example 2 Similar to the above ⁇ 3-1>, intracellular location analysis was performed for Example 2 or Example 3 using CD44 positive MCF-7, and as a result, Example 2 was relatively denser to ER than mitochondria. Although it was confirmed that it was distributed, Example 3 showed an even distribution in both ER and mitochondria.
  • the Ru complex of the present invention acts through a cell death pathway that mediates ER and mitochondria.
  • CSC cancer stem cells
  • MCF-7 and HCT-116 cells were seeded in 12-well culture plates and incubated overnight at 37° C., 5% CO 2 .
  • the cells were treated with or without the Ru complex of the present invention (Example 1 treated with 1 ⁇ M, 5 ⁇ M, 10 ⁇ M) for 6 hours, and then cultured in a 37° C., 5% CO 2 environment. Did.
  • cells were fixed with 4% formaldehyde and incubated for 10 minutes at room temperature.
  • DCFDA 2′,7′-dichlorofluoresine 2 acetate
  • ROS induced 2′,7′-dichloro Fluorescence intensity of fluorescein was measured at excitation and emission wavelengths of 495 and 529 nm, and the results are shown in FIGS. 3A and 3B.
  • Example 1 of the present invention induces ROS production in a concentration proportional manner (0, 1, 5 and 10 ⁇ M) in CSC (cancer stem cells).
  • DCFH-DA which is sensitive to oxidation, produces green fluorescence when ROS is produced.
  • 3B is a bar graph showing the average fluorescence intensity of DCFH-DA staining in cells treated with Example 1 at concentrations of 1 ⁇ M, 5 ⁇ M, and 10 ⁇ M, and it is confirmed that the fluorescence intensity increases proportionally.
  • Example 2 and Example Example 3 are confirmed to induce ROS production in a concentration-dependent manner, it can be confirmed that the maximum ROS production is induced at 12 and 60 ⁇ M, respectively.
  • the ruthenium complex of the present invention significantly induces ROS production from redox circulation, and from this, it is possible to excel in oxidative stress and cell death effects of cells, which is contained as an active ingredient It can be usefully used as a pharmaceutical composition for preventing or treating cancer, and as a chemotherapy adjuvant for preventing or treating cancer having drug resistance.
  • CSC Cancer stem cells of HCT-116 and MCF-7 were cultured in 12-well culture flasks, respectively, and maintained in DMEM medium supplemented with 10% FBS for 24 hours at 37°C and 5% CO 2 atmosphere. Next, the cells were maintained for 16 hours without treatment with or without treatment of the present invention Ru complex example 1 (by concentrations of 1, 5 and 10 ⁇ M). After washing with 1 ⁇ PBS buffer, cells were incubated with calcium indicator orange (Invitrogen, CA, USA) for 45 minutes at room temperature in the dark. Cells were washed with 1 ⁇ PBS and incubated with calcein-AM (acetoxymethyl ester, Invitrogen, CA, USA) for 30 minutes at 37°C.
  • Ru complex example 1 by concentrations of 1, 5 and 10 ⁇ M
  • the fluorescence emission of calcein AM, calcium orange and magic red caspase 3/7 was monitored at 525 nm, 580 nm and 630 nm, respectively, using AOTF.
  • the green fluorescence image corresponds to the cell image of MPT
  • the orange fluorescence image represents cytoplasmic calcium
  • the red fluorescence image represents caspase 3/7.
  • the bar graph in (b) shows the average fluorescence intensity of calcein AM, calcium indicator orange and caspase 3/7.
  • Example 1 treatment significantly reduced the fluorescence intensity of calcein-AM accumulated in the mitochondria of CSC compared to the control group (p ⁇ 0.01).
  • a sharp decrease in fluorescence intensity of calcein-AM accumulated in mitochondria was observed in 2 ⁇ M of Example 1 treatment and saturated in 4 ⁇ M of Example 1 treatment.
  • Example 1 complexes were mostly distributed in mitochondria and ER.
  • the ROS induced by Example 1 can mediate calcium release from ER, which may play a role in the activation of caspase-mediated cell death.
  • MPTP mitochondrial permeable transition pores
  • Example 2 and Example 3 Performed in the same manner as in ⁇ 5-1>, but was performed using Example 2 and Example 3 in MCF-7 cancer stem cells (CD44(+) MCF-7). As a result, Example 2 and Example 3 Again, it appears that the shape following the cell death mechanism appears, but it was confirmed that Example 1 responds most sensitively to the treatment concentration.
  • Figure 5 shows the induction of apoptosis and expression of anti-cell death protein in CD133 positive HCT116 cells treated with Example 1.
  • FIG. 5A shows immunofluorescence analysis of Bcl-2 expression in control and Example 1 treated HCT-116 CSC.
  • the protein level of Bcl-2 was further evaluated by Western blot method and is shown in Figure 5D.
  • FIGS. 5B and 5C show the expression of Bax and Bak in the control and Example 1 treated CSC, respectively.
  • the oligomer structure of Bax and Bak was observed in Example 1 treated cells. However, oligomerization of Bax and Bak was not well observed in control cells.
  • the apoptosis-inducing proteins Bax and Bak are generally present in the cytoplasm, but during cell death, they oligomerize the outer membrane of the mitochondria to cause MOMP.
  • Bak/Bax leads to mitochondrial outer membrane permeability (MOMP) causing release of cytochrome c (Cyt c).
  • MOMP mitochondrial outer membrane permeability
  • 5D shows Western blot analysis of Bak and Bax, and it was confirmed that Bax and Bak levels were significantly increased in CSC cells treated in Example 1 compared to the control group (p ⁇ 0.01).
  • Example 1 treatment of the present invention activation of Bak and Bax inducing cell death is observed, and the oligomerization of Bak/Bax causes mitochondrial outer membrane permeability (MOMP) causing release of cytochrome c (Cyt c). Leads to Cyt c in the cytoplasm forms apoptosome with protease activating factor 1 (Apaf1) and protease caspase-9. This multimeric apotosomal complex activates caspase-3 and caspase-7.
  • MOMP mitochondrial outer membrane permeability
  • ⁇ MOMP is irreversible for cell survival, furthermore, the reduced anti-cell death Bcl-2 expression observed in Example 1 treated cells maintains Cyt-c release from mitochondria.
  • the ruthenium complex of the present invention induces MPTP and MOMP formation in mitochondria of cancer cells and confirms effective intrinsic cell death-mediated action of cancer cells.
  • Example 1 is ARPase domain binding of GRP 78;
  • Example 1 It could not be accommodated in the ATP domain of the first scenario, and the size of the complex of Example 1 was successfully modeled as the dimer interface of GRP 78 in the second scenario.
  • the corresponding docking result is a 3D view of the interaction between Example 1 and GRP 78 in FIG. 6.
  • Example 1 of the present invention intercalates the dimeric structure of GRP-78 by forming a strong non-covalent interaction with a specific amino acid residue of GRP-78 at the interface of the dimeric structure of the protein.
  • Genomic DNA from the control human sample was isolated using the QIAamp DNA Blood Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.
  • GRP-78 forward (50 pmol; 5'-AAAGCTTTTATGAAGCTCTCCCTGGTGG-3') and
  • GRP-78 reverse (50 pmol; 5'-AGGATCCCTACAACTCATCTTTTTCTGCTG-3') or
  • ATR forward (50 pmol, 5'-AAGCTTATGGCCACGGCGGAGC-3')
  • ATR Reverse (50 pmol; 5'-GGATCCTTTTATTTTATTTTCCTCACTCTCCT -3')
  • GRP78, CLU and ATR primers were designed to amplify the GRP78, CLU and ATR transcripts of each gene.
  • PCR amplification was confirmed by analyzing 1.9 kb GRP78, 1.5 kb CLU and 850 bp ATR fragments using a 1.2% agarose gel with standard molecular weight markers.
  • PCR amplified GRP78, CLU and ATR fragments were restricted to the HindIII/BamHI enzyme. Restricted GRP78, CLU and ATR fragments were pTag-YFP-C (4.7 kb; Evrogen, Moscow, Russia), pDs-Red2-N1 (4.7 kb; Clontech, USA) and pAC-GFP1-N1 (4.7 kb; Clontech, respectively). USA).
  • the conjugated fusion gene vector was individually transformed into E. coli E. coli DH5 ⁇ cells through chemical modification as suggested by the manufacturer (Invitrogen, Carlsbad, CA).
  • Transformants (pTag-YFP-GRP78-C, pDs-CLU-Red2-N1 and pAC-ATR-GFP1-N1) were selected on LB agar plates added with kanamycin (30 ⁇ g/mL). Plasmids from resistant colonies were isolated using a plasmid midi kit (Qiagen). Plasmids cloned with GRP78, CLU and ATR genes were co-transfected into HEK-293 cells.
  • HEK-293 human embryonic kidney cells
  • KCLB1 Korean cell line bank
  • FBS 10% FBS
  • HEK-293 cells 5x10 5 cells/well
  • plasmid DNA GFP78, CLU and ATR
  • Lipofectamine 2000 Invitrogen
  • HEK293 cells were treated in Example 1 for 16 hours, and then maintained in a CO 2 incubator in DMEM medium at 37°C. Then, total RNA was extracted according to the manufacturer's protocol (Dynabeads® MRNA Purification Kit, Invitrogen, USA). The integrity of the isolated RNA was evaluated qualitatively by the ratio of absorbance at 260/280 nm and then qualitatively by 1% agarose RNA gel electrophoresis.
  • RNA concentration was measured at 260 nm using Nanodrop (Thermo Scientific, U.S.A).
  • Total RNA, GAPDH-specific cDNA and GRP78 were prepared using the QuantiTect Reverse Transcription Kit (Qiagen, USA) according to the manufacturer's protocol. Two picomolar primers were used for amplification of the target m-RNA. After determining the starting template amount of the sample using GAPDH expression, a quantitative PCR reaction was performed.
  • GAPDH sense CATGAGAAGTATGACAACAGCCT, antisense AGTCCTTCCACGATACCAAAGT; GRP78 sense TGCCGCTTTGCAGGTGTATT, antisense CCGATGCTCAGAGCTTTCTCC.
  • RT-PCR SYBR green qPCR kit, Thermo Scientific, USA. RT-PCR was run using Applied BiosystemsTM Real-Time PCR instrument (7300).
  • Antibodies specific to GRP78 were conjugated with Q-dot 705 (Quantum Dot Conjugation Kit; Invitrogen, Carlsbad, CA, USA), respectively.
  • Q-dot 705 Quantum Dot Conjugation Kit; Invitrogen, Carlsbad, CA, USA
  • DTT dithiothreitol
  • the antibody was then incubated with maleimide-functionalized quantum dot for 1 hour at room temperature.
  • conjugate was then treated with 2-mercaptoethanol to remove maleimide groups. Unconjugated quantum dots were eluted using the column provided in the kit.
  • the Q-dot antibody conjugate was diluted 1:200 with 1% BSA for immunofluorescence analysis.
  • the excitation and emission used for fluorescence analysis were 405/705 nmdl, respectively.
  • Example 1 shows that the binding of Example 1 with GRP-78 can lead to structural changes in GRP-78 that induce ubiquitin-mediated degradation.
  • Example 1 Western blot analysis also confirmed that the Example 1 dose decreased the protein level of GRP-78 dependently.
  • Example 1 the inhibitory effect of Example 1 on GRP-78 is a very useful property that reduces the likelihood of tumor recurrence in cancer treatment and overcomes drug resistance of cancer.
  • mice This in vivo animal experiment was conducted with the approval of the Institutional Animal Care and Use Committee of the Seoul National University, and a 7-week-old Swiss female athymic mouse was purchased and used from Daehan Biolink (Seoul, Korea). All mice were adapted to be free of specific pathogens at the Seoul National University College of Pharmacy's Zoo Center (Seoul, Korea), and maintained by maintaining a dark cycle of 12 hours at 24-26°C.
  • CD133 positive HCT-116 cells (3 ⁇ 10 6 cells) isolated from HCT-116 cell culture were mixed with 100 ⁇ l of LDEV-Free reduced growth factor basement membrane matrix (Geltrex; Thermofischer Scientific, USA), followed by the right flank of the mouse. It was injected subcutaneously. When the tumors reached a volume of 100 mm 3 , the mice were divided into three groups of 6 animals each.
  • control group was injected intraperitoneally with 1 ⁇ PBS containing 4% DMSO;
  • mice were injected intraperitoneally with Example 1 (Example 1 dissolved in DMSO and diluted with 1 ⁇ PBS) at a dose of 0.03 mg/kg/body weight or 0.06 mg/kg/body weight daily.
  • Treatment was repeated for 2 weeks, and the experiment was stopped when the tumor size of the control reached about 1500 mm 3 .
  • Tumor size and weight were monitored daily during the treatment.
  • Tumor volume (mm 3 ) was calculated as follows:
  • Example 1 As described above, the possibility of chemotherapy in vivo of the complex of Example 1 for xenograft derived from CD133 + HCT-116 cells in athymic nude mice was investigated.
  • Example 1 Ru complex/kg/body weight was administered daily to the experimental group, and as a result, tumor weight and volume of the mouse group of the Example 1 treated experimental group were compared with that of the control mouse group. It was confirmed that it was significantly reduced (Figs. 8B and C).
  • Tumor weight was significantly reduced from 55% to 80% compared to the control (FIG. 8D).
  • the tumor weight in the control group, the experimental group (low dose), and the experimental group (high dose) was confirmed to be 3.2 g, 1.6 g, and 1.15 g, respectively, indicating the remarkable anticancer efficacy of Example 1 (FIG. 8E ).
  • mice of the experimental group treated in Example 1 maintained normal body weight during the entire treatment process, and the mortality rate was not observed. As a result, it was confirmed that the Ru complex of the present invention was not toxic to normal cells.
  • CSC cancer stem cells
  • Example 1 It was confirmed that the experimental mice treated with Example 1 exhibited 2 and 4 fold reduction in fluorescence intensity in the low- and high-dose treatment groups, respectively, compared to the control group (Fig. 8G). It demonstrates that it shows excellent cytotoxicity against CSC and excellent cell death effect.
  • the Ru complex of the present invention can be usefully used as an anticancer agent and an adjuvant (a composition for inhibiting resistance) of conventional chemotherapy. Furthermore, the Ru complex of the present invention was confirmed as an excellent in vivo treatment potential for a colon cancer xenograft model, and the Ru complex of the present invention is excellent as an alternative to conventional chirogens, such as platinum-based chemotherapy, which had problems such as resistance and side effects. It can be seen that can be used.
  • novel Ru complex according to the present invention a pharmaceutical composition for preventing or treating cancer containing it as an active ingredient, or a composition for inhibiting anticancer drug resistance, and other chemotherapeutic agents in combination with the existing anticancer drug resistance problem is improved It can be useful as a pharmaceutical composition for the prevention or treatment of cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un nouveau composé complexe de ruthénium, son procédé de préparation et une composition pharmaceutique le comprenant en tant que principe actif pour prévenir ou traiter le cancer. Le nouveau composé complexe de Ru selon la présente invention a non seulement un excellent effet de destruction sur des cellules cancéreuses, mais peut également inhiber de manière remarquable les mécanismes de résistance des cellules souches cancéreuses. Ainsi, le composé complexe peut être utilisé de manière efficace en tant que principe actif dans une composition pharmaceutique pour la prévention ou le traitement du cancer ou une composition pour l'inhibition de la résistance à des agents anticancéreux, et peut être utilisé en combinaison avec d'autres agents chimiothérapeutiques dans une composition pharmaceutique pour la prévention ou le traitement du cancer ; l'invention peut ainsi résoudre des problèmes classiques se liant à la résistance à des agents anticancéreux.
PCT/KR2018/016898 2018-12-28 2018-12-28 Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer WO2020138570A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2018/016898 WO2020138570A1 (fr) 2018-12-28 2018-12-28 Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2018/016898 WO2020138570A1 (fr) 2018-12-28 2018-12-28 Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer

Publications (1)

Publication Number Publication Date
WO2020138570A1 true WO2020138570A1 (fr) 2020-07-02

Family

ID=71127076

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/016898 WO2020138570A1 (fr) 2018-12-28 2018-12-28 Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer

Country Status (1)

Country Link
WO (1) WO2020138570A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8193175B2 (en) * 2004-07-13 2012-06-05 Universite De Strasbourg Ruthenium complexes for treating cancers
CN102942595A (zh) * 2012-11-22 2013-02-27 中山大学 一类钌配合物及其制备方法和应用
KR20190074542A (ko) * 2017-12-20 2019-06-28 서울대학교산학협력단 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8193175B2 (en) * 2004-07-13 2012-06-05 Universite De Strasbourg Ruthenium complexes for treating cancers
CN102942595A (zh) * 2012-11-22 2013-02-27 中山大学 一类钌配合物及其制备方法和应用
KR20190074542A (ko) * 2017-12-20 2019-06-28 서울대학교산학협력단 신규 루테늄 착화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 암의 예방 또는 치료용 약학적 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SHILPA, M.: "DNA-interactions of ruthenium (II) & cobalt (III) phenanthroline and bipyridine complexes with a planar aromatic ligand 2-(2-fluronyl) IH-imidazo [4, 5-f][1, 10-Phenanthroline", JOURNAL OF INCLUSION PHENOMENA AND MACROCYCLIC CHEMISTRY, 2011, pages 187 - 195, XP019900486 *
TAN, L.-F.: "Nucleic acid binding behaviors and cytotoxic properties of a Ru (II) complex", DNA AND CELL BIOLOGY, vol. 30, no. 5, 2011, pages 277 - 285, XP055721474 *

Similar Documents

Publication Publication Date Title
WO2016200101A2 (fr) Composé dérivé tricyclique, son procédé de préparation, et composition pharmaceutique le contenant
WO2021075691A1 (fr) Dérivé de pyrimidine, son procédé de préparation, et composition pharmaceutique pour prévenir ou traiter le cancer, le comprenant en tant que composant actif
WO2017188694A1 (fr) Composé hétéroaryle comprenant de l'azote et son utilisation
WO2016126085A2 (fr) Composé hétérocyclique et composition pharmaceutique comprenant celui-ci
WO2018012907A1 (fr) Nouveaux dérivés de quinazolinone inhibant la pi3k et composition pharmaceutique en contenant
WO2018004213A1 (fr) Nouveau composé ayant une activité inhibitrice de smo et composition comprenant celui-ci en tant qu'ingrédient actif pour prévenir ou traiter le cancer
WO2021162451A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer, contenant des acides biliaires ou des dérivés de ceux-ci, composés à base de biguanide, et deux ou plus de deux types d'agents antiviraux en tant que principes actifs
WO2019168237A1 (fr) Nouveau composé et composition pour la prévention, l'amélioration ou le traitement de la fibrose ou de la stéatohépatite non alcoolique le comprenant en tant que principe actif
WO2020222461A1 (fr) Adjuvant d'immunothéraphie anticancéreuse
WO2021145655A1 (fr) Nouveau dérivé de pyrazole
WO2016108489A1 (fr) Nouveau composé de ruthénium et composition pharmaceutique pour prévenir ou traiter le cancer contenant ledit composé comme principe actif
WO2017176040A1 (fr) Composé hétérocyclique décomposant une protéine ras et utilisations correspondantes
WO2021235812A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer du poumon non à petites cellules associé à une mutation ron, et méthode l'utilisant
WO2018021826A1 (fr) Nouveau dérivé de pyrimidine-2,4-diamine et composition pharmaceutique pour la prévention ou le traitement du cancer contenant celui-ci comme ingrédient actif
WO2020138570A1 (fr) Nouveau composé complexe de ruthénium, son procédé de préparation et composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer
WO2016093554A2 (fr) Nouveau dérivé de 4-(aryl)-n-(2-alkoxythiéno[3,2-b]pyrazin-3-yl)-pipérazine-1-carboxamide et effet antiprolifératif de celui-ci
WO2018056621A1 (fr) Nouveau dérivé de pyrimidine imidazolyle, son procédé de préparation et une composition pharmaceutique le contenant en tant que principe actif pour prévenir ou traiter le cancer
WO2016006975A2 (fr) Nouveaux dérivés imidazotriazinone ou imidazopyrazinone et leur utilisation
WO2018164549A1 (fr) Nouveau composé ayant une activité inhibitrice de malate déshydrogénase et composition pharmaceutique destinée à prévenir ou à traiter le cancer le contenant à titre de principe actif
WO2022103149A1 (fr) Nouveau dérivé de carbazole et composition pharmaceutique pour la prévention ou le traitement du cancer le comprenant en tant que principe actif
WO2023287128A1 (fr) Dérivé d'indazole yl benzimidazole ou sel pharmaceutiquement acceptable de celui-ci et son utilisation
WO2021149900A1 (fr) Dérivé d'adamantyle disubstitué ou son sel pharmaceutiquement acceptable, et composition pharmaceutique pour empêcher la croissance du cancer le contenant comme principe actif
WO2022086110A1 (fr) Dérivé de thiobenzimidazole ou sel pharmaceutiquement acceptable de celui-ci, et leur utilisation
WO2021235813A1 (fr) Composition pharmaceutique pour la prévention ou le traitement du cancer du pancréas associé à une mutation ron et méthode l'utilisant
WO2021101268A1 (fr) Dérivé de benzamide, son procédé de préparation, et composition pharmaceutique le comprenant en tant que principe actif pour la prévention ou le traitement du cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18944318

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18944318

Country of ref document: EP

Kind code of ref document: A1