WO2020130615A1 - 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물 및 이의 용도 - Google Patents
간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물 및 이의 용도 Download PDFInfo
- Publication number
- WO2020130615A1 WO2020130615A1 PCT/KR2019/017980 KR2019017980W WO2020130615A1 WO 2020130615 A1 WO2020130615 A1 WO 2020130615A1 KR 2019017980 W KR2019017980 W KR 2019017980W WO 2020130615 A1 WO2020130615 A1 WO 2020130615A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bile duct
- cells
- stem cells
- medium composition
- present
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/37—Digestive system
- A61K35/407—Liver; Hepatocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/12—Hepatocyte growth factor [HGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases (EC 2.)
- C12N2501/727—Kinases (EC 2.7.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/50—Proteins
- C12N2533/54—Collagen; Gelatin
Definitions
- the present invention relates to a media composition for inducing bile duct cell differentiation of liver stem cells and uses thereof, and more specifically, to provide a media composition for differentiating liver stem cells into bile duct cells without undergoing an endoderm step, and the medium composition is a cell By applying at the time of culturing, it relates to a method capable of rapidly obtaining bile duct cells.
- the liver is one of the most complex organs in the body and consists of hepatocytes, biliary epithelial cells, Kupffer's cells, stellate cells, and hepatic progenitor cells. do. Hepatocytes make up the largest share of this, and 95% of the liver. The remaining 5% are bile epithelial cells, also known as cholangiocytes.
- Biliary epithelial cells are actively involved in changes in the amount and composition of bile, activated by interaction with endogenous and exogenous stimuli and involved in the recovery of liver damage.
- Biliary duct disease refers to a category of chronic liver disease and is a disease associated with biliary epithelial cells.
- Common biliary pathologies include primary biliary liver cirrhosis, primary sclerosing cholangitis, liver-associated cystic fibrosis, biliary atresia, polycystic liver disease, and bile duct cancer.
- the disease is characterized by a rapid progression of the disease and a serious morbidity and mortality due to the absence of medical treatment including clinical management capable of treating the disease.
- the best treatment for bile duct disease is liver transplantation, but there is a shortage of donors and a high risk of complications during transplantation.
- the present invention was devised to solve the above problems, and experimentally confirmed that differentiation into bile duct cells is possible by culturing liver stem cells reprogrammed from liver cells in a medium containing specific compounds. Based on this, the present invention was completed.
- an object of the present invention is to provide a medium composition for inducing differentiation of liver stem cells into bile duct cells, which comprises HGF, sodium taurocholate hydrate and CHIR99021.
- Another object of the present invention (a) gelatin coated liver (plate) step of placing the stem cells in the liver; And (b) culturing liver stem cells by adding the above-described medium composition, to provide a method for differentiating liver stem cells into bile duct cells.
- Another object of the present invention is to provide bile duct cells differentiated by the above method.
- Another object of the present invention is to provide a composition for preventing or treating bile duct disease, which comprises the bile duct cells.
- the present invention provides a medium composition for inducing differentiation of liver stem cells into bile duct cells, comprising HGF, sodium taurocholate hydrate, and CHIR99021.
- HGF may be included at a concentration of 50 to 160 ng/mL.
- sodium taurocholate hydrate with respect to the medium composition may be included in a concentration of 1 to 10 ⁇ M.
- CHIR99021 may be included at a concentration of 0.75 to 7.5 ⁇ M.
- the present invention comprises the steps of: (a) placing liver stem cells on a gelatin-coated plate; And (b) provides a method for differentiating liver stem cells into bile duct cells, comprising the step of culturing liver stem cells by adding the above-described medium composition.
- the gelatin may be coated on a plate at a concentration of 0.05 to 0.15%.
- the stem cells can be cultured for 7 to 17 days.
- the present invention provides bile duct cells differentiated by the above method.
- the present invention provides a composition for preventing or treating bile duct disease, including the bile duct cells.
- the bile duct disease is Alagille syndrome (AGS), primary biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), cystic fibrosis (cystic) fibrosis, bile duct injury, biliary atresia, or cholangiocarcinoma.
- Alagille syndrome Alagille syndrome
- PBC primary biliary cirrhosis
- PSC primary sclerosing cholangitis
- cystic fibrosis cystic fibrosis
- bile duct injury biliary atresia
- cholangiocarcinoma cholangiocarcinoma
- the present invention provides a method of preventing or treating bile duct disease, comprising administering the composition to an individual.
- the present invention provides a composition for preventing or treating bile duct disease.
- bile duct cells can be rapidly obtained without going through an endoderm stage, Since the use of gelatin as a cell support during the differentiation of the bile duct cells, it is expected that it is possible to obtain bile duct cells applicable to the clinic, which can be usefully used for the treatment of bile duct disease.
- FIG. 1 shows a schematic diagram of the process of inducing differentiation of bile duct cells from the liver.
- FIG. 2 shows the results of observing the morphology of liver stem cells and differentiated bile duct cells according to the present invention
- FIG. 2A shows the results of observing the morphology of liver stem cells
- FIG. 2B is an enlarged result of FIG. 2A
- 2c shows the result of observing the morphology of the differentiated bile duct cells
- Figure 3 shows the gene expression pattern of the bile duct cell marker in the differentiated bile duct cells according to the present invention compared to liver stem cells (hCdH is a liver stem cell, hCdH-Chol represents differentiated bile duct cells).
- Figure 5 shows the results confirming the enzyme activity in the liver stem cells and differentiated bile duct cells according to the present invention by Fluorescein diacetate (FD) assay (hCdH is liver stem cells, hCdH-Chol represents differentiated bile duct cells) .
- FD Fluorescein diacetate
- the present inventors have experimentally confirmed that cultured liver stem cells reprogrammed from liver cells in a medium containing specific compounds differentiate into bile duct cells, thereby completing the present invention.
- the present invention provides a medium composition for inducing differentiation of liver stem cells into bile duct cells, characterized by comprising HGF, sodium taurocholate hydrate and CHIR99021.
- the term “differentiation” refers to a phenomenon in which cells divide and proliferate and the structure or function of cells is specialized while the entire individual is growing. In other words, it refers to a process in which cells, tissues, etc. of an organism are transformed into a suitable form and function in order to perform a role given to each.
- an omnipotent stem cell such as an embryonic stem cell into ectodermal, mesodermal, and endoderm cells is also differentiated, and narrowly, the process by which hematopoietic stem cells turn into red blood cells, white blood cells, platelets, etc. also corresponds to differentiation. It is also called "natural differentiation.”
- culture media used in the present invention means a medium that can support stem cell growth and survival in vitro (in-vitro), and is usually used in the art suitable for culturing cells. Contains all of the medium. Media and culture conditions can be selected according to the cell type.
- the medium composition may include HGF, sodium taurocholate hydrate, and CHIR99021, and HGF may be included at a concentration of 50 to 160 ng/mL for a medium composition for inducing differentiation of liver stem cells into bile duct cells, , It may be preferably included at a concentration of 75ng/mL, but is not limited thereto.
- the sodium taurocholate hydrate is known to play a role in inhibiting spontaneous differentiation of liver stem cells into hepatocytic lineage, and 1 to 1 for a medium composition for inducing differentiation of liver stem cells into bile duct cells It may be included in a concentration of 10 ⁇ M, preferably may be included in a concentration of 10 ⁇ M, but is not limited thereto.
- the CHIR99021 is known as a low-molecular inhibitor of GSK-3 (Glycogen Synthase Kinase-3), and may be included in a concentration of 0.75 to 7.5 ⁇ M with respect to a medium composition for inducing differentiation of liver stem cells into bile duct cells, preferably It may be included in a concentration of 7.5 ⁇ M, but is not limited thereto.
- GSK-3 Glycogen Synthase Kinase-3
- the medium used for the culture is preferably a cell culture minimum medium (CCMM), and generally contains a carbon source, a nitrogen source, and a trace element component.
- the cell culture minimal medium is, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI1640, F-10, F-12, aMEM (a Minimal Essential Medium) , GMEM (Glasgow's Minimal Essential Medium), Iscove's Modified Dulbecco's Medium, and the like.
- the medium may include antibiotics such as penicillin, streptomycin, and gentamicin.
- the present invention comprises the steps of (a) placing liver stem cells on a plate coated with gelatin and (b) culturing liver stem cells by adding the above medium composition. , A method for differentiating liver stem cells into bile duct cells and bile duct cells differentiated by the above method.
- gelatin used in the present invention is an inducing protein obtained by hydrolyzing collagen (collagen), which is a natural polymer protein constituting animal bones, skins, tendons, and cartilage.
- the general constituents of gelatin may consist of about protein: 84 to 90%, water: 8 to 12% and mineral salts: 2 to 4%.
- Gelatin in the present invention may have a variety of gel strength (gel strength), viscosity (viscosity).
- gelatin may be separated or synthesized from natural materials, and the type of the raw material is not limited, but may be preferably produced by hydrolyzing collagen separated from leather, bone shells, etc. of mammals or fish.
- the step (a) of the present invention is a step of placing on a cell support to cultivate liver stem cells, bile duct cells differentiated through a culture step using a gelatin coating instead of a matrigel extracted from cancer cells Can be used directly in clinical practice.
- the gelatin coating may be at a concentration of 0.05 to 0.15%, preferably 0.1%, but is not limited thereto.
- the step (b) of the present invention is a step of culturing liver stem cells in the differentiation medium for differentiation into bile duct cells, and when the stem cells are cultured for 7 to 17 days, differentiated bile duct cells can be obtained. . Preferably it can be cultured for 10 to 14 days, but is not limited thereto.
- expression of a bile duct cell specific marker may be increased compared to the stem cells.
- the cells may increase expression of bile duct cell specific markers CK19 and CK7 by 3 times, expression of AE2 and AQP1 by 12 times, and expression of CFTR by 20 times or more compared to liver stem cells, but are not limited thereto. It is not.
- 0.1 ⁇ M dexamethasone (dexamethasone), 10mM nicotinamide (nicotinamide), 1% ITS (insulin-transferrin-selenium), 75ng/mL HGF, 10 ⁇ M sodium taurocholate hydrate, As a result of culturing liver stem cells for 10 to 14 days using DMEM/F-12 medium supplemented with 7.5 ⁇ M CHIR99021 and 75 ng/mL Epidermal Growth Factor (EGF), it was confirmed that differentiated bile duct cells can be obtained. (See Example 2-1).
- EGF Epidermal Growth Factor
- the differentiated cells were bile duct cells
- a branched structure characteristic of bile duct cells was confirmed ( See Example 2-2)
- specific marker genes of the bile duct cells CK19, CK7, CFTR, AE2 and AQPR1 It was confirmed that the expression increased (see Example 2-3).
- bile duct cells can be effectively obtained by using liver stem cells and the medium composition, and that the bile duct cells can be provided for regeneration of bile ducts, and thus can be usefully used as a therapeutic agent for bile duct disease. Suggests.
- the present invention provides a composition for preventing or treating bile duct disease, comprising the bile duct cells.
- biliary tract disease refers to a disease related to bile ( ⁇ ) secreted from hepatocytes, and preferably, Alagille syndrome (AGS), primary biliary liver cirrhosis (primary biliary) cirrhosis, PBC, primary sclerosing cholangitis (PSC), cystic fibrosis, biliary atresia or cholangiocarcinoma, but is not limited thereto.
- Alagille syndrome Alagille syndrome
- primary biliary liver cirrhosis primary biliary liver cirrhosis
- PBC primary sclerosing cholangitis
- cystic fibrosis cystic fibrosis
- biliary atresia or cholangiocarcinoma but is not limited thereto.
- composition for preventing or treating bile duct disease of the present invention may further include a pharmaceutically acceptable carrier.
- the pharmaceutically acceptable carrier is commonly used in preparation, and includes, but is not limited to, saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposomes, and the like. If necessary, it may further contain other conventional additives such as antioxidants, buffers, if necessary.
- diluents, dispersants, surfactants, binders, lubricants, and the like can be additionally added to prepare formulations for injection, pills, capsules, granules, or tablets, such as aqueous solutions, suspensions, and emulsions.
- suitable pharmaceutically acceptable carriers and formulations the formulations described in Remington's literature can be used to formulate according to each component.
- the pharmaceutical composition of the present invention is not particularly limited in the formulation, but may be formulated as an injection, an inhalant, an external preparation for skin, or an oral intake.
- composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, skin, nasal cavity, airway) according to the desired method, the dosage is the patient's condition and weight, the degree of disease , Depending on the drug form, the route of administration and time, it can be appropriately selected by those skilled in the art.
- composition according to the invention is administered in a pharmaceutically effective amount.
- a pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, and activity of the drug , The sensitivity to the drug, the time of administration, the route of administration and the rate of excretion, the duration of treatment, factors including the drugs used simultaneously, and other factors well known in the medical field.
- the composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art.
- suitable dosages of the compositions of the present invention vary by factors such as formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response sensitivity. Can be prescribed. For example, at least about 10 4 to 10 6 And typically 1 ⁇ 10 8 to 1 ⁇ 10 10 liver progenitor cells may be injected intravenously or intraperitoneally over approximately 60 to 120 minutes to a patient weighing 70 kg. For administration, bile duct cells are administered at a rate determined by LD-50 (or other toxicity measurement method) according to the cell type and side effects depending on the cell type at various concentrations, taking into account the overall health and weight of the individual. do.
- LD-50 or other toxicity measurement method
- the administration can be administered at one time or divided into several times. However, since the dosage may be increased or decreased depending on the route of administration, severity of bile duct disease, sex, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.
- the present invention provides a method for preventing or treating bile duct disease, comprising administering the composition to an individual.
- “individual” means a subject in need of a method for treating a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, and Means mammals such as cows.
- human primary hepatocytes were cultured with 10 mM nicotinamide (Sigma-Aldrich, MO, USA), 1% penicillin/streptomycin (Gibco), 20 ng/mL HGF (Peprotech, NJ, USA) ), at a temperature of 37° C. and CO 2 in DMEM/F-12 (11965, Gibco, CA, USA) with 20 ng/mL EGF (Peprotech) and 4 ⁇ M A83-01 (Gibco) and 3 ⁇ M CHIR99021 (StemCell Technologies). Cultured in the incubator, the medium was changed daily.
- tissue samples were fixed with paraformaldehyde and glutaraldehyde, and then fixed once again with osmium tetraoxide (OsO 4 ).
- a tissue sample fixed to the resin was filled, and then ultrathin sections were stained with uranyl acetate and lead citrate and photographed.
- the 4 ⁇ m cross section was deparaffinized by washing 3 times with xylene for 5 minutes each time.
- the differentiated bile duct cells were rehydrated with ethanol, and finally washed with distilled water.
- slides were autoclaved in pH 6.0 and 10 mM sodium citrate buffer to recover after exposing the antigen.
- the slides were incubated in distilled water for 5 minutes and the primary antibody was added at 4° C. overnight and then placed in a chamber where constant humidity was maintained. The next day, slides were washed three times for 5 minutes with PBS staining solution supplemented with 1% FBS, and then incubated with secondary antibodies for 1 hour and 30 minutes at room temperature.
- Antibodies are shown in Table 2.
- Nuclei were counter stained using Hoechst 33342 (1:10000, Molecular Probes) dissolved in PBS. After incubation with the secondary antibody, slides were washed with running tap water, dehydrated, cleared and fitted. Samples were imaged with a TCS SP5 confocal microscope (Leica).
- Quantitative data are expressed as mean ⁇ standard deviation (SD) along with inference statistics (p value). Statistical significance was evaluated by a significant bilateral t-test set to *P ⁇ 0.05, **P ⁇ 0.01, and ***P ⁇ 0.001.
- liver stem cells In order to differentiate liver stem cells into bile duct cells, the liver stem cells (see Example 1-1) were placed on a plate coated with 0.1% gelatin and 0.1 ⁇ M dexamethasone and 10 mM nicotinamide on the plate. ), DMEM/F- supplemented with 1% insulin-transferrin-selenium (ITS), 75 ng/mL HGF, 10 ⁇ M sodium taurocholate hydrate, 7.5 ⁇ M CHIR99021 and 75 ng/mL Epidermal Growth Factor (EGF) The liver medium was cultured for 10 to 14 days by adding 12 medium.
- ITS insulin-transferrin-selenium
- the observation of a scanning microscope according to Example 1-2 above confirmed the branched structure characteristic of bile duct cells as shown in FIGS. 2C and 2D ( hCdH represents liver stem cells, and hCdH-Chol represents differentiated bile duct cells).
- QRT-PCR was performed according to Examples 1-3 above to clarify whether the differentiated cells were bile duct cells.
- CK19, CK7, CFTR and AE2 which are markers of bile duct cells, increased as compared to liver stem cells as shown in FIG. 4 (hCdH is liver stem cell, hCdH-Chol is differentiated bile duct cell) Indicates).
- Fluorescein diacetate assay was performed according to Example 1-5 to clarify whether the differentiated cells were bile duct cells.
- the bile duct cells rapidly pass through the induced pluripotent stem cell stage and the endoderm stage It was confirmed that it is possible to induce differentiation of the furnace.
- the gelatin is used as a cell support instead of the matrigel extracted from cancer cells during the differentiation of bile duct cells, it is expected to be useful for directly treating bile duct disease.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Virology (AREA)
- Nutrition Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physiology (AREA)
- Immunology (AREA)
- Developmental Biology & Embryology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
본 발명은 간 줄기세포의 담관 세포 분화 유도용 배지 조성물 및 이의 용도에 관한 것으로서, 보다 구체적으로, 간 줄기세포를 내배엽 단계를 거치지 않고 담관 세포로 분화시키는 배지 조성물을 제공하고, 상기 배지 조성물을 세포 배양 시에 적용함으로써, 신속하게 담관 세포를 수득할 수 있는 방법에 관한 것이다. 본 발명에 의하면, 간 줄기세포의 배양 과정에서 HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 배지 조성물을 첨가함으로써, 내배엽 단계를 거치지 않고 신속하게 담관 세포를 수득할 수 있으며, 상기 담관 세포의 분화 시에 젤라틴(gelatin)을 세포 지지체로 사용하므로 임상에 적용 가능한 담관 세포를 수득할 수 있어, 이를 직접 담관 병증의 치료에 유용하게 이용할 수 있을 것으로 기대한다.
Description
본 발명은 간 줄기세포의 담관 세포 분화 유도용 배지 조성물 및 이의 용도에 관한 것으로서, 보다 구체적으로, 간 줄기세포를 내배엽 단계를 거치지 않고 담관 세포로 분화시키는 배지 조성물을 제공하고, 상기 배지 조성물을 세포 배양 시에 적용함으로써, 신속하게 담관 세포를 수득할 수 있는 방법에 관한 것이다.
간은 체내에서 가장 복잡한 기관 중 하나이며, 간세포(hepatocyte), 담즙 상피 세포(biliary epithelial cell), 쿠퍼 세포(Kupffer's cell), 성상 세포(stellate cell) 및 간 전구 세포(hepatic progenitor cell) 등으로 구성된다. 이 중 가장 큰 비중을 차지하는 것은 간세포이며 전체 간의 95%를 차지한다. 나머지 5%는 cholangiocytes로도 알려진 담즙 상피 세포이다.
담즙 상피 세포(Cholangiocytes)는 담즙의 양과 조성의 변화에 적극적으로 관여하며, 내인성 및 외인성 자극과의 상호 작용에 의해 활성화되고 간 손상 회복에 관여한다.
담관 병증은 만성 간 질환의 한 범주를 말하며, 담즙 상피 세포와 관련된 질환이다. 일반적인 담관 병증으로는 원발성 담즙성 간 경변, 원발성 경화성 담관염, 간과 관련된 낭포성 섬유증, 담즙 폐쇄증, 다낭성 간 질환 및 담관암 등이 있다. 상기 병증은 병의 진행이 빠르며, 상기 질환을 치료할 수 있는 임상 관리를 비롯한 의학 요법이 없어 심각한 이환율과 사망률을 기록한다. 현재까지 담관 병증에 대한 가장 적합한 치료법은 간 이식이지만, 기증자가 부족하고 이식 시 합병증이 발생할 위험이 높다.
이러한 문제를 극복하기 위해 많은 연구자들이 담관 세포와 유사한 세포 생성을 위한 배지 조성물과 담관 세포 분화법에 대해 연구하였으나, 종래의 유도 만능 줄기세포(Induced pluripotent stem cell, iPSC) 및 배아 줄기세포(Embryonic stem cell, ESC)를 이용한 담관 세포 분화법은 내배엽 단계와 간 전구세포 단계를 거친 후 담관 세포로 분화하여 시간적, 경제적으로 비효율적이며 암세포에서 추출된 마트리겔(matrigel)을 사용하여 임상에 적용할 수 없다는 한계가 있었다. 또한, 다능성 줄기세포로부터 간세포 및 담관 세포의 생성 방법에 관한 연구는 진행된 바 있으나(한국공개특허공보 제10-2015-0119427호), 저분자 화합물을 이용하여 유도된 간 줄기세포를 담관 세포로 분화시키기 위한 배지 조성물에 관한 연구는 아직 미진한 실정이다.
본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로서, 간 세포로부터 리프로그래밍(reprogramming)된 간 줄기세포를 특정 화합물들을 함유하는 배지에서 배양하면 담관 세포로 분화가 가능하다는 것을 실험적으로 확인하였는바, 이에 기초하여 본 발명을 완성하였다.
따라서, 본 발명의 목적은 HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물을 제공하는 것이다.
본 발명의 다른 목적은 (a) 젤라틴이 코팅된 플레이트(plate)에 간 줄기세포를 위치시키는 단계; 및 (b) 상기의 배지 조성물을 첨가하여 간 줄기세포를 배양하는 단계를 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 방법으로 분화된 담관 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 담관 세포를 포함하는 것을 특징으로 하는, 담관 질환 예방 또는 치료용 조성물을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위하여, 본 발명은 HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물을 제공한다.
본 발명의 일 구현예로 상기 배지 조성물에 대해 HGF는 50 내지 160ng/mL의 농도로 포함될 수 있다.
본 발명의 다른 구현예로 상기 배지 조성물에 대해 나트륨 타우로콜레이트 수화물은 1 내지 10μM의 농도로 포함될 수 있다.
본 발명의 또 다른 구현예로 상기 배지 조성물에 대해 CHIR99021은 0.75 내지 7.5μM의 농도로 포함될 수 있다.
또한, 본 발명은 (a) 젤라틴이 코팅된 플레이트(plate)에 간 줄기세포를 위치시키는 단계; 및 (b) 상기의 배지 조성물을 첨가하여 간 줄기세포를 배양하는 단계를 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 방법을 제공한다.
본 발명의 일 구현예로 상기 젤라틴은 0.05 내지 0.15%의 농도로 플레이트(plate)에 코팅된 것일 수 있다.
본 발명의 다른 구현예로 상기 줄기세포를 7 내지 17일 동안 배양할 수 있다.
또한, 본 발명은 상기의 방법으로 분화된 담관 세포를 제공한다.
또한, 본 발명은 상기 담관 세포를 포함하는, 담관 질환 예방 또는 치료용 조성물을 제공한다.
본 발명의 일 구현예로 상기 담관 질환은 알라질 증후군(Alagille syndrome, AGS), 원발성 담즙성 간 경변(primary biliary cirrhosis, PBC), 원발성 경화성 담관염(primary sclerosing cholangitis, PSC), 낭포성 섬유증(cystic fibrosis), 담도손상 (bile duct injury), 담즙 폐쇄증(biliary atresia) 또는 담관암(cholangiocarcinoma)일 수 있다.
또한, 본 발명은 상기 조성물을 개체에 투여하는 단계를 포함하는 담관 질환의 예방 또는 치료방법을 제공한다.
또한, 본 발명은 상기 조성물의 담관 질환 예방 또는 치료 용도를 제공한다.
본 발명에 의하면, 간 줄기세포의 배양 과정에서 HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 배지 조성물을 첨가함으로써, 내배엽 단계를 거치지 않고 신속하게 담관 세포를 수득할 수 있으며, 상기 담관 세포의 분화 시에 젤라틴(gelatin)을 세포 지지체로 사용하므로 임상에 적용 가능한 담관 세포를 수득할 수 있어, 이를 직접 담관 병증의 치료에 유용하게 이용할 수 있을 것으로 기대한다.
도 1은 간으로부터 담관 세포 분화 유도 과정의 개략도를 나타낸 것이다.
도 2는 본 발명에 따른 간 줄기세포와 분화된 담관 세포의 형태를 관찰한 결과를 나타낸 것으로서, 도 2a는 간 줄기세포의 형태를 관찰한 결과를 나타내며, 도 2b는 상기 도 2a를 확대한 결과를 나타내고, 도 2c는 분화된 담관 세포의 형태를 관찰한 결과를 나타내며, 도 2d는 상기 도 2c를 확대한 결과를 나타낸 것이다(스케일바=100μm, hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
도 3은 본 발명에 따른 분화된 담관 세포에서의 담관 세포 마커의 유전자 발현 양상을 간 줄기세포와 비교하여 나타낸 것이다(hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
도 4는 본 발명에 따른 분화된 담관 세포에서의 담관 세포 마커의 단백질 발현 양상을 간 줄기세포와 비교하여 나타낸 것이다(스케일바=50μm, hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
도 5는 본 발명에 따른 간 줄기세포 및 분화된 담관 세포에서의 효소 활성을 Fluorescein diacetate(FD) assay로 확인한 결과를 나타낸 것이다(hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
이하, 본 발명을 상세히 설명한다.
본 발명자들은 간 세포로부터 리프로그래밍(reprogramming)된 간 줄기세포를 특정 화합물들을 함유하는 배지에서 배양하면 담관 세포로 분화된다는 것을 실험적으로 확인하였는바, 이에 기초하여 본 발명을 완성하였다.
이에, 본 발명은 HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물을 제공한다.
본 발명에서 사용되는 용어 "분화"란, 세포가 분열하여 증식하며 전체 개체가 성장하는 동안에 세포의 구조나 기능이 특수화되는 현상을 말한다. 즉, 생물의 세포, 조직 등이 각각에게 주어지는 역할을 수행하기 위해 적합한 형태 및 기능으로 변하는 과정을 말한다. 예를 들어, 배아줄기세포와 같은 전능성 줄기세포는 외배엽, 중배엽, 및 내배엽 세포로 변하는 과정도 분화이며, 좁게는 조혈 모세포가 적혈구, 백혈구, 혈소판 등으로 변하는 과정도 분화에 해당된다. 또한, 이를 "자연 분화"라고 칭하기도 한다.
본 발명에서 사용되는 용어 "배지(culture media)"란, 시험관 내(in-vitro)에서 줄기세포 성장 및 생존을 지지할 수 있게 하는 배지를 의미하고, 세포의 배양에 적절한 당 분야에서 사용되는 통상의 배지를 모두 포함한다. 세포의 종류에 따라 배지와 배양 조건을 선택할 수 있다.
본 발명에서 상기 배지 조성물은 HGF, 나트륨 타우로콜레이트 수화물 및 CHIR99021을 포함할 수 있으며, HGF는 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물에 대해 50 내지 160ng/mL의 농도로 포함될 수 있으며, 바람직하게는 75ng/mL의 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 나트륨 타우로콜레이트 수화물는 간 줄기세포의 간세포 계통(hepatocytic lineage)으로의 자발적인 분화를 저해하는 역할을 하는 것으로 알려져 있으며, 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물에 대해 1 내지 10μM의 농도로 포함될 수 있으며, 바람직하게는 10μM의 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 CHIR99021은 GSK-3(Glycogen Synthase Kinase-3)의 저분자 저해제로 알려져 있으며, 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물에 대해 0.75 내지 7.5μM의 농도로 포함될 수 있으며, 바람직하게는 7.5μM의 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다.
배양에 사용되는 배지는 바람직하게는 세포 배양 최소 배지(cell culture minimum medium, CCMM)로, 일반적으로 탄소원, 질소원 및 미량원소 성분을 포함한다. 상기의 세포 배양 최소 배지에는 예를 들어, DMEM(Dulbecco's Modified Eagle's Medium), MEM(Minimal essential Medium), BME(Basal Medium Eagle), RPMI1640, F-10, F-12, aMEM(a Minimal essential Medium), GMEM(Glasgow's Minimal essential Medium), Iscove's Modified Dulbecco's Medium 등이 있으나, 이에 제한되는 것은 아니다. 또한, 상기 배지는 페니실린(penicillin), 스트렙토마이신(streptomycin), 겐타마이신(gentamicin) 등의 항생제를 포함할 수 있다.
본 발명의 다른 양태로서, 본 발명은 (a) 젤라틴이 코팅된 플레이트(plate)에 간 줄기세포를 위치시키는 단계 및 (b) 상기의 배지 조성물을 첨가하여 간 줄기세포를 배양하는 단계를 포함하는, 간 줄기세포의 담관 세포로의 분화 방법 및 상기 방법으로 분화된 담관 세포를 제공한다.
본 발명에서 사용되는 용어 "젤라틴"이란, 동물의 뼈, 가죽, 힘줄, 연골 등을 구성하는 천연 고분자 단백질인 콜라겐(교원질)을 가수분해하여 얻어지는 유도 단백질이다. 젤라틴의 일반적 구성 성분은 약 단백질(protein): 84 내지 90%, 수분(water): 8 내지 12% 및 무기염류(mineral salts): 2 내지 4%로 구성될 수 있다. 본 발명에서 젤라틴은 다양한 젤 강도(gel strength), 점도(viscosity)를 가질 수 있다. 본 발명에서 젤라틴은 천연물질로부터 분리 또는 합성될 수 있으며, 그 원료의 종류는 한정되지 않으나, 바람직하게는 포유동물 또는 어류 등의 가죽, 뼈 껍질 등으로부터 분리된 콜라겐을 가수분해하여 생산할 수 있다.
본 발명의 상기 (a) 단계는 간 줄기세포를 배양하기 위해 세포 지지체에 위치시키는 단계로서, 암세포에서 추출된 마트리겔(matrigel) 대신 젤라틴(gelatin) 코팅을 사용하여 배양 단계를 거쳐 분화된 담관 세포를 임상에 직접 사용할 수 있다. 상기 젤라틴 코팅은 0.05 내지 0.15% 농도로 일 수 있으며, 바람직하게는 0.1%이나, 이에 제한되는 것은 아니다.
본 발명의 상기 (b) 단계는 담관 세포로의 분화를 위해 간 줄기세포를 상기 분화용 배지에서 배양하는 단계로서, 상기 줄기세포가 7 내지 17일 동안 배양되면 분화된 담관 세포를 수득할 수 있다. 바람직하게는 10 내지 14일 동안 배양할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 담관 세포는 담관 세포 특이적 마커의 발현이 상기 줄기세포에 비해 증가할 수 있다. 바람직하게는 상기 세포는 간 줄기세포에 비해 담관 세포 특이적 마커인 CK19 및 CK7의 발현이 3배, AE2 및 AQP1의 발현이 12배 및 CFTR의 발현이 20배 이상 증가할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일실시예에서는 0.1μM 덱사메타손(dexamethasone), 10mM 니코틴아마니드(nicotinamide), 1% ITS(insulin-transferrin-selenium), 75ng/mL HGF, 10μM 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate), 7.5μM CHIR99021 및 75ng/mL EGF(Epidermal Growth Factor)가 보충된 DMEM/F-12 배지를 사용하여 간 줄기세포를 10 내지 14일 동안 배양한 결과, 분화된 담관 세포를 수득할 수 있음을 확인하였다(실시예 2-1 참조).
이에 상기 분화된 세포가 담관 세포인지를 명확하게 하기 위해, 본 발명의 다른 일실시예에서는 간 줄기세포에서 분화된 담관 세포의 형태를 관찰한 결과, 담관 세포의 특징인 분지된 구조를 확인하였고(실시예 2-2 참조), 본 발명의 또 다른 일실시예에서는 간줄기 세포에서 분화된 담관 세포의 mRNA를 관찰한 결과, 담관 세포의 특이적 마커 유전자인 CK19, CK7, CFTR, AE2 및 AQPR1의 발현이 증가한 것을 확인하였다(실시예 2-3 참조). 이에 더하여 본 발명의 또 다른 일실시예에서는 간줄기 세포에서 분화된 담관 세포의 다양한 담관 세포 마커의 양을 확인한 결과, CK19, CK7, CFTR 및 AE2의 발현이 증가한 것을 시각적으로 확인하였다(실시예 2-4 참조).
상기 결과들은 간 줄기세포와 상기 배지 조성물을 이용하여 효과적으로 담관 세포를 수득할 수 있으며, 상기의 담관 세포는 담관 재생을 위해 제공될 수 있다는 점에서, 담관 질환의 치료제로써 유용하게 이용될 수 있음을 시사한다.
이에, 본 발명은 상기 담관 세포를 포함하는 것을 특징으로 하는, 담관 질환 예방 또는 치료용 조성물을 제공한다.
본 발명에서 대상으로 하는 질환인 "담관 질환"이란, 간세포에서 분비된 담즙(膽汁)에 관련된 질환을 총칭하며, 바람직하게는 알라질 증후군(Alagille syndrome, AGS), 원발성 담즙성 간 경변(primary biliary cirrhosis, PBC), 원발성 경화성 담관염(primary sclerosing cholangitis, PSC), 낭포성 섬유증(cystic fibrosis), 담즙 폐쇄증(biliary atresia) 또는 담관암(cholangiocarcinoma)일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 담관 질환 예방 또는 치료용 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다. 상기 약학적으로 허용 가능한 담체는 제제 시에 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 사이클로덱스트린, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포솜 등을 포함하지만 이에 한정되지 않으며, 필요에 따라 항산화제, 완충액 등 다른 통상의 첨가제를 더 포함할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제, 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립, 또는 정제로 제제화할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제화에 관해서는 레밍턴의 문헌에 개시되어 있는 방법을 이용하여 각 성분에 따라 바람직하게 제제화할 수 있다. 본 발명의 약학적 조성물은 제형에 특별한 제한은 없으나 주사제, 흡입제, 피부 외용제, 또는 경구 섭취제 등으로 제제화할 수 있다.
본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 피부, 비강, 기도에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물 형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명에 따른 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 따른 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로, 본 발명의 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 예컨대, 적어도 약 104 내지 106개 및 전형적으로 1×108 내지 1×1010개의 간 전구세포를 70kg의 환자에게 대략 60분 내지 120분에 걸쳐 정맥 내 또는 복강 내로 주입할 수 있다. 투여의 경우, 개체의 전반적 건강 상태 및 체중을 고려하면서, 담관 세포를 세포의 유형에 따른 LD-50(또는 기타 독성 측정 방법) 및 다양한 농도에서의 세포의 유형에 따른 부작용에 의해 결정된 비율로 투여한다. 투여는 한 번에 또는 여러 회 나누어 투여할 수 있다. 그러나 투여 경로, 담관 질환의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
한편, 본 발명의 또 다른 양태로서, 본 발명은 상기 조성물을 개체에 투여하는 단계를 포함하는 담관 질환 예방 또는 치료 방법을 제공한다.
본 발명에서 "개체"란, 질병의 치료방법을 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. 실험준비 및 실험방법
1-1. 간 줄기세포의 확립
William의 배지에서 24시간 동안 배양한 후, 인간 프라이머리 간세포를 10mM 니코틴아마이드(Sigma-Aldrich, MO, USA), 1% 페니실린/스트렙토마이신(Gibco), 20ng/mL의 HGF(Peprotech, NJ, 미국), 20ng/mL의 EGF(Peprotech) 및 4μM A83-01(Gibco) 및 3μM CHIR99021(StemCell Technologies)이 첨가된 DMEM/F-12(11965, Gibco, CA, USA)에서 37℃ 및 CO2 조건의 배양기에서 배양하였으며, 매일 배지를 교체하였다.
1-2. 주사전자현미경
조직 샘플을 파라포름알데히드와 글루타알데히드로 고정한 후, 사산화오스뮴(OsO4)으로 다시 한번 고정하였다. 레진에 고정된 조직 샘플을 충전 후 초박 절편하여 아세트산 우라닐과 납시트레이트로 염색하여 사진 촬영하였다.
1-3. mRNA 분리 및 RT-PCR 분석
트리졸 시약(Gibco)을 사용하여 총 RNA를 분리하였다. Transcriptor First Strand cDNA Synthesis Kit(Roche, PA, USA)로 1μg의 RNA 샘플을 역전사하고 qPCR PreMix(Dyne bio, Korea) 10μL, cDNA 1μL 및 올리고 뉴클레오티드 프라이머(표 1)를 사용하여 CFX Connect Real-Time PCR Detection system(Bio-rad, CA, USA)에서 실시간 PCR을 수행하였다. 반응은 각 유전자에 대해 세 번씩 반복 분석하였다. PCR 사이클은 95℃에서 20초, 60℃에서 40초의 40사이클로 구성된다. 용융 곡선 및 용융 피크 데이터를 수득하여 PCR 산물을 특성화하였다.
유전자 | 정방향 프라이머 서열(5´-3´) | 역방향 프라이머 서열(5´-3´) |
CK19 | TCCGAACCAAGTTTGAGACG | CCCTCAGCGTACTGATTTCC |
CK7 | GATAAAAGGCGCGGAGTGTC | GAAACCGCACCTTGTCGATG |
CFTR | AGTTGCAGATGAGGTTGGGC | AAAGAGCTTCACCCTGTCGG |
AE2 | GGGGAAAGTTGAGTTGGGAGA | CTGGCTCTGGCGTACAGAAA |
AQPR1 | GGCCAGCGAGTTCAAGAAGAA | TCACACCATCAGCCAGGTCAT |
1-4. 면역조직화학
매회 5분 동안 크실렌으로 3회 세척하여 4μm 단면을 탈파라핀화 시켰다. 분화된 담관 세포를 에탄올로 재수화하고, 마지막으로 증류수로 세척하였다. 세척 후, 슬라이드를 pH 6.0 및 10mM 시트르산 나트륨 완충액에서 오토클레이브하여 항원을 노출시킨 후 회수하였다. 슬라이드를 5분 동안 증류수에서 배양하고 밤새 4℃에서 1차 항체를 첨가한 후 일정 습도가 유지되는 챔버에 넣었다. 다음날, 슬라이드를 1% FBS가 보충된 PBS 염색 용액으로 5분 동안 3회 세척한 후, 실온에서 1시간 30분 동안 2차 항체와 함께 배양하였다. 항체는 표 2에 나타내었다. PBS에 녹인 Hoechst 33342(1:10000, Molecular Probes)를 사용하여 핵을 대조 염색하였다. 2차 항체와 함께 항온 배양한 후, 슬라이드를 흐르는 수돗물로 세척하고, 탈수시키고, 맑게 하고, 장착시켰다. 샘플을 TCS SP5 공초점 현미경(Leica)으로 영상화하였다.
단백질 | 회사 | 상품번호 |
CK19 | Santa Cruz Biotechnology | sc-376126 |
CK7 | Abcam | ab9021 |
CFTR | Almone | Acl006 |
AE2 | Abcam | ab42687 |
1-5. Fluorescein diacetate(FD) assay
리파아제, 에스테라제 및 프로테아제를 비롯한 여러 종류의 효소는 FDA를 가수분해하며, 상기 가수분해로 무색의 FDA는 형광성 황록색 플루오레세인을 형성한다.
FDA 분석에서, 시료는 FDA 및 완충액과 혼합하였고, 1 내지 2시간 동안 진탕 배양하였다. 생성된 황록색 형광 강도로 FDA 분자의 효소 절단량 및 시료에서 효소 활성을 측정하였다. 효소 활성의 정량화는 분광 광도계를 사용하여 형광 형성의 강도로 평가하였다.
1-6. 통계 분석
정량적 데이터는 추론 통계치(p 값)와 함께 평균±표준 편차(SD)로 표시된다. 통계적 유의성은 *P<0.05, **P<0.01, ***P<0.001로 설정한 유의미한 양측 t-검정으로 평가하였다.
실시예 2. 간 줄기세포의 담관 세포로의 분화 유도 확인
2-1. 간 줄기세포의 담관 세포로의 분화 유도
간 줄기세포를 담관 세포로 분화시키기 위하여 상기 간 줄기세포(실시예 1-1 참조)를 0.1%의 젤라틴이 코팅된 플레이트에 위치시키고 상기 플레이트에 0.1μM 덱사메타손(dexamethasone), 10mM 니코틴아마니드(nicotinamide), 1% ITS(insulin-transferrin-selenium), 75ng/mL HGF, 10μM 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate), 7.5μM CHIR99021 및 75ng/mL EGF(Epidermal Growth Factor)가 보충된 DMEM/F-12 배지를 첨가하여 상기 간 줄기세포를 10 내지 14일 동안 배양하였다.
2-2. 분화된 담관 세포의 형태 확인
상기 분화된 세포가 담관 세포인지 여부를 명확하게 하기 위해 상기 실시예 1-2에 따라 주사현미경으로 관찰한 결과, 도 2c 및 도 2d에서 나타낸 바와 같이 담관 세포의 특징인 분지된 구조를 확인하였다(hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
2-3. qRT-PCR를 이용한 분화된 담관 세포의 확인
상기 분화된 세포가 담관 세포인지 여부를 명확하게 하기 위해 상기 실시예 1-3에 따라 qRT-PCR를 수행하였다.
그 결과, 도 3에서 나타낸 바와 같이 간 줄기세포에 비하여 상기 세포는 담관 세포 특이적 마커인 CK19 및 CK7의 발현이 3배, AE2 및 AQP1의 발현이 12배 및 CFTR의 발현이 20배 이상 증가한 것을 확인하였다(hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
2-4. 담관 세포 마커를 이용한 분화된 담관 세포의 확인
상기 분화된 세포가 담관 세포인지 여부를 명확하게 하기 위해 상기 실시예 1-4에 따라 면역조직화학을 수행하여 다양한 담관 세포 마커의 양을 형광의 세기를 통해 측정하였다.
그 결과, 도 4에서 나타낸 바와 같이 간 줄기세포에 비하여 담관 세포의 마커인 CK19, CK7, CFTR 및 AE2의 발현이 증가한 것을 시각적으로 확인하였다(hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
2-5. Fluorescein diacetate assay에 의한 분화된 담관 세포의 확인
상기 분화된 세포가 담관 세포인지 여부를 명확히 하기 위해 상기 실시예 1-5에 따라 Fluorescein diacetate assay을 수행하였다.
그 결과, 도 5에서 나타낸 바와 같이 FD 흡수 30분이 지난 후 간 줄기세포를 제외한 분화된 담관 세포에서만 형광을 관찰하여 담관 세포의 효소 활성을 확인하였다(hCdH는 간 줄기세포, hCdH-Chol는 분화된 담관 세포를 나타냄).
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따르면, 간 줄기세포의 배양 과정에서 HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 배지 조성물을 첨가함으로써, 유도만능줄기세포 단계와 내배엽 단계를 거치지 않고 신속하게 담관 세포로의 분화를 유도할 수 있음을 확인하였다. 뿐만 아니라 담관 세포의 분화 시에 암세포에서 추출된 마트리겔(matrigel) 대신 젤라틴(gelatin)을 세포 지지체로 사용하므로 이를 직접 담관 병증의 치료에 유용하게 이용할 수 있을 것으로 기대된다.
Claims (10)
- HGF, 나트륨 타우로콜레이트 수화물(sodium taurocholate hydrate) 및 CHIR99021을 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물.
- 제1항에 있어서,상기 배지 조성물에 대해 HGF는 50 내지 160ng/mL의 농도로 포함되는 것을 특징으로 하는, 배지 조성물.
- 제1항에 있어서,상기 배지 조성물에 대해 소디움 타우로콜레이트 수화물은 1 내지 10μM의 농도로 포함되는 것을 특징으로 하는, 배지 조성물.
- 제1항에 있어서,상기 배지 조성물에 대해 CHIR99021은 0.75 내지 7.5μM의 농도로 포함하는 것을 특징으로 하는, 배지 조성물.
- (a) 젤라틴이 코팅된 플레이트(plate)에 간 줄기세포를 위치시키는 단계; 및(b) 제1항의 배지 조성물을 첨가하여 간 줄기세포를 배양하는 단계를 포함하는 것을 특징으로 하는, 간 줄기세포의 담관 세포로의 분화 방법.
- 제5항에 있어서,상기 젤라틴은 0.05 내지 0.15%의 농도로 플레이트(plate)에 코팅된 것을 특징으로 하는, 방법.
- 제5항에 있어서,상기 줄기세포를 7 내지 17일 동안 배양하는 것을 특징으로 하는, 방법.
- 제5항의 방법으로 분화된 담관 세포.
- 제8항의 담관 세포를 포함하는 것을 특징으로 하는, 담관 질환 예방 또는 치료용 조성물.
- 제 9항에 있어서,담관 질환은 알라질 증후군(Alagille syndrome, AGS), 원발성 담즙성 간 경변(primary biliary cirrhosis, PBC), 원발성 경화성 담관염(primary sclerosing cholangitis, PSC), 낭포성 섬유증(cystic fibrosis), 담즙 폐쇄증(biliary atresia) 또는 담관암(cholangiocarcinoma)인 것을 특징으로 하는, 담관 질환 예방 또는 치료용 조성물.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2018-0163740 | 2018-12-18 | ||
KR1020180163740A KR102146932B1 (ko) | 2018-12-18 | 2018-12-18 | 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물 및 이의 용도 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2020130615A1 true WO2020130615A1 (ko) | 2020-06-25 |
Family
ID=71101509
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2019/017980 WO2020130615A1 (ko) | 2018-12-18 | 2019-12-18 | 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물 및 이의 용도 |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102146932B1 (ko) |
WO (1) | WO2020130615A1 (ko) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015140257A1 (en) * | 2014-03-19 | 2015-09-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | A method for inducing human cholangiocyte differentiation |
KR20150119427A (ko) * | 2013-02-18 | 2015-10-23 | 유니버시티 헬스 네트워크 | 다능성 줄기세포로부터 간세포 및 담관세포의 생성 방법 |
-
2018
- 2018-12-18 KR KR1020180163740A patent/KR102146932B1/ko active IP Right Grant
-
2019
- 2019-12-18 WO PCT/KR2019/017980 patent/WO2020130615A1/ko active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20150119427A (ko) * | 2013-02-18 | 2015-10-23 | 유니버시티 헬스 네트워크 | 다능성 줄기세포로부터 간세포 및 담관세포의 생성 방법 |
WO2015140257A1 (en) * | 2014-03-19 | 2015-09-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | A method for inducing human cholangiocyte differentiation |
Non-Patent Citations (3)
Title |
---|
FIOROTTO, R. ET AL.: "Liver diseases in the dish: iPSC and organoids as a new approach to modeling liver diseases", BIOCHIMICA ET BIOPHYSICA ACTA (BBA)-MOLECULAR BASIS OF DISEASE, vol. 1865, 5 September 2018 (2018-09-05), pages 920 - 928, XP055719740 * |
POZNIAK, K. N. ET AL.: "Taurocholate induces biliary differentiation of liver progenitor cells causing hepat ic stellate cell chemotaxis in the ductular reaction: Role in pediatric cystic fibrosis liver disease", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 187, no. 12, 2017, pages 2744 - 2757, XP055719742 * |
SAMPAZIOTIS, F. ET AL.: "Directed differentiation of human induced pluripotent stem cells into functional cholangiocyte-like cells", NATURE PROTOCOLS, vol. 12, no. 4, 2017, pages 814 - 827, XP055534582, DOI: 10.1038/nprot.2017.011 * |
Also Published As
Publication number | Publication date |
---|---|
KR20200075260A (ko) | 2020-06-26 |
KR102146932B1 (ko) | 2020-08-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20110165682A1 (en) | Human Trophoblast Stem Cells and Use Thereof | |
US20210052665A1 (en) | Methods to induce terminal differentiation in stem cells by interfering with dna replication, methods of inducing pancreatic differentiation, and differentiated cells obtained thereof | |
WO2019107939A1 (ko) | 줄기세포 유래 엑소좀 생성 촉진용 조성물 | |
WO2015105357A1 (ko) | 영양막 기저층으로부터 유래된 줄기세포 및 이를 포함하는 세포치료제 | |
US20120003186A1 (en) | Method for dedifferentiating adipose tissue stromal cells | |
WO2013085303A1 (ko) | 개과동물 양막-유래 다분화능 줄기세포 | |
WO2012008733A2 (ko) | 1기 태반조직 유래 줄기세포 및 이를 함유하는 세포치료제 | |
WO2018221904A2 (ko) | 인간 성체 간세포 리프로그래밍 배지 조성물 | |
WO2017146468A1 (ko) | 줄기세포의 효능 개선을 위한 조성물 및 방법 | |
WO2024076173A1 (ko) | 지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물 및 그 조성물을 이용한 분화 방법 | |
WO2021071289A2 (ko) | 줄기세포능을 증대시키기 위한 조성물 및 이의 용도 | |
KR20010071601A (ko) | 뇌실막 신경 간세포 및 이의 분리 방법 | |
WO2020130615A1 (ko) | 간 줄기세포의 담관 세포로의 분화 유도용 배지 조성물 및 이의 용도 | |
WO2011065661A2 (ko) | 중간엽 줄기세포를 dkk-1 또는 sfrp-1을 이용하여 연골세포로 분화시키는 방법 | |
WO2018155913A1 (ko) | 저분자 화합물을 이용한 골격근육세포 분화 방법 | |
WO2021141452A1 (ko) | 인슐린 생산세포로의 분화 유도용 조성물 및 이의 이용 | |
WO2021125844A1 (ko) | 인간 만능 줄기세포로부터 제작된 3d 오가노이드를 해체하여 희소돌기아교세포를 다량 확보하는 분화방법 | |
WO2019190175A9 (ko) | 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법 | |
WO2019221477A1 (ko) | 전구세포 배양액 및 다층 그래핀 필름을 포함하는 줄기세포 분화 촉진용 조성물 및 이의 용도 | |
US8778416B2 (en) | Pharmaceutical compositions and methods for the treatment and prevention of cancer | |
WO2014119893A1 (ko) | 식물 줄기세포 또는 식물 역분화 줄기 세포의 추출물을 이용한 맞춤형 만능줄기세포의 유도 방법 및 상기 방법에 의해 제조된 만능줄기세포 | |
WO2019117454A1 (ko) | 세포 소기관 스트레스 조절 인자를 이용하는 고효율 세포전환용 배지 첨가제 | |
WO2024085651A1 (ko) | 줄기세포에서 대식세포로의 분화 유도용 배지 조성물 및 이를 이용한 분화 방법 | |
WO2014042292A1 (ko) | 단백질 인산화효소 c 활성화제를 포함하는 줄기세포 부착 촉진용 조성물 및 줄기세포의 부착 촉진 방법 | |
WO2017176054A1 (ko) | 줄기세포 배양용 배지조성물 및 그를 이용한 줄기세포 배양방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19897668 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 19897668 Country of ref document: EP Kind code of ref document: A1 |