WO2020104782A1 - Liver-Specific Regulatory Nucleic Acid Sequences - Google Patents
Liver-Specific Regulatory Nucleic Acid SequencesInfo
- Publication number
- WO2020104782A1 WO2020104782A1 PCT/GB2019/053267 GB2019053267W WO2020104782A1 WO 2020104782 A1 WO2020104782 A1 WO 2020104782A1 GB 2019053267 W GB2019053267 W GB 2019053267W WO 2020104782 A1 WO2020104782 A1 WO 2020104782A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cre0058
- cre0065
- crm
- cre0051
- liver
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
Definitions
- the present invention relates to regulatory nucleic acid sequences, in particular liver-specific cis-regulatory elements, cis-regulatory modules, promoters and other such nucleic acid sequences, that are capable of enhancing liver-specific expression of genes.
- the invention also relates to expression constructs, vectors and cells comprising such liver-specific regulatory nucleic acid sequences, and to methods of their use.
- the liver-specific regulatory nucleic acid sequences are of particular utility for gene therapy applications, but also find utility in other areas such as bioprocessing and biotechnology.
- regulatory nucleic acid sequences that are capable of driving expression of a gene to produce a protein or nucleic acid expression product within a desired cell, tissue or organ.
- liver is of particular interest as it is involved in a wide range of essential functions in the body, including the synthesis of many proteins involved in metabolism, haemostasis, and protection against infection. Given that many diseases are linked to disruption of gene expression in the liver, there is a significant interest in developing gene therapy strategies that allow expression of a transgene in the liver to produce a therapeutic expression product.
- diseases of the liver associated with abnormal expression of genes include haemophilia (including haemophilia A or B), familial hypercholesterolemia, ornithine transcarbamylase deficiency, a-antitrypsin deficiency, hepatitis virus infection, non- viral hepatitis, liver cancer, and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD), and alcohol-related liver disease (ARLD).
- haemophilia including haemophilia A or B
- familial hypercholesterolemia ornithine transcarbamylase deficiency
- a-antitrypsin deficiency hepatitis virus infection
- non- viral hepatitis non- viral hepatitis
- liver cancer and various other liver diseases (such as non-alcoholic fatty liver disease (NAFLD), and alcohol-related liver disease (ARLD).
- NAFLD non-alcoholic fatty liver disease
- ARLD alcohol-related liver disease
- liver-specific also known as hepato-specific
- Adenoviral vectors have also been reported to primarily target the liver in mice. However, they also infect other tissues, in particular lung and skeletal muscle, leading to“off-target” effects.
- AAV adeno-associated viral vectors
- lentiviral vectors preferentially transduce hepatocytes, but off-target effects do again arise.
- WO95/011308 and W001/098482 describe a gene therapy vector comprising a hepatocyte-specific apolipoprotein E-Hepatocyte Control Region enhancer linked to a promoter and a transgene.
- Other liver-specific constructs have also been proposed in the literature, e.g. with the AAT promoter and the albumin or hepatitis B enhancers, or the alcohol dehydrogenase 6 (ADH6) basal promoter linked to two tandem copies of the apolipoprotein E enhancer element.
- W02009/130208 describes various liver-specific regulatory elements, which are described as advantageous because of their comparatively short length. Regulatory sequences of short length are desirable to minimise the proportion of a gene therapy vector taken up by regulatory sequences; this is particularly important for gene therapy vectors with limited capacity (payload) such as AAV vectors.
- liver-specific regulatory sequences e.g. cis-regulatory elements and minimal or proximal promoter elements
- liver-specific cis-regulatory modules and promoters comprising such elements, which can be incorporated in expression constructs and vectors for liver-specific expression of a desired gene (e.g. a therapeutic transgene in a gene therapy context).
- a synthetic liver-specific cis- regulatory module comprising two or more operably linked cis-regulatory elements (CREs) selected from the group consisting of: CRE0018 (SEQ ID NO: 1) or a functional variant thereof;
- CRE0042 (SEQ ID NO: 2) or a functional variant thereof;
- CRE0051 (SEQ ID NO: 3) or a functional variant thereof;
- CRE0058 (SEQ ID NO: 4) or a functional variant thereof;
- CRE0065 (SEQ ID NO: 5) or a functional variant thereof;
- CRE0066 (SEQ ID NO: 7) or a functional variant thereof;
- CRE0074 (SEQ ID NO: 11) or a functional variant thereof.
- the synthetic liver-specific CRM comprises three or more, four or more, five or more, or six or more of said CREs. As discussed in more detail below, these CREs have been found to contribute to the activity of CRMs present in synthetic liver-specific promoters.
- the synthetic liver-specific CRM of the present invention comprises a combination of CREs, or functional variants thereof, selected from the group consisting of:
- the recited CREs may be present in any order. In some embodiments, which in some cases are preferred, the CREs are present in the recited order (i.e. in an upstream to downstream order, with reference to their position with respect to an operably linked promoter element or gene). In any of the combinations of CREs, or functional variants thereof, disclosed herein, some or all of the recited CREs may suitably be positioned adjacent to one other in the CRM (i.e. without any intervening CREs or other regulatory elements). The CREs may be contiguous or non-contiguous (i.e.
- the CREs, or functional variants thereof, are provided in the recited order and are adjacent to one another.
- the synthetic liver-specific regulatory nucleic acid may comprise CRE0051 immediately upstream of CRE0058, and so forth.
- the CREs may be contiguous or non-contiguous. In some embodiments it is preferred that some or all of the CREs are contiguous.
- CRMs comprising the abovementioned combinations CREs have been found to provide significant liver-specific enhancer activity when combined with a suitable promoter element. Particularly high levels of activity have been observed when the CREs are present in the recited order and adjacent to one another. Thus, these represent some preferred CRE “motifs”, which typically correlate to high levels of liver-specific promoter activity.
- a synthetic liver-specific CRM of the present invention comprises two, three, four or more CREs selected from the group consisting of:
- a synthetic liver-specific CRM of the present invention further comprises one or more CREs selected from the group consisting of:
- CRE0078 (SEQ ID NO: 20) or a functional variant thereof
- CRE0083.1 (SEQ ID NO: 21) or a functional variant thereof
- the synthetic liver-specific CRM comprises a combination of CREs, or functional variants thereof, selected from the group consisting of:
- said CREs are present in the synthetic liver-specific CRM in the recited order.
- some or all of the recited CREs, or functional variants thereof, may suitably be adjacent to one other.
- the CREs may be contiguous or non-contiguous. CRMs comprising these combinations of CREs have been found to provide high levels of liver-specific enhancer activity when combined with a suitable promoter element.
- the synthetic liver-specific CRM comprises a combination of CREs, or functional variants thereof, selected from the group consisting of:
- the CREs are preferably present in the recited order, and are preferably positioned adjacent to one another. They may also be contiguous. CRMs comprising these combinations of CREs have been found to provide high levels of liver-specific enhancer activity when combined with a suitable promoter element and are of particular interest.
- the synthetic liver-specific CRM comprises a CRM selected from the group consisting of: CRM_SP0109, CRM_SP0112, CRM_SP0113, CRM_SP0121 , CRM_SP0124, CRM_SP0127, CRM_SP0127A1 , CRM_SP0127V1 , CRM_SP0127V2, CRM_SP0128, CRM_SP0131 , CRM_SP0132, CRM_SP0133,
- CRM_SP0272 CRM_SP0273, CRM_SP0368, CRM_SP0373, CRM_SP0378,
- CRM_SP0406 CRM_SP0407, CRM_SP0409, CRM_SP0411 , CRM_SP0412,
- CRM_SP0413 CRM_SP0107, CRM_SP0111 , CRM_SP0115, CRM_SP0116,
- CRM_SP0259, CRM_SP0264, CRM_SP0388 and CRM_SP0399 or a functional variant of any thereof.
- the functional variant of any of said CRMs comprises a sequence that is at least 70% identical to the reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific CRM.
- the sequences and SEQ ID NOs corresponding to these CRMs are set out in Example 1.
- the synthetic liver-specific CRM comprises a CRM selected from the group consisting of: CRM_SP0399, CRM_SP0405, CRM_SP0379, CRM_SP0381 , CRM_SP0384, CRM_SP0412, CRM_SP0112, CRM_SP0239,
- CRM_SP0241 CRM_SP0255, CRM_SP0249, CRM_SP0247, CRM_SP0265,
- CRM_SP0406 CRM_SP0373, CRM_SP0155, CRM_SP0380, CRM_SP0244,
- CRM_SP0111 CRM_SP0258, CRM_SP0268, CRM_SP0250, CRM_SP0242,
- CRM_SP0109, and CRM_SP0259 or a functional variant of any thereof comprises a sequence that is at least 70% identical to the reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific CRM.
- This group comprises synthetic liver- specific CRMs exhibiting very high levels of activity.
- the synthetic liver-specific CRM comprises a CRM selected from the group consisting of: CRM_SP0239, CRM_SP0244, CRM_SP0259 CRM_SP0265 and CRM_SP0412, or a functional variant of any thereof.
- This group comprises a preferred subset of CRMs from synthetic liver-specific promoters exhibiting very high levels of activity.
- the functional variant of any of said CRMs comprises a sequence that is at least 70% identical to the reference synthetic liver-specific CRM, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific CRM.
- a synthetic liver-specific promoter comprising:
- a CRM operably linked to a promoter element (preferably a minimal promoter or liver-specific proximal promoter); or
- a promoter element selected from CRE0059, or a functional variant thereof, or CRE0006, or a functional variant thereof.
- promoter elements for use in the synthetic liver-specific promoter of group a) are discussed herein.
- the promoter element can be selected from CRE0006, CRE0059, CRE0052, CRE0079, CRE0073, and CRE0073.1 , or a functional variant of any thereof.
- the synthetic liver-specific promoter of b) comprises at least two of the recited cis-regulatory elements, or functional variants thereof, operably linked to a promoter element selected from CRE0059 or a functional variant thereof or CRE0006 or a functional variant.
- the synthetic liver-specific promoter of b) can comprise a CRM according to the first aspect operably linked to a promoter element selected from CRE0059 or CRE0006 (or functional variants thereof).
- a synthetic liver-specific promoter of the present invention comprises one the combinations of CREs, or functional variants thereof, as set out in Table 1 operably linked to a promoter element:
- the CREs are preferably present in the recited order, and are preferably positioned adjacent to one another. They may also be contiguous. Table 1 sets out combinations of two or more CREs selected from CRE0018, CRE0042, CRE0051 , CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074 that have been found to provide high levels of liver-specific activity when combined with a suitable promoter element (e.g. a minimal promoter or liver-specific proximal promoter). These combinations of CREs, or functional variants thereof, also represent some preferred embodiments of CRMs according to the first aspect of the invention.
- a suitable promoter element e.g. a minimal promoter or liver-specific proximal promoter.
- Combinations of at least two CREs comprising at least one CRE selected from CRE0018, CRE0042, CRE0051 , CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074 that have been found to provide high levels of liver-specific activity when combined with promoter element CRE0059 or CRE0006 are set out in the final 7 rows. These represent additional preferred of CRMs according to the invention.
- the synthetic liver-specific promoter comprises one the individual CREs, or functional variants thereof, or combinations of CREs, or functional variants thereof, as set out in Table 2 operably linked to a promoter element selected from CRE0006, or a functional variant thereof, or CRE0059, or a functional variant thereof:
- the CREs are preferably present in the recited order, and are preferably adjacent to one another. They may also be contiguous.
- the promoter element lies downstream of the CREs, and it is typically adjacent to the proximal CRE.
- the promoter element can be contiguous with the adjacent CRE, or it can be separated by a spacer.
- Table 2 sets out various individual CREs, or combinations of CREs, selected from CRE0018, CRE0051 , CRE0058, CRE0065, CRE0066, CRE0042, CRE0068, and CRE0074 (or functional variants thereof) that can suitably be provided operably linked to with promoter elements CRE0006 or CRE0059 (or functional variants thereof) in accordance with some embodiments of the present invention.
- the CREs are preferably present in the recited order, and are preferably adjacent to one another. They may also be contiguous.
- the promoter element lies downstream of the CREs, and it is typically adjacent to the proximal CRE.
- the promoter element can be contiguous with the adjacent CRE, or it can be separated by a spacer.
- a synthetic liver-specific promoter comprising one of the following CREs or functional variants thereof, or combinations of CREs or functional variants thereof, operably linked to a promoter element or functional variant thereof as set out in Table 4:
- the CREs are preferably present in the recited order, and are preferably adjacent to one another. They may also be contiguous.
- the promoter element lies downstream of the CREs, and it is typically adjacent to the proximal CRE.
- the promoter element can be contiguous with the adjacent CRE, or it can be separated by a spacer.
- Table 4 provides further exemplary combinations of CREs and promoter elements that have been found to provide high levels of liver-specific activity. Thus, they represent additional synthetic liver-specific promoters of interest.
- the synthetic liver-specific promoter comprises a promoter selected from the group consisting of: SP0109, SP0112, SP0113, SP0121 , SP0124, SP0127, SP0127A1 , SP0127V1 , SP0127V2, SP0128, SP0131 , SP0132,
- the functional variant of any of said promoters comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific promoter.
- the sequences and SEQ ID NOs corresponding to these promoters are set out in Example 1.
- the synthetic liver-specific promoter comprises a promoter selected from the group consisting of: SP0109, SP0112, SP0113, SP0121 , SP0124, SP0127, SP0127A1 , SP0127V1 , SP0127V2, SP0128, SP0131 , SP0132, SP0133, SP0239, SP0240, SP0241 , SP0242, SP0243, SP0244, SP0246, SP0247, SP0248,
- the functional variant of any of said promoters comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific promoter.
- the sequences and SEQ ID NOs corresponding to these promoters are set out in Example 1.
- the synthetic liver-specific promoter comprises a promoter selected from the group consisting of: SP0399, SP0405, SP0379, SP0381 , SP0384, SP0412, SP0112, SP0239, SP0243, SP0413, SP0163, SP0382, SP0383, SP0241 ,
- the functional variant of any of said promoters comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific promoter.
- This group comprises synthetic liver-specific promoters having relatively high levels of activity.
- the synthetic liver-specific promoter comprises a promoter selected from the group consisting of: SP0399, SP0405, SP0379, SP0381 , SP0384, SP0412, SP0112, SP0239, SP0243, SP0413, SP0163, SP0382, SP0383, SP0241 , SP0255, SP0249, SP0247, SP0265, SP0406, SP0373, SP0155, SP0380, SP0244, SP0111 , SP0258, SP0268, SP0250, SP0242, SP0109 and SP0259 or a functional variant of any thereof.
- the functional variant of any of said promoters comprises a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific promoter.
- This group comprises synthetic liver-specific promoters having high levels of activity.
- the synthetic liver-specific promoter comprises a promoter selected from the group consisting of: SP0239, SP0244, SP0259, SP0265 and SP0412, or a functional variant of any thereof.
- This group comprises a particularly preferred subset of synthetic liver-specific promoters having high levels of activity.
- SP0412 and SP0265 are of particular interest given their short length (283 and 381 nucleotides, respectively). In vivo activity for SP0239 and SP0244 has also been confirmed to be high compared to the LP1 promoter.
- the synthetic liver-specific promoter comprises a combination of CREs (or functional variants of any thereof) and a promoter elements (or functional variants of any thereof) selected from the following:
- CRE0047, CRE0001 , CRE0006 i.e. the CREs and promoter element from SP0265;
- CRE0051 , CRE0042, CRE0059 i.e. the CREs and promoter element from SP0412.
- the synthetic liver-specific promoters SP0109, SP0121 , SP0113, and SP0380 have been found to have somewhat higher expression in non-liver (HEK293) cells than other synthetic liver-specific promoters disclosed herein. Accordingly, in some embodiments, where low levels of expression in non-liver cells are particularly import, there promoters or functional variants thereof may be less desirable. In such cases, the synthetic liver-specific promoters which show very low expression in non-liver (HEK293) cells may be particularly preferred. In some embodiments of the present invention the synthetic liver-specific promoter has length of 700 or fewer nucleotides, for example, 600, 500, 450, 400, 350, 300, 250, 200,
- the present invention provides a synthetic liver-specific promoter comprising CRE0006, or a functional variant thereof.
- CRE0006 can be provided without any operably linked CREs (i.e. the synthetic liver-specific promoter consists essentially of CRE0006), or it can be provided with operatively linked CREs. It has surprisingly been found that CRE0006 is an active liver-specific promoter in its own right (i.e. absent any operably linked regulatory sequences; see results for SP0154 in Example 3) as well as providing high levels of activity when combined with one or more liver-specific CREs (e.g. as discussed above). The present invention thus also provides a synthetic liver-specific promoter consisting of CRE0006, or a functional variant thereof.
- the invention also provides a promoter element comprising CRE0006 or a functional variant thereof, optionally wherein the promoter element has a length of 400 or fewer nucleotides, preferably 350 or fewer nucleotides, more preferably 300 or fewer nucleotides, more preferably 280 or fewer nucleotides.
- the invention also provides a promoter element consisting of CRE0006 or a functional variant thereof.
- the present invention provides a synthetic liver-specific promoter comprising CRE0059, or a functional variant thereof.
- CRE0059 has surprisingly been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g. as discussed above).
- the invention also provides a promoter element comprising CRE0059 or a functional variant thereof, wherein the promoter element has a length of 350 or fewer nucleotides, more preferably 300 or fewer nucleotides, more preferably 250 or fewer nucleotides, more preferably 230 or fewer nucleotides.
- the invention also provides a promoter element consisting of CRE0059 or a functional variant thereof.
- the present invention provides a synthetic liver-specific promoter comprising CRE0079, or a functional variant thereof.
- CRE0079 has surprisingly been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g. as discussed above).
- the invention also provides a promoter element comprising CRE0079 or a functional variant thereof, wherein the promoter element has a length of 200 or fewer nucleotides, preferably 150 or fewer nucleotides, more preferably 100 or fewer nucleotides.
- the invention also provides a promoter element consisting of CRE0079 or a functional variant thereof.
- the present invention provides a synthetic liver-specific promoter comprising CRE0073, or a functional variant thereof.
- CRE0073 has surprisingly been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g. as discussed above).
- the invention also provides a promoter element comprising CRE0073 or a functional variant thereof, wherein the promoter element has a length of 300 or fewer nucleotides, more preferably 250 or fewer nucleotides, more preferably 200 or fewer nucleotides, more preferably 190 or fewer nucleotides.
- the invention also provides a promoter element consisting of CRE0073 or a functional variant thereof.
- the present invention provides a synthetic liver-specific promoter comprising CRE0073.1 , or a functional variant thereof.
- CRE0073.1 has surprisingly been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g. as discussed above).
- the invention also provides a promoter element comprising CRE0073.1 or a functional variant thereof, wherein the promoter element has a length of 180 or fewer nucleotides, more preferably 170 or fewer nucleotides.
- the invention also provides a promoter element consisting of CRE0073.1 or a functional variant thereof.
- the present invention provides a synthetic liver-specific promoter comprising CRE0040, or a functional variant thereof.
- CRE0040 has surprisingly been found to provide high levels of activity when combined with one or more liver-specific CREs (e.g. as discussed above).
- the invention also provides a promoter element comprising CRE0040 or a functional variant thereof, wherein the promoter element has a length of 400 or fewer nucleotides, more preferably 325 or fewer nucleotides, more preferably 275 or fewer nucleotides, more preferably 250 or fewer nucleotides.
- the invention also provides a promoter element consisting of CRE0040 or a functional variant thereof.
- the synthetic liver-specific CRM and/or synthetic liver-specific promoter of the present invention does not comprise CR0077, or a functional variant thereof, or CR0078, or a functional variant thereof.
- the synthetic liver-specific CRM and/or synthetic liver-specific promoter of the present invention does not comprise CRE0052 or a functional variant thereof.
- a CRE selected from the group consisting of: CRE0018, CRE0042, CRE0058, CRE0065, CRE0066, CRE0068, CRE0074, CRE0001 , CRE0005, CRE0012, CRE0047, CRE0048, CRE0056, CRE0062, CRE0077, CRE0078, CRE0083.1 , and CRE0089, or a functional variant of any thereof.
- a CRE selected from the group consisting of: CRE0018, CRE0042, CRE0058, CRE0065, CRE0066, CRE0068, and CRE0074, or a functional variant of any thereof.
- a synthetic liver- specific CRM or synthetic liver-specific promoter comprising any one or more of said CREs, or functional variants of thereof.
- an expression cassette comprising a synthetic liver-specific promoter of the present invention operably linked to a sequence encoding an expression product, suitably a gene, e.g. a transgene.
- a vector comprising a synthetic liver-specific CRM, a synthetic liver-specific promoter, or an expression cassette according to the present invention.
- the vector is an expression vector.
- the vector is a viral vector.
- the vector is a gene therapy vector, suitably an AAV vector, an adenoviral vector, a retroviral vector or a lentiviral vector. AAV vectors are particular interest.
- virion comprising a vector, suitably a viral vector, according to the present invention.
- composition comprising a synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector or virion according to the present invention.
- a synthetic liver-specific regulatory CRM, synthetic liver-specific promoter, expression cassette, vector, virion or pharmaceutical composition according to the present invention for use in therapy, i.e. the prevention or treatment of a medical condition or disease.
- a condition or disease associated with aberrant gene expression optionally aberrant gene expression in the liver.
- the use is for gene therapy, preferably for use in treatment of a disease involving aberrant gene expression.
- the gene therapy involves expression of a therapeutic expression product in the liver.
- a cell comprising a synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, or virion as described herein.
- the cell is a eukaryotic cell, optionally a mammalian cell, optionally a human cell.
- the cell can be a liver cell, optionally wherein the cell is a human liver cell.
- the synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette can be in a vector or can be in the genome of the cell.
- a synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, virion or pharmaceutical composition as described herein for use in the manufacture of a pharmaceutical composition for the treatment of a medical condition or disease as discussed herein.
- a method for producing an expression product comprising providing a synthetic liver-specific expression cassette of the present invention in a liver cell and expressing the gene present in the synthetic liver-specific expression cassette.
- the method can be in vitro or ex vivo, or it can be in vivo. In some embodiments the method is bioprocessing method.
- a method of expressing a therapeutic transgene in a liver cell comprising introducing into the liver cell a synthetic liver-specific expression cassette, vector or virion as described herein.
- a subject preferably a human, in need thereof, the method comprising:
- the method comprises administering a vector, virion or pharmaceutical composition as described herein to the subject.
- the vector is a viral gene therapy vector, preferably an AAV vector.
- Fig. 1 shows a schematic illustration of synthetic liver-specific promoters according to the present invention, with the CRE enhancer elements indicated.
- Fig. 2 shows a graph of expression levels of a luciferase reporter protein driven by various synthetic liver-specific promoters in the liver-derived cell line Huh7 relative to expression levels driven by the known liver-specific promoter LP1 and the ubiquitous CMV-IE and CBA promoters.
- the CBA (chicken beta actin) promoter as used herein comprises the CMV immediate early enhancer + chicken beta actin proximal promoter + intron.
- Fig. 3 shows a schematic illustration of further synthetic promoters according to the present invention, with the CRE enhancer elements indicated. These promoters correspond to the promoters of Fig. 1 , but with the addition of the“V1”
- LVR_CRE0077_V1 LVR_CRE0077_V1
- “V2” or LVR_CRE0078_V2
- “A1” or LVR_CRE0051_AMBP
- Fig. 4a shows a graph of expression levels of luciferase reporter protein driven by variants of the LVR_127 synthetic liver-specific promoter in Huh7 cells, i.e. LVR_127 alone, and with the A1 , V1 and V2 CRE enhancer elements added immediately upstream of the LVR_127 promoter. Again, a comparison with the LP1 , CMV-IE and CBA promoters is shown.
- Fig 4b shows a graph of expression levels of luciferase reporter protein driven by variants of the LVR_131 synthetic liver-specific promoter in Huh7 cells, i.e. LVR_131 alone, and with the A1 , V1 and V2 CRE enhancer elements added immediately upstream of the LVR_131 promoter. Again, a comparison with the LP1 , CMV-IE and CBA promoters is shown.
- Fig 4c shows a graph of expression levels of luciferase reporter protein driven by variants of the LVR_132 synthetic liver-specific promoter in Huh7 cells, i.e. LVR_132 alone, and with the A1 , V1 and V2 CRE enhancer elements added immediately upstream of the LVR_132 promoter. Again, a comparison with the LP1 , CMV-IE and CBA promoters is shown.
- Fig. 4d shows a graph of expression levels of luciferase reporter protein driven by variants of the LVR_133 synthetic liver-specific promoter in Huh7 cells, i.e. LVR_133 alone, and with the A1 , V1 and V2 CRE enhancer elements added immediately upstream of the LVR_133 promoter. Again, a comparison with the LP1 , CMV-IE and CBA promoters is shown.
- Fig. 5 shows a graph of expression levels of luciferase reporter protein in HEK-293 cells (i.e. non-liver-derived cells) driven by the LVFM27, LVF 31 , LVFM32 and LVFM33 synthetic liver-specific promoters, and the variants thereof as set out in respect of Figs 4a-4d. Again, a comparison with the LP1 , CMV-IE and CBA promoters is shown.
- Fig. 6 shows a graph of expression levels of luciferase reporter protein in HeLa cells (i.e. non-liver-derived cells) driven by the LVFM27, LVR_131 , LVFM32 and LVFM33 synthetic liver-specific promoters, and the variants thereof as set out in respect of Figs 4a-4d. Again, a comparison with the LP1 , CMV-IE and CBA promoters is shown.
- Fig. 7A, Fig. 7B and Fig. 7C show a schematic illustration of synthetic liver-specific promoters according to embodiments of the present invention, with the CRE enhancer elements indicated.
- Fig. 8A, Fig. 9A, Fig. 10A and Fig. 11A show the average activity of the promoters according to embodiments of this invention in Huh7 cell normalised to the activity of TBG.
- a relative activity of 100 is equal to the activity of TBG.
- the error bar is a standard error of the mean. If no error bar is present, the results come from a single experiment.
- Fig. 8A Fig. 9A and Fig. 10A
- the promoters have been arranged in terms of relative activity with the promoters with the highest relative activity first.
- Promoters in Fig. 10A are members of‘Group 2’ as defined in Example 3. Some of the promoters in Fig. 10A are also members of‘Group T as defined in Example 3. Promoters in Fig. 8A and Fig.
- Fig. 8B, Fig. 9B, Fig. 10B and Fig. 11C show the average expression in HEK293 of the promoters presented in Fig. 8A, Fig. 9A, Fig. 10A and Fig. 11 A, respectively.
- the mean relative activity of different experiments is shown for each promoter. If no error bar is present, the results come from a single experiment. Specificity has been tested and confirmed for the majority, but not all, of the promoters presented in Fig. 8A, Fig. 9A, Fig.
- Fig. 11 B shows the average activity of two promoters containing only promoter elements CRE0006 (SP0154) and CRE0040 (SP0235).
- Fig. 12A shows the average relative activity of a large pool of liver-specific promoters (group‘ALL’), promoters which comprise at least two“Core” CREs (‘Group T) and promoters which comprise at least one“Core” CRE operably linked to a promoter element selected from CRE0059 or CRE0006 (‘Group 2’).
- group‘ALL’ liver-specific promoters
- Group T promoters which comprise at least two“Core” CREs
- Error bars are standard error of the mean.
- Fig. 12B presents the mean value of the relative activity of each promoter divided by its size (in base pairs) per each of groups‘ALL’,‘Group T and‘Group 2’.
- the increased performance of‘Group T and‘Group 2’ compared to group‘ALL’ persists even when size of the promoters is taken into account. This indicates that the superior performance of‘Group T and‘Group 2’ compared to group‘ALL’ is not due to differences in promoter size between the groups.
- Fig. 13A shows the mean activity of promoters which have a specific number of core CREs compared to the mean activity of promoters which have the specific number of CREs (any CREs).
- the presence of 1 , 2, 3 or 4 of the core CRE elements is associated with increased activity compared to promoters which have 1 , 2, 3 or 4 of any CRE elements.
- the core CREs are the group consisting of CRE0018 (SEQ ID NO: 1), CRE0042 (SEQ ID NO: 2), CRE0051 (SEQ ID NO: 3), CRE0058 (SEQ ID NO: 4), CRE0065 (SEQ ID NO: 5), CRE0066 (SEQ ID NO: 7), CRE0068 (SEQ ID NO: 10) and CRE0074 (SEQ ID NO: 11).
- Fig. 13B shows the mean activity over size (in base pairs) of promoters which have a specific number of core CREs compared to the mean activity over size of promoters which have the specific number of CREs (any CREs).
- the presence of 1 , 2, 3 or 4 of the core CRE elements is associated with increased activity over size (bp) compared to promoters which have 1 , 2 3 or 4 of any CRE elements. This indicates that the higher activity of promoters comprising the specified number of core CREs compared to promoters comprising the specified number of any CRE is not due to differences in promoter size.
- Fig. 15A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 and CRE0058 compared to promoters from group ‘ALL’ which have any two liver-specific cis-regulatory elements.
- Fig. 15B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 and CRE0058 compared to promoters from group‘ALL’ which have any two liver-specific cis-regulatory elements. This indicates that the superior performance of promoters comprising CREs CRE0051 and CRE0058 compared to promoters comprising any two liver-specific CREs is not due to differences in promoter size.
- Fig. 16A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058 and CRE0065 compared to promoters from group‘ALL’ which have any three liver-specific cis-regulatory elements.
- Fig. 16B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058 and CRE0065 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements. This indicates that the superior performance of promoters comprising CREs CRE0051 , CRE0058 and CRE0065 compared to promoters comprising any three liver-specific CREs is not due to differences in promoter size.
- Fig. 17A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis-regulatory elements.
- Fig. 17B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements. This indicates that the superior performance of promoters comprising CREs CRE0051 , CRE0058 and CRE0066 compared to promoters comprising any three liver-specific CREs is not due to differences in promoter size.
- Fig. 18A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058, CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any four liver-specific cis-regulatory elements.
- Fig. 18B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058, CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any four liver- specific cis-regulatory elements. This indicates that the superior performance of promoters comprising CREs CRE0051 , CRE0058, CRE0065 and CRE0066 compared to promoters comprising any four liver-specific CREs is not due to differences in promoter size.
- Fig. 19A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis-regulatory elements.
- Fig. 19B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements.
- promoters comprising cis-regulatory elements CRE0051 , CRE0065 and CRE0066 compared to promoters comprising any three liver-specific cis-regulatory elements is not due to differences in promoter size.
- Fig. 20A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058 and CRE0074 compared to promoters from group‘ALL’ which have any three liver-specific cis-regulatory elements.
- Fig. 20B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058 and CRE0074 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements. This indicates that the superior performance of promoters comprising cis-regulatory elements CRE0051 , CRE0058 and CRE0074 compared to promoters comprising any three liver-specific cis-regulatory elements is not due to differences in promoter size.
- Fig. 21A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058, CRE0065 and CRE0074 compared to promoters from group‘ALL’ which have any four liver-specific cis-regulatory elements.
- Fig. 21 B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0051 , CRE0058, CRE0065 and CRE0074 compared to promoters from group‘ALL’ which have any four liver- specific cis-regulatory elements.
- promoters comprising cis-regulatory elements CRE0051 , CRE0058, CRE0065 and CRE0074 compared to promoters comprising any four liver-specific cis-regulatory elements is not due to differences in promoter size.
- Fig. 22A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0058, CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis-regulatory elements.
- Fig. 22B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0058, CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements. This indicates that the superior performance of promoters comprising cis-regulatory elements CRE0058, CRE0065 and CRE0066 compared to promoters comprising any three liver-specific cis-regulatory elements is not due to differences in promoter size.
- Fig. 22B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0058, CRE0065 and CRE0066 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements.
- 23A shows the mean relative activity of promoters which comprise the combination of cis-regulatory elements CRE0058, CRE0065 and CRE0074 compared to promoters from group‘ALL’ which have any three liver-specific cis-regulatory elements.
- Fig. 23B shows the mean relative activity over size (in base pairs) of promoters which comprise the combination of cis-regulatory elements CRE0058, CRE0065 and CRE0074 compared to promoters from group‘ALL’ which have any three liver-specific cis- regulatory elements. This indicates that the superior performance of promoters comprising cis-regulatory elements CRE0058, CRE0065 and CRE0074 compared to promoters comprising any three liver-specific cis-regulatory elements is not due to differences in promoter size.
- Fig. 24A shows the PWM of HNF1A and Fig. 24B shows the PWM of HNF1 B.
- CREs that can be used in the construction of liver-specific promoters. These CREs are generally derived from genomic promoter and enhancer sequences, but they are used herein in contexts quite different from their native genomic environment. Generally, the CREs constitute small parts of much larger genomic regulatory domains, which control expression of the genes with which they are normally associated. It has been surprisingly found that these CREs, many of which are very small, can be isolated form their normal environment and retain liver-specific regulatory activity when used to construct various synthetic promoters.
- CRE0018, CRE0051 , CRE0042, CRE0058, CRE0065, CRE0066, CRE0068 and CRE0074 are of particular interest in the present invention as their presence in various combinations has been shown to consistently correlate with highly active liver-specific promoters. Thus, combinations which comprise two of these elements are of particular relevance. Furthermore, combinations of one of these CREs with promoter elements CRE0006 and CRE0059 have been shown to consistently correlate with highly active liver-specific promoters. Without wishing to be bound by theory, it appears that these CREs are particularly effective in enhancing liver specific promoter activity, and in many cases they may act synergistically when combined in a CRM/promoter.
- CRE0062, CRE0077, CRE0078, CRE0083.1 and CRE0089 have been found to also correlate with high liver-specific activity, but to a lesser degree. As such, the presence of one or more of these CREs are preferred in some cases. Without wishing to be bound by theory, it appears that these CREs are somewhat effective in enhancing liver-specific promoter activity, and they may act synergistically when combined with one or more of the above-mentioned CREs in a CRM/promoter.
- the CREs of the present invention comprise certain liver- specific TFBS. It is generally desired that in functional variants of the CREs these liver- specific TFBS remain functional.
- TFBS sequences can vary yet retain functionality.
- the sequence for a TFBS is typically illustrated by a consensus sequence from which some degree of variation is typically present. Further information about the variation that occurs in a TFBS can be illustrated using a positional weight matrix (PWM), which represents the frequency with which a given nucleotide is typically found at a given location in the consensus sequence.
- PWM positional weight matrix
- TF consensus sequences and associated positional weight matrices can be found in, for example, the Jaspar or Transfac databases http://jaspar.genereg.net/ and http://gene- regulation.com/pub/databases.html).
- This information allows the skilled person to modify the sequence in any given TFBS of a CRE in a manner which retains, and in some cases even increases, CRE functionality.
- TFBS for HNF1 found in CRE0079 as set below.
- the TFBS for HNF1 in CRE0079 has the sequence GTT AATTT AT AAC (SEQ ID NO: 98).
- the PMW for HNF1 is shown in Fig.
- HNF1 has two sub-family members, HNF1A and HNF1 B, with very similar TFBS PWMs; the PWMs for both HNF1A and HNF1 B isoforms are shown in Fig. 24A and 24B, respectively).
- the skilled person has ample guidance on how the TFBS for HNF1 can be modified, while maintaining ability to bind the desired TF; the Jaspar system will, for example, score a putative TFBS based on its similarity to a given PWM.
- CREs can be scanned against all PWM from JASPAR database to identify/analyse all TFBS.
- CRE0018 has a sequence as set out in SEQ ID NO: 1.
- CRE0018 Functional variants of CRE0018 are regulatory elements with sequences which vary from CRE0018, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non functional.
- a functional variant of CRE0018 can be viewed as a CRE which, when substituted in place of CRE0018 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0018 substituted in place of CRE0018 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0018).
- CRE0018 in SP0239 in can be replaced with a functional variant of CRE0018, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0018 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0018.
- the liver-specific TFBS present in CRE0018 listed in the order in which they are present, are: IRF, NF1 , HNF3, HBLF, RXRa, EF-C, NF1 , and c/EBP.
- the functional variant of CRE0018 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0018, i.e. in the order IRF, NF1 , HNF3, HBLF, RXRa, EF-C,
- NF1 NF1
- c/EBP c/EBP
- this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0018 comprises the following TFBS sequences: CTTTCACTTTC (IRF), TCGCCAA (NF1), TGTGTAAACA (HNF3),
- TGT AAACAAT A (HBLF), CT G AACCTTT ACCC (RXRa), GTTGCCCGGCAAC (EF-C), CAGGTCTGTGCCAAG (NF1), TGCCAAGTGTTTG (c/EBP), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 9 for TFBS SEQ ID NOs). These may be present in the same order as CRE0018, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0018 comprises the sequence:
- Na, Nb, Nc, and Nd represent optional spacer sequences.
- Na optionally has a length of from 10 to 20 nucleotides, preferably from 13 to 17 nucleotides, and more preferably 15 nucleotides.
- Nb optionally has a length of from 1 to 10 nucleotides, preferably from 1 to 5 nucleotides, more preferably 1 nucleotide.
- Nc optionally has a length of from 1 to 10 nucleotides, preferably 1 to 5 nucleotides, and more preferably 1 nucleotide.
- Nd suitably has a length of from 1 to 10 nucleotides, preferably from 2 to 8 nucleotides in length, and more preferably 3 nucleotides in length.
- a functional variant of CRE0018 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 1 , more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 1. Additionally or alternatively, a functional variant of CRE0018 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 1.
- the cis-regulatory enhancer element consists of SEQ ID NO: 1 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 1 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 1 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0018 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 103 or fewer nucleotides.
- CRE0042 has a sequence as set out in SEQ ID NO: 2.
- CRE0042 Functional variants of CRE0042 are regulatory elements with sequences which vary from CRE0042, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE substantially non functional.
- a functional variant of CRE0042 can be viewed as a ORE which, when substituted in place of CRE0042 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0042 substituted in place of CRE0042 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0042).
- CRE0042 in SP0380 can be replaced with a functional variant of CRE0042, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0042 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0042.
- the liver-specific TFBS present in CRE0042 listed in the order in which they are present, are: HNF-3, C/EBP, HNF-4 and C/EBP.
- the functional variant of CRE0042 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0042, i.e. in the order HNF-3, C/EBP, HNF-4 and then C/EBP.
- this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0042 comprises the following TFBS sequences: GTT CAAACAT G (HNF-3), CTAATACTCTG (C/EBP), TGCAAGGGTCAT (HNF- 4), and TTACTCAACA (C/EBP) and sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 10 for SEQ ID NOs). These may be present in the same order as CRE0042, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0042 comprises the sequence:
- Na, Nb and Nc represent optional spacer sequences.
- Na optionally has a length of from 1 to 10 nucleotides, preferably from 1 to 5 nucleotides, and more preferably 2 nucleotides.
- Nb optionally has a length of from 1 to 10 nucleotides, preferably from 2 to 6 nucleotides, and more preferably 4 nucleotides.
- Nc optionally has a length of from 8 to 23 nucleotides, preferably from 10 to 20 nucleotides, and more preferably 15 nucleotides.
- a functional variant of CRE0042 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 2, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 2. Additionally or alternatively, a functional variant of CRE0042 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 2.
- the cis-regulatory enhancer element consists of CRE0042 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 2 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 2 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0042 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, or 80 or fewer nucleotides.
- CRE0051 (also known as A1 or alpha mic/bik) has a sequence as set out in SEQ ID NO: 3.
- CRE0051 Functional variants of CRE0051 are regulatory elements with sequences which vary from CRE0051 , but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE substantially non functional.
- a functional variant of CRE0051 can be viewed as a CRE which, when substituted in place of CRE0051 in a CRM or promoter, substantially retains its activity.
- a liver-promoter which comprises a functional variant of CRE0051 substituted in place of CRE0051 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity.
- CRE0051 in SP0239 can be replaced with a functional variant of CRE0051 , and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0051 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0051.
- the liver-specific TFBS present in CRE0051 listed in the order in which they are present, are: HNF1 , HNF4, HNF3, HNF1 and HNF3.
- the functional variant of CRE0051 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0051 , i.e. in the order HNF1 , HNF4, HNF3, HNF1 then HNF3.
- this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0051 comprises the following TFBS sequences: GTT AATTTTT AAA (HNF1), GTGGCCCTTGG (HNF4), TGTTTGC (HNF3),
- TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 11 for TFBS SEQ ID NOs).
- CRE0051 may be present in the same order as CRE0051 , i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0051 comprises the sequence:
- GTTAATTTTTAAA-Na-GTGGCCCTTGG-Nb-TGTTTGC-Nc-TGGTTAATAATCTCA-Nd-ACAAACA (SEQ ID NO: 270), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto,
- Na, Nb, Nc, and Nd represent optional spacer sequences.
- Na optionally has a length of from 10 to 26 nucleotides, preferably from 14 to 22 nucleotides, and more preferably 18 nucleotides.
- Nb optionally has a length of from 8 to 22 nucleotides, preferably from 12 to 20 nucleotides, more preferably 16 nucleotides.
- Nc optionally has a length of from 1 to 10 nucleotides, preferably 1 to 5 nucleotides, and more preferably 2 nucleotides.
- Nd suitably has a length of from 1 to 13 nucleotides, preferably from 2 to 9 nucleotides in length, and more preferably 5 nucleotides in length.
- a functional variant of CRE0051 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 3, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 3. Additionally or alternatively, a functional variant of SEQ ID NO: 3 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 3.
- the cis-regulatory enhancer element consists of SEQ ID No: 3 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 3 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 3 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0051 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
- CRE0058 has a sequence as set out in SEQ ID NO: 4.
- Functional variants of CRE0058 are regulatory elements with sequences which vary from CRE0058, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0058 can be viewed as a CRE which, when substituted in place of CRE0058 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0058 substituted in place of CRE0058 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0058).
- CRE0058 in SP0373 can be replaced with a functional variant of CRE0058, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0058 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0058.
- the liver-specific TFBS present in CRE0058 listed in the order in which they are present, are: HNF4 and c/EBP.
- the functional variant of CRE0058 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0058, i.e. in the order HNF4 then c/EBP.
- this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0058 comprises the following TFBS sequences: CGCCCTTTGGACC (HNF4) and GACCTTTTGCAATCCTGG (c/EBP), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 12 for TFBS SEQ ID NOs). These may be present in the same order as CRE0058, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0058 comprises the sequence:
- GCGCCCTTTGGACCTTTTGCAATCCTGG (SEQ ID NO: 271), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto.
- a functional variant of CRE0058 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 4, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 4. Additionally or alternatively, a functional variant of CRE0058 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 4.
- the cis-regulatory enhancer element consists of SEQ ID NO: 4 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 4 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 4 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0058 or a functional variant thereof has a length of 120 or fewer nucleotides, 80 or fewer nucleotides, 60 or fewer nucleotides, or 40 or fewer nucleotides.
- CRE0065 (also known as LVR_CRE0065_APOA1) has a sequence as set out in SEQ ID NO: 5.
- Functional variants of CRE0065 are regulatory elements with sequences which vary from CRE0065, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0065 can be viewed as a CRE which, when substituted in place of CRE0065 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0065 substituted in place of CRE0065 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0065).
- CRE0065 in SP0239 can be replaced with a functional variant of CRE0065, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0065 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0065.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0065 listed in the order in which they are present, are: RXR Alpha, HNF3 and HNF3.
- the functional variant of CRE0065 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0065, i.e. in the order RXR Alpha, HNF3 then HNF3.
- this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0065 comprises the following TFBS sequences: ACT GAACCCTT GACCCCTGCCCT (RXR Alpha), CTGTTTGCCC (HNF3), and CTATTTGCCC (HNF3), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 13 for TFBS SEQ ID NOs). These may be present in the same order as CRE0065, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present. In some embodiments of the invention, the functional variant of CRE0065 comprises the sequence:
- Na and Nb represent optional spacer sequences.
- Na optionally has a length of from 14 to 30 nucleotides, preferably from 18 to 26 nucleotides, and more preferably 22 nucleotides.
- Nb optionally has a length of from 1 to 10 nucleotides, preferably from 2 to 6 nucleotides, and more preferably 4 nucleotides.
- a functional variant of CRE0065 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 5, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 5. Additionally or alternatively, a functional variant of CRE0065 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 5.
- the cis-regulatory enhancer element consists of SEQ ID NO: 5 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 5 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 5 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0065 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 90 or fewer nucleotides, or 72 or fewer nucleotides.
- CRE0065.1 (also known as LVR_CRE0065_APOA1_v1) has a sequence as set out in SEQ ID NO: 6.
- CRE0065.1 comprises CRE0065 in its entirety, and an additional 34 nucleotides at the 3’ end.
- CRE0065.1 can be viewed as a longer, functional equivalent of CRE0065.
- CRE0065.1 Functional variants of CRE0065.1 are regulatory elements with sequences which vary from CRE0065.1 , but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0065.1 can be viewed as a CRE which, when substituted in place of CRE0065.1 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0065.1 substituted in place of CRE0065.1 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0065.1).
- CRE0065.1 in SP0127A1 can be replaced with a functional variant of CRE0065.1 , and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0065.1 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0065.1.
- the liver-specific TFBS present in CRE0065.1 listed in the order in which they are present, are: RXR Alpha, HNF3, HNF3 and HNF4 (i.e. it compares an additional HNF4 TFBS when compared to CRE0065).
- the functional variant of CRE0065.1 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0065.1 , i.e. in the order RXR Alpha, HNF3, HNF3 then HNF4.
- this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0065.1 comprises the following TFBS sequences: ACT GAACCCTT GACCCCTGCCCT (RXR Alpha), CTGTTTGCCC (HNF3), CTATTTGCCC (HNF3) and TGATCCTTGAACTCT (HNF4), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 14 for TFBS SEQ ID NOs). These may be present in the same order as CRE0065.1 , i.e. the order in which they are set out above. It is well- known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0065.1 comprises the sequence:
- Na, Nb and Nc represent optional spacer sequences.
- Na optionally has a length of from 14 to 30 nucleotides, preferably from 18 to 26 nucleotides, and more preferably 22 nucleotides.
- Nb optionally has a length of from 1 to 10 nucleotides, preferably from 2 to 6 nucleotides, and more preferably 4 nucleotides.
- Nc optionally has a length of from 9 to 25 nucleotides, preferably from 13 to 21 nucleotides, and more preferably 17 nucleotides.
- a functional variant of CRE0065.1 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 6, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 6. Additionally or alternatively, a functional variant of
- CRE0065.1 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 6.
- the cis-regulatory enhancer element consists of CRE0065.1 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 6 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 6 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0065.1 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 106 or fewer nucleotides.
- CRE0066 (also known as Enh_18XS) has a sequence as set out in SEQ ID NO: 7.
- Functional variants of CRE0066 are regulatory elements with sequences which vary from CRE0066, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0066 can be viewed as a CRE which, when substituted in place of CRE0066 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0066 substituted in place of CRE0066 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0066).
- CRE0066 in SP0239 can be replaced with a functional variant of CRE0066, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0066 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0066.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0066 listed in the order in which they are present, are: HNF4G and FOS::JUN.
- the functional variant of CRE0066 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0066, i.e. in the order HNF4G then FOS::JUN
- this order is preferably considered in an upstream to downstream direction (i.e.
- the functional variant of CRE0066 comprises the following TFBS sequences: GCAGGGCAAAGTGCA (HNF4G) and GATGACTCAG (FOS::JUN), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 15 for SEQ ID NOs). These may be present in the same order as CRE0066, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0066 (SEQ ID NO: 7) comprises the sequence:
- GCAGGGCAAAGTGCA-Na-GATGACTCAG (SEQ ID NO: 274) or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto,
- Na represents an optional spacer sequence.
- Na optionally has a length of from 10 to 28 nucleotides, preferably from 14 to 24 nucleotides, and more preferably 19 nucleotides.
- a functional variant of CRE0066 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 7, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 7. Additionally or alternatively, a functional variant of CRE0066 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 7.
- the cis-regulatory enhancer element consists of CRE0066 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 7 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 7 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0066 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, or 87 or fewer nucleotides.
- CRE0066.2 (also known as LVR_CRE0066_v2 or Enh_18S) has a sequence as set out in SEQ ID NO: 8.
- CRE0066.2 comprises CRE0066 in its entirety, with an additional 81 nucleotides present at the 3’ end.
- CRE0066.2 can be viewed as a longer, functional variant of CRE0066.
- Functional variants of CRE0066.2 are regulatory elements with sequences which vary from CRE0066.2, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0066.2 can be viewed as a CRE which, when substituted in place of CRE0066.2 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0066.2 substituted in place of CRE0066.2 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0066.2).
- CRE0066.2 in SP0109 can be replaced with a functional variant of CRE0066.2, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- CRE0066.2 contains the same TFBS for liver-specific TFBS as CRE0066, and thus the same considerations apply as regards the preferable presence and location of the relevant TFBS.
- a functional variant of CRE0066.2 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 8, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 8. Additionally or alternatively, a functional variant of
- CRE0066.2 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 8.
- the cis-regulatory enhancer element consists of SEQ ID NO: 8 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 8 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 8 or a functional variant thereof also fall within the scope of the invention.
- CRE0066.1 (also known as LVR_CRE0066_v1 or Enh_18) has a sequence as set out in SEQ ID NO: 9.
- CRE0066.1 comprises both CRE0066 and CRE0066.2 in their entirety, with an additional 154 nucleotides present at the 3’ end when compared to CRE0066.
- CRE0066.1 can be viewed as a longer, functional variant of each of CRE0066 and
- Functional variants of CRE0066.1 are regulatory elements with sequences which vary from CRE0066.1 , but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0066.1 can be viewed as a CRE which, when substituted in place of CRE0066.1 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0066.1 substituted in place of CRE0066.1 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0066.1. Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- CRE0066.1 contains the same TFBS for liver-specific TFBS as CRE0066, and thus the same considerations apply as regards the preferable presence and location of the relevant TFBS.
- a functional variant of CRE0066.1 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 9, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 9. Additionally or alternatively, a functional variant of
- CRE0066.1 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 9.
- the cis-regulatory enhancer element consists of SEQ ID NO: 9 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 9 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 9 or a functional variant thereof also fall within the scope of the invention.
- CRE0068 has a sequence as set out in SEQ ID NO: 10.
- Functional variants of CRE0068 are regulatory elements with sequences which vary from CRE0068, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE non-functional.
- a functional variant of CRE0068 can be viewed as a ORE which, when substituted in place of CRE0068 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0068 substituted in place of CRE0068 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0068).
- CRE0068 in SP0379 can be replaced with a functional variant of CRE0068, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0068 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0068.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0068 listed in the order in which they are present, are: HNF-4, HNF-1/HNF-3 and SP1.
- the functional variant of CRE0068 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0068, i.e. in the order above.
- the cis-regulatory element is associated with a promoter and gene, this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0068 comprises the following TFBS sequences: TTCCTGCTCTTTGTCCC (HNF4), AGACTAATATTTGCC (HNF-1/HNF-3) and ATGGGGGAGGGACAG (SP1), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 16 for TFBS SEQ ID NOs). These may be present in the same order as CRE0068, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0068 comprises the sequence:
- Na and Nb represent optional spacer sequences.
- Na optionally has a length of from 4 to 20 nucleotides, preferably from 8 to 16 nucleotides, and more preferably 12 nucleotides.
- Nb optionally has a length of from 10 to 30 nucleotides, preferably from 15 to 25 nucleotides, and more preferably 20 nucleotides.
- a functional variant of CRE0068 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 10, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 10. Additionally or alternatively, a functional variant of CRE0068 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 10.
- the cis-regulatory enhancer element consists of CRE0068 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 10 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 10 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0068 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 100 or fewer nucleotides.
- CRE0074 (also known as SEPP1) has a sequence as set out in SEQ ID NO: 11.
- CRE0074 Functional variants of CRE0074 are regulatory elements with sequences which vary from CRE0074, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE non-functional.
- a functional variant of CRE0068 can be viewed as a ORE which, when substituted in place of CRE0074 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0074 substituted in place of CRE0074 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0074).
- CRE0074 in SP0268 can be replaced with a functional variant of CRE0074, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0074 comprises transcription factor binding sites (TFBS) for the liver-specific same transcription factors (TF) as CRE0074.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0074 listed in the order in which they are present, are: HNF4 and FoxOla.
- the functional variant of CRE0074 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0074, i.e. in the order HNF4 then FoxOla.
- this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0074 comprises the following TFBS sequences: AACATTGAACTTTGGACTA (HNF4) and GTAAACAA (FoxOla), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 17 for TFBS SEQ ID NOs). These may be present in the same order as CRE0074, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0074 comprises the sequence:
- AAC ATT G AACTTT GG ACTA- N a-GTAAAC AA (SEQ ID NO: 276), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto,
- Na represents an optional spacer sequence.
- Na optionally has a length of from 7 to 23 nucleotides, preferably from 11 to 19 nucleotides, and more preferably 15 nucleotides.
- a functional variant of CRE0074 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 11 , more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 11. Additionally or alternatively, a functional variant of SEQ ID NO:
- SEQ ID NO: 11 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 11.
- the cis-regulatory enhancer element consists of SEQ ID No: 11 or a functional variant thereof.
- the CRE0074 or a functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 11 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 11 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0074 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 100 or fewer nucleotides, 80 or fewer nucleotides, or 61 or fewer nucleotides.
- CRE0001 has a sequence as set out in SEQ ID NO: 12.
- CRE0001 Functional variants of CRE0001 are regulatory elements with sequences which vary from CRE0001 , but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0001 can be viewed as a CRE which, when substituted in place of CRE0001 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0001 substituted in place of CRE0001 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0001).
- CRE0001 in SP0250 can be replaced with a functional variant of CRE0001 , and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0001 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0001.
- the liver-specific TFBS present in CRE0001 listed in the order in which they are present, are: HNF-4, HNF-1 , HNF-3 and HNF-4.
- the functional variant of CRE0018 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0018, i.e. in the order set out above.
- this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e.
- overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0001 comprises the following TFBS sequences: TCCAAAGTCCAAA (HNF-4), TGTT AAT AATT AAT A (HNF-1), CAAT AAA CAT CA (HNF-3), TTCCCTTTGAACCTT (HNF-4), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 18 for TFBS SEQ ID NOs). These may be present in the same order as CRE0018, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0001 comprises the sequence:
- TCCAAAGTCCAAA-Na-TGTTAATAATTAATA-Nb-CAATAAACATCA-Nc-TTCCCTTTGAACCTT (SEQ ID NO: 277), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto,
- Na, Nb, and Nc represent optional spacer sequences.
- Na optionally has a length of from 1 to 10 nucleotides, preferably from 2 to 6 nucleotides, and more preferably 3 nucleotides.
- Nb optionally has a length of from 1 to 10 nucleotides, preferably from 2 to 6 nucleotides, and more preferably 3 nucleotides.
- Nc optionally has a length of from 11 to 31 nucleotides, preferably 16 to 26 nucleotides, and more preferably 21 nucleotides.
- a functional variant of CRE0001 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 12, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 12. Additionally or alternatively, a functional variant of CRE0001 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 12.
- the cis-regulatory enhancer element consists of SEQ ID NO: 12 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 12 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 12 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0001 or a functional variant thereof has a length of 400 or fewer nucleotides, 300 or fewer nucleotides, 250 or fewer nucleotides, or 201 or fewer nucleotides.
- CRE0005 has a sequence as set out in SEQ ID NO: 13.
- CRE0005 Functional variants of CRE0005 are regulatory elements with sequences which vary from CRE0005, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE non-functional.
- a functional variant of CRE0005 can be viewed as a ORE which, when substituted in place of CRE0005 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0005 substituted in place of CRE0005 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0005).
- CRE0005 in SP0256 can be replaced with a functional variant of CRE0005, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- CRE0005 Bioinformatic analysis of CRE0005 revealed that it does not apparently contain any known liver-specific TFBS. Nonetheless, the present inventors have determined that CRE0005 nonetheless contributes to liver-specific activity of promoters. Without wishing to be bound by theory, this may be through cooperative interaction with other CREs that do contain liver- specific TFBS to enhance their activity.
- the functional variant of CRE0005 comprises a sequence that is at least 70% identical to SEQ ID NO: 13, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 13. Additionally or alternatively, a functional variant of CRE0005 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 13.
- the CRE consists of SEQ ID NO: 13 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 13 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 13 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0005 or a functional variant thereof has a length of 400 or fewer nucleotides, 325 or fewer nucleotides, 275 or fewer nucleotides, or 232 or fewer nucleotides.
- CRE0012 has a sequence as set out in SEQ ID NO: 14.
- Functional variants of CRE0012 are regulatory elements with sequences which vary from CRE0012, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0012 can be viewed as a CRE which, when substituted in place of CRE0012 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0012 substituted in place of CRE0012 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0012).
- CRE0012 in SP0243 in can be replaced with a functional variant of CRE0012, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0012 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0012.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0012, listed in the order in which they are present, are: HNF-4, HNF-3, HNF-3 and C/EBP.
- the functional variant of CRE0012 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0012, i.e. in the order HNF-4, HNF-3, HNF-3 and then C/EBP.
- this order is preferably considered in an upstream to downstream direction (i.e.
- the functional variant of CRE0012 comprises the following TFBS sequences: AAGTCCAAAGGTAGA (HNF-4), G AGTCAACAT GA (HNF-3),
- AAATGTTGACTG HNF-3
- GGTTGCTTAAT C/EBP
- the functional variant of CRE0012 comprises the sequence:
- AAGTCCAAAGGT AG A- N a-G AGTCAACAT G A- N b-AAAT GTT GACT G- N c-GGTTGCTT AAT (SEQ ID NO: 278), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto,
- Na, Nb, and Nc represent optional spacer sequences.
- Na optionally has a length of from 23 to 43 nucleotides, preferably from 28 to 38 nucleotides, and more preferably 33 nucleotides.
- Nb optionally has a length of from 38 to 58 nucleotides, preferably from 42 to 53 nucleotides, more preferably 48 nucleotides.
- Nc optionally has a length of from 8 to 28 nucleotides, preferably 13 to 23 nucleotides, and more preferably 18 nucleotides.
- a functional variant of CRE0012 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 14, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 14. Additionally or alternatively, a functional variant of CRE0012 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 14.
- the CRE consists of SEQ ID NO: 14 or a functional variant thereof.
- CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 14 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 14 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0012 or a functional variant thereof has a length of 400 or fewer nucleotides, 300 or fewer nucleotides, 250 or fewer nucleotides, or 200 or fewer nucleotides.
- CRE0047 has a sequence as set out in SEQ ID NO: 15.
- Functional variants of CRE0047 are regulatory elements with sequences which vary from CRE0047, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0047 can be viewed as a CRE which, when substituted in place of CRE0047 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0047 substituted in place of CRE0047 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0047).
- CRE0047 in SP0258 in can be replaced with a functional variant of CRE0047, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0047 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0047.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0047 listed in the order in which they are present, are: HNF-3 and C/EBP.
- the functional variant of CRE0047 thus preferably comprises both of these TFBS.
- they are present in the same order that they are present in CRE0047, i.e. in the order HNF-3 and then C/EBP.
- this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e.
- overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0047 comprises the following TFBS sequences: GCAATGTTTGCCCAT (HNF-3), TGTTTGCCCAT (C/EBP), sequences complementary thereto, or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 20 for TFBS SEQ ID NOs). These may be present in the same order as CRE0047, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0047 comprises the sequence:
- GCAATGTTTGCCCAT (SEQ ID NO: 279), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto.
- a functional variant of CRE0047 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 15, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 15. Additionally or alternatively, a functional variant of CRE0047 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 15.
- the CRE consists of SEQ ID NO: 15 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 15 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 15 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0047 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 100 or fewer nucleotides, 50 or fewer nucleotides, or 35 or fewer nucleotides.
- CRE0048 has a sequence as set out in SEQ ID NO: 16.
- Functional variants of CRE0048 are regulatory elements with sequences which vary from CRE0048, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0048 can be viewed as a CRE which, when substituted in place of CRE0048 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0048 substituted in place of CRE0048 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0048).
- CRE0048 in SP0378 can be replaced with a functional variant of CRE0048, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- CRE0048 Bioinformatic analysis of CRE0048 revealed that it does not apparently contain any known liver-specific TFBS. Nonetheless, the present inventors have determined that CRE0005 nonetheless contributes to liver-specific activity of promoters. Without wishing to be bound by theory, this may be through cooperative interaction with other CREs that do contain liver- specific TFBS to enhance their activity.
- the functional variant of CRE0048 comprises a sequence that is at least 70% identical to SEC ID NO: 16, more preferably at least 80%, 90%, 95% or 99% identical to SEC ID NO: 16. Additionally or alternatively, a functional variant of CRE0048 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 16.
- the CRE consists of SEQ ID NO: 16 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 16 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 16 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0048 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 92 or fewer nucleotides.
- CRE0056 has a sequence as set out in SEQ ID NO: 17.
- CRE0056 Functional variants of CRE0056 are regulatory elements with sequences which vary from CRE0056, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0056 can be viewed as a CRE which, when substituted in place of CRE0056 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0056 substituted in place of CRE0056 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0056).
- CRE0056 in SP0380 can be replaced with a functional variant of CRE0056, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0056 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0056.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0056 listed in the order in which they are present, are: HNF-4 and HNF-3.
- the functional variant of CRE0056 thus preferably comprises both of these TFBS.
- they are present in the same order that they are present in CRE0056, i.e. in the order HNF-4 and then HNF-3.
- this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- TSS transcription start site
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e.
- overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0056 comprises the following TFBS sequences: ACT GAACCCTT GACCCCTGCCCT (HNF-4) and
- TGCCCACTCTATTTGCCCAGCC HNF-3
- sequences complementary thereto or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 21 for TFBS SEQ ID NOs).
- These may be present in the same order as CRE0056, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0056 comprises the sequence:
- ACTGAACCCTTGACCCCTGCCCT-Na-TGCCCACTCTATTTGCCCAGCC SEQ ID NO: 280
- ACTGAACCCTTGACCCCTGCCCT-Na-TGCCCACTCTATTTGCCCAGCC SEQ ID NO: 280
- Na represents an optional spacer sequence.
- Na optionally has a length of from 12 to 32 nucleotides, preferably from 17 to 27 nucleotides, and more preferably 22 nucleotides.
- a functional variant of CRE0056 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 17, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 17. Additionally or alternatively, a functional variant of CRE0056 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 17.
- the CRE consists of SEQ ID NO: 17 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 17 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 17 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0056 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, or 79 or fewer nucleotides.
- CRE0062 has a sequence as set out in SEQ ID NO: 18.
- CRE0062 Functional variants of CRE0062 are regulatory elements with sequences which vary from CRE0062, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0062 can be viewed as a CRE which, when substituted in place of CRE0062 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0062 substituted in place of CRE0062 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0062).
- CRE0062 in SP0381 can be replaced with a functional variant of CRE0062, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0062 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0062.
- TFBS transcription factor binding sites
- the liver-specific TFBS present in CRE0062 listed in the order in which they are present, are: HNF-4, HNF-4, and HNF-3.
- the functional variant of CRE0062 thus preferably comprises all of these TFBS. Preferably, they are present in the same order that they are present in CRE0062, i.e. in the order : HNF-4, HNF-4, and then HNF-3.
- this order is preferably considered in an upstream to downstream direction (i.e.
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0062 comprises the following TFBS sequences: AGATTCCAAAGTT CA (HNF-4), ACCAAAGTTCAGA (HNF-4), and
- GTTATTTACAA HNF-3
- sequences complementary thereto or functional variants of these TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 22 for TFBS SEQ ID NOs).
- These may be present in the same order as CRE0062, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0062 comprises the sequence:
- Na and Nb represent optional spacer sequences.
- Na optionally has a length of from 1 to 13 nucleotides, preferably from 2 to 8 nucleotides, and more preferably 3 nucleotides.
- Nb optionally has a length of from 1 to 18 nucleotides, preferably from 3 to 13 nucleotides, more preferably 8 nucleotides.
- a functional variant of CRE0062 suitably comprises a sequence that is at least 70% identical to SEQ ID NO: 18, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 18. Additionally or alternatively, a functional variant of CRE0062 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 18.
- the ORE consists of SEQ ID NO: 18 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 18 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 18 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0062 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, or 85 or fewer nucleotides.
- CRE0077 has a sequence as set out in SEQ ID NO: 19.
- CRE0077 Functional variants of CRE0077 are regulatory elements with sequences which vary from CRE0077, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE non-functional.
- a functional variant of CRE0077 can be viewed as a ORE which, when substituted in place of CRE0077 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0077 substituted in place of CRE0077 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0077).
- CRE0077 in SP0405 can be replaced with a functional variant of CRE0077, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0077 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0077.
- the liver-specific TFBS present in CRE0077 listed in order (5’ to 3’), are: HNF3, HNF3, HNF1 , HNF3, and HNF3.
- a functional variant of CRE0077 thus preferably comprises all of these TFBS.
- the TFBS are present in the same order that they are present in CRE0077, i.e. in the order HNF3, HNF3, HNF1 , HNF3, then HNF3.
- this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- Spacer sequences may be provided between adjacent TFBS.
- the TFBS may suitably overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0077 comprises the following TFBS sequences: AGCAAATATTT (HNF3), AAATATTTGTGG (HNF3),
- TFBS sequences that maintain the ability to bind to bind to their respective TF (see Table 23 for TFBS SEQ ID NOs). These may be present in the same order as CRE0077, i.e. the order in which they are set out above. It is well-known in the art that there is sequence variability associated with TFBS, and that for a given TFBS there is typically a consensus sequence, from which some degree of deviation is typically present.
- the functional variant of CRE0077 comprises the sequence:
- Na and Nb each represent an optional spacer sequence.
- the spacer sequences Na and Nb are suitably from 0 to 10 nucleotides in length.
- Na is from 2 to 8 nucleotides in length, preferably from 3 to 6 nucleotides in length, and more preferably 4 nucleotides in length.
- Nb is from 2 to 8 nucleotides in length, preferably from 2 to 6 nucleotides in length, and more preferably 3 nucleotides in length.
- the functional variant of CRE0077 comprises a sequence that is at least 70% identical to SEQ ID NO: 19, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 19. Additionally or alternatively, a functional variant of CRE0077 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 19.
- the ORE consists of SEQ ID NO: 19 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 19 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 19 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0077 or a functional variant thereof has a length of 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, 75 or fewer nucleotides, or 56 or fewer nucleotides.
- CRE0078 has a sequence as set out in SEQ ID NO: 20.
- CRE0078 Functional variants of CRE0078 are regulatory elements with sequences which vary from CRE0078, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE non-functional.
- a functional variant of CRE0078 can be viewed as a ORE which, when substituted in place of CRE0078 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0078 substituted in place of CRE0078 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0078).
- CRE0078 in SP0270 can be replaced with a functional variant of CRE0078, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- the functional variant of CRE0078 comprises transcription factor binding sites (TFBS) for the same liver-specific transcription factors (TF) as CRE0078.
- the liver-specific TFBS present in CRE0078 listed in order, are: HNF4, c/EBP, HNF3, and HNF3.
- the functional variant of CRE0078 thus preferably comprises these TFBS. Preferably, they are present in the same order that they are present in CRE0078, i.e. in the order HNF4, c/EBP, HNF3, and HNF3.
- the cis-regulatory element is associated with a promoter and gene, this order is preferably considered in an upstream to downstream direction (i.e. in the direction from distal from the transcription start site (TSS) to proximal to the TSS).
- the TFBS overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- the functional variant of CRE0078 comprises the following TFBS sequences: CGCCCTTTGGACC (HNF4), G ACCTTTT GCAATCCT GG (c/EBP),
- the functional variant of CRE0078 comprises the sequence: CGCCCTTTGGACCTTTTGCAATCCTGGAGCAAACAGCAAACAC (SEQ ID NO: 283), or a sequence that is at least 70%, 80%, 90%, 95% or 99% identical thereto.
- the functional variant of CRE0078 comprises a sequence that is at least 70% identical to SEQ ID NO: 20, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 20. Additionally or alternatively, a functional variant of CRE0078 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 20.
- the ORE consists of SEQ ID NO: 20 or a functional variant thereof.
- the ORE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 20 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 20 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0078 or a functional variant thereof has a length of 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, 75 or fewer nucleotides, or 45 or fewer nucleotides.
- CRE0083.1 has a sequence as set out in SEQ ID NO: 21.
- CRE0083.1 Functional variants of CRE0083.1 are regulatory elements with sequences which vary from CRE0083.1 , but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a ORE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference ORE, provided they do not render the ORE non-functional.
- a functional variant of CRE0083.1 can be viewed as a ORE which, when substituted in place of CRE0083.1 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0083.1 substituted in place of CRE0083.1 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0083.1).
- CRE0083.1 in SP0112 can be replaced with a functional variant of CRE0083.1 , and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- CRE0083.1 Bioinformatic analysis of CRE0083.1 revealed that it does not apparently contain any known liver-specific TFBS. Nonetheless, the present inventors have determined that CRE0005 nonetheless contributes to liver-specific activity of promoters. Without wishing to be bound by theory, this may be through cooperative interaction with other CREs that do contain liver- specific TFBS to enhance their activity.
- the functional variant of CRE0083.1 comprises a sequence that is at least 70% identical to SEQ ID NO: 21 , more preferably at least 80%,
- a functional variant of CRE0083.1 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 21.
- the CRE consists of SEQ ID NO: 21 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 21 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 21 or a functional variant thereof also fall within the scope of the invention.
- a CRE comprising or consisting of CRE0083.1 or a functional variant thereof has a length of 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 112 or fewer nucleotides.
- CRE0089 has a sequence as set out in SEQ ID NO: 22.
- Functional variants of CRE0089 are regulatory elements with sequences which vary from CRE0089, but which substantially retain their activity as liver-specific CREs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRE while retaining its ability to bind to the requisite transcription factors (TFs) and enhance expression.
- a functional variant can comprise substitutions, deletions and/or insertions compared to a reference CRE, provided they do not render the CRE non-functional.
- a functional variant of CRE0089 can be viewed as a CRE which, when substituted in place of CRE0089 in a CRM or promoter, substantially retains its activity.
- a promoter which comprises a functional variant of CRE0089 substituted in place of CRE0089 preferably retains 80% of its activity, more preferably 90% of its activity, more preferably 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising CRE0089).
- CRE0089 in SP0139 can be replaced with a functional variant of CRE0089, and the promoter substantially retains its activity.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- CRE0083 Bioinformatic analysis of CRE0083 revealed that it does not apparently contain any known liver-specific TFBS. Nonetheless, the present inventors have determined that CRE0005 nonetheless contributes to liver-specific activity of promoters. Without wishing to be bound by theory, this may be through cooperative interaction with other CREs that do contain liver- specific TFBS to enhance their activity.
- the functional variant of CRE0089 comprises a sequence that is at least 70% identical to SEQ ID NO: 22, more preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 22. Additionally or alternatively, a functional variant of CRE0089 suitably comprises a sequence which hybridises under stringent conditions to SEQ ID NO: 22.
- the CRE consists of SEQ ID NO: 22 or a functional variant thereof.
- the CRE or functional variant thereof can be provided on either strand of a double stranded polynucleotide and can be provided in either orientation.
- complementary and reverse complementary sequences of SEQ ID NO: 22 or a functional variant thereof fall within the scope of the invention.
- Single stranded nucleic acids comprising the sequence according to SEQ ID NO: 22 or a functional variant thereof also fall within the scope of the invention.
- a ORE comprising or consisting of CRE0089 or a functional variant thereof has a length of 250 or fewer nucleotides, 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, or 102 or fewer nucleotides.
- promoter elements are disclosed herein that can be used in the constructions of synthetic liver-specific promoters. These promoter elements are either minimal promoters or liver-specific proximal promoters. While the CREs and CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or liver-specific proximal promoters, some proximal promoters have been found to act synergistically with the CREs or CRMs to contribute significantly to activity of the activity of the liver-specific promoter. In addition, some liver-specific proximal promoters as disclosed herein have been found to have remarkable levels of activity even in the absence of additional CRE or CRM sequences (most notably the proximal promoters CRE0006 and CRE0059)
- Functional variants of a promoter element include sequences which vary from the reference promoter element, but which substantially retain their activity liver-specific promoter elements. It will be appreciated by the skilled person that it is possible to vary the sequence of a promoter element while retaining its ability to recruit RNA polymerase II, and, where relevant, bind to liver-specific transcription factors (TFs) to enhance expression.
- a functional variant of a promoter element can comprise substitutions, deletions and/or insertions compared to a reference promoter element, provided they do not render the promoter element non-functional.
- a functional variant of a promoter element can be viewed as a promoter element which, when substituted in place of a reference promoter element in a promoter, substantially retains its activity.
- a liver-specific promoter which comprises a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified promoter element).
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- functional variants of a promoter element retain a significant level of sequence identity to a reference promoter element.
- functional variants comprise a sequence that is at least 70% identical to the reference promoter element, more preferably at least 80%, 90%, 95% or 99% identical to the reference promoter element.
- TFBS for the liver-specific TFs that bind to the reference promoter element
- the TFBS are retained in the same order and at substantially the same location as in the reference promoter element.
- sequence of the transcription start site (TSS) is substantially unaltered in a functional variant of a promoter element.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- Promoter elements used in the present invention can be natural (i.e. obtained or derived from a naturally occurring gene promoter) or can be synthetic (i.e., non-naturally occurring).
- CRE0006 has a sequence as set out in SEQ ID NO: 25.
- functional variants of CRE0006 substantially retain the ability of CRE0006 to act as a liver-specific promoter element.
- the modified retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0241 or SP0244.
- the functional variant of CRE0006 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 25.
- CRE0006 is a proximal promoter and comprises TFBS for liver-specific TFs upstream of the TSS.
- the liver-specific TFBS present in CRE0006, listed in order, are HNF4, RXRa, HNF4, c/EBP, and HNF3 (see Table 25 for details).
- the functional variant of CRE0006 thus preferably comprises these TFBS. Preferably, they are present in the same order that they are present in CRE0006, i.e. in the order HNF4, c/EBP, HNF3, and HNF3.
- the TFBS overlap provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- a functional variant of CRE0006 comprises a sequence which is at least 70% identical to SEQ ID NO: 25 (preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 25), which contains TFBS for HNF4, RXRa, HNF4, c/EBP, and HNF3, and preferably which contains a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 25 downstream of said TFBS.
- a functional variant of CRE0006 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 25, and which further comprises the following TFBS: HNF4 at or near position 25-37; RXRa at or near position 73-83; HNF4 at or near position 74-86; c/EBP at or near position 123-136; and HNF3 at or near position 129-137; and which comprises a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 25 at or near position 166-196, positions being numbered with reference to SEQ ID NO: 25.
- At or near in the present context suitably means within 10, 5, 4, 3, 2, or 1 nucleotide of the recited position with reference to SEQ ID NO: 25.
- Suitable TFBS sequences are shown in Table 25, but alternative TFBS sequences can be used.
- a promoter comprising or consisting of CRE0006 or a functional variant thereof has a length of 400 or fewer nucleotides, 350 or fewer nucleotides, 325 or fewer nucleotides, 300 or fewer nucleotides, or 279 or fewer nucleotides.
- CRE0059 has a sequence as set out in SEQ ID NO: 26.
- functional variants of CRE0059 substantially retain the ability of CRE00059 to act as a liver-specific promoter element.
- the modified retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0412 or SP0380.
- the functional variant of CRE0059 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 26.
- CRE0059 is a proximal promoter and comprises a TFBS for a liver-specific TF, namely HNF1 , upstream of the TSS.
- the functional variant of CRE0059 thus preferably comprises a TFBS for HNF1 upstream of the TSS.
- a functional variant of CRE0059 comprises a sequence which is at least 70% identical to SEQ ID NO: 26 (preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 26), which contains a TFBS for HNF1 , and preferably which contains a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 27 downstream of said TFBS.
- a functional variant of CRE0059 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 26, and which further comprises a TFBS for HNF3 at or near position 24-36; and which comprises the TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 27 at or near position 73-93, positions being numbered with reference to SEQ ID NO: 26.
- At or near in the present context suitably means within 10, 5, 4, 3, 2, or 1 nucleotide of the recited position with reference to SEQ ID NO: 26.
- Suitable TFBS sequences are shown in Table 27, but alternative TFBS sequences can be used.
- a promoter comprising or consisting of CRE0059 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 110 or fewer nucleotides, or 95 or fewer nucleotides.
- CRE0073 has a sequence as set out in SEQ ID NO: 27.
- functional variants of CRE0073 substantially retain the ability of CRE0073 to act as a liver-specific promoter element.
- the modified retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0249 or SP0116.
- the functional variant of CRE0073 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 27.
- CRE0073 is a proximal promoter and comprises TFBS for liver-specific TFs upstream of the TSS.
- the liver-specific TFBS present in CRE0073 are HNF3, C/EBP, HNF1 and C/EBP (see Table 28 for details).
- the functional variant of CRE0073 thus preferably comprises these TFBS.
- they are present in the same order that they are present in CRE0073, i.e. in the order HNF3, C/EBP, HNF1 and then C/EBP.
- the TFBS overlap, provided they remain functional, i.e. overlapping sequences are both able to bind their respective TFs.
- a functional variant of CRE0073 comprises a sequence which is at least 70% identical to SEQ ID NO: 27 (preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 27), which contains TFBS for HNF3, C/EBP, HNF1 and C/EBP, and preferably which contains a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 28 downstream of said TFBS.
- a functional variant of CRE0073 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 27, and which further comprises the following TFBS: HNF3 at or near position 36-42; C/EBP at or near position 38-49; HNF1 at or near position 66-83; C/EBP at or near position 75-86; and HNF3 at or near position 129-137; and which comprises a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 28 at or near position 138-156, positions being numbered with reference to SEQ ID NO: 27.
- At or near in the present context suitably means within 10, 5, 4, 3, 2, or 1 nucleotide of the recited position with reference to SEQ ID NO: 27.
- Suitable TFBS sequences are shown in Table 28, but alternative TFBS sequences can be used.
- CRE0073.1 in an exemplary functional variant of CRE0073.
- CRE0073.1 has a deletion of 22 nucleotides from the 5’ end compared with CRE0073. It is otherwise identical, and comprises the same TFBS in the same relative positions relative to CRE0073.
- a promoter comprising or consisting of CRE0073 or a functional variant thereof has a length of 300 or fewer nucleotides, 250 or fewer nucleotides, 200 or fewer nucleotides, 175 or fewer nucleotides, or 164 or fewer nucleotides.
- CRE0040 has a sequence as set out in SEQ ID NO: 29.
- functional variants of CRE0040 substantially retain the ability of CRE0040 to act as a liver-specific promoter element.
- the modified retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0254 or SP0252.
- the functional variant of CRE0040 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 29.
- CRE0040 is a proximal promoter and comprises TFBS for liver-specific TFs upstream of the TSS.
- the liver-specific TFBS present in CRE0040 listed in order, are C/EBP and HNF1 (see Table 30 for details).
- the functional variant of CRE0040 thus preferably comprises these TFBS. Preferably, they are present in the same order that they are present in
- a functional variant of CRE0040 comprises a sequence which is at least 70% identical to SEQ ID NO: 29 (preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 29), which contains TFBS for C/EBP and HNF1 , and preferably which contains a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 30 downstream of said TFBS.
- a functional variant of CRE0040 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 29, and which further comprises the following TFBS: C/EBP at or near position 39-52; HNF1 at or near position 120-140; and which comprises a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 30 at or near position 172-201 , positions being numbered with reference to SEQ ID NO: 29.
- TFBS C/EBP at or near position 39-52
- HNF1 at or near position 120-140
- TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 30 at or near position 172-201 , positions being numbered with reference to SEQ ID NO: 29.
- At or near in the present context suitably means within 10, 5,
- Suitable TFBS sequences are shown in Table 30, but alternative TFBS sequences can be used.
- a promoter comprising or consisting of CRE0006 or a functional variant thereof has a length of 400 or fewer nucleotides, 350 or fewer nucleotides, 300 or fewer nucleotides, 275 or fewer nucleotides, or 240 or fewer nucleotides.
- CRE0079 has a sequence as set out in SEQ ID NO: 24.
- functional variants of CRE0079 substantially retain the ability of CRE0079 to act as a liver-specific promoter element.
- the modified retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0271 or SP0272.
- the functional variant of CRE0079 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 24.
- CRE0079 is a proximal promoter and comprises TFBS for liver-specific TFs upstream of the TSS.
- the liver-specific TFBS present in CRE0079 listed in order, are HNF4, HNF1 and C/EBP (see Table 26 for details).
- the functional variant of CRE0079 thus preferably comprises these TFBS. Preferably, they are present in the same order that they are present in CRE0079, i.e. in the order HNF4, HNF1 and then C/EBP.
- a functional variant of CRE0079 comprises a sequence which is at least 70% identical to SEQ ID NO: 24 (preferably at least 80%, 90%, 95% or 99% identical to SEQ ID NO: 24), which contains TFBS for HNF4, HNF1 and C/EBP, and preferably which contains a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 24 downstream of said TFBS.
- a functional variant of CRE0079 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 24, and which further comprises the following TFBS: HNF4 at or near position 43-55; HNF1 at or near position 138-150; C/EBP at or near position 162-175, and which comprises a TSS sequence which is at least 80%, 90%, 95% or completely identical to that shown in Table 26 at or near position 206- 219, positions being numbered with reference to SEQ ID NO: 24. At or near in the present context suitably means within 10, 5, 4, 3, 2, or 1 nucleotide of the recited position with reference to SEQ ID NO: 24. Suitable TFBS sequences are shown in Table 26, but alternative TFBS sequences can be used.
- a promoter comprising or consisting of CRE0079 or a functional variant thereof has a length of 400 or fewer nucleotides, 325 or fewer nucleotides, 275 or fewer nucleotides, 250 or fewer nucleotides, or 226 or fewer nucleotides.
- CRE0052 has a sequence as set out in SEQ ID NO: 23.
- functional variants of CRE0052 substantially retain the ability of CRE0052 to act as a liver-specific promoter element.
- the modified retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of the activity of SP0239 or SP0265.
- the functional variant of CRE0052 comprises a sequence which has at least 70%, 80%, 90%, 95% or 99% identity to SEQ ID NO: 23.
- a promoter comprising or consisting of CRE0052 or a functional variant thereof has a length of 200 or fewer nucleotides, 150 or fewer nucleotides, 125 or fewer nucleotides, 100 or fewer nucleotides, or 76 or fewer nucleotides.
- Non-limiting examples of other liver-specific proximal promoters include, but are not limited to, the ApoA-l promoter, the ApoA-ll promoter, the ApoA-IV promoter, the ApoB promoter, the ApoC-1 promoter, the ApoC-ll promoter, the ApoC-lll promoter, the ApoE promoter, the albumin promoter, the a-fetoprotein promoter, the phosphoenolpyruvate carboxykinase (PCK1) promoter, the phosphoenolpyruvate carboxykinase 2 (PCK2) promoter, the transthyretin (TTR) promoter, the a-antitrypsin (AAT or SERPINAI) promoter, the TK (thymidine kinase) promoter, the hemopexin promoter, the alcohol dehydrogenase 6 promoter, the cholesterol 7alpha- 25 hydroxylase promoter, the factor IX promoter,
- CRMs of the present invention can be used in combination with a wide range of suitable minimal promoters or liver-specific proximal promoters, as discussed above.
- Functional variants of a CRM include sequences which vary from the reference CRM element, but which substantially retain activity as liver-specific CRMs. It will be appreciated by the skilled person that it is possible to vary the sequence of a CRM while retaining its ability to recruit suitable liver-specific transcription factors (TFs) and thereby enhance expression.
- a functional variant of a CRM can comprise substitutions, deletions and/or insertions compared to a reference CRM, provided they do not render the CRM substantially non-functional.
- a functional variant of a CRM can be viewed as a CRM which, when substituted in place of a reference CRM in a promoter, substantially retains its activity.
- a liver-specific promoter which comprises a functional variant of a given CRM preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified CRM).
- functional variants of a CRM retain a significant level of sequence identity to a reference CRM.
- functional variants comprise a sequence that is at least 70% identical to the reference CRM, more preferably at least 80%, 90%, 95% or 99% identical to the reference CRM.
- Retention of activity can be assessed by comparing expression of a suitable reporter under the control of the reference promoter with an otherwise identical promoter comprising the substituted CRE under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- Functional variants of a given CRM can, in some embodiments, comprise functional variants of one or more of the CREs present in the reference CRM.
- functional variants of a given CRM can comprise functional variants of 1 , 2, 3, 4, 5, or 6 of the CREs present in the reference CRM.
- Functional variants of CREs are discussed above.
- Functional variants of a given CRM can, in some embodiments, comprise the same combination CREs as a reference CRM, but the CREs can be present in a different order from the reference CRM. It is usually preferred that the CREs are present in the same order as the reference CRM (thus, the functional variant of a CRM suitably comprises the same permutation of the CREs as set out in a reference CRM).
- Functional variants of a given CRM can, in some embodiments, comprise one or more additional CREs to those present in a reference CRM. Additional CREs can be provided upstream of the CREs present in the reference CRM, downstream of the CREs present in the reference CRM, and/or between the CREs present in the reference CRM. The additional CREs can be CREs disclosed herein, or they can be other CREs. Generally, it is preferred that a functional variant of a given CRM comprises the same CREs (or functional variants thereof) and does not comprise additional CREs.
- Functional variants of a given CRM can comprise one or more additional regulatory elements compared to a reference CRM.
- they may comprise an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the CRM substantially non-functional.
- Functional variants of a given CRM can comprise additional spacers between adjacent CREs or, if one or more spacer are present in the reference CRM, said one or more spacers can be longer or shorter than in the reference CRM.
- CRMs as disclosed herein, or functional variants thereof can be combined with any suitable promoter elements in order to provide a synthetic liver-specific promoter according to the present invention.
- the synthetic liver-specific CRM has length of 500 or fewer nucleotides, for example 450, 400, 350, 300, 250, 200, 150, 100, 75, 60, 50 or fewer nucleotides.
- liver-specific promoters are disclosed herein.
- a functional variant of a reference synthetic liver-specific promoter is a promoter which comprise a sequence which varies from the reference synthetic liver-specific promoter, but which substantially retains liver-specific promoter activity. It will be appreciated by the skilled person that it is possible to vary the sequence of a synthetic liver-specific promoter while retaining its ability to recruit suitable liver-specific transcription factors (TFs) and to recruit RNA polymerase II to provide liver-specific expression of an operably linked sequence (e.g. open reading frame).
- a functional variant of a synthetic liver-specific promoter can comprise substitutions, deletions and/or insertions compared to a reference promoter, provided such substitutions, deletions and/or insertions do not render the synthetic liver-specific promoter substantially non-functional compared to the reference promoter.
- a functional variant of a synthetic liver-specific promoter can be viewed as a variant which substantially retains the liver-specific promoter activity of the reference promoter.
- a functional variant of a synthetic liver-specific promoter preferably retains at least 70% of the activity of the reference promoter, more preferably at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity.
- Functional variants of a synthetic liver-specific promoter often retain a significant level of sequence similarity to a reference synthetic liver-specific promoter.
- functional variants comprise a sequence that is at least 70% identical to the reference synthetic liver-specific promoter, more preferably at least 80%, 90%, 95% or 99% identical to the reference synthetic liver-specific promoter.
- Activity in a functional variant can be assessed by comparing expression of a suitable reporter under the control of the reference synthetic liver-specific promoter with the putative functional variant under equivalent conditions.
- Suitable assays for assessing liver-specific promoter activity are disclosed herein, e.g. in examples 2 and 3.
- Functional variants of a given synthetic liver-specific promoter can comprise functional variants of one or more CREs present in the reference synthetic liver-specific promoter.
- functional variant of a given CRM can comprise 1 , 2, 3, 4, 5, or 6 of the CREs present in the reference CRM.
- Functional variants of CREs are discussed above.
- Functional variants of a given synthetic liver-specific promoter can comprise functional variants of the promoter element, or a different promoter element when compare to the reference synthetic liver-specific promoter.
- Functional variants of a given synthetic liver-specific promoter can comprise the same CREs as a reference synthetic liver-specific promoter, but the CREs can be present in a different order from the reference synthetic liver-specific promoter.
- Functional variants of a given synthetic liver-specific promoter can comprise one or more additional CREs to those present in a reference synthetic liver-specific promoter. Additional CREs can be provided upstream of the CREs present in the reference CRM, downstream of the CREs present in the reference synthetic liver-specific promoter, and/or between the CREs present in the reference synthetic liver-specific promoter.
- the additional CREs can be CREs disclosed herein, or they can be other CREs.
- Functional variants of a given CRM can comprise one or more additional regulatory elements compared to a reference CRM.
- they may comprise an inducible elements, an intronic element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the promoter substantially non-functional.
- Functional variants of a given synthetic liver-specific promoter can comprise additional spacers between adjacent CREs and promoter elements or, if one or more spacer are present in the reference synthetic liver-specific promoter, said one or more spacers can be longer or shorter than in the reference synthetic liver-specific promoter.
- synthetic liver-specific promoters of the present invention can comprise a CRM of the present invention and additional regulatory sequences.
- they may comprise one or more additional CRMs, an inducible or repressible element, a boundary control element, an insulator, a locus control region, a response element, a binding site, a segment of a terminal repeat, a responsive site, a stabilizing element, a de-stabilizing element, and a splicing element, etc., provided that they do not render the promoter substantially non-functional.
- Preferred synthetic liver-specific promoters of the present invention exhibit liver-specific promoter activity which is at least 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter.
- the synthetic liver-specific promoters of the invention are suitable for promoting liver-specific transgene expression at a level at least 100% of the activity of the LP1 promoter, preferably 150%, 200%, 300% or 500% of the activity of the LP1 promoter. In many cases higher levels of promoter activity is preferred, but this is not always the case; thus, in some cases more moderate levels of expression may be preferred.
- Activity of a given synthetic liver-specific promoter of the present invention compared to TBG can be assessed by comparing liver-specific expression of a reporter gene under control of the synthetic liver-specific promoter with expression of the same reporter under control of the TBG promoter, when the two promoters are provided in otherwise equivalent expression constructs and under equivalent conditions.
- a synthetic liver-specific promoter of the invention is able to increase expression of a gene (e.g. a therapeutic gene or gene of interest) in the liver of a subject or in a liver cell by at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 200%, at least 300%, at least 500%, at least 1000% or more relative to a known liver- specific promoter, suitably the LP-1 promoter.
- a gene e.g. a therapeutic gene or gene of interest
- Preferred synthetic liver-specific promoters of the present invention exhibit activity in non liver cells (e.g. HEK293 cells) which is 50% or less when compared to CMV-IE, preferably 25% or less than CMV-IE, more preferably 10% or less than CMV-IE, and in some cases 5% or less than CMV-IE, or 1 % or less than CMV-IE.
- non liver cells e.g. HEK293 cells
- the synthetic liver-specific promoter has length of 700 or fewer nucleotides, for example, 600, 500, 450, 400, 350, 300, 250, 200, 150, 100, 75, 70, 68 or fewer nucleotides.
- Particularly preferred synthetic liver-specific promoters are those that are both short and which exhibit high levels of activity.
- the present invention also provides a synthetic liver-specific expression cassette comprising a synthetic liver-specific promoter of the present invention operably linked to a sequence encoding an expression product, suitably a gene (e.g. a transgene).
- a gene e.g. a transgene
- the gene typically encodes a desired gene expression product such as a polypeptide (protein) or RNA.
- the gene may be a full-length cDNA or genomic DNA sequence, or any fragment, subunit or mutant thereof that has at least some desired biological activity.
- the gene encodes a protein
- the protein can be essentially any type of protein.
- the protein can be an enzyme, an antibody or antibody fragment (e.g. a monoclonal antibody), a viral protein (e.g. REP-CAP, REV, VSV-G, or RD114), a therapeutic protein, or a toxic protein (e.g. Caspase 3, 8 or 9).
- the gene encodes a therapeutic expression product, preferably a therapeutic polypeptide suitable for use in treating a disease or condition associated with aberrant gene expression, optionally in the liver.
- the therapeutic expression product can be a protein, e.g. a secretable protein such as, e.g., a clotting factor (e.g., factor IX or factor VIII), a cytokine, a growth factor, an antibody or nanobody, a chemokine, a plasma factor, insulin, erythropoietin, lipoprotein lipase, or a toxic protein.
- the therapeutic expression product may be RNA, such as an siRNA or miRNA.
- a non-exhaustive list of therapeutic expression products (and sequences encoding them) envisaged for use in the present invention includes: factor VIII, factor IX, factor VII, factor X, von Willebrand factor, erythropoietin (EPO), interferon-a, interferon-B, interferon-y, interleukin 1 (IL-1), interleukin 2 (IL-2), interleukin 3 (IL-3), interleukin 4 (IL-4 ), interleukin 5 (IL-5), interleukin 6 (IL-6), interleukin 7 (IL-7), interleukin 8 (IL-8), interleukin 9 (IL-9), interleukin 10 (IL-10), interleukin 11 (IL-11 ), interleukin 12 (IL-12), chemokine (C-X-C motif) ligand 5 (CXCL5), granulocyte-colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), macrophage colony
- the synthetic liver-specific expression cassette comprises a gene useful for gene editing, e.g. a gene encoding a site-specific nuclease, such as a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector- based nuclease (TALEN), or the clustered regularly interspaced short palindromic repeats system (CRISPR-Cas).
- a gene useful for gene editing e.g. a gene encoding a site-specific nuclease, such as a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector- based nuclease (TALEN), or the clustered regularly interspaced short palindromic repeats system (CRISPR-Cas).
- a gene useful for gene editing e.g. a gene encoding a site-specific nuclease, such as a meganuclease, zinc finger nucleas
- the site-specific nuclease is adapted to edit a desired target genomic locus by making a cut (typically a site-specific double-strand break) which is then repaired via non-homologous end-joining (NHEJ) or homology dependent repair (HDR), resulting in a desired edit.
- NHEJ non-homologous end-joining
- HDR homology dependent repair
- the edit can be the partial or complete repair of a gene that is dysfunctional, or the knock-down or knock-out of a functional gene.
- the synthetic liver-specific expression cassette comprises sequences providing or coding for one or more of, and preferably all of, a ribosomal binding site, a start codon, a stop codon, and a transcription termination sequence.
- the expression cassette comprises a nucleic acid encoding a posttranscriptional regulatory element.
- the expression cassette comprises a nucleic acid encoding a polyA element.
- the present invention further provides a vector comprising a synthetic liver-specific CRM, synthetic liver-specific promoter, or expression cassette according to the present invention.
- the vector is a plasmid.
- a plasmid may include a variety of other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, multiple cloning sites and the like.
- the vector is a viral vector.
- the vector is an expression vector for expression in eukaryotic cells.
- eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTI and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, plRES2-DsRed2, pDsRed2-Mito, pCMV-EGFP available from Clontech. Many other vectors are well-known and commercially available.
- yeast expression vectors including, without limitation, yeast integrative plasmids (Yip) and yeast replicative plasmids (YRp).
- Yip yeast integrative plasmids
- YRp yeast replicative plasmids
- Ti plasmid of agrobacterium is an exemplary expression vector
- plant viruses also provide suitable expression vectors, e.g. tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.
- the vector is a gene therapy vector.
- Various gene therapy vectors are known in the art, and mention can be made of AAV vectors, adenoviral vectors, retroviral vectors and lentiviral vectors.
- the vector preferably comprises a nucleic acid sequence operably linked to the synthetic liver-specific promoter of the invention that encodes a therapeutic product, suitably a therapeutic protein.
- the therapeutic protein may be a secretable protein.
- secretable proteins include clotting factors, such as factor VIII or factor IX, insulin, erythropoietin, lipoprotein lipase, antibodies or nanobodies, growth factors, cytokines, chemokines, plasma factors, toxic proteins, etc.
- the vector is a viral vector, such as a retroviral, lentiviral, adenoviral, or adeno-associated viral (AAV) vector.
- a viral vector such as a retroviral, lentiviral, adenoviral, or adeno-associated viral (AAV) vector.
- AAV adeno-associated viral
- the vector is an AAV vector.
- the AAV has a serotype suitable for liver transduction.
- the AAV is selected from the group consisting of: AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, or derivatives thereof.
- AAV vectors are preferably used as self-complementary, double-stranded AAV vectors (scAAV) in order to overcome one of the limiting steps in AAV transduction (i.e. single-stranded to double-stranded AAV conversion), although the use of single-stranded AAV vectors (ssAAV) is also encompassed herein.
- the AAV vector is chimeric, meaning it comprises components from at least two AAV serotypes, such as the ITRs of an AAV2 and the capsid protein of an AAV5.
- the invention further provides recombinant virions (viral particles) comprising a vector as described above.
- the vectors or virions of the present invention may be formulated in a pharmaceutical composition with a pharmaceutically acceptable excipient, i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
- a pharmaceutically acceptable excipient i.e., one or more pharmaceutically acceptable carrier substances and/or additives, e.g., buffers, carriers, excipients, stabilisers, etc.
- the pharmaceutical composition may be provided in the form of a kit.
- a further aspect of the invention provides a pharmaceutical composition comprising a vector or virion as described herein.
- the present invention also provides a synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, virion or pharmaceutical composition according to various aspects of the present invention for use in the treatment of a disease, preferably a disease associated with aberrant gene expression, optionally in the liver (e.g. a genetic liver disease).
- a disease associated with aberrant gene expression optionally in the liver (e.g. a genetic liver disease).
- a disease associated with aberrant gene expression in the liver e.g. a genetic liver disease.
- diseases associated with aberrant gene expression in the liver include but are not limited to haemophilia (including
- haemophilia A or B haemophilia A or B
- familial hypercholesterolemia ornithine transcarbamylase deficiency
- phenylketonuria ornithine transcarbamylase deficiency
- glycogen storage disease a1- antitrypsin deficiency
- hereditary hemochromatosis hereditary hemochromatosis
- tyrosinemia type 1 argininosuccinic aciduria
- hepatitis virus infection non-viral hepatitis
- liver cancer genetic cholestasis, Wilson’s disease
- various other liver diseases such as non-alcoholic fatty liver disease (NAFLD), alcohol-related liver disease (ARLD), and lysosomal storage disorders.
- Use for the treatment of haemophilia A or B represent preferred embodiments of the invention.
- the present invention also provides a synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, virion according to the various aspects of the present invention for use the manufacture of a pharmaceutical composition for treatment of any condition or disease mentioned herein.
- the present invention further provides a cell comprising a synthetic liver-specific CRM, synthetic liver-specific promoter, expression cassette, vector, virion according to the various aspects of the invention.
- the cell is a eukaryotic cell.
- the eukaryotic cell can suitably be a fungal cell (e.g. yeast cell), an animal (metazoan) cell (e.g. a mammalian cell), or a plant cell.
- the cell may be a prokaryotic cell.
- the cell is ex vivo, e.g. in cell culture. In other embodiments of the invention the cell may be part of a tissue or multicellular organism.
- the cell is a liver cell (hepatocyte), which may be ex vivo or in vivo.
- the liver cell may be a primary liver cell or a cell of a liver-derived cell line, e.g. an immortalised cell line.
- the cell may be present within a liver tissue environment (e.g. within a liver of an animal) or may be isolated from liver tissue, e.g. it may be in cell culture.
- the cell is a human cell.
- liver-specific CRM, synthetic liver-specific promoter, expression cassette, or vector, according to the invention may be inserted into the genome of the cell, or it may be episomal (e.g. present in an episomal vector).
- the present invention provides a method for producing an expression product, the method comprising providing a synthetic liver-specific expression cassette according to the present invention (preferably in a vector as set out above) in a cell, preferably a liver cell and expressing the gene present in the synthetic liver-specific expression cassette.
- the method suitably comprises maintaining said liver cell under suitable conditions for expression of the gene. In culture this may comprise incubating the cell, or tissue comprising the cell, under suitable culture conditions.
- the expression may of course be in vivo, e.g. in one or more cells in the liver of a subject.
- the method comprises the step of introducing the synthetic liver-specific expression cassette into the liver cell.
- a wide range of methods of transfecting liver cells are well-known in the art.
- a preferred method of transfecting liver cells is transducing the cells with a viral vector comprising the synthetic liver-specific expression cassette, e.g. an AAV vector.
- the invention thus provides, in some embodiments, an expression cassettes, vectors or virion according to the present for use in gene therapy in a subject, preferably gene therapy through liver-specific expression of a therapeutic gene.
- the therapy may involve treatment of a disease through secretion of a therapeutic product from liver cells, suitable, a disease involving aberrant gene expression in the liver (for example, haemophilia A or B).
- the present invention also provides a method of expressing a therapeutic transgene in a liver cell, the method comprising introducing into the liver cell an expression cassette or vector according to the present invention.
- the liver cell can be in vivo or ex vivo.
- the present invention also provides a method of gene therapy of a subject, preferably a human, in need thereof, the method comprising:
- a synthetic liver-specific expression cassette, vector, virion or pharmaceutical composition of the present invention which comprises a gene encoding a therapeutic product.
- the method suitably comprises expressing a therapeutic amount of the therapeutic product from the gene in the liver of said subject.
- Genes encoding suitable therapeutic products are discussed above. However, specific mention may be made of therapeutic proteins, such as factor VIII and IX for the treatment of haemophilia.
- the method suitably comprises administering a vector or virion according to the present invention to the subject.
- the vector is a viral gene therapy vector, for example an AAV vector.
- the method comprises administering the viral gene therapy vector systemically.
- Systemic administration may be enteral (e.g. oral, sublingual, and rectal) or parenteral (e.g. injection).
- Preferred routes of injection include intravenous, intramuscular, subcutaneous, intra-arterial, intra-articular, intrathecal, and intradermal injections.
- the viral gene therapy vector may be administered concurrently or sequentially with one or more additional therapeutic agents or with one or more saturating agents designed to prevent clearance of the vectors by the reticular endothelial system.
- the dosage of the vector may be from 1x10 10 gc/kg to 1x10 15 gc/kg or more, suitably from 1x10 12 gc/kg to 1x10 14 gc/kg, suitably from 5x10 12 gc/kg to 5x10 13 gc/kg.
- the subject in need thereof will be a mammal, and preferably primate, more preferably a human.
- the subject in need thereof will display symptoms
- the method typically comprises ameliorating the symptoms displayed by the subject in need thereof, by expressing the therapeutic amount of the therapeutic product.
- Gene therapy protocols for therapeutic gene expression in target cells in vitro and in vivo are well-known in the art and will not be discussed in detail here. Briefly, they include intramuscular injection, interstitial injection, instillation in airways, application to endothelium, intra-hepatic parenchyme, and intravenous or intra-arterial administration (e.g. intra-hepatic artery, intra-hepatic vein) of plasmid DNA vectors (naked or in liposomes) or viral vectors.
- Various devices have been developed for enhancing the availability of DNA to the target cell. While a simple approach is to contact the target cell physically with catheters or implantable materials containing the relevant vector, more complex approaches can use jet injection devices an suchlike.
- Gene transfer into mammalian liver cells has been performed using both ex vivo and in vivo procedures.
- the ex vivo approach typically requires harvesting of the liver cells, in vitro transduction with suitable expression vectors, followed by reintroduction of the transduced hepatocytes the liver.
- In vivo gene transfer has been achieved by injecting DNA or viral vectors into the liver parenchyma, hepatic artery, or portal vein.
- the methods set out above may be used for the treatment of a subject with haemophilia, e.g. haemophilia A or B. Accordingly, the invention provides a method of treating a subject with haemophilia A or B, the method comprising the steps of:
- a synthetic liver-specific expression cassette, vector, virion or pharmaceutical composition of the present invention which comprises a gene encoding a suitable clotting factor (in particular, factor VIII in the case of haemophilia A or factor IX in the case of haemophilia B); and
- the synthetic liver-specific expression cassette is provided in a gene therapy vector, suitably an AAV vector.
- the method comprises expressing a suitable amount of the relevant clotting factor in the liver of the subject to alleviate or ameliorate the symptoms of haemophilia A or B.
- the CRM or synthetic liver-specific promoter does not comprise both CR0077 (or a functional variant thereof) and CR0078 (or a functional variant thereof).
- a CRE, CRM or synthetic liver-specific promoter comprises either CR0077 or CR0078 (or a functional variant thereof)
- it does not comprise a further CRE selected from the group consisting of: CR0077 (or a functional variant thereof) and CR0078 (or a functional variant thereof).
- the CRM or synthetic liver-specific promoter does not comprise more than one CRE selected from the group consisting of: CR0077 (or a functional variant thereof) or CR0078 (or a functional variant thereof).
- the CRE, CRM or synthetic liver-specific promoter does not comprise CR0077 or a functional variant thereof or CR0078 or a functional variant thereof. In some embodiments of the invention, the CRM or synthetic liver-specific promoter does not comprise the sequence
- the CRM or synthetic liver-specific promoter comprises either CR0077 or CR0078 (or functional variants of any thereof), it does not contain SEQ ID NO: 284 or SEQ ID NO: 285 (or functional variants of any thereof).
- the CRM or synthetic liver-specific promoter contains not more than one of sequences V1 , V2, SEQ ID NO: 284 and SEQ ID NO: 285.
- the CRM or synthetic liver-specific promoter comprises not more than two of the following elements: LVR_CRE0080_PROC,
- the CRM or synthetic liver-specific promoter comprises not more than one of said elements, or functional variants of any thereof. In some embodiments of the invention, the CRM or synthetic liver-specific promoter does not comprise any of said elements, or functional variants of any thereof.
- LVR_CRE0080_PROC, and LVR_CRE0081_APOA1 are components of CR0077, and LVR_CRE0061_APOB, LVR_CRE0082_APOC4 are components of CR0078 (see Tables 7 and 8 for further details).
- the synthetic liver-specific promoter does not comprise the CRE0052 minimal promoter or a functional variant thereof.
- the CRM or synthetic liver-specific promoter does not comprise a sequence as disclosed in European patent application no 18207027.6.
- the functional variants of the any of the sequences in these disclaimers and embodiments discussed above can have, for example, a sequence having 60%, 70%, 80%, 90%, 95% or 99% identity to any of the reference sequences.
- CRE cis-regulatory element
- TFs i.e. they include TFBS.
- a single TF may bind to many CREs, and hence control the expression of many genes (pleiotropy).
- CREs are usually, but not always, located upstream of the transcription start site (TSS) of the gene that they regulate.
- TSS transcription start site
- Enhancers are CREs that enhance (i.e. upregulate) the transcription of genes that they are operably associated with, and can be found upstream, downstream, and even within the introns of the gene that they regulate. Multiple enhancers can act in a coordinated fashion to regulate transcription of one gene.
- “Silencers” in this context relates to CREs that bind TFs called repressors, which act to prevent or downregulate transcription of a gene.
- the term “silencer” can also refer to a region in the 3' untranslated region of messenger RNA, that bind proteins which suppress translation of that mRNA molecule, but this usage is distinct from its use in describing a CRE.
- the CREs of the present invention are liver- specific enhancer elements (often referred to as liver-specific CREs, or liver-specific CRE enhancers, or suchlike).
- the CRE is located 1500 nucleotides or less from the transcription start site (TSS), more preferably 1000 nucleotides or less from the TSS, more preferably 500 nucleotides or less from the TSS, and suitably 250, 200, 150, or 100 nucleotides or less from the TSS.
- CREs of the present invention are preferably comparatively short in length, preferably 250 nucleotides or less in length, for example they may be 200, 175, 150, 90, 80, 70, 60 or 50 nucleotides or less in length.
- the CREs of the present invention are typically provided in combination with an operably linked promoter element, which ca be a minimal promoter or proximal promoter; the CREs of the present invention enhance liver-specific activity of the promoter element.
- cis-regulatory module means a functional regulatory nucleic acid module, which usually comprises two or more CREs; in the present invention the CREs are typically liver-specific enhancers and thus the CRM is a synthetic liver-specific regulatory nucleic acid.
- a CRM typically comprises a plurality of liver- specific CREs.
- the multiple CREs within the CRM act together (e.g. additively or synergistically) to enhance the transcription of a gene that a promoter comprising the CRM is operably associated with.
- shuffle i.e. reorder
- invert i.e. reverse orientation
- alter spacing between CREs has been altered.
- promoter refers to a region of DNA that generally is located upstream of a nucleic acid sequence to be transcribed that is needed for transcription to occur, i.e. which initiates transcription. Promoters permit the proper activation or repression of transcription of a coding sequence under their control.
- a promoter typically contains specific sequences that are recognized and bound by plurality of TFs. TFs bind to the promoter sequences and result in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene. Many diverse promoters are known in the art.
- the term“synthetic promoter” as used herein relates to a promoter that does not occur in nature.
- it typically comprises a CRE and/or CRM of the present invention operably linked to a minimal (or core) promoter or liver-specific proximal promoter (promoter element).
- the CREs and/or CRMs of the present invention serve to enhance liver-specific transcription of a gene operably linked to the synthetic promoter.
- Parts of the synthetic promoter may be naturally occurring (e.g. the minimal promoter or one or more CREs in the promoter), but the synthetic promoter as a complete entity is not naturally occurring.
- minimal promoter refers to a short DNA segment which is inactive or largely inactive by itself, but can mediate transcription when combined with other transcription regulatory elements.
- Minimum promoter sequence can be derived from various different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters are discussed above, and include the dopamine beta- hydroxylase gene minimum promoter, cytomegalovirus (CMV) immediate early gene minimum promoter (CMV-MP), and the herpes thymidine kinase minimal promoter (MinTK).
- CMV cytomegalovirus
- CMV-MP immediate early gene minimum promoter
- MinTK herpes thymidine kinase minimal promoter
- a minimal promoter typically comprises the transcription start site (TSS) and elements directly upstream, a binding site for RNA polymerase II, and general transcription factor binding sites (often a TATA box).
- TSS transcription start site
- a minimal promoter may also include some elements downstream of the TSS, but these typically have little functionality absent additional regulatory elements.
- proximal promoter relates to the minimal promoter plus the proximal sequence upstream of the gene that tends to contain primary regulatory elements. It often extends approximately 250 base pairs upstream of the TSS, and includes specific TFBS.
- a proximal promoter may also include one or more regulatory elements downstream of the TSS, for example a UTR or an intron.
- the proximal promoter may suitably be a naturally occurring liver-specific proximal promoter that can be combined with one or more CREs or CRMs of the present invention.
- the proximal promoter can be synthetic.
- promoter element refers to either a minimal promoter or proximal promoter as defined above.
- a promoter element is typically combined with one or more CREs in order to provide a synthetic liver-specific promoter of the present invention.
- A“functional variant” of a CRE, CRM, promoter element, promoter or other nucleic acid construct in the context of the present invention is a variant of a reference sequence that retains the ability to function in the same way as the reference sequence, e.g. as a liver- specific CRE, liver-specific CRM or liver-specific promoter.
- Alternative terms for such functional variants include“biological equivalents” or“equivalents”.
- a functional variant of a CRE or CRM will contain TFBS for the most or all of same TFs as the reference CRE or CRM. It is preferred, but not essential, that the TFBS of a functional variant are in the same relative positions (i.e. order and general position) as the reference CRE or CRM. It is also preferred, but not essential, that the TFBS of a functional variant are in the same orientation as the reference sequence (it will be noted that TFBS can in some cases be present in reverse orientation, e.g.
- the TFBS of a functional variant are on the same strand as the reference sequence.
- the functional variant comprises TFBS for the same TFs, in the same order, the same position, in the same orientation and on the same strand as the reference sequence.
- sequences lying between TFBS referred to in some cases as spacer sequences, or suchlike
- spacer sequences, or suchlike are of less consequence to the function of the CRE or CRM.
- Such sequences can typically be varied considerably, and their lengths can be altered.
- the spacing i.e. the distance between adjacent TFBS
- the spacing is substantially the same (e.g.
- a functional variant of a CRE does not vary by more than 20%, preferably by not more than 10%, and more preferably it is approximately the same) in a functional variant as it is in the reference sequence. It will be apparent that in some cases a functional variant of a CRE can be present in the reverse orientation, e.g. it can be the reverse complement of a CRE as described above, or a variant thereof.
- Levels of sequence identity between a functional variant and the reference sequence can also be an indicator or retained functionality.
- High levels of sequence identity in the TFBS of the CRE is of generally higher importance than sequence identity in the spacer sequences (where there is little or no requirement for any conservation of sequence).
- sequence identity in the spacer sequences where there is little or no requirement for any conservation of sequence.
- the ability of one or more TFs to bind to a TFBS in a given functional variant can determined by any relevant means known in the art, including, but not limited to, electromobility shift assays (EMSA), binding assays, chromatin immunoprecipitation (ChIP), and ChlP- sequencing (ChIP-seq).
- EMSA electromobility shift assays
- ChoIP chromatin immunoprecipitation
- ChIP-seq ChlP- sequencing
- the ability of one or more TFs to bind a given functional variant is determined by EMSA.
- Methods of performing EMSA are well- known in the art. Suitable approaches are described in Sambrook et al. cited above. Many relevant articles describing this procedure are available, e.g. Heilman and Fried, Nat Protoc. 2007; 2(8): 1849-1861.
- Liver-specific or“liver-specific expression” refers to the ability of a cis-regulatory element, cis-regulatory module or promoter to enhance or drive expression of a gene in the liver (or in liver-derived cells) in a preferential or predominant manner as compared to other tissues (e.g. spleen, muscle, heart, lung, and brain). Expression of the gene can be in the form of mRNA or protein. In preferred embodiments, liver-specific expression is such that there is negligible expression in other (i.e. non-liver) tissues or cells, i.e. expression is highly liver- specific.
- any given CRM to be assessed can be operably linked to a minimal promoter (e.g. positioned upstream of CMV- MP) and the ability of the cis-regulatory element to drive liver-specific expression of a gene (typically a reporter gene) is measured.
- a minimal promoter e.g. positioned upstream of CMV- MP
- the ability of the cis-regulatory element to drive liver-specific expression of a gene typically a reporter gene
- a variant of a CRE can be substituted into a synthetic liver-specific promoter in place of a reference CRE, and the effects on liver- specific expression driven by said modified promoter can be determined and compared to the unmodified form.
- the ability of a CRM or promoter to drive liver-specific expression can be readily assessed by the skilled person (e.g. as described in the examples below).
- Expression levels of a gene driven by a variant of a reference promoter can be compared to the expression levels driven by the reference sequence.
- liver-specific expression levels driven by a variant promoter are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the expression levels driven by the reference promoter, it can be said that the variant remains functional.
- Suitable nucleic acid constructs and reporter assays to assess liver-specific expression enhancement can easily constructed, and the examples set out below give suitable methodologies.
- Liver-specificity can be identified wherein the expression of a gene (e.g. a therapeutic or reporter gene) occurs preferentially or predominantly in liver-derived cells.
- a gene e.g. a therapeutic or reporter gene
- Preferential or predominant expression can be defined, for example, where the level of expression is significantly greater in liver-derived cells than in other types of cells (i.e. non-liver-derived cells).
- expression in liver-derived cells is suitably at least 5-fold higher than in non-liver cells, preferably at least 10-fold higher than in non-liver cells, and it may be 50-fold higher or more in some cases.
- liver-specific expression can suitably be demonstrated via a comparison of expression levels in a hepatic cell line (e.g.
- liver-derived cell line such as Huh7 and/or HepG2 cells
- liver primary cells compared with expression levels in a kidney-derived cell line (e.g. HEK-293), a cervical tissue-derived cell line (e.g. HeLa) and/or a lung-derived cell line (e.g. A549).
- a kidney-derived cell line e.g. HEK-293
- a cervical tissue-derived cell line e.g. HeLa
- a lung-derived cell line e.g. A549
- the synthetic liver-specific promoters of the present invention preferably exhibit reduced expression in non-liver-derived cells, suitably in HEK-293, HeLa, and/or A549 cells when compared to a non-tissue specific promoter such as CMV-IE.
- the synthetic liver-specific promoters of the present invention preferably have an activity of 50% or less than the CMV- IE promoter in non-liver-derived cells (suitably in HEK-293, HeLa, and/or A549 cells), suitably 25% or less, 20% or less, 15% or less, 10% or less, 5% or less or 1% or less.
- the synthetic liver-specific promoters of the present invention are suitable for promoting gene expression at a level of at 50% or less than an LP1 promoter in non-liver-derived cells (e.g. HEK-293, HeLa, and/or A 549 cells).
- an LP1 promoter in non-liver-derived cells e.g. HEK-293, HeLa, and/or A 549 cells.
- the synthetic liver-specific promoters of the present invention are preferably suitable for promoting expression in the liver of a subject, e.g. driving liver-specific expression of a transgene, preferably a therapeutic transgene.
- Preferred synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific transgene expression and have an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter.
- the synthetic liver-specific promoters of the invention are suitable for promoting liver-specific transgene expression at a level at least 100% of the activity of the LP1 promoter, preferably 150%, 200%, 300% or 500% of the activity of the LP1 promoter.
- Such liver-specific expression is suitably determined in liver-derived cells, e.g. in Huh7, and/or HepG2 cells or primary liver cells (suitably primary human hepatocytes).
- Synthetic liver-specific promoters of the present invention may also be able to promote liver- specific expression of a gene at a level at least 150% compared to CMV-IE in liver-derived cells (e.g. Huh7 and/or HepG2 cells), preferably at least 200% CMV-IE promoter in liver- derived cells
- nucleic acid typically refers to an oligomer or polymer (preferably a linear polymer) of any length composed essentially of nucleotides.
- a nucleotide unit commonly includes a heterocyclic base, a sugar group, and at least one, e.g. one, two, or three, phosphate groups, including modified or substituted phosphate groups.
- Heterocyclic bases may include inter alia purine and pyrimidine bases such as adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) which are widespread in naturally-occurring nucleic acids, other naturally-occurring bases (e.g., xanthine, inosine, hypoxanthine) as well as chemically or biochemically modified (e.g., methylated), non-natural or derivatised bases.
- A adenine
- G guanine
- C cytosine
- T thymine
- U uracil
- other naturally-occurring bases e.g., xanthine, inosine, hypoxanthine
- chemically or biochemically modified e.g., methylated
- Sugar groups may include inter alia pentose (pentofuranose) groups such as preferably ribose and/or 2-deoxyribose common in naturally-occurring nucleic acids, or arabinose, 2- deoxyarabinose, threose or hexose sugar groups, as well as modified or substituted sugar groups.
- Nucleic acids as intended herein may include naturally occurring nucleotides, modified nucleotides or mixtures thereof.
- a modified nucleotide may include a modified heterocyclic base, a modified sugar moiety, a modified phosphate group or a combination thereof. Modifications of phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or some other useful property.
- nucleic acid further preferably encompasses DNA, RNA and DNA RNA hybrid molecules, specifically including hnRNA, pre-mRNA, mRNA, cDNA, genomic DNA, amplification products, oligonucleotides, and synthetic (e.g., chemically synthesised) DNA, RNA or DNA RNA hybrids.
- a nucleic acid can be naturally occurring, e.g., present in or isolated from nature; or can be non-naturally occurring, e.g., recombinant, i.e. , produced by recombinant DNA technology, and/or partly or entirely, chemically or biochemically synthesised.
- nucleic acid can be double-stranded, partly double stranded, or single-stranded. Where single- stranded, the nucleic acid can be the sense strand or the antisense strand. In addition, nucleic acid can be circular or linear.
- identity refers to the sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules, such as between two DNA molecules. Sequence alignments and determination of sequence identity can be done, e.g., using the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences” algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250).
- BLAST Basic Local Alignment Search Tool
- NCBI National Center for Biotechnology Information
- BLASTTM Basic Local Alignment Search Tool
- Bethesda, MD National Center for Biotechnology Information
- Blastn the "Blast 2 sequences" function of the BLASTTM (Blastn) program may be employed using the default parameters. Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identity when assessed by this method. Typically, the percentage sequence identity is calculated over the entire length of the sequence.
- a global optimal alignment is suitably found by the Needleman-Wunsch algorithm with the following scoring parameters: Match score: +2, Mismatch score: -3; Gap penalties: gap open 5, gap extension 2.
- the percentage identity of the resulting optimal global alignment is suitably calculated by the ratio of the number of aligned bases to the total length of the alignment, where the alignment length includes both matches and mismatches, multiplied by 100.
- hybridising means annealing to two at least partially complementary nucleotide sequences in a hybridization process.
- complementary nucleic acid molecules are generally thermally or chemically denatured to melt a double strand into two single strands and/or to remove hairpins or other secondary structures from single-stranded nucleic acids.
- the stringency of hybridisation is influenced by conditions such as temperature, salt concentration and hybridisation buffer composition.
- High stringency conditions for hybridisation include high temperature and/or low sodium/salt concentration (salts include sodium as for example in NaCI and Na-citrate) and/or the inclusion of formamide in the hybridisation buffer and/or lowering the
- SDS sodium dodecyl sulphate detergent
- dextran sulphate or polyethylene glycol promoting molecular crowding
- representative salt and temperature conditions for stringent hybridization are: 1 x SSC, 0.5% SDS at 65°C.
- SSC refers to a buffer used in nucleic acid hybridization solutions.
- One litre of a 20X (twenty times concentrate) stock SSC buffer solution (pH 7.0) contains 175.3 g sodium chloride and 88.2 g sodium citrate.
- TFBS transcription factor binding site
- A means that an A is always found in that position; [CT] stands for either C or T in that position; N stands for any base in that position; and ⁇ A ⁇ means any base except A is found in that position.
- Y represents any pyrimidine, and R indicates any purine.
- Synthetic in the present application means a nucleic acid molecule that does not occur in nature. Synthetic nucleic acid expression constructs of the present invention are produced artificially, typically by recombinant technologies. Such synthetic nucleic acids may contain naturally occurring sequences (e.g. promoter, enhancer, intron, and other such regulatory sequences), but these are present in a non-naturally occurring context. For example, a synthetic gene (or portion of a gene) typically contains one or more nucleic acid sequences that are not contiguous in nature (chimeric sequences), and/or may encompass
- “Complementary” or“complementarity”, as used herein, refers to the Watson-Crick base pairing of two nucleic acid sequences. For example, for the sequence 5 -AGT-3' binds to the complementary sequence 3 -TCA-5'. Complementarity between two nucleic acid sequences may be“partial”, in which only some of the bases bind to their complement, or it may be complete as when every base in the sequence binds to its complementary base. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridisation between nucleic acid strands.
- Transfection in the present application refers broadly to any process of deliberately introducing nucleic acids into cells, and covers introduction of viral and non-viral vectors, and includes transformation, transduction and like terms and processes. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors;
- transgene refers to an exogenous nucleic acid sequence.
- a transgene is a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding a desirable trait.
- the transgene encodes an antisense nucleic acid sequence, wherein expression of the antisense nucleic acid sequence inhibits expression of a target nucleic acid sequence.
- the transgene preferably encodes a therapeutic product, e.g. a protein.
- vector refers to a nucleic acid molecule, e.g. double-stranded DNA, which may have inserted into it a nucleic acid sequence according to the present invention.
- a vector is suitably used to transport an inserted nucleic acid molecule into a suitable host cell.
- a vector typically contains all of the necessary elements that permit transcribing the insert nucleic acid molecule, and, preferably, translating the transcript into a polypeptide.
- a vector typically contains all of the necessary elements such that, once the vector is in a host cell, the vector can replicate independently of, or coincidental with, the host chromosomal DNA; several copies of the vector and its inserted nucleic acid molecule may be generated.
- Vectors of the present invention can be episomal vectors (i.e., that do not integrate into the genome of a host cell), or can be vectors that integrate into the host cell genome.
- This definition includes both non-viral and viral vectors.
- Non-viral vectors include but are not limited to plasmid vectors (e.g. pMA-RQ, pUC vectors, bluescript vectors (pBS) and pBR322 or derivatives thereof that are devoid of bacterial sequences (minicircles)) transposons-based vectors (e.g. PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors), etc.
- plasmid vectors e.g. pMA-RQ, pUC vectors, bluescript vectors (pBS) and pBR322 or derivatives thereof that are devoid of bacterial sequences (minicircles)
- transposons-based vectors e.g. PiggyBac (PB) vectors or Sleeping Beauty (SB)
- viral vectors such as artificial chromosomes (bacteria (BAC), yeast (YAC), or human (HAC) may be used to accommodate larger inserts.
- Viral vectors are derived from viruses and include but are not limited to retroviral, lentiviral, adeno- associated viral, adenoviral, herpes viral, hepatitis viral vectors or the like.
- viral vectors are replication-deficient as they have lost the ability to propagate in a given cell since viral genes essential for replication have been eliminated from the viral vector.
- some viral vectors can also be adapted to replicate specifically in a given cell, such as e.g. a cancer cell, and are typically used to trigger the (cancer) cell-specific (onco)lysis.
- Virosomes are a non-limiting example of a vector that comprises both viral and non-viral elements, in particular they combine liposomes with an inactivated HIV or influenza virus (Yamada et al. , 2003).
- Another example encompasses viral vectors mixed with cationic lipids.
- operably linked refers to the arrangement of various nucleic acid elements relative to each other such that the elements are functionally connected and are able to interact with each other in the manner intended.
- Such elements may include, without limitation, a promoter, a CRE (e.g. enhancer or other regulatory element), a polyadenylation sequence, one or more introns and/or exons, and a coding sequence of a gene of interest to be expressed.
- the nucleic acid sequence elements when properly oriented or operably linked, act together to modulate the activity of one another, and ultimately may affect the level of expression of an expression product. By modulate is meant increasing, decreasing, or maintaining the level of activity of a particular element.
- each element relative to other elements may be expressed in terms of the 5' terminus and the 3' terminus of each element or their position upstream or downstream of another element or position (such as a TSS or promoter element), and the distance between any particular elements may be referenced by the number of intervening nucleotides, or base pairs, between the elements.
- operably linked implies functional activity, and is not necessarily related to a natural positional link.
- CREs when used in nucleic acid expression cassettes, CREs will typically be located immediately upstream of the promoter element (although this is generally the case, it should definitely not be interpreted as a limitation or exclusion of positions within the nucleic acid expression cassette), but this needs not be the case in vivo, e.g., a regulatory element sequence naturally occurring downstream of a gene whose transcription it affects is able to function in the same way when located upstream of the promoter.
- the regulatory or enhancing effect of the regulatory element can be position- independent.
- A“spacer sequence” or“spacer” as used herein is a nucleic acid sequence that separates two functional nucleic acid sequences (e.g. TFBS, CREs, CRMs, promoter element, etc.). It can have essentially any sequence, provided it does not prevent the functional nucleic acid sequence (e.g. cis-regulatory element) from functioning as desired (e.g. this could happen if it includes a silencer sequence, prevents binding of the desired transcription factor, or suchlike). Typically, it is non-functional, as in it is present only to space adjacent functional nucleic acid sequences from one another. In some embodiments, spacers may have a length of 75, 50, 40, 30, 30 or 10 nucleotides or fewer.
- pharmaceutically acceptable is consistent with the art and means compatible with the other ingredients of the pharmaceutical composition and not deleterious to the recipient thereof.
- “Therapeutically effective amount” and like phrases mean a dose or plasma concentration in a subject that provides the desired specific pharmacological effect, e.g. to express a therapeutic gene in the liver.
- a therapeutically effective amount may not always be effective in treating the conditions described herein, even though such dosage is deemed to be a therapeutically effective amount by those of skill in the art.
- the therapeutically effective amount may vary based on the route of administration and dosage form, the age and weight of the subject, and/or the disease or condition being treated.
- the terms“treatment” or“treating” refer to reducing, ameliorating or eliminating one or more signs, symptoms, or effects of a disease or condition.
- The“administration” of an agent to a subject includes any route of introducing or delivering to a subject the agent to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, intraocularly, ophthalmically, parenterally (intravenously, intramuscularly, intraperitoneally, or subcutaneously), or topically. Administration includes self-administration and the administration by another.
- the terms“individual,”“subject,” and“patient” are used interchangeably, and refer to any individual subject with a disease or condition in need of treatment.
- the subject may be a primate, preferably a human, or another mammal, such as a dog, cat, horse, pig, goat, or bovine, and the like.
- Cis-regulatory elements (CREs):
- p1@VTN underlined, represents the transcription start site (TSS) in CRE0006, as determined by Cap Analysis of Gene Expression (CAGE).
- TSS transcription start site
- CAGE Cap Analysis of Gene Expression
- NB CRE0006 can also be considered as synthetic liver-specific promoter due to its high level of liver-specific activity even absent additional CREs (SP0154).
- p1@AFP underlined, represents the TSS in CRE0059, as determined by CAGE.
- Table 28 - TFBS and TSS sequences in promoter element CRE0073 (TFBS shown in bold):
- Promoters were designed using Synpromics’ proprietary platform PROMPT® and synthesised by GeneArt®. This involved an analysis of liver gene expression datasets to identify candidate genes, including microarray and NGS datasets and scientific literature reviews to identify genes expressed to very high levels in liver cells. Cis-regulatory element selection and analysis was performed. TFBS within the CREs were identified.
- Synthetic promoters comprising the CRMs linked to minimal/proximal promoters as discussed herein, were cloned upstream of the luciferase reporter gene followed by SV40 late PolyA signal into a vector with a backbone having properties essentially identical to pUC19.
- DNA preparations were transfected into either Huh7 (a hepato-cellular carcinoma cell line), HeLa (an immortal cell line derived from cervical cancer) or HEK293 (human embryonic kidney cells) to asses transcriptional activity.
- Huh-7 cells were sourced from JCRB Cell Bank (JCRB0403), HeLa and HEK293 were sourced from ECACC cell bank. All cell lines were grown and maintained according to the cell banks’ recommendations.
- Luciferase activity was quantified using the Luciferase Reporter 1000 assay system (Promega #E4550) following manufacturer’s guidelines in 10 mI of lysate using 96 well flat bottom solid white Microplate FluoroNunc plates (ThermoFisher #236105) and luminescence quantified in a FLUOstar Omega plate reader (BMG Labtech) machine.
- CRE cis-regulatory elements
- LVR_127, LVR_131 , LVR_132 and LVR_133 promoters are highly-specific for activity in liver cell lines.
- the effects of these candidate enhancers were tested by adding them to the previously described LVR_127, LVR_131 , LVR_132 and LVR_133 liver-specific promoters.
- LVR_CRE0051_AMBP, SEQ ID NO: 3 (Rouet et al., 1992) was also adding them to the LVR_127, LVR_131 , LVR_132 and LVR_133 liver-specific promoters. These new promoters with the additional enhancer element were tested in Huh7 cells, as previously described for the LVR_127, LVR_131 , LVR_132 and LVR_133 liver-specific promoters.
- V1 or V2 enhancer significantly enhanced promoter activity of LVR_127, LVR_132 and LVR_133.
- the only exception observed was combining LVR_131 with V2.
- addition of V1 and V2 enhancer sequences retained promoter liver-specificity, which was confirmed when the promoters were counter- screened in HEK293 and HeLa cells (Fig. 5).
- SYNP_LVR_131 family of promoters (SEQ ID NO: 202, and SEQ ID NO: 230 to 232), and in particular SYNP_LVR_131_A1 (SEQ ID NO: 230), appears to be especially powerful.
- these promoters, and the CRMs that they comprise (SEQ ID NO: 130, and SEQ ID NO: 158 to 160, and especially SEQ ID NO: 158), and functional variants thereof, are of particular interest.
- all of the synthetic promoters according to the present invention appear to be both powerful and liver-specific.
- the CREs used in the specifically exemplified CRMs and promoters can be rearranged (for example, shuffled or inverted) and liver-specific promoter activity will be remained. Furthermore, it is expected that the sequence of the CREs, CRMs and promoters can be altered considerably while retaining liver-specific promoter activity.
- the TFBS within CREs should be preserved to the extent that the CRE is still able bind the same TFs, and preferably in the same order and approximate spacing as the reference CRE, in order to maintain function.
- the disclosed CREs i.e. enhancers themselves are self-contained regulatory units, and they can be moved, and/or orientation altered, without loss of function.
- CRE CRE
- CRM CRE
- promoter e.g. in absolute terms or in comparison to a reference CRE, CRM or promoter
- the CREs can be incorporated in other promoters in order to drive liver-specific expression (especially V1 and V2, which are believed to have particularly broad utility, but also the other CREs disclosed herein).
- CREs cis-regulatory elements
- liver-specific promoters i.e. all of the promoters set out in Table 32
- Huh7 cells Huh7 cells using the materials and methods essentially as described in Example 2.
- the activity of the liver-specific promoters was compared to the activity of the promoter TBG, as TBG was found to have higher and more consistent in vitro expression than LP1.
- the specificity of the liver-specific promoters for liver cells was also tested using non-liver HEK293 cells, using the materials and methods described in Example 2.
- the activity of the liver-specific promoters is expressed compared to the activity of CMV-IE (TBG and LP1 are liver-specific and thus not particularly active in HEK293 cells).
- ‘Relative activity’ in the graphs showing the specificity of the liver-specific promoters tested in HEK293 cells is the activity of the named promoter expressed as a ratio to the activity of CMV-IE, wherein 1 is the same activity as CMV-IE, more than 1 is higher activity compared to CMV-IE and lower than 1 is lower activity compared to CMV-IE.
- the average activity of the promoters according to this invention is shown in Fig. 8A, Fig. 9A, Fig. 10A and Fig. 11A.
- the mean relative activity of different experiments is shown for each promoter, wherein each experiment is itself a mean value of technical repeats.
- the error bar is a standard error of the mean. If no error bar is present, the data arises from a single experiment.
- ‘Relative activity’ in these graphs showing the activity of the liver-specific promoters tested in Huh7 cells is the activity of the named promoter expressed as a percentage of the activity of TBG (i.e. wherein 100 is the same activity as TBG, more than 100 is higher activity compared to TBG, and less than 100 is lower activity compared to TBG).
- TBG is an extremely powerful liver-specific promoter, and thus a promoter which shows expression which is less than TBG may still be extremely useful.
- promoters which are shorter than TBG, but which still demonstrate high levels of activity e.g. 15%, more preferably 25%, 50%, or 75% of the activity of TBG or higher are of particular interest.
- the synthetic liver-specific promoters of the present invention are all highly active in liver cells.
- Fig. 11 B shows the activity of SP0154, which contains only promoter element CRE0006.
- SP0154 has a comparatively low activity compared to TBG, but it is actually surprisingly high considering the lack of any additional CREs.
- an additional CRE is combined with the promoter element CRE0006, such as in promoters SP0155 (CRE0006 and
- Fig. 11 B also shows the activity of SP0235, which contains only promoter element
- CRE0040 is combined with a combination of multiple CREs, such as in promoter SP0252 (CRE0040 in combination with CRE0018 and CRE0077), the activity of the resultant synthetic promoters is increased around 40-fold, as shown in Fig. 11 A. This indicates that the individual CRE CRE0018 and the combination of CRE0018 and CRE0077 can provide considerable enhancement activity when added to a promoter element such as CRE0040.
- promoters SP0236 and SP0264 contain the same CRE and promoter element but SP0236 does not have a consensus Kozak sequence while SP0264 has a consensus Kozak sequence. The presence of a consensus Kozak sequence does not appear to impact the activity of a promoter.
- Fig. 10B and Fig. 11C The mean relative activity of different experiments is shown for each promoter. If no error bar is present, the results arise from a single experiment.
- the specificity of the majority, but not all, promoters has been tested experimentally. Many of the promoters according to the present invention have low expression in HEK293 cells, as indicated by activity in HEK293 cells of less than 50% of the activity of CMV-IE. The majority of the promoters have activity in HEK293 cells of less than 10% of the activity of CMV-IE which indicates that their activity is very liver specific.
- a large group of more than 200 promoters comprising various combinations of CREs and/or promoter elements expected to be useful to enhance liver-specific gene expression was assembled (this included all of the synthetic promoters used in Example 3 as well as additional liver specific promoters and liver-specific CRE). These promoters represent a large group of liver-specific promoters which is useful for assessing the contribution made to expression by various CREs. This large group of promoters is referred to in Figs12A and 12B as‘ALL’.
- liver-specific promoters comprising two or more operably linked“core” CREs selected from the group consisting of CRE0018, CRE0042, CRE0051 , CRE0058, CRE0065, CRE0066, CRE0068 and CRE0074 was found to correlate particularly well with high levels of activity.
- This preferred group of promoters is referred to in Figs 12A and 12B as‘Group T.
- liver-specific promoters comprising at least one of the abovementioned Core CREs operably linked to one of promoter elements CRE0059 and CRE0006 was found to correlate particularly well with high activity.
- This preferred group of promoters is referred to in Figs 12A and 12B as‘Group 2’. It should be noted that some promoters fall both within‘Group T and‘Group 2’ (i.e. where they contain two or more Core CREs and either CRE0059 or CRE0006).
- the average relative activity of‘Group T is around two times higher than the average relative activity of group‘ALL’.
- the average relative activity of‘Group 2’ is around three times higher than the average relative activity of group‘ALL’.
- the superior performance of‘Group T and‘Group 2’ may be due to the presence of one or more of the core CREs and the preferred promoter elements.
- group‘ALL’ the number of CRE present in each promoter was counted. Additionally, the number of core CRE present in each promoter was counted, wherein again the core CREs are the CRE0018, CRE0042, CRE0051 , CRE0058, CRE0065, CRE0066, CRE0068 and CRE0074.
- the mean activity of promoters which have a specific number of core CREs versus any CREs was calculated and is presented in Fig. 13A.
- This figure shows that the presence of the specified number of Core CREs in a promoter is associated with increased activity compared to promoters with the specified number of CREs, wherein the CRE is any CRE. This is not because of difference in size between the group of promoters which contain the specified number of core CREs and the group of promoters which have the specified number of any CRE as comparison of the activity over size shows a similar trend, as indicated in Fig. 13B.
- the activity of the resultant synthetic promoter is even higher as can be seen from the higher mean relative activity of‘Group 2’ (promoters comprising at least one Core CRE and a preferred promoter element) compared to‘Group T (promoters comprising at least two Core CREs).
- the presence of various subset of CREs within the group of core CREs in a promoter is also associated with high levels of activity.
- the presence of the abovementioned combinations of CREs are associated with higher activity. This is not due to differences in size between the groups as normalisation of the activity over size (in base pairs) reveals similar superior performance of the promoters comprising the abovementioned combinations of CREs.
- the activity of a subset of the promoters according to this invention were tested in vivo.
- the synthetic promoters included in this study were LVR-239 (SP0239), LVR-244 (SP0244) and the positive control LP1.
- the reporter gene used was fLUC-T2A-EGFP, i.e. fLUC (firefly Luciferase) fused to mEGFP (mutant green fluorescent protein) via T2A signal (two-way self cleaving peptides).
- pAAV_SYNP_Luc-T2A-GFP destination vector is derived from pAAV ZsGreenl (purchased from Clontech) in which the ZsGreenl reporter was replaced by the Luc-T2A-GFP dual reporter. All DNA plasmids were prepared using GIAGEN Plasmid Mega Kit (Giagen#12181 , Germany) according to manufacturer instructions.
- HEK293T cells were cultured in Culture dish, Tissue culture treated, 145mm (Greiner Bio- One Ltd# 639160, UK) in Dulbecco’s modified Eagle’s medium, high glucose, GlutaMAX supplement (Gibco (Life Technologies)# 61965-059, UK) supplemented with 10% (v/v) fetal bovine serum (Sigma# F7524.UK), and incubated at 37°C and 5% CO2.
- Other reagents for cell culture were purchased from Invitrogen-UK and plasticware form Life Technologies.
- HEK293T cells were used as a producer cells where they were co-transfected with plasmids wherein the reporter gene was controlled by different promoters alongside a plasmid encoding the helper functions to allow virus propagation (pDG9).
- HEK293T cells were transfected using Polyethylenimine (PEI) (Sigma-Aldrich# 764604, UK) at stock
- the number of vector genomes was determined by qPCR titration to target LUC cassettes with forward primer (ACGCTGGGCTACTTGATC - SEQ ID NO: 265), reverse primer (CG AGG AGG AGCT ATT CTT G - SEQ ID NO: 266) and probe (TTTCGGGTCGTGCTCATG - SEQ ID NO: 267) following manufacturer instructions of Luna® Universal qPCR Master Mix (NEB# M3003, UK) in QuantStudioTM 3 System Real-Time PCR (Thermo Fisher Scientific, UK) and data analysed by QuantStudio design and analysis software V1.4.1.
- mice Outbred 6 weeks old CD1 male mice were purchased from Charles River-UK. They were kept in quarantine for one week and then moved to their closed ventilation cages and maintained in minimal-disease facilities. They were caged at 5 mice/cage and normalized into their weights with food and water ad libitum. Newly housed mice were given another week for acclimatization before carrying out any experiments. This study was conducted under statutory Home Office recommendation; regulatory, ethics, and licensing procedures; and the Animals (Scientific Procedures) Act 1986 and following the institutional guidelines at University College London.
- AAV was administered to 8-week-old young adult male CD1 mice anaesthetised with 2%- 4% isoflurane supplied in medical air (21% oxygen) (Abbotts Laboratories, UK) in warm chamber (Thermo Fisher Scientific, UK).
- the mice were injected intravenously into lateral tail vein using an Insulin syringe: 27 G 1/2 in., 1.0 ml (Fisher Scientific, UK).
- Each mouse is injected with AAV vectors dose of 8E+10 AAV viral genome per mouse in a final volume of 200 pi of physiological saline solution. The mice were then allowed to return to normal temperature before placing them back into their cages.
- mice were subjected to weekly whole-body bioluminescence imaging. Where appropriate, mice were anaesthetised with 2%-4% isoflurane supplied in medical air (21 % oxygen) and received an intraperitoneal injection of 300 mI of 15 mg/mL of D-luciferin potassium salt (Syd Labs # MB000102, US) using an Insulin syringe (Fisher Scientific, UK). D-luciferin stock was prepared in physiological saline (Gibco #14190-094, UK). Mice were imaged after 5 minutes using a cooled charged-coupled device camera, (I VIS Lumina II machine, Perkin Elmer, UK) for between 1 second and 10 seconds. The regions of interest (ROI) were measured using I VIS Lumina Living image 4.5.5 (Perkin Elmer) and expressed as photons per second per centimetre squared per steradian (photons/second/cm 2 /sr). Data
- Fig. 13B The results of this study are shown in Fig. 13B. The results are expressed as the mean of the luciferase bioluminescence intensity, total flux (in photons per second), for all tested animals in each group. Error bars are standard error of the mean.
- This group is a negative control and indicates that no luciferase bioluminescence is detected if no luciferase operably linked to a promoter is injected.
- LPT luciferase
- This group is a positive control and indicates that luciferase is expressed under the control of the LP1 promoter and can be detected.
- mice were injected with a construct comprising luciferase under operably linked to two promoters.
- luciferase is operably linked to the SP0244 promoter.
- luciferase is operably linked to the SP0239 promoter.
- groups‘SP0244’ and‘SP0239’ have higher bioluminescence intensity than group‘LPT. Promoters SP0244 and SP0239 show high activity in vivo and their activity is higher than the activity of LPT
- Example 3 This experiment demonstrates that the in vitro results obtained in Example 3 corelate with results obtained in vivo. Furthermore, consistent with the data presented in Example 3 indicating that there is a relationship between the presence of core CREs and preferred promoter elements (CRE0006 an CRE0059), promoter SP0239, which shows high expression in vivo, is a member‘Group T as discussed above and comprises 5 Core CREs. Promoter SP0244, which also shows high expression, is a member of both‘Group T and ‘Group 2’, which comprises 3 Core CREs and a preferred promoter element, namely CRE0006. This data indicates that the presence of Core CREs and the combination of Core CREs with a preferred promoter element is not only associated with high expression in vitro but also in vivo. A range of liver-specific promoters with varying strength is provided by this invention which can be very useful to provide the desired level of liver-specific expression in a therapeutic setting.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Cell Biology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2021527948A JP7489161B2 (ja) | 2018-11-19 | 2019-11-19 | 肝臓特異的調節性核酸配列 |
| AU2019382955A AU2019382955B2 (en) | 2018-11-19 | 2019-11-19 | Liver-specific regulatory nucleic acid sequences |
| US17/295,208 US12590129B2 (en) | 2018-11-19 | 2019-11-19 | Liver-specific regulatory nucleic acid sequences |
| EP19809587.9A EP3883951A1 (en) | 2018-11-19 | 2019-11-19 | Liver-specific regulatory nucleic acid sequences |
| CN201980089303.6A CN113454104A (zh) | 2018-11-19 | 2019-11-19 | 肝特异性调节性核酸序列 |
| CA3120253A CA3120253A1 (en) | 2018-11-19 | 2019-11-19 | Liver-specific regulatory nucleic acid sequences |
| IL283219A IL283219A (en) | 2018-11-19 | 2021-05-16 | Liver-specific regulatory nucleic acid sequences |
| JP2024075266A JP2024096349A (ja) | 2018-11-19 | 2024-05-07 | 肝臓特異的調節性核酸配列 |
| AU2025287323A AU2025287323A1 (en) | 2018-11-19 | 2025-12-24 | Liver-Specific Regulatory Nucleic Acid Sequences |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1818816.9 | 2018-11-19 | ||
| GBGB1818816.9A GB201818816D0 (en) | 2018-11-19 | 2018-11-19 | Regulatory nucleic acid sequences |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020104782A1 true WO2020104782A1 (en) | 2020-05-28 |
Family
ID=64740036
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2019/053267 Ceased WO2020104782A1 (en) | 2018-11-19 | 2019-11-19 | Liver-Specific Regulatory Nucleic Acid Sequences |
| PCT/GB2019/053268 Ceased WO2020104783A1 (en) | 2018-11-19 | 2019-11-19 | Regulatory nucleic acid sequences |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2019/053268 Ceased WO2020104783A1 (en) | 2018-11-19 | 2019-11-19 | Regulatory nucleic acid sequences |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US12590129B2 (https=) |
| EP (2) | EP3883951A1 (https=) |
| JP (2) | JP7489161B2 (https=) |
| CN (1) | CN113454104A (https=) |
| AU (2) | AU2019382955B2 (https=) |
| CA (1) | CA3120253A1 (https=) |
| GB (1) | GB201818816D0 (https=) |
| IL (1) | IL283219A (https=) |
| WO (2) | WO2020104782A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022157630A1 (en) | 2021-01-20 | 2022-07-28 | Curogen Technology Co., Ltd. | Ssu72 protein or polynucleotide for treating and diagnosing liver cancer |
| WO2022162568A1 (en) | 2021-01-29 | 2022-08-04 | Curogen Technology Co., Ltd. | Pharmaceutical composition for treating liver diseases using ssu72 |
| WO2023008925A1 (ko) * | 2021-07-29 | 2023-02-02 | 주식회사 리보퓨틱스 | 융합 프로모터, 이를 포함하는 재조합 벡터 및 이를 이용하는 간암 치료용 조성물 |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN121358865A (zh) * | 2023-04-20 | 2026-01-16 | 阿斯克生物公司 | 肝脏特异性调控核酸序列 |
| CN116555266B (zh) * | 2023-06-09 | 2024-11-12 | 呈诺再生医学科技(北京)有限公司 | 肝脏特异性表达的重组启动子和载体及其在肝脏相关疾病治疗中的应用 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| WO1995011308A1 (en) | 1993-10-18 | 1995-04-27 | Amgen Inc. | Mammal with enhanced liver expression of a transgene |
| WO2001098482A2 (en) | 2000-06-20 | 2001-12-27 | Board Of Trustees Of The Leland Stanford Junior University | Liver-specific gene expression cassettes, and methods of use |
| WO2009130208A1 (en) | 2008-04-22 | 2009-10-29 | Vib Vzw | Liver-specific nucleic acid regulatory elements and methods and use thereof |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5721096A (en) * | 1991-01-24 | 1998-02-24 | Children's Medical Center Corporation | Methods of screening for compounds with ability to alter apolipoprotein AI gene expression |
| US5578444A (en) | 1991-06-27 | 1996-11-26 | Genelabs Technologies, Inc. | Sequence-directed DNA-binding molecules compositions and methods |
| WO1998009524A1 (en) * | 1996-09-06 | 1998-03-12 | Chiron Corporation | Methods and compositions for liver specific delivery of therapeutic molecules using recombinant aav vectors |
| ATE437221T1 (de) | 2001-05-14 | 2009-08-15 | Gbp Ip Llc | Lentivirale vektoren kodierend für gerinnungsfaktoren für die gentherapie |
| CN102634515B (zh) * | 2008-02-14 | 2013-11-06 | 财团法人牧岩生命工学研究所 | 适于表达用于基因治疗的编码序列的表达载体 |
| CN102628041B (zh) * | 2008-02-14 | 2013-09-11 | 财团法人牧岩生命工学研究所 | 适于表达用于基因治疗的编码序列的表达载体 |
| US8815779B2 (en) * | 2009-09-16 | 2014-08-26 | SwitchGear Genomics, Inc. | Transcription biomarkers of biological responses and methods |
| EP2479278A1 (en) * | 2011-01-25 | 2012-07-25 | Synpromics Ltd. | Method for the construction of specific promoters |
| US11007280B2 (en) * | 2015-03-17 | 2021-05-18 | Vrije Universiteit Brussel | Optimized liver-specific expression systems for FVIII and FIX |
| MX2018012537A (es) * | 2016-04-15 | 2019-02-25 | Univ Pennsylvania | Terapia de genes para tratar hemofilia a. |
| WO2018144709A2 (en) * | 2017-02-01 | 2018-08-09 | The Trustees Of The University Of Pennsylvania | Gene therapy for treating citrullenemia |
| EP3630160A1 (en) * | 2017-05-24 | 2020-04-08 | Universitat Autònoma De Barcelona | Viral expression construct comprising a fibroblast growth factor 21 (fgf21) coding sequence |
| JP2020533971A (ja) * | 2017-08-28 | 2020-11-26 | アルター・バイオサイエンス・コーポレーション | Il−15をベースとするil−7及びil−21への融合物 |
| CN108588097B (zh) * | 2018-04-28 | 2021-07-13 | 北京锦篮基因科技有限公司 | 改造后的hbv基因组和相关组合物及其应用 |
-
2018
- 2018-11-19 GB GBGB1818816.9A patent/GB201818816D0/en not_active Ceased
-
2019
- 2019-11-19 AU AU2019382955A patent/AU2019382955B2/en active Active
- 2019-11-19 CN CN201980089303.6A patent/CN113454104A/zh active Pending
- 2019-11-19 EP EP19809587.9A patent/EP3883951A1/en active Pending
- 2019-11-19 WO PCT/GB2019/053267 patent/WO2020104782A1/en not_active Ceased
- 2019-11-19 US US17/295,208 patent/US12590129B2/en active Active
- 2019-11-19 CA CA3120253A patent/CA3120253A1/en active Pending
- 2019-11-19 EP EP19809588.7A patent/EP3883952A1/en active Pending
- 2019-11-19 WO PCT/GB2019/053268 patent/WO2020104783A1/en not_active Ceased
- 2019-11-19 JP JP2021527948A patent/JP7489161B2/ja active Active
- 2019-11-19 US US17/295,210 patent/US20210388347A1/en active Pending
-
2021
- 2021-05-16 IL IL283219A patent/IL283219A/en unknown
-
2024
- 2024-05-07 JP JP2024075266A patent/JP2024096349A/ja active Pending
-
2025
- 2025-12-24 AU AU2025287323A patent/AU2025287323A1/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683195B1 (https=) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| WO1995011308A1 (en) | 1993-10-18 | 1995-04-27 | Amgen Inc. | Mammal with enhanced liver expression of a transgene |
| WO2001098482A2 (en) | 2000-06-20 | 2001-12-27 | Board Of Trustees Of The Leland Stanford Junior University | Liver-specific gene expression cassettes, and methods of use |
| WO2009130208A1 (en) | 2008-04-22 | 2009-10-29 | Vib Vzw | Liver-specific nucleic acid regulatory elements and methods and use thereof |
Non-Patent Citations (27)
| Title |
|---|
| "Methods in Enzymology", vol. 154, 155, 185, ACADEMIC PRESS, INC., article "Gene Expression Technology" |
| ALAMCOOK: "Reporter Genes: Application to the Study of Mammalian Gene Transcription", ANALYTICAL BIOCHEMISTRY, vol. 188, 1990, pages 245 - 254 |
| ALTSCHUL ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 10 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10 |
| AUSUBEL: "Current Protocols in Molecular Biology", 2000, WILEY AND SON INC, LIBRARY OF CONGRESS |
| CORPET ET AL., NUCLEIC ACIDS RES., vol. 16, 1988, pages 10881 - 90 |
| DATABASE Geneseq [online] 23 April 2002 (2002-04-23), "Wild type hepatitis B virus (HBV) X promoter.", XP002797161, retrieved from EBI accession no. GSN:ABK29876 Database accession no. ABK29876 * |
| DATABASE Geneseq [online] 26 July 2018 (2018-07-26), "HBV enhancer DNA sequence (EnhI).", XP002797160, retrieved from EBI accession no. GSN:BFJ18268 Database accession no. BFJ18268 * |
| FEIGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7413 - 7 |
| FRALEY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 4803 - 7 |
| FROMM ET AL., NATURE, vol. I-IV, 1986, pages 791 - 3 |
| HELLMANFRIED, NAT PROTOC., vol. 2, no. 8, 2007, pages 1849 - 1861 |
| HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151 - 3 |
| HIGGINSSHARP, GENE, vol. 73, 1988, pages 237 - 44 |
| HUANG ET AL., COMP. APPL. BIOSCI., vol. 8, 1992, pages 155 - 65 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 |
| MUELLER ET AL., CELL, vol. 15, 1978, pages 579 - 85 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NISHA NAIR ET AL: "Computationally designed liver-specific transcriptional modules and hyperactive factor IX improve hepatic gene therapy", BLOOD, 15 May 2014 (2014-05-15), pages 3195 - 3199, XP055281944, Retrieved from the Internet <URL:http://www.bloodjournal.org/content/123/20/3195.full.pdf> [retrieved on 20160620], DOI: 10.1182/blood-2013-10-534032 * |
| PEARSON ET AL., METHODS MOL. BIOL., vol. 24, 1994, pages 307 - 31 |
| PEARSONLIPMAN, PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 2444 |
| PERBAL, A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984 |
| PHILIPPE ROUET ET AL: "A Potent Enhancer Made of Clustered Liver-specific Elements in the Transcription Control Sequences of Human al-Microglobulin/Bikunin Gene", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, 15 October 1992 (1992-10-15), pages 20765 - 20773, XP055281598 * |
| SAMBROOK ET AL.: "Molecular Cloning: a laboratory manual", 2001, COLD SPRING HARBOR LABORATORY PRESS, CSH |
| SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| TATIANA ET AL., FEMS MICROBIOL. LETT., vol. 174, 1999, pages 247 - 50 |
| TATUSOVAMADDEN, FEMS MICROBIOL LETT, vol. 174, 1999, pages 247 - 250 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022157630A1 (en) | 2021-01-20 | 2022-07-28 | Curogen Technology Co., Ltd. | Ssu72 protein or polynucleotide for treating and diagnosing liver cancer |
| WO2022162568A1 (en) | 2021-01-29 | 2022-08-04 | Curogen Technology Co., Ltd. | Pharmaceutical composition for treating liver diseases using ssu72 |
| WO2023008925A1 (ko) * | 2021-07-29 | 2023-02-02 | 주식회사 리보퓨틱스 | 융합 프로모터, 이를 포함하는 재조합 벡터 및 이를 이용하는 간암 치료용 조성물 |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2019382955A1 (en) | 2021-06-10 |
| EP3883952A1 (en) | 2021-09-29 |
| US20210388347A1 (en) | 2021-12-16 |
| CA3120253A1 (en) | 2020-05-28 |
| CN113454104A (zh) | 2021-09-28 |
| EP3883951A1 (en) | 2021-09-29 |
| AU2025287323A1 (en) | 2026-03-26 |
| AU2019382955B2 (en) | 2025-09-25 |
| JP2022507828A (ja) | 2022-01-18 |
| US12590129B2 (en) | 2026-03-31 |
| WO2020104783A1 (en) | 2020-05-28 |
| JP7489161B2 (ja) | 2024-05-23 |
| JP2024096349A (ja) | 2024-07-12 |
| US20220009981A1 (en) | 2022-01-13 |
| IL283219A (en) | 2021-06-30 |
| GB201818816D0 (en) | 2019-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12590129B2 (en) | Liver-specific regulatory nucleic acid sequences | |
| US20240110179A1 (en) | Systems and methods for treating alpha 1-antitrypsin (a1at) deficiency | |
| US11608503B2 (en) | RNA targeting of mutations via suppressor tRNAs and deaminases | |
| JP2025118716A (ja) | ハプロ不全のための遺伝子治療 | |
| JP6718859B2 (ja) | 肝特異的核酸調節要素ならびにその方法および用途 | |
| TW202028466A (zh) | 編輯RNAs的方法以及組成物 | |
| TW202027797A (zh) | 用於治療α-1抗胰蛋白酶不足的組成物及方法 | |
| CA3045335A1 (en) | Crispr-based treatment of friedreich ataxia | |
| US12559757B2 (en) | Regulation of gene expression through aptamer-modulated polyadenylation | |
| US12472269B2 (en) | Liver-specific inducible promoters and methods of use thereof | |
| JP7250031B2 (ja) | 新規ウイルスベクターおよびその製造方法と使用方法 | |
| AU2024258634A1 (en) | Liver-specific regulatory nucleic acid sequences |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19809587 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3120253 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021527948 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2019382955 Country of ref document: AU Date of ref document: 20191119 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019809587 Country of ref document: EP Effective date: 20210621 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17295208 Country of ref document: US |