WO2020077091A1 - Kir 7.1 gene therapy vectors and methods of using the same - Google Patents

Kir 7.1 gene therapy vectors and methods of using the same Download PDF

Info

Publication number
WO2020077091A1
WO2020077091A1 PCT/US2019/055635 US2019055635W WO2020077091A1 WO 2020077091 A1 WO2020077091 A1 WO 2020077091A1 US 2019055635 W US2019055635 W US 2019055635W WO 2020077091 A1 WO2020077091 A1 WO 2020077091A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
gene therapy
kir7
cells
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/055635
Other languages
English (en)
French (fr)
Inventor
Bikash PATTNAIK
Pawan SHAHI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wisconsin Alumni Research Foundation
Original Assignee
Wisconsin Alumni Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wisconsin Alumni Research Foundation filed Critical Wisconsin Alumni Research Foundation
Priority to CA3115782A priority Critical patent/CA3115782A1/en
Priority to EP19870458.7A priority patent/EP3864160A4/en
Priority to US17/284,408 priority patent/US20210348196A1/en
Priority to AU2019357602A priority patent/AU2019357602A1/en
Priority to CN201980081804.XA priority patent/CN113227386A/zh
Priority to JP2021519805A priority patent/JP2022512667A/ja
Publication of WO2020077091A1 publication Critical patent/WO2020077091A1/en
Priority to IL282181A priority patent/IL282181A/en
Priority to JOP/2021/0067A priority patent/JOP20210067A1/ar
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/035Animal model for multifactorial diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15071Demonstrated in vivo effect
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16071Demonstrated in vivo effect
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect

Definitions

  • Leber congenital amaurosis is an inherited pediatric form of blindness characterized by severe loss of vision at birth. Children with LCA may also exhibit a variety of other abnormalities including roving eye movements (nystagmus), deep-set eyes, sensitivity to bright light, and central nervous system abnormalities. Typically, within an infant’s first few months of life, parents notice a lack of visual responsiveness and nystagmus. Although the retinas of infants with LCA appear normal, little (if any) activity is detected in the retina by electroretinography (ERG). By early adolescence, however, various changes in the appearance of retina may be detected including pigmentary changes in the retinal pigment epithelium (RPE) and the presence of constricted blood vessels.
  • RPE retinal pigment epithelium
  • LCA is typically passed through families in an autosomal recessive pattern of inheritance. Mutations in at least 21 genes that are expressed in the outer retinal photoreceptors and retinal pigment epithelium (RPE) have been associated with LCA. Within the last decade, autosomal recessive mutations in the human KCNJ13 gene (603203 on chromosome locus 2q37.l) have been identified in patients with a specific form of LCA known as LCA16. To date, LCA16 pathogenic allelic variants include c.
  • l58G>A p.Trp53Ter
  • c.359T>C p.Isol20Thr
  • c.458C>T p.Thrl53Iso
  • c.496C>T p.Argl66Ter
  • c.722T>C p.Leu24lPro
  • the compound heterozygous KCNJ13 mutations C.314 G>T p.Serl05Iso
  • c.655C>T p.G2l9Ter
  • An autosomal dominant KCNJ13 mutation, c.484C>T causes early-onset blindness called snowflake vitreoretinal degeneration (SVD OMIM-193230).
  • the human KCNJ13 gene encodes an inward rectifying potassium channel - Kir7. l.
  • the Kir7.l protein is expressed in several human tissues including the cell apical processes of RPE, in which it modulates retinal function and health. The role of the Kir7.l channel in other organs remains to be elucidated.
  • Kir7. l Although the role of Kir7. l is beginning to be understood in conditions such as LCA16, there are no approved therapies to treat channelopathies or conditions associated with insufficient expression or function of the Kir7. l protein. Accordingly, there is a need in the art for new therapies for treating such conditions.
  • gene therapy vectors are provided.
  • the gene therapy vectors may include a promoter operably connected to a polynucleotide encoding a Kir7.l polypeptide.
  • the present invention relates to therapeutic compositions.
  • the therapeutic compositions may include any of the gene therapy vectors described herein and a pharmaceutically-acceptable carrier.
  • methods of treating a subject having a condition associated with insufficient expression or function of a Kir7.l polypeptide are provided.
  • the methods may include administering a therapeutically effective amount of any one of the gene therapy vectors described herein or any one of the therapeutic compositions described herein to the subject.
  • FIGS. 1A-1N show patient-derived iPSC-RPE with the LCA16 phenotype.
  • FIG. 1A Illustration of a mature RPE cell (bright-field image) with the normal TGG sequence (SEQ ID NO: 19). Family pedigree indicating sample origin.
  • FIG. IB Bright-field image of mature RPE cells derived from an LCA16 proband with the TAG sequence.
  • SEQ ID NO:20 SEQ ID NO:20
  • FIG. 1C Normal karyotype in the patient sample with no clonal abnormalities.
  • FIG. ID Analysis of the Nhel digestion product from the control, LCA16, and wild-type iPSC-RPE lines and human fetal RPE cells.
  • the full-length Kir7.l sequence is 1083 bp in length, and the digested products are 925 and 158 bp in length.
  • FIG. IE RPE cell-specific gene expression in iPSC-RPE cells.
  • FIG. IF Electron micrograph of a representative LCA16 iPSC-RPE cell.
  • FIG. 1G Comparison of the average mitochondria (Mit) count within 10 pm of the cell.
  • FIG. 1H Evaluation of the average length of RPE apical (AP) processes.
  • FIG. II Immunofluorescence localization of Kir7.l (red), ZO-l (green) and DAPI (blue) in control iPSC-RPE cells.
  • FIG. 1J Localization of Kir7. l (red), ZO-l (green) and DAPI (blue) in LCA16 iPSC-RPE.
  • FIG. IK Western blot results showing the expression of RPE cell-specific proteins in both tissue samples. ETsing a C terminal-specific antibody against Kir7. l, we detected Kir7.l protein in whole-cell lysates from the control iPSC-RPE but not in those from the LCA16 iPSC-RPE. Phagosomes (red) localization within control iPSC-RPE (FIG.
  • FIG. IN Plot of the average phagosome count within a fixed 200 pm 2 area in the control and diseased iPSC-RPE cells after 4 hr of feeding and a subsequent 48-hr digestion period or after 1 day of feeding followed by 6 days of digestion.
  • FIGS. 2A-2N show a putative Kir7.l loss-of-function cure through nonsense mutation suppression or gene augmentation.
  • FIG. 2A Plot of the average current-voltage (I/V) curve for Kir7.l currents using normal external K+ (black) or high external Rb+ (light blue) in control iPSC-RPE cells.
  • FIG. 2B An average I/V curve using normal K+ (red) and high Rb+ (light blue) in LCA16 iPSC-RPE cells.
  • FIG. 2C Average plot of an inward current amplitude measured at -150 mV. Color representation as shown in a and b.
  • FIG. 2D Comparison of the average membrane potential of the control (black) cells to depolarized LCA16 (red) RPE cells.
  • FIG. 2E Average I/V relationship before (red) and after (dark blue) treatment with NB84. The current measured in Rb+ is shown as a light-blue trace. Evaluation of the average inward current measured at -150 mV (FIG. 2F) and membrane potential (FIG. 2G) to demonstrate the effect of NB84.
  • FIG. 2H A GFP-fused protein was precipitated using anti-GFP antibody as a trap, and silver staining shows the purified component bands for the full-length Kir7.l and W53X proteins. The GFP control sample shows a smaller protein product.
  • FIG. 21 Western blot analysis of cell lysates shows the respective bands when probed with a GFP-specific antibody. A partial restoration of the full-length protein product is observed after NB84 treatment.
  • FIG. 2J Plot of the average I/V curve for Kir7.l currents measured in GFP-positive cells expressing a normal copy of the human Kir7. l clone. Both K+ (green) and Rb+ (light blue) traces are shown. Average plot of the current amplitudes (FIG. 2K) measured at -150 mV and membrane potential (FIG. 2L) to show rescue after gene augmentation.
  • FIG. 2M Cultured LCA16 iPSC-RPE showing wild-type Kir7.l (green), ZO-l (red) and DAPI (blue) proteins. Z-stack planes are shown in the lower and side panels.
  • FIG. 2N Western blot analysis of Kir7. l protein expression in LCA16 iPSC-RPE cells detected after gene augmentation by using anti-GFP antibody.
  • FIGS. 3A-3D show the phenotype of patient-derived iPSC-RPE cells. Comparison of electron micrograph of a control hiPSC-RPE cell (FIG. 3A) and an LCA16 hiPSC-RPE cell (FIG. 3B) showing normal columnar morphology with basal infoldings, large nuclei, mitochondria (m), melanosomes and intact apical membrane with extending processes (ap). Images of live control hiPSC-RPE (FIG. 3C) and patient-derived hiPSC-RPE (FIG. 3D) cells in x-y-z dimension showing POS (red) and nuclei (blue) imaged 6 days after feeding cells for 1 day with fluorescent-labeled bovine POS. More undigested red fluorescent POS particles are visible in LCA16 hiPSC-RPE cells.
  • FIGS. 4A-4D show that a subpopulation of hiPSC-RPE show rescue in membrane potential but not current amplitude.
  • FIG. 4A EV plot of average current response in a subgroup of LCA16 hiPSC-RPE cells in normal K+ Ringer’s and high Rb+ Ringer’s solution after treatment of cells with 100 mM NB84.
  • FIG. 4B I/V plot showing K+ and Rb+ current response in LCA16 hiPSC-RPE after treatment with 500 pM NB84.
  • FIG. 4C Average plot of membrane potential showing rescue of membrane potential to control levels after treatment of LCA16 hiPSC-RPE with 100 or 500 pM NB84.
  • FIG. 4D Current amplitude plot clearly demonstrating no rescue in current amplitude after treatment with either 100 or 500 pM NB84.
  • FIGS. 5A-5D show read-through of Trp53Ter ectopically expressed in CHO cells.
  • transduced CHO cells showed inwardly rectifying Kir7.l current activated by Rb+ only after treatment with NB84.
  • FIG. 5A I/V plot of cells showing K+ (black) and Rb+ (red) current after treatment with NB84 showing recovery of both current amplitude and membrane potential.
  • FIG. 5B A group of NB84 treated cells showing somewhat linear I/V plot for K+ (black) and Rb+ (red) illustrating recovery of only membrane potential but not current amplitude. Comparison of average recovery of both current amplitude (FIG. 5C) and membrane potential (FIG.
  • FIGS. 6A-6D show determination of the extent of wildtype protein expression required for functional rescue. We were particularly interested in quantitating how much gene augmentation/correction is required to restore channel function. We expressed either Trp53Ter or wild type Kir7.l protein alone or in various combinations in CHO cells.
  • FIG. 6A Current recordings are shown as I/V plots.
  • FIG. 6B On an expanded scale for x-axis, resting membrane potential shows negative shift with wild type protein making up only 20% of the protein expression.
  • FIG. 6C Average plot of either normalized current amplitude (filled circles) or membrane potential (grey bar) as a function of increasing wildtype protein expression. Solid line is a best fit for distribution using equation shown in FIG. 6D. Half-maximum current was obtained with about 26% of the wild type protein expression.
  • FIG. 6D Values of best fit curve indicating half maximal response and Hill Slope.
  • FIGS. 7A-7D show a comparison of the rescue of membrane potential across treatment modalities.
  • FIG. 7A On an expanded scale of the x-axis, resting membrane potential of control (black) and LCA16 iPSC-RPE (red) showed a positive shift in EV plot.
  • FIG. 7B For the LCA16 iPSC-RPE cells (red trace), treatment with NB84 shifted the I/V-plot to negative (blue).
  • FIG. 7C Plot of average EV also showed a negative shift of resting potential after gene augmentation (green).
  • FIG. 7D Bar graph comparison of resting membrane potential showed recovery of LCA16 iPSC-RPE to control level after treatment with NB84 or upon gene augmentation.
  • FIG. 9A-9E shows gene augmentation of W53X mutant expressing CHO cells had recovery of average inwardly rectifying K+ current (FIG. 9A. IV plot in red trace) compared to no current before (FIG 9A. plot in black trace).
  • FIG. 9B Average higher Rb+ current (red trace) in W53X mutant expressing cells after gene augmentation.
  • FIG. 9C Net increase in Rb+ permeability increased (Blue) through Kir7. l channel after gene augmentation.
  • FIG. 9D Complete recovery of resting membrane potential (RMP) after AAV-Kir7.l transduction of W53X expressing cells represented as blue box.
  • FIG. 9E Western blot results showing expression of full length protein product after gene augmentation in lane W53X + AAV (red band).
  • FIG. 10A-10B shows Kir7.l expression (green) in W53X mutant line after gene augmentation through AAV-Kir7.l (FIG. 10A).
  • FIG. 10B A higher magnification image shows membrane localization of the Kir7.l protein alongside membrane marker WGA-Alexa 594. In the lower panel is the line scan for red and green showing membrane marker and Kir7. l co-localize.
  • FIG. 11 shows Kir7.l gene-therapy in vivo.
  • On the left is a control mouse showing normal wave form of electroretinogram and no change after gene augmentation.
  • In the middle is a conditional knock out mice showing no c-wave in the right black trace. This wave which directly depends on Kir7.l expression is completely recovered 4 weeks after gene therapy. Average result is shown in box plot with significant recovery of c-wave in experimental gene therapy.
  • FIG. 12 shows a vector map for an exemplary AAV viral vector for delivery of a Kir7. l protein.
  • FIG. 13 shows a vector map for an exemplary Lentivirus viral vector for delivery of a Kir7.l protein.
  • FIGS. 14A-14F demonstrates functional recovery of Retinal Pigment Epithelial (RPE) cells lacking Kir7.l protein after gene therapy.
  • FIG. 14A Injection control on WT mice and the cKO control mice depicting the RPE response functional after 8weeks with PBS injection.
  • FIG. 14B ERG response from the Kir7. l cKO mice which showed no a-, b- and c-wave during the screening. Delivery of the Kir7. l with lentivirus carrying either constitutive EFla promoter or RPE specific VMD2 promoter failed to rescue the RPE function due to the severe phenotype as both RPE and photoreceptors were degenerated.
  • FIG. 14A Injection control on WT mice and the cKO control mice depicting the RPE response functional after 8weeks with PBS injection.
  • FIG. 14B ERG response from the Kir7. l cKO mice which showed no a-, b- and c-wave during the screening. Delivery of the Kir7. l
  • FIGS. 14C c-wave from RPE is recovered in the cKO mice, by subretinal delivery of lentivirus carrying kcnj l3 gene driven by EFla and VMD2 promoter, where the photoreceptors were not degenerated but had no response from the RPE cells during screening.
  • FIG. 14D Representative optical coherence tomography (OCT) images showing the retinal structure from the control mice, cKO mice ( no-a- ,b-c-wave) with no recovery and c-wave recovered mice (a-, b- but no-c-wave) during screening and post 8weeks after lentiviral gene delivery respectively.
  • FIG. 15A-15E demonstrates results of a subset of mice that did not show c-wave recovery.
  • FIG. 15A Graph representing the subset of mice that did not show c-wave recovery after injection of lentivirus carrying kcnjl3 gene driven by EFla and VMD2 promoter.
  • FIG. 15B Graph representing the subset of mice that did not show c-wave recovery after injection of lentivirus carrying kcnjl3 gene driven by EFla and VMD2 promoter.
  • FIG. 15B Fig. 15C
  • OCT Optical coherence tomography
  • FIG. 16 depicts Table 2 and Table 3 demonstrating an exemplary AAV vector for the present invention containing specific components and a suitable exemplary sequence for the AAV vector comprising a RPE specific promoter and the Kir7.1 gene.
  • FIG. 17 depicts Table 5 and Table 6 demonstrating an exemplary lentiviral vector of the present invention, including the specific components and a suitable exemplary sequence for the lentiviral vector.
  • the present inventors disclose new gene therapy vectors and therapeutic compositions that may be used to treat Leber Congenital Amaurosis 16 (LCA16) or other conditions associated with insufficient expression or function of a Kir7.l protein.
  • LCA16 Leber Congenital Amaurosis 16
  • the inventors surprisingly show that a gene therapy approach may be used to effectively restore Kir7. l polypeptide function in retinal pigment epithelium (RPE) cells either in vitro or in vivo resulting in RPE cells with rescued electrophysiological phenotypes.
  • RPE retinal pigment epithelium
  • the present inventors demonstrate in part that expression of a Kir7.l protein open reading frame alone is sufficient to get the Kir7.l protein trafficked to the proper subcellular compartment. These results provide hope for potential curative therapeutics to treat Leber Congenital Amaurosis 16 (LCA16) or other conditions associated with insufficient expression or function of a Kir7.1 protein.
  • LCA16 Leber Congenital Amaurosis 16
  • gene therapy vectors are provided.
  • the gene therapy vectors may include a promoter operably connected to a polynucleotide encoding a Kir7.l polypeptide.
  • the general approach in certain aspects of the present invention is to provide a cell with an expression construct encoding a Kir7.1 polypeptide, thereby permitting the expression of the Kir7.1 polypeptide in the cell .
  • the Kir7. l polypeptide encoded by the expression construct is synthesized by the transcriptional and translational machinery of the ceil.
  • an "‘expression construct encoding a Kir7.1 polypeptide” refers to a promoter operably connected to a polynucleotide encoding a Kir7. l polypeptide.
  • the terms“polynucleotide,”“polynucleotide sequence,”“nucleic acid” and“nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide (which terms may be used interchangeably), or any fragment thereof. These phrases also refer to DNA or RNA of natural or synthetic origin (which may be single-stranded or double-stranded and may represent the sense or the antisense strand).
  • the promoters and Kir7. l polynucleotides or expression constructs encoding a Kir7. l polypeptide described herein are encoded in double-stranded DNA, single-stranded DNA, or RNA.
  • a“gene therapy vector” refers to viral or non-viral vector systems that may be used to deliver an expression construct encoding a Kir7. l polypeptide into a cell (i.e., eukaryotic cell). Both broad types of vector systems are described in the following sections.
  • Ex vivo gene transfer comprises vector modification of (host) cells in culture and the administration or transplantation of the vector modified cells to a gene therapy recipient.
  • In vivo gene transfer comprises direct introduction of the vector (e.g., injection, inhalation) into the target source or therapeutic gene recipient.
  • the expression construct encoding the Kir7.l polypeptide may be stably integrated into the genome of the cell. In yet further embodiments, the expression construct encoding the Kir7. l polypeptide may be stably or transiently maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or“episomes” encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and/or where in the cell the nucleic acid remains is dependent on the type of vector employed. The following gene delivery methods provide the framework for choosing and developing the most appropriate gene delivery system for a preferred application.
  • the gene therapy vector may be a delivery particle.
  • Delivery particles suitable for delivering polynucleotides are known in the art and may include, without limitation, polymeric particles, liposomal particles, and particles including lipids and at least one type of polymer.
  • the delivery particles may be formed using common Lipofectamine reagents.
  • the delivery particles may include nanoscale particles and/or microscale particles, for example, as delivery vehicles of components to a cell for genome editing.
  • the particles may have an effective average diameter less than about 500 pm, 100 pm, 50 pm, 20 pm, 10 pm, 5 pm, 2 pm, 1 pm, 0.5 pm, 0.2 pm, 0.1 pm, 0.05 pm, 0.02 pm, 0.01 pm, or have an effective average diameter within a range bounded by any of 500 pm, 100 pm, 50 pm, 20 pm, 10 pm, 5 pm, 2 pm, 1 pm, 0.5 pm, 0.2 pm, 0.1 pm, 0.05 pm, 0.02 pm, 0.01 pm ( e.g ., 0.01-5 pm).
  • the nanoscale particles and microscale particles may be referred to as “nanoparticles” and “microparticles,” respectively.
  • Polymeric particles have been described in the art. (U.S. Patent Publication 20140066388). Polymeric particles may include or may be formed from biodegradable polymeric molecules, which in some embodiments may include dendrimers. Suitable dendrimers may include, but are not limited to, polyamidoamine (PAMAM) dendrimers. Polyamidoamine dendrimers have been used in the art as vehicles for intracellular delivery of therapeutics. Polyamidoamine dendrimers suitable for preparing the presently disclosed nanoparticles may include 3rd-, 4th-, 5th-, or preferably at least 6th-generation dendrimers.
  • PAMAM polyamidoamine dendrimers
  • Polymeric particles may also include or may be formed from other biodegradable polymeric molecules which may include, without limitation, polylactic acid (PLA), polygycolic acid (PGA), co-polymers of PLA and PGA (e.g., polyactic-co-glycolic acid (PLGA)), poly-e- caprolactone (PCL), polyethylene glycol (PEG), poly(3-hydroxybutyrate), poly(p-dioxanone), polypropylene fumarate, poly(orthoesters), polyol/diketene acetals addition polymers, poly- alkyl-cyano-acrylates (PAC), poly(sebacic anhydride) (PSA), poly(carboxybiscarboxyphenoxyphenoxy hexone (PCPP) poly[bis (p- carboxypheonoxy)methane](PCPM), copolymers of PSA, PCPP and PCPM, poly(amino acids), poly(pseudo amino acids), polyphosphazene
  • the particles may include a mixture of PLGA and PAMAM.
  • Polymeric particles may be prepared by methods known in the art. (International Application Publication Nos. WO 2012/115806; and WO 2012/054425). Suitable methods for preparing the nanoparticles may include methods that utilize a dispersion of a preformed polymer, which may include but are not limited to solvent evaporation, nanoprecipitation, emulsification/solvent diffusion, salting out, dialysis, and supercritical fluid technology.
  • the nanoparticles may be prepared by forming a double emulsion (e.g., water-in- oil-in-water) and subsequently performing solvent-evaporation.
  • the nanoparticles obtained by the disclosed methods may be subjected to further processing steps such as washing and lyophilization, as desired.
  • the nanoparticles may be combined with a preservative (e.g., trehalose).
  • Micelle and liposomal-based particles may also serve as suitable delivery particles. See, e.g., U.S. Patent 8,252,324.
  • Micelles are self-assembling spherical colloidal nanoparticles formed by amphiphilic molecules. Micelles are also described as aggregate surfactant molecules disbursed in a liquid colloid.
  • the core of the micelle which is segregated in an aqueous milieu, is capable of encapsulating polynucleotides and/or proteins protecting them from destruction and biological surroundings while improving their pharmacokinetics and biodistribution.
  • Micelles are generally in the order of 5-50 nm in diameter, and are therefore capable of accumulating in pathological areas with leaky vasculature, such as infarct zones and tumors due to the enhanced permeability and retention effect. Micelles are also capable of evading a major obstacle in drug targeting by particulate systems: non-specific uptake by the reticulo-endothelial systems and renal secretion.
  • liposomes are bilayered phospholipid vesicles approximately 50 to 1,000 nm in diameter. Liposomes are biologically inert and completely biocompatible; they cause practically no toxic or antigenic reactions. Polynucleotides included in liposomes are protected from the destructive action of the external media by the liposomes. Thus, liposomes are able to deliver their content inside cells and even inside different cell compartments. Generally, liposomes are considered a promising carrier with significant therapeutic potential, as demonstrated in numerous laboratory tests and clinical trials.
  • Delivery particles may also include particles including lipids and polymer components.
  • particles including a phospholipid bilayer and poly(beta-amino ester) (PBAE) have been developed for the in vivo delivery of polynucleotides.
  • the delivery particles preferably have physical properties that facilitate uptake by a targeted cell.
  • the particles have a size and a charge that facilitate uptake by a targeted cell.
  • the particles have a mean effective diameter of less than 1 micron, and preferably the particles have a mean effective diameter of between about 25 nm and about 500 nm, and more preferably between about 50 nm and about 250 nm, and most preferably about 100 nm to about 150 nm.
  • the size of the particles may be assessed by known methods in the art, which may include but are not limited to transmission electron microscopy (TEM), scanning electron microscopy (SEM), Atomic Force Microscopy (AFM), Photon Correlation Spectroscopy (PCS), Nanoparticle Surface Area Monitor (NS AM), Condensation Particle Counter (CPC), Differential Mobility Analyzer (DMA), Scanning Mobility Particle Sizer (SMPS), Nanoparticle Tracking Analysis (NTA), X-Ray Diffraction (XRD), Aerosol Time of Flight Mass Spectroscopy (ATFMS), and Aerosol Particle Mass Analyzer (APM).
  • TEM transmission electron microscopy
  • SEM scanning electron microscopy
  • AFM Atomic Force Microscopy
  • PCS Nanoparticle Surface Area Monitor
  • CPC Condensation Particle Counter
  • DMA Differential Mobility Analyzer
  • SPS Scanning Mobility Particle Sizer
  • NTA Nanoparticle Tracking Analysis
  • XRD X-Ray Diffraction
  • Delivery particles will be taken up by cells non-specifically even if the particles do not include a specific ligand on their surface.
  • the disclosed delivery particles may be configured to also include a ligand that specifically targets a particular cell type.
  • such particles may be modified with various ligands using advanced conjugation procedures. For example, antibodies and small peptides have been attached to the water exposed tips of polyethyleneglycol chains. Antibodies and small peptides have also been conjugated via reactive p-nitrophenylcarbonyl, N- benzotrazole carbonyl or maleimide terminated PEG-phosphatidylethanolamine.
  • the gene therapy vector may also be a viral vector.
  • the viral vector may be a virus particle or may be encoded on a DNA plasmid.
  • the viral vector is a virus particle, for example a lentivirus viral particle
  • the virus particle may include a VSV-G envelop protein.
  • the capacity of certain viral vectors to efficiently infect or enter cells, to integrate into a host cell genome and stably express viral genes, have led to the development and application of a number of different viral vector systems (Robbins et al., 1998).
  • Viral systems are currently being developed for use as vectors for ex vivo and in vivo gene transfer. For example, adenovirus, herpes-simplex virus, retrovirus and adeno-associated virus vectors are being evaluated currently for treatment of human diseases.
  • the various viral vectors described below present specific advantages and disadvantages depending on the particular gene-therapeutic application.
  • Suitable viral vectors may include, without limitation, retroviral vectors, adeno-associated viral (AAV) vectors, adenoviral vectors, or herpes-simplex vectors.
  • Retroviral vectors may include, for example, lentiviral vectors.
  • the present inventors demonstrate that a polynucleotide encoding a Kir7.l polypeptide could successfully be introduced and expressed in retinal pigment epithelium (RPE) cells either in vitro or in vivo using either lentiviral or adeno- associated viral (AAV) vectors so as to rescue functional defects in a KCNJ13 gene.
  • the viral vector may be a lentiviral vector or an AAV, suitably an AAV2, vector.
  • the AAV vectors described herein may further include at least one, two, three, four, five, six, seven, or eight of the components listed in Table 2 or Table 3.
  • the lentiviral vectors described herein may further include at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or fifteen of the components listed in Table 5 or Table 6.
  • Retroviruses or retroviral vectors are RNA viruses comprising an RNA genome.
  • the genomic RNA is reverse transcribed into a DNA intermediate which is integrated into the chromosomal DNA of infected cells.
  • This integrated DNA intermediate is referred to as a provirus.
  • retroviruses can stably infect dividing cells with a gene of interest (e.g., a therapeutic gene) by integrating into the host DNA, without expressing immunogenic viral proteins. Theoretically, the integrated retroviral vector will be maintained for the life of the infected host cell, expressing the gene of interest.
  • Lentiviral vectors are a type of retrovirus that can infect both dividing and nondividing cells. Lentiviruses can be used to provide highly effective gene therapy as lentiviruses can change the expression of their target cell's gene for up to six months. They can be used for nondividing or terminally differentiated cells such as neurons, macrophages, hematopoietic stem cells, retinal photoreceptors, and muscle and liver cells, cell types for which previous gene therapy methods could not be used.
  • AAV Adeno-Associated Viral
  • Adeno-associated virus a member of the parvovirus family, is a human virus that is increasingly being used for gene delivery therapeutics.
  • AAV has several advantageous features not found in other viral systems. First, AAV can infect a wide range of host cells, including non dividing cells. Second, AAV can infect cells from different species. Third, AAV has not been associated with any human or animal disease and does not appear to alter the biological properties of the host cell upon integration. For example, it is estimated that 80-85% of the human population has been exposed to AAV. Finally, AAV is stable at a wide range of physical and chemical conditions which lends itself to production, storage and transportation requirements.
  • the AAV genome is a linear, single-stranded DNA molecule containing 4681 nucleotides.
  • the AAV genome generally comprises an internal non-repeating genome flanked on each end by inverted terminal repeats (ITRs) of approximately 145 bp in length.
  • ITRs inverted terminal repeats
  • the ITRs have multiple functions, including origins of DNA replication, and as packaging signals for the viral genome.
  • AAV ITRs may be derived from any of several AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, avian AAVs, bovine AAVs etc.
  • the 5’ and 3’ ITRs of the AAV viral vectors disclosed herein may be derived from any of these AAV serotypes.
  • the 5’ and 3’ ITRs which flank the AAV viral vectors disclosed herein need not necessarily be identical or derived from the same AAV serotype.
  • rAAV vector design and production allow for exchanging the capsid proteins between different AAV serotypes.
  • Homologous vectors comprising an expression cassette flanked by e.g., AAV2- ITRs and packaged in an AAV2 capsid, can be produced as well as heterologous, hybrid vectors where the transgene expression cassette is flanked by e.g., AAV2 ITRs, but the capsid originates from another AAV serotype such as AAV5 for example.
  • AAV2 viral vectors may be used to effectively deliver Kir7. l expression constructs into cells.
  • the internal non-repeated portion of the AAVgenome includes two large open reading frames, known as the AAV replication (rep) and capsid (cap) genes.
  • the rep and cap genes code for viral proteins that allow the virus to replicate and package the viral genome into a virion.
  • a family of at least four viral proteins is expressed from the AAV rep region, Rep 78, Rep 68, Rep 52, and Rep 40, named according to their apparent molecular weight.
  • the AAV cap region encodes at least three proteins, VP1, VP2, and VP3.
  • AAV is a helper-dependent virus requiring co-infection with a helper virus (e.g., adenovirus, herpesvirus or vaccinia) in order to form AAV virions.
  • a helper virus e.g., adenovirus, herpesvirus or vaccinia
  • AAV establishes a latent state in which the viral genome inserts into a host cell chromosome, but infectious virions are not produced.
  • Subsequent infection by a helper virus “rescues” the integrated genome, allowing it to replicate and package its genome into infectious AAV virions.
  • the helper virus must be of the same species as the host cell (e.g., human AAV will replicate in canine cells co-infected with a canine adenovirus).
  • AAV has been engineered to deliver genes of interest by deleting the internal non repeating portion of the AAV genome and inserting a heterologous gene between the ITRs.
  • the heterologous gene may be functionally linked to a heterologous promoter (constitutive, cell- specific, or inducible) capable of driving gene expression in target cells.
  • a suitable producer cell line is transfected with a rAAV vector containing a heterologous gene.
  • the producer cell is concurrently transfected with a second plasmid harboring the AAV rep and cap genes under the control of their respective endogenous promoters or heterologous promoters.
  • the producer cell is infected with a helper virus.
  • the heterologous gene is replicated and packaged as though it were a wild-type AAV genome.
  • the heterologous gene enters and is expressed in the target cells. Because the target cells lack the rep and cap genes and the adenovirus helper genes, the rAAV cannot further replicate, package or form wild-type AAV.
  • suitable AAV vectors include AAV2/5, demonstrated in "AAV2/5-mediated gene therapy in iPSC-derived retinal pigment epithelium of a choroideremia patient", incorporated by reference in its entirety. See, e.g., Cereso et. al. Mol Ther Methods Clin Dev. 2014. Further examples of AAV vectors that can suitably be adapted for the present gene delivery can be found in "Comparative AAV-eGFP Transgene Expression Using Vector Serotypes 1-9, 7m8, and 8b in Human Pluripotent Stem Cells, RPEs, and Human and Rat Cortical Neurons.” See Duong et.al. Stem Cells Int. 2019. Adenoviral Vectors
  • an adenoviral vector is contemplated for the delivery of Kir7.l expression constructs.
  • “Adenoviral vector” is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express construct that has been cloned therein.
  • Adenoviruses comprise linear double stranded DNA, with a genome ranging from 30 to 35 kb in size.
  • An adenoviral vector according to the present invention comprises a genetically engineered form of the adenovirus. Advantages of adenoviral gene transfer include the ability to infect a wide variety of cell types, including non-dividing cells, a mid-sized genome, ease of manipulation, high infectivity and they can be grown to high titers. Further, adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner, without potential genotoxicity associated with other viral vectors. Adenoviruses also are structurally stable and no genome rearrangement has been detected after extensive amplification.
  • An exemplary adenoviral vector according to the present invention is replication defective vector that will not have an adenovirus El region.
  • Adenovirus growth and manipulation is known to those of skill in the art, and exhibits broad host range in vitro and in vivo. See, e.g., U.S. Pat. No. 5,670,488; U.S. Pat. No. 5,932,210; U.S. Pat. No. 5,824,544.
  • Herpes simplex virus (HSV) type I and type II contain a double-stranded, linear DNA genome of approximately 150 kb, encoding 70-80 genes. Wild type HSV are able to infect cells lytically and to establish latency in certain cell types (e.g., neurons). Similar to adenovirus, HSV also can infect a variety of cell types. For use in therapeutic gene delivery, HSV must be rendered replication-defective. Protocols for generating replication-defective HSV helper virus- free cell lines have been described (U.S. Pat. No. 5,879,934; U.S. Pat. No. 5,851,826, each specifically incorporated herein by reference in its entirety).
  • viral vectors for gene delivery is constantly improving and evolving.
  • Other viral vectors such as poxvirus; e.g., vaccinia virus, alpha virus; e.g., Sindbis virus, Semliki forest virus, reovirus and influenza A virus are contemplated for use in the present invention and may be selected according to the requisite properties of the target system.
  • a promoter refers generally to transcriptional regulatory regions of a gene, which may be found at the 5’ or 3’ side of the polynucleotides described herein, or within the coding region of the polynucleotides, or within introns in the polynucleotides.
  • a promoter is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3’ direction) coding sequence.
  • the typical 5’ promoter sequence is bounded at its 3’ terminus by the transcription initiation site and extends upstream (5’ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with nuclease Sl), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • the promoter is specific to the cell type in which Kir7. l is to be expressed.
  • suitable cell types including retinal pigment epithelium, small intestinal cells, uterine cells, kidney cells, among others.
  • the promoters may be specific to polarized cells, e.g., cells that have directionality and the Kir7.l potassium pump plays a role in maintaining the polarization of the cells.
  • Suitable promoters that may be used in a tissue specific manner include the RPE promoters (e.g., EFla or VMD2) described and the promoters found below in Table 7.
  • the promoter is active in the retinal pigment epithelium (RPE) in the eye of a subject.
  • RPE retinal pigment epithelium
  • The“promoter” may be the endogenous promoter for the KCNJ13 gene found, for example, in a subject.
  • the promoter may be a heterologous promoter (i.e., a promoter for a non-KCNJl3 gene).
  • Heterologous promoters useful in the practice of the present invention include, without limitation, constitutive, inducible, temporally-regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters.
  • Suitable heterologous promoters may include, without limitation, an EFla promoter or a VMD2 promoter.
  • An exemplary EFla promoter is provided as SEQ ID NO: 3.
  • An exemplary VMD2 promoter is provided as SEQ ID NO: 4.
  • Suitable EFla promoters may also include variants of the EFla promoter provided as SEQ ID NO: 3 having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3.
  • Suitable VMD2 promoters may also include variants of the VMD2 promoter provided as SEQ ID NO: 4 having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 4.
  • the phrases“% sequence identity,”“percent identity,” or“% identity” refer to the percentage of base matches between at least two polynucleotide sequences aligned using a standardized algorithm. Methods of polynucleotide sequence alignment are well-known.
  • the disclosed polynucleotides encoding a Kir7.l polypeptide are operably connected to the promoter.
  • a polynucleotide is“operably connected” or “operably linked” when it is placed into a functional relationship with a second polynucleotide sequence.
  • a promoter is operably linked to a polynucleotide if the promoter is connected to the polynucleotide such that it may effect transcription of the polynucleotides.
  • the polynucleotides may be operably linked to at least 1, at least 2, at least 3, at least 4, at least 5, or at least 10 promoters.
  • a“Kir7.l polypeptide” refers to an inward rectifier potassium channel characterized by a greater tendency to allow potassium to flow into the cell rather than out of it.
  • a human Kir7.l polypeptide is provided as SEQ ID NO: 1.
  • a Kir7.l polypeptide may also be a variant or homolog of the human Kir7.l polypeptide provided as SEQ ID NO: 1 having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1.
  • protein or “polypeptide” or “peptide” may be used interchangeably to refer to a polymer of amino acids.
  • A“polypeptide” as contemplated herein typically comprises a polymer of naturally occurring amino acids (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine).
  • naturally occurring amino acids e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan,
  • the phrases“% sequence identity,”“percent identity,” or “% identity” refer to the percentage of residue matches between at least two amino acid sequences aligned using a standardized algorithm. Methods of amino acid sequence alignment are well-known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail below, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. Percent identity for amino acid sequences may be determined as understood in the art. (See, e.g ., U.S. Patent No. 7,396,664, which is incorporated herein by reference in its entirety).
  • NCBI National Center for Biotechnology Information
  • BLAST Basic Local Alignment Search Tool
  • the BLAST software suite includes various sequence analysis programs including“blastp,” that is used to align a known amino acid sequence with other amino acids sequences from a variety of databases.
  • Polypeptide sequence identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues.
  • Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or Sequence Listing, may be used to describe a length over which percentage identity may be measured.
  • the Kir7.l polypeptides disclosed herein may include“variant” polypeptides,“mutants,” and“derivatives thereof.”
  • wild-type is a term of the art understood by skilled persons and means the typical form of a polypeptide as it occurs in nature as distinguished from variant or mutant forms.
  • a“variant,“mutant,” or“derivative” refers to a polypeptide molecule having an amino acid sequence that differs from a reference protein or polypeptide molecule.
  • a variant or mutant may have one or more insertions, deletions, or substitutions of an amino acid residue relative to a reference molecule.
  • a Kir7 For example, a Kir7.
  • l polypeptide mutant or variant may have one or more insertions, deletions, or substitution of at least one amino acid residue relative to the Kir7. l“wild-type” polypeptides disclosed herein.
  • the polypeptide sequence of a“wild-type” Kir7.l polypeptides is provided as SEQ ID NO: 1. This sequence may be used as a reference sequence.
  • the Kir7. l polypeptides provided herein may be full-length polypeptides or may be fragments of the full-length polypeptide.
  • a“fragment” is a portion of an amino acid sequence which is identical in sequence to but shorter in length than a reference sequence.
  • a fragment may comprise up to the entire length of the reference sequence, minus at least one amino acid residue.
  • a fragment may comprise from 5 to 350 contiguous amino acid residues of a reference polypeptide, respectively.
  • a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, or 250 contiguous amino acid residues of a reference polypeptide.
  • Fragments may be preferentially selected from certain regions of a molecule.
  • the term“at least a fragment” encompasses the full length polypeptide.
  • a fragment of a Kir7.l polypeptide may comprise or consist essentially of a contiguous portion of an amino acid sequence of a full-length Kir7. l polypeptide (See SEQ ID NO: 1).
  • a fragment may include an N-terminal truncation, a C-terminal truncation, or both truncations relative to the full-length Kir7. l polypeptide.
  • l polypeptide refers to a change in the amino acid sequence resulting in the absence of one or more amino acid residues.
  • a deletion may remove at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, or more amino acids residues.
  • a deletion may include an internal deletion and/or a terminal deletion (e.g., an N-terminal truncation, a C-terminal truncation or both of a reference polypeptide).
  • “Insertions” and“additions” in a Kir7.l polypeptide refer to changes in an amino acid sequence resulting in the addition of one or more amino acid residues.
  • An insertion or addition may refer to 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or more amino acid residues.
  • a variant of a Kir7.l polypeptide may have N-terminal insertions, C-terminal insertions, internal insertions, or any combination of N-terminal insertions, C-terminal insertions, and internal insertions.
  • the amino acid sequences of the Kir7. l polypeptide variants, mutants, derivatives, or fragments as contemplated herein may include conservative amino acid substitutions relative to a reference amino acid sequence.
  • a variant, mutant, derivative, or fragment polypeptide may include conservative amino acid substitutions relative to a reference molecule.
  • conservative amino acid substitutions are those substitutions that are a substitution of an amino acid for a different amino acid where the substitution is predicted to interfere least with the properties of the reference polypeptide. In other words, conservative amino acid substitutions substantially conserve the structure and the function of the reference polypeptide.
  • Conservative amino acid substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a beta sheet or alpha helical conformation, (b) the charge or hydrophobicity of the molecule at the site of the substitution, and/or (c) the bulk of the side chain.
  • the disclosed variant and fragment Kir7.l polypeptides described herein may have one or more functional or biological activities exhibited by a reference polypeptide (e.g., one or more functional or biological activities exhibited by a wild-type Kir7.l polypeptide (i.e, SEQ ID NO: 1).
  • a“functional fragment” of a Kir7.l polypeptide is a fragment of, for example, the polypeptide of SEQ ID NO: 1 that retains at least 20%, 40%, 60%, 80%, or 100% of the potassium conductance properties of the full-length ADH polypeptide.
  • Kir7.l polypeptide variants may be created by aligning Kir7. l polypeptide sequences from two or more species. Based on these alignments, a person of ordinary skill in the art may identify various amino acid residues that may be altered (i.e. substituted, deleted, etc.) without substantially affecting the potassium conductance properties of the polypeptide. For example, a person of ordinary skill in the art would appreciate that substitutions in a reference Kir7.l polypeptide could be based on alternative amino acid residues that occur at the corresponding position in other Kir7.1 polypeptides from other species.
  • the gene therapy vector may be a lentiviral vector or adeno- associated viral (AAV) vector including a polynucleotide having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity sequence identity to SEQ ID NO: 5 (EFla-Kir7.l) or SEQ ID NO: 6 (VMD2-Kir7.l).
  • AAV adeno- associated viral
  • the present invention relates to therapeutic compositions.
  • the therapeutic compositions may include any of the gene therapy vectors described herein and a pharmaceutically-acceptable carrier.
  • the therapeutic compositions may include a pharmaceutically-acceptable carrier, excipient, or diluent, which are nontoxic to the cell or subject being exposed thereto at the dosages and concentrations employed. Often a pharmaceutical diluent is in an aqueous pH buffered solution.
  • Examples of pharmaceutically- acceptable carriers or excipients may include, without limitation, water, buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, di saccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM brand surfactant, polyethylene glycol (PEG), and PLEIRONICSTM surfactant.
  • buffers such as phosphate, citrate, and other organic acids
  • antioxidants including ascorbic acid
  • methods of treating a subject having a condition associated with insufficient expression or function of a Kir7.l polypeptide are provided.
  • the methods may include administering a therapeutically effective amount of any one of the gene therapy vectors described herein or any one of the therapeutic compositions described herein to the subject.
  • the terms“subject” and“patient” are used interchangeably to refer to both human and nonhuman animals.
  • the term“nonhuman animals” of the disclosure may include mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, pig, mice, rats, and the like.
  • the subject is a human patient.
  • the subject may be a human patient having cells (i.e., RPE cells) that exhibit insufficient expression or function of a Kir7.1 polypeptide.
  • Conditions associated with insufficient expression or function of a Kir7. l polypeptide may include conditions in which a subject has reduced or eliminated Kir7. l expression or function in or outside a cell as compared to a control.
  • a“control” may include subjects having wildtype Kir7.l function.
  • a control may be a subject having a wildtype KCNJ13 gene that does not include any loss-of-function mutations in either the non-coding regulatory sequences (i.e., promoter, enhancers, etc.) controlling the expression of the KCNJ13 gene or in the coding region of the KCNJ13 gene (i.e., SEQ ID NOS: 1 and 2).
  • Subjects may have several “cell” types that may display insufficient expression or function of a Kir7. l polypeptide.
  • a“cell” may refer to cells that normally express a Kir7.l polypeptide in a wild-type subject. Suitable cells may include, without limitation, eye cells such as retinal cells or retinal pigment epithelium (RPE) cells.
  • RPE retinal pigment epithelium
  • Kir7.l is also expressed in epithelial cells of various organs including kidney, thyroid, CNS neurons, ependymal cells, choroid plexus epithelium, spinal cord, myometrial smooth muscle, small intestine, neural regions of the gastric mucosa as well as gastric parietal cells, and also in the lung, prostate, liver, pancreas, cochlear nucleus, testis and ovaries.
  • the condition associated with insufficient expression or function of a Kir7. l polypeptide may be associated with at least one loss-of-function mutation in a KCNJ13 gene.
  • the human KCNJ13 gene is provided as ETniProt 060928.
  • the KCNJ13 gene in other non-human subjects may be identified by using homology searching methods well known in the art.
  • Suitable loss-of-function mutations in the KCNJ13 gene may include at least one substitution to the Kir7.l protein provided as SEQ ID NO: 1 selected from the group consisting of W53Ter, Q116R, I120T, T153I, R162Q, Rl66Ter, L241P, E276A, S105I, and G2l9Ter.
  • l polypeptide may be, without limitation, Leber Congenital Amaurosis 16 (LCA16), retinitis pigmentosa, or Snowflake Vitreoretinal Degeneration (SVD).
  • LCA16 Leber Congenital Amaurosis 16
  • retinitis pigmentosa retinitis pigmentosa
  • SSD Snowflake Vitreoretinal Degeneration
  • the cell that displays insufficient expression or function of a Kir7.l polypeptide is within the small intestine of the subject.
  • Suitable vectors may be constructed using a small intestine specific promoter, including, but not limited to, for example, HIFABP, HMUC2, or HLY (found in Table 7) to target the Kir7.l to the small intestine. Methods of treating a subject with insufficient expression or function of Kir7. l in the small intestine are provided.
  • the method may include administering a therapeutically effective amount of a gene therapy vector comprising a small intestine specific promoter, e.g., HIFABP, HMUC2, or HLY operably linked to the Kir7.l polynucleotide or a therapeutic composition comprising the vector to the subject in order to provide expression of Kir7.l in the small intestine of the subject.
  • a gene therapy vector comprising a small intestine specific promoter, e.g., HIFABP, HMUC2, or HLY operably linked to the Kir7.l polynucleotide or a therapeutic composition comprising the vector to the subject in order to provide expression of Kir7.l in the small intestine of the subject.
  • the cell displays insufficient expression or function of a Kir7. l polypeptide within the uterus of a subject.
  • Suitable vectors may be constructed using a smooth muscle specific promoter, for example, SM22a (found in Table 7) to target the Kir7. l to the
  • the method may include administering a therapeutically effective amount of a gene therapy vector comprising a smooth muscle or uterus specific promoter, e.g., SM22a operably linked to the Kir7. l polynucleotide or a therapeutic composition comprising the vector to the subject in order to provide expression of Kir7. l in the uterus.
  • a gene therapy vector comprising a smooth muscle or uterus specific promoter, e.g., SM22a operably linked to the Kir7. l polynucleotide or a therapeutic composition comprising the vector to the subject in order to provide expression of Kir7. l in the uterus.
  • This method may allow for controlling uterine contractions by regulating Kir7.l expression and/or regulating the potassium balance within smooth muscles of the uterus.
  • the cell that displays insufficient expression or function of a Kir7. l polypeptide is within the kidney of a subject.
  • Suitable promoters that result in kidney specific expression include, but are not limited to, for example, KAP (kidney androgen-regulated protein or NPHS2 (podocin) promoter (See Table 7).
  • Methods of treating a subject having a condition associated with insufficient expression or function of a Kir7. l polypeptide within the kidney are provided.
  • the methods may include administering a therapeutically effective amount of a gene therapy vector comprising a kidney specific promoter (e.g., KAP or NPHS2) operably linked to the Kir7. l polynucleotide sequence or a therapeutic composition comprising such vector to the subject in order to express Kir7.1 in the kidney of the subject.
  • a kidney specific promoter e.g., KAP or NPHS2
  • Table 7 Promoters specific to cell types.
  • Treating” the condition associated with insufficient expression or function of a Kir7.l polypeptide includes, without limitation, increasing the levels of functional Kir7.l polypeptide in or outside a cell in a subject. It would be understood by one skilled in the art that an increase in the amount of functional Kir7.l may only need to be an increase of at least about 10%, preferably at least about 20%, alternatively about 30%, which may result in the proper functioning of the potassium channel within the cell in which it is expressed, leading to alleviation of one or more symptoms of the disease. For example, the ratio of functional to non functional Kir7. l within the cell needs to be sufficient to allow for proper functioning of the potassium channel, and may vary depending of cell type and location.
  • A“therapeutically effective amount” or an“effective amount” as used herein means the amount of a composition that, when administered to a subject for treating a state, disorder or condition is sufficient to effect a treatment (as defined above).
  • the therapeutically effective amount will vary depending on the compound, formulation or composition, the disease and its severity and the age, weight, physical condition and responsiveness of the subject to be treated.
  • compositions i.e. gene therapy vectors and/or therapeutic compositions
  • the compositions i.e. gene therapy vectors and/or therapeutic compositions
  • the targeted region for delivery of the compositions i.e. gene therapy vectors and/or therapeutic compositions
  • the specific dosage administered in any given case will be adjusted in accordance with the composition or compositions being administered, the disease to be treated or inhibited, the condition of the subject, and other relevant medical factors that may modify the activity of the compositions or the response of the subject, as is well known by those skilled in the art.
  • the specific dose for a particular subject depends on age, body weight, general state of health, diet, the timing and mode of administration, medicaments used in combination and the severity of the particular disorder to which the therapy is applied. Dosages for a given patient can be determined using conventional considerations, e.g., by customary comparison of the differential activities of the compositions described herein and of a known agent, such as by means of an appropriate conventional pharmacological or prophylactic protocol.
  • the maximal dosage for a subject is the highest dosage that does not cause undesirable or intolerable side effects.
  • the number of variables in regard to an individual treatment regimen is large, and a considerable range of doses is expected.
  • the route of administration will also impact the dosage requirements.
  • the effective dosage amounts described herein refer to total amounts administered, that is, if more than one composition is administered, the effective dosage amounts correspond to the total amount administered.
  • the compositions can be administered as a single dose or as divided doses. For example, the composition may be administered two or more times separated by 4 hours, 6 hours, 8 hours, 12 hours, a day, two days, three days, four days, one week, two weeks, or by three or more weeks.
  • compositions i.e. gene therapy vectors and/or therapeutic compositions
  • the compositions may be administered one or more times to the subject to effectively increase the levels of functional Kir7.l polypeptide in or outside a cell in a subject.
  • the compositions may be administered based on the number of copies of the expression construct encoding a Kir7. i polypeptide delivered to the subject.
  • the subject may be administered between 10 6 and 10 14 , or between 10 8 and 10 12 , or between 10 9 and 10 11 , or any range therein copies.
  • the gene therapy vector is a viral vector
  • the subject may be administered between 10 6 and 10 14 , or between 10 8 and 10 12 , or between 10 9 and 10 11 , or any range therein viral genomes.
  • RNA Unless otherwise specified or indicated by context, the terms“a”,“an”, and“the” mean “one or more.”
  • “a protein” or“an RNA” should be interpreted to mean“one or more proteins” or“one or more RNAs,” respectively.
  • Leber Congenital Amaurosis is an inherited pediatric blindness that is associated with at least 21 different genes.
  • LCA16 pathogenic allelic variants include c.
  • Kir7. l An inwardly rectifying potassium channel, Kir7. l, is encoded by KCNJ13 and is expressed in several tissues 7,8 . In the retina, Kir7. l is expressed exclusively in cell apical processes of RPE, in which it modulates retinal function and health. The role of the Kir7.l channel in other organs remains to be elucidated 9,10 .
  • Kir7.l protein expression was detected on the apical membrane of mature control iPSC-RPE cells but not in LCA16 iPSC-RPE cells (FIGS. II and 1J). We did not find any difference in protein expression between the two cell lines, except for Kir7.l (FIG. IK).
  • the Trp53Ter locus is located within the second exon of the 3-exon KCNJ13 sequence. We have previously shown that a nonsense substitution at amino acid 53 results in a truncated protein product, which explains why the LCA16 patient-derived iPSC-RPE failed to express the full-length Kir7. l protein.
  • RPE cells One of the key physiological functions of RPE cells is the daily phagocytosis of the photoreceptor outer segment, which contributes to the renewal process.
  • POS fluorescently labeled photoreceptor outer segments
  • the LCA16 mutation we are studying is a tryptophan (ETGG) to amber stop codon (ETAG) variant.
  • EGG tryptophan
  • ETAG amber stop codon
  • This nonsense mutation in eukaryotes can be suppressed by the incorporation of near cognate amino acid tRNA in the presence of the small-molecule read-through designer aminoglycoside NB84 (US Patent Publication# 20140357590A1) 15 17 .
  • NB84 small-molecule read-through designer aminoglycoside NB84
  • NB84 potentiates the specific read-through of a recessive Trp53Ter codon mutation, and we found that as low as a 25% rescue of functional channels was sufficient to circumvent both membrane potential and potassium current and thereby rescue the disease phenotype (FIGS. 6A-6D).
  • hiPSC-RPE Differentiation of hiPSC-RPE. Fibroblasts from two subjects were reprogrammed to induced pluripotent stem cells and cultured using established methods 1 3 . One of the subjects was an LCA16 patient with two copies of the Trp53Ter autosomal recessive mutation in the KCNJ13 gene, and the second subject was heterozygous for this mutation. The hiPSC lines were differentiated to RPE using protocols described earlier 2 5 .
  • hiPSCs were cultured either on mouse embryonic fibroblasts (MEFs) in iPS cell media (Dulbecco’s modified Eagle’s medium (DMEM): F12 (1 : 1), 20% Knockout Serum, 1% minimal essential medium (MEM) non-essential amino acids, 1% GlutaMAX, b-mercaptoethanol, 20 ng/ml FGF-2), or on Matrigel® with mTeSRl media.
  • DMEM modified Eagle’s medium
  • EBs embryoid bodies
  • NIM neural induction medium
  • DMEM F12; 1% N2 supplement, 1% MEM non-essential amino acids, 1% L-Glutamine, 2 pg/ml Heparin
  • mTeSRl neural induction medium
  • DMEM/F12 retinal differentiation medium
  • B27 supplement without retinoic acid
  • Antibiotic- Antimycotic Remaining adhered cells were allowed to continue differentiation for an additional 45 days, followed by microdissection and passaging of pigmented RPE patches to obtain purified monolayers of RPE as described earlier 5 .
  • MEFs, Matrigel® and FGF-2 were purchased from WiCell (Madison, WI), and all other tissue culture reagents were purchased from ThermoFisher.
  • PCR was performed with MyTaqHS master mix (Bioline) in a final volume of 25 m ⁇ with the following conditions: 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 15 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec. A final extension step was done for 10 min at 72°C and amplification products were visualized by electrophoresis on a 2% agarose gel containing Midori green advanced stain (Nippon Genetics Europe).
  • RFLP assay PCR was performed as described with primers specific to the full length KCNJ13 mRNA (Fwd 5'- GCTTCGAATTCCGACAGCAGTAATTG- 3' (SEQ ID NO: 7) and Rev 5'- ATCCGGTGGATCCTTATTCTGTCAGT -3' (SEQ ID NO: 8).
  • the PCR products were then digested by Nhel restriction enzyme (ThermoFisher) and visualized by electrophoresis on a 2% agarose gel containing Midori green advanced stain (Nippon Genetics Europe). Transmission Electron Microscopy.
  • Monolayers of hiPSC-RPE on transwell inserts were fixed in a solution of 2.5% glutaraldehyde, 2.0% paraformaldehyde in 0.1M sodium phosphate buffer (PB), pH 7.4 for ⁇ l hr at room temperature (RT). Samples were rinsed 5 x 5 minutes in 0.1M PB. The rinsed cultures were then post-fixed in 1% Osmium Tetroxide (Os0 4 ), 1% potassium ferrocyanide in PB for 1 hr at RT. Following post-fixation, samples were rinsed in PB, as before, followed by 3 x 5 minute rinses in distilled water to clear the phosphates.
  • Osmium Tetroxide Os0 4
  • Transwell inserts with monolayer of hiPSC-RPE cells from either the patient or control were fixed as follows: the transwell membrane was cut out and fixed by immersing it in 4% paraformaldehyde in phosphate-buffered saline for 10 mins in the dark. The membrane with cells was then washed with chilled PBS twice and blocked for 2 hrs in blocking solution that contained 5% goat serum and 0.25% Tween-20 in IX PBS.
  • the cells were then incubated for 24-48 hrs with primary antibodies raised against Kir7.l (mouse monoclonal IgG, 1 :250- Santa Cruz), and ZO-l (rabbit polyclonal, 2.5 pg/ml - ThermoFisher) prepared in incubation solution (Blocking solution diluted in 1 :3 with IX PBS). After incubation with primary antibody, the membranes were washed with chilled IX PBS thrice and incubated with conjugated secondary antibodies (Donkey anti goat Alexa Fluor® 488, donkey anti Rabbit Alexa Fluor® 594 and DAPI, 1 :500) in incubation solution for an hour in dark. A no primary antibody control was included for all experiments. Immunostained samples were imaged on a Nikon C2 confocal microscope (Nikon Instruments Inc., Mellville, NY).
  • the samples were diluted to contain equal amounts of protein and mixed with 2X Laemmli sample buffer (Bio-Rad) then electrophoresed on NuPAGE® Novex® 4-12% pre-cast polyacrylamide gel (ThermoFisher) followed by transfer to polyvinlidene difluoride (PVDF) membranes using the iBlot® dry blotting system (ThermoFisher).
  • the membranes were blocked with odyssey blocking buffer (LI-COR Biosciences) containing 0.l%Tween-20 for at least 2 hours at 4°C. After blocking, the membranes were incubated in the appropriate primary antibodies prepared in the Odyssey blocking buffer containing 0.1% Tween-20.
  • the primary antibodies used for this purpose were anti-Kir7.
  • the membranes were incubated with these primary antibodies in combination with control overnight at 4°C and then washed with Tris buffered saline containing 0.1% Tween-20 4 times before incubating them for another 1 hour with the appropriate IRDyeTM secondary antibodies (LI-COR Biosciences) at 1 :20000 dilutions in blocking buffer. The membranes were washed 4 times and imaged on an Odyssey® Imaging system.
  • Photoreceptor Outer Segment (POS) isolation Fresh bovine eyes were dissected under dim red light and retinas were removed carefully from the eyecup. Isolated retinas were placed in chilled homogenization solution (20% w/v sucrose, 20 mM Tris/ Acetate pH 7.2, 2 mM MgCh, 10 mM glucose, 5 mM taurine) and mixed gently. The suspension was then passed though gauze to remove clumps. This filtrate was centrifuged through a 25-60% sucrose gradient at 25000 rpm for an hour at 4°C.
  • POS Photoreceptor Outer Segment
  • wash solution 1 (20 mM tris acetate pH 7.2 and 5 mM taurine)
  • wash solution 2 (10% sucrose, 20 mM tris acetate pH 7.2 and 5 mM taurine)
  • wash solution 3 10% sucrose, 20 mM sodium phosphate pH 7.2 and 5 mM taurine
  • WGA Wood Germ Agglutinin conjugated with Alexa Fluor 594 ® (1 mg/ml, ThermoFisher) was mixed and incubated for 10 min at 37°C. After completion of incubation with WGA, the tube was again centrifuged at 2400g for 5 min and the POS pellet was washed twice with DMEM, after which it was used for phagocytosis assays
  • Phagocytosis Assay The labelled POS were added to culture media and fed to hiPSC- RPE cells growing in transwells that had a transepithelial electrical resistance (TEER) of >150 Ocrn 2 . 1 The cells were fed POS for either 4 hrs or 24 hrs after which any POS that had not been phagocytosed were removed by washing the cells 3 times with DMEM media. The cells were then incubated for 24 hrs or 6 days respectively before imaging. The images were captured and analyzed with NIS-Elements using a Nikon C2 confocal microscope (Nikon Instruments Inc., Mellville, NY).
  • CHO-K1 cells were transiently transfected to exogenously express either the Kir7.l WT protein or the Kir7. l Trp53Ter protein as N-terminal fusions with GFP. Cells expressing Trp53Ter protein were then treated with NB84 8 . Immunoprecipitation was performed using GFP-Trap agarose beads (ChromoTek, Germany) according to the manufacturer’s protocol. 6 In brief, the cells were collected and protein isolated as described above for western blotting. GFP-Trap agarose beads were added to the cell lysate and incubated at 4°C for 2 hours with constant mixing.
  • the mixture was then centrifuged at 2500g for 2 mins and the beads were washed twice.
  • SDS-sample buffer was added to the beads and incubated at 95°C for 10 mins followed by centrifugation at 2500xg.
  • the supernatant was separated on a 4-12% acrylamide gel and protein bands were visualized by silver staining using the Pierce Silver Stain kit (Therm oFisher) according to the manufacturer’s instructions.
  • hiPSC-RPE Transduction Lentivirus, custom engineered to be devoid of pathogenic elements, and carrying KCNJ13 gene fused at N - terminal with green fluorescent protein (GFP) under the control of EFla promoter, was generated by Cyagen Biosciences (Santa Clara, CA, EISA) and used for transduction 9 .
  • LCA-16 hiPSC-RPE monolayer was infected with pLV-EFla Kir7.l- GFP at an MOI of 200. The cells were cultured for 4- 5 days after infection then used for immunocytochemistry and western blotting.
  • the cells were then incubated with ONaCMF containing papain (2.5 m ⁇ /ml), cysteine (0.3 mg/ml), glutathione (0.25 mg/ml) and taurine (0.05 mg/ml) for 45 mins at 37°C.
  • ONaCMF containing papain (2.5 m ⁇ /ml), cysteine (0.3 mg/ml), glutathione (0.25 mg/ml) and taurine (0.05 mg/ml) for 45 mins at 37°C.
  • HEPES- Ringer HEPES- Ringer’s (HR) solution [NaCl (135 mM), KC1 (5 mM), CaCk (1.8 mM), MgCk (1 mM), HEPES (10 mM), D-glucose (10 mM), pH 7.4 ⁇ 0.1 with NaOH, prepared in ddH 2 0], and kept on ice for up to 8 hrs until used for electrophysiological recording.
  • Patch pipettes with a resistance of 3-5 mO were fabricated from borosilicate capillaries using a pipet puller (P-1000®, Sutter instruments). The glass electrode was then fire polished using a microforge (MF-830®, Narshige). Data acquisition and the holding potential parameters were controlled using the Clampex® software (Axon instruments). Current recorded from the successful patch was amplified using Axopatch 200-B® (Axon Instruments) and filtered at 2KHz. The signal was digitized using digidata 1400 A® (Axon instruments) and analyzed using Clampfit® (Axon Instruments).
  • Pattnaik, B.R. et al. A Novel KCNJ13 Nonsense Mutation and Loss of Kir7. l Channel Function Causes Leber Congenital Amaurosis (LCA16). HumMutat 36, 720-7 (2015).
  • FIG. 9 shows gene augmentation of W53X mutant expressing CHO cells had recovery of average inwardly rectifying K+ current (FIG. 9A. IV plot in red trace) compared to no current before (FIG 9A. plot in black trace).
  • FIG. 9B Average higher Rb+ current (red trace) in W53X mutant expressing cells after gene augmentation.
  • FIG. 9C Net increase in Rb+ permeability increased (Blue) through Kir7.l channel after gene augmentation.
  • FIG. 9D Complete recovery of resting membrane potential (RMP) after AAV-Kir7.l transduction of W53X expressing cells represented as blue box.
  • FIG. 9E Western blot results showing expression of full length protein product after gene augmentation in lane W53X + AAV (red band).
  • FIG. 10 shows Kir7. l expression (green) in W53X mutant line after gene augmentation through AAV-Kir7. l (FIG. 10A).
  • FIG. 10B A higher magnification image shows membrane localization of the Kir7.l protein alongside membrane marker WGA-Alexa 594. In the lower panel is the line scan for red and green showing membrane marker and Kir7.1 co-localize.
  • FIG. 11 left box is an example of a wild type mouse that received 2 m ⁇ of Lenti-EF 1 a-eGFPKir7.1 by sub-retinal injection. Electrophysiological results are obtained before (black trace) and 1 (blue trace), 2 (red trace), and 4 (green trace) weeks post injection.
  • retina responses recorded as normal a- and b-wave are shown on the left and RPE cell response c-wave is shown on the right. Only in the I st week after injection there was a reduction in retina response otherwise there was hardly any effect of gene therapy on electrophysiological outcome.
  • FIG. 11 left box is an example of a wild type mouse that received 2 m ⁇ of Lenti-EF 1 a-eGFPKir7.1 by sub-retinal injection. Electrophysiological results are obtained before (black trace) and 1 (blue trace), 2 (red trace), and 4 (green trace) weeks post injection.
  • retina responses recorded as normal a- and b-wave are shown on the left and RPE cell response c-wave
  • FIGS. 14A-F show functional recovery of Retinal Pigment Epithelial (RPE) cells lacking Kir7.l protein after gene therapy in the cKO mouse model.
  • FIG. 14A shows injection control on WT mice and the cKO control mice depicting the RPE response functional after 8 weeks with PBS injection. ERG response from the Kir7.l cKO mice which showed no a-, b- and c-wave during the screening (FIG. 14B).
  • 14D-F show representative optical coherence tomography (OCT) images showing the retinal structure from the control mice, cKO mice ( no-a-,b-c-wave) with no recovery and c-wave recovered mice (a-, b- but no-c-wave) during screening and post 8 weeks after lentiviral gene delivery, respectively.
  • OCT optical coherence tomography
  • mice were dark adapted overnight prior to performing ERG.
  • the mice were anesthetized with Ketamine/ Xylazine (80: 16 mg/kg) cocktail injected intra-peri toneally. While maintaining the body temperature at 37°C with a heating pad, the pupil of the mouse was dilated with a drop of tropicamide (Bausch + Lomb, Rochester, NY).
  • ERGs were performed using the Espion recording system (Diagnosys) by placing a corneal contact lens (Ocusciences Inc., MO) on the dilated eyes along with Gonak, a 2.5% hypromellose ophthalmic demulcent solution (GONIOVISC, HUB Pharmaceuticals, LLC, CA). A reference and the ground electrode were placed in the mouth and the back respectively.
  • the protocol for ERG consisted of recordings from flash intensities from 0.1 to 30 cd.s.m-2 and 60Hz line noise was removed using the filter.
  • the KCNJ13 knockout mice with no c- waveforms were used for this purpose.
  • the mice were maintained under tightly controlled temperature (23 ⁇ 5°C), humidity (40-50%) and light/dark (12/12 h) cycle conditions in 200 lux light environment. Prior to the injection, the mice were anesthetized and pupils were dilated as described above.
  • 2 pl of Lentivirus or Adeno- associated virus (AAV) carrying the functional full length KCNJ13 gene fused with eGFP and driven by EFla or VMD2 promoters were delivered to the RPE cells through sub-retinal injection using a lOmm 34 gauge needle.
  • eGFP fluorescence was detected using confocal microscopy after preparing a flat mount of the isolated RPE. Eyes from the Lentivirus/ AAV carrying eGFP-KCNJl3 gene injected mice were retrieved one week post injection. Enucleated eyes from the sacrificed mice were rinsed twice with PBS, a puncture was made at ora serrata with a 28 gauge needle and the eyes were opened along the corneal incisions. The lens was then carefully removed. The eye cup was flattened making incisions radially to the center resulting in a“starfish” appearance. The retina was then separated gently from the RPE layer.
  • AAV vectors for the delivery of Kir7.l protein were produced using VectorBuilder software of Cyagen Biosciences and packaging services from Cyagen Biosciences.
  • the following Tables 1-3 and FIG. 12 summarize the construction of AAV vectors that successfully rescued physiological defects in a Kcnj l3 gene.
  • Table 2 and Table 3 in FIG. 16 have the color-coded segments and sequence for the AAV vector encoding Kir7.l (SEQ ID NO:9).
  • AAV adeno-associated virus
  • An AAV vector is first constructed as a plasmid in E. coli. It is then transfected into packaging cells along with helper plasmids, where the region of the vector between the two inverted terminal repeats (ITRs) is packaged into live virus. When the virus is added to target cells, the double-stranded linear DNA genome is delivered into cells where it enters the nucleus and remains as episomal DNA without integration into the host genome. Any gene(s) placed in- between the two ITRs are introduced into target cells along with the rest of viral genome.
  • a major practical advantage of AAV is that in most cases AAV can be handled in biosafety level 1 (BSL1) facilities. This is due to AAV being inherently replication-deficient, producing little or no inflammation, and causing no known human disease.
  • BSL1 biosafety level 1
  • Many strains of AAV have been identified in nature. They are divided into different serotypes based on different antigenicity of the capsid protein on the viral surface. Different serotypes can render the virus with different tissue tropism (i.e. tissue specificity of infection). Different AAV serotypes have tropism for different cell types, and certain cell types may be hard to transduce by any serotype. See, e.g., Curr Opin Pharmacol. 24:59-67 (2015). We found that the AAV2 serotype may be used to effectively transduce retinal pigment epithelium (RPE) cells either in vitro or in vivo. See, e.g., Examples 1 and 2.
  • RPE retinal pigment epithelium
  • Lentivirus vectors for the delivery of Kir7.l protein were produced using VectorBuilder software of Cyagen Biosciences and packaging services from Cyagen Biosciences.
  • the following Tables 4-6 and FIG. 13 summarize the construction of Lentivirus vectors that successfully rescued physiological defects in the KCNJ13 gene.
  • Table 5 and 6 found in FIG. 17 provide the color index and sequence listing for the lentiviral vector (SEQ ID NO: 10).
  • the lentiviral vector system is a highly efficient vehicle for introducing genes permanently into mammalian cells.
  • Lentiviral vectors are derived from HIV, which is a member of the retrovirus family. Wildtype lentivirus has a plus-strand linear RNA genome.
  • a lentiviral vector is first constructed as a plasmid in E. coli. It is then transfected into packaging cells along with several helper plasmids. Inside the packaging cells, vector DNA located between the two long terminal repeats (LTRs) is transcribed into RNA, and viral proteins expressed by the helper plasmids further package the RNA into virus. Live virus is then released into the supernatant, which can be used to infect target cells directly or after concentration.
  • LTRs long terminal repeats
  • lentiviral vectors lack the genes required for viral packaging and transduction (these genes are instead carried by helper plasmids used during virus packaging).
  • virus produced from lentiviral vectors has the important safety feature of being replication incompetent (meaning that they can transduce target cells but cannot replicate in them).
  • the Lentivirus viral vectors described herein may be derived from the third-generation lentiviral vector system. See, e.g., J Virol. 72:8463 (1998). It is optimized for high copy number replication in E. coli, high-titer packaging of live virus, efficient viral transduction of a wide range of cells, efficient vector integration into the host genome, and high-level transgene expression.
  • the packaging system for the lentivirus viral vectors described herein may add the VSV- G envelop protein to the viral surface.
  • This protein has broad tropism and we found that it may help transduce retinal pigment epithelium (RPE) cells either in vitro or in vivo.
  • RPE retinal pigment epithelium

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2019/055635 2018-10-10 2019-10-10 Kir 7.1 gene therapy vectors and methods of using the same Ceased WO2020077091A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA3115782A CA3115782A1 (en) 2018-10-10 2019-10-10 Kir 7.1 gene therapy vectors and methods of using the same
EP19870458.7A EP3864160A4 (en) 2018-10-10 2019-10-10 KIR 7.1 GENE THERAPY VECTORS AND METHODS OF USING THE SAME
US17/284,408 US20210348196A1 (en) 2018-10-10 2019-10-10 Kir 7.1 gene therapy vectors and methods of using the same
AU2019357602A AU2019357602A1 (en) 2018-10-10 2019-10-10 Kir 7.1 gene therapy vectors and methods of using the same
CN201980081804.XA CN113227386A (zh) 2018-10-10 2019-10-10 Kir 7.1基因治疗载体及其使用方法
JP2021519805A JP2022512667A (ja) 2018-10-10 2019-10-10 Kir7.1遺伝子療法ベクターおよびその使用方法
IL282181A IL282181A (en) 2018-10-10 2021-04-08 Kir 7.1 Vectors for gene therapy and methods of use
JOP/2021/0067A JOP20210067A1 (ar) 2018-10-10 2021-04-08 ناقلات العلاج الجيني kir 7.1 وطرق استخدامها

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862743623P 2018-10-10 2018-10-10
US62/743,623 2018-10-10

Publications (1)

Publication Number Publication Date
WO2020077091A1 true WO2020077091A1 (en) 2020-04-16

Family

ID=70164038

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/055635 Ceased WO2020077091A1 (en) 2018-10-10 2019-10-10 Kir 7.1 gene therapy vectors and methods of using the same

Country Status (9)

Country Link
US (1) US20210348196A1 (cg-RX-API-DMAC7.html)
EP (1) EP3864160A4 (cg-RX-API-DMAC7.html)
JP (1) JP2022512667A (cg-RX-API-DMAC7.html)
CN (1) CN113227386A (cg-RX-API-DMAC7.html)
AU (1) AU2019357602A1 (cg-RX-API-DMAC7.html)
CA (1) CA3115782A1 (cg-RX-API-DMAC7.html)
IL (1) IL282181A (cg-RX-API-DMAC7.html)
JO (1) JOP20210067A1 (cg-RX-API-DMAC7.html)
WO (1) WO2020077091A1 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021184009A1 (en) * 2020-03-13 2021-09-16 Wisconsin Alumni Research Foundation Kir 7.1 gene therapy vectors and methods of using the same

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030036648A1 (en) * 1998-08-07 2003-02-20 Icagen, Inc. Human potassium channel genes
US20130035475A1 (en) * 2009-12-01 2013-02-07 The Rockerveller University Methods for Identifying Compounds That Modulate Ion Channel Activity of a Kir Channel
WO2017197355A2 (en) * 2016-05-13 2017-11-16 4D Molecular Therapeutics Inc. Adeno-associated virus variant capsids and methods of use thereof
US20180057795A1 (en) * 2016-07-25 2018-03-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Methods of producing modified natural killer cells and methods of use

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0922763A1 (en) * 1997-12-12 1999-06-16 Synthelabo Inwardly rectifying potassium channel gene and protein
US9567376B2 (en) * 2013-02-08 2017-02-14 The Trustees Of The University Of Pennsylvania Enhanced AAV-mediated gene transfer for retinal therapies
AU2014305218B2 (en) * 2013-08-05 2020-01-16 Academisch Ziekenhuis Leiden H.O.D.N. Leids Universitair Medisch Centrum Recombinant AAV-Crumbs homologue composition and methods for treating LCA-8 and progressive RP
LT3137497T (lt) * 2014-05-02 2021-07-26 Genzyme Corporation Aav vektoriai, skirti tinklainės ir cns genų terapijai
GB201519086D0 (en) * 2015-10-28 2015-12-09 Syncona Partners Llp Gene Therapy

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030036648A1 (en) * 1998-08-07 2003-02-20 Icagen, Inc. Human potassium channel genes
US20130035475A1 (en) * 2009-12-01 2013-02-07 The Rockerveller University Methods for Identifying Compounds That Modulate Ion Channel Activity of a Kir Channel
WO2017197355A2 (en) * 2016-05-13 2017-11-16 4D Molecular Therapeutics Inc. Adeno-associated virus variant capsids and methods of use thereof
US20180057795A1 (en) * 2016-07-25 2018-03-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Methods of producing modified natural killer cells and methods of use

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP3864160A4 *
SHAHI ET AL.: "Gene Augmentation and Readthrough Rescue Channelopathy in an iPSC-RPE Model of Congenital Blindness", AM J HUM GENET, vol. 104, no. 2, 7 February 2019 (2019-02-07), XP055704474 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021184009A1 (en) * 2020-03-13 2021-09-16 Wisconsin Alumni Research Foundation Kir 7.1 gene therapy vectors and methods of using the same

Also Published As

Publication number Publication date
EP3864160A1 (en) 2021-08-18
JP2022512667A (ja) 2022-02-07
CA3115782A1 (en) 2020-04-16
IL282181A (en) 2021-05-31
US20210348196A1 (en) 2021-11-11
CN113227386A (zh) 2021-08-06
AU2019357602A1 (en) 2021-05-13
JOP20210067A1 (ar) 2023-01-30
EP3864160A4 (en) 2022-10-26

Similar Documents

Publication Publication Date Title
US12071627B2 (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
US20220040327A1 (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
JP7190352B2 (ja) 認知保護を提供しつつ疾患の発症及び進行を遅らせるための遺伝子治療を用いた神経変性疾患の治療方法
US20230108913A1 (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
Reid et al. Improvement of photoreceptor targeting via intravitreal delivery in mouse and human retina using combinatory rAAV2 capsid mutant vectors
US20210079406A1 (en) Aav vectors encoding clarin-1 or gjb2 and uses thereof
TW202130654A (zh) 使用耳畸蛋白雙載體系統治療感覺神經性聽力損失之組合物及方法
EP3959324B1 (en) Aav vectors encoding mini-pcdh15 and uses thereof
CN109154002A (zh) 用于治疗显性视网膜色素变性的aav载体
JP2024538076A (ja) ステレオシリンプロモーター及びその使用
CN101065488A (zh) 将核酸递送到外周神经元的方法
US20210348196A1 (en) Kir 7.1 gene therapy vectors and methods of using the same
TW202313981A (zh) 用於增強視覺功能之組成物和方法
WO2025002450A1 (en) Engineered reprogramming factors and uses thereof for treating eye diseases
US20230108025A1 (en) Kir 7.1 gene therapy vectors and methods of using the same
HK40098362A (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
WO2025015317A2 (en) Complement pathway inhibitor fusions and methods of using the same
US20210290727A1 (en) MODULATION OF mTORCI ACTIVITY AND AUTOPHAGY VIA CIB2-RHEB INTERACTION
EP4713463A1 (en) Compositions and methods for treating gjb2-related hearing loss
Lee Transport of Outer Segment Proteins in Animal Models of Retinal Degenerations: Disease Mechanisms and Potential Therapies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19870458

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3115782

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021519805

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019357602

Country of ref document: AU

Date of ref document: 20191010

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019870458

Country of ref document: EP

Effective date: 20210510

WWE Wipo information: entry into national phase

Ref document number: 521421689

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 521421689

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 521421689

Country of ref document: SA

WWR Wipo information: refused in national office

Ref document number: 521421689

Country of ref document: SA

WWW Wipo information: withdrawn in national office

Ref document number: 282181

Country of ref document: IL