WO2020014625A1 - Methods of treating non-syndromic sensorineural hearing loss - Google Patents

Methods of treating non-syndromic sensorineural hearing loss Download PDF

Info

Publication number
WO2020014625A1
WO2020014625A1 PCT/US2019/041625 US2019041625W WO2020014625A1 WO 2020014625 A1 WO2020014625 A1 WO 2020014625A1 US 2019041625 W US2019041625 W US 2019041625W WO 2020014625 A1 WO2020014625 A1 WO 2020014625A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acids
amino acid
acid substitutions
amino
acids
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/041625
Other languages
English (en)
French (fr)
Inventor
Robert NG
Emmanuel J. Simons
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Akouos Inc
Original Assignee
Akouos Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Akouos Inc filed Critical Akouos Inc
Priority to CN201980057626.7A priority Critical patent/CN112639108A/zh
Priority to CA3106261A priority patent/CA3106261A1/en
Priority to AU2019300045A priority patent/AU2019300045A1/en
Priority to EP19833536.6A priority patent/EP3821019A4/en
Priority to JP2021500888A priority patent/JP2021530227A/ja
Priority to US17/259,661 priority patent/US12226493B2/en
Publication of WO2020014625A1 publication Critical patent/WO2020014625A1/en
Anticipated expiration legal-status Critical
Priority to JP2024079983A priority patent/JP2024109708A/ja
Priority to US19/015,387 priority patent/US20260000787A1/en
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/16—Otologicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/103—Ovine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14144—Chimeric viral vector comprising heterologous viral elements for production of another viral vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/007—Vectors comprising a special translation-regulating system cell or tissue specific

Definitions

  • the present disclosure relates generally to the use of nucleic acids to treat hearing loss in a human subject.
  • Non-syndromic deafness in contrast to syndromic deafness, is hearing loss that is not associated with other signs and symptoms. Seventy to eighty percent of cases of genetic deafness are non-syndromic. While the causes of non-syndromic deafness are complex, researchers have identified more than 30 genes that, when altered, are associated with non-syndromic deafness (e.g., stereocilin (STRC)).
  • STSC stereocilin
  • Hearing loss can be conductive (arising from the ear canal or middle ear), sensorineural (arising from the inner ear or auditory nerve), or mixed. Most forms of non-syndromic deafness are associated with permanent hearing loss caused by damage to structures in the inner ear (sensorineural deafness), although some forms may involve changes in the middle ear (conductive hearing loss).
  • sensorineural hearing loss is caused by abnormalities in the hair cells of the organ of Corti in the cochlea (poor hair cell function). The hair cells may be abnormal at birth, or may be damaged during the lifetime of an individual (e.g., as a result of noise trauma or infection).
  • the present invention is based on the discovery that a composition including at least two different nucleic acid vectors, where each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, can be used to generate a sequence encoding an active stereocilin protein (e.g., a full-length stereocilin protein) in a mammalian cell, and thereby treat non- syndromic sensorineural hearing loss in a subject in need thereof.
  • an active stereocilin protein e.g., a full-length stereocilin protein
  • compositions that include at least two different nucleic acid vectors, where: each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions being at least 30 amino acid residues in length, wherein the amino acid sequence of each of the encoded portions may optionally partially overlap with the amino acid sequence of a different one of the encoded portions; no single vector of the at least two different vectors encodes a full-length stereocilin protein; at least one of the coding sequences includes a nucleotide sequence spanning two neighboring exons of stereocilin genomic DNA, and lacks an intronic sequence between the two neighboring exons; and when introduced into a mammalian cell the at least two different vectors undergo homologous recombination with each other, thereby forming a recombined nucleic acid that encodes a full-length stereocilin protein.
  • each of the at least two different vectors is a plasmid, a transposon, a cosmid, an artificial chromosome, or a viral vector.
  • each of the at least two different vectors is a human artificial chromosome (HAC), yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), or a Pl- derived artificial chromosome (PAC).
  • HAC human artificial chromosome
  • YAC yeast artificial chromosome
  • BAC bacterial artificial chromosome
  • PAC Pl- derived artificial chromosome
  • each of the at least two different vectors is a viral vector selected from an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, or a retrovirus vector.
  • the viral vector is an AAV vector.
  • the amino acid sequence of none of the encoded portions overlaps with the amino acid sequence of a different one of the encoded portions. In some embodiments of any of the compositions described herein, the amino acid sequence of each of the encoded portions partially overlaps with the amino acid sequence of a different one of the encoded portions. In some embodiments of any of the compositions described herein, the overlapping amino acid sequence is between about 30 amino acid residues to about 1000 amino acid residues in length.
  • the vectors include two different vectors, each of which includes a different segment of an intron, wherein the intron includes the nucleotide sequence of an intron that is present in stereocilin genomic DNA, and wherein the two different segments overlap in sequence by at least 100 nucleotides.
  • the two different segments overlap in sequence by about 100 nucleotides to about 800 nucleotides.
  • the nucleotide sequence of each of the at least two different vectors is between about 500 nucleotides to about 10,000 nucleotides in length (e.g., between about 500 nucleotides to about 5,000 nucleotides in length).
  • the number of different vectors in the composition is two. In some embodiments, one of the two vectors includes SEQ ID NO: 13 and the second of the two vectors includes SEQ ID NO: 17.
  • one of the at least two different vectors includes a sequence encoding a stereocilin protein.
  • the sequence encoding a stereocilin protein is at least 90% (e.g., at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 11.
  • a first of the two different vectors includes a coding sequence that encodes an N-terminal portion of the stereocilin protein.
  • the N-terminal portion of the stereocilin protein is between 30 amino acids to 1600 amino acids in length (e.g., between about 200 amino acids to about 1500 amino acids in length).
  • the first vector further includes one or both of a promoter and a Kozak sequence.
  • the first vector includes a promoter that is an inducible promoter, a constitutive promoter, or a tissue-specific promoter.
  • the second of the two different vectors includes a coding sequence that encodes a C-terminal portion of the stereocilin protein.
  • the C-terminal portion of the stereocilin protein is between 30 amino acids to 1600 amino acids in length (e.g., between 200 amino acids to 1500 amino acids in length).
  • the second vector further includes a poly(dA) sequence.
  • Some embodiments of any of the compositions described herein further include a pharmaceutically acceptable excipient.
  • kits that include any of the compositions described herein. Some embodiments of any of the kits described herein further include a pre- loaded syringe containing the composition.
  • kits that include introducing into a cochlea of a mammal a therapeutically effective amount of any of the compositions described herein.
  • the mammal is a human.
  • the mammal has been previously identified as having a defective stereocilin gene.
  • compositions described herein into the mammalian cell In some embodiments of any of the methods described herein, the mammalian cell is a cochlear outer hair cell. In some embodiments of any of the methods described herein, the mammalian cell is a human cell. In some embodiments of any of the methods described herein, the mammalian cell has previously been determined to have a defective stereocilin gene.
  • Also provided herein are methods of increasing expression of a full-length stereocilin protein in an outer hair cell in a cochlea of a mammal that include introducing into the cochlea of the mammal a therapeutically effective amount of any of the compositions described herein.
  • the mammal has been previously identified as having a defective stereocilin gene.
  • the mammal is a human.
  • the subject is a human.
  • Some embodiments of any of the methods described herein further include, prior to the administering step, determining that the subject has a defective stereocilin gene.
  • compositions that include two different nucleic acid vectors, where: a first nucleic acid vector of the two different nucleic acid vectors includes a promoter, a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter, and a splicing donor signal sequence positioned at the 3’ end of the first coding sequence; and a second nucleic acid vector of the two different nucleic acid vectors including a splicing acceptor signal sequence, a second coding sequence that encodes a C-terminal portion of a stereocilin protein positioned at the 3’ end of the splicing acceptor signal sequence, and a
  • each of the encoded portions is at least 30 amino acid residues in length, where the amino acid sequence of each of the encoded portions do not overlap; where no single vector of the two different vectors encodes a full-length stereocilin protein; and when introduced into a mammalian cell, splicing occurs between the splicing donor signal sequence and the splicing acceptor signal sequence, thereby forming a recombined nucleic acid that encodes a full-length stereocilin protein.
  • at least one of the coding sequences includes a nucleotide sequence spanning two neighboring exons of stereocilin genomic DNA, and lacks an intronic sequence between the two neighboring exons.
  • compositions that include two different nucleic acid vectors, where: a first nucleic acid vector of the two different nucleic acid vectors includes a promoter, a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter, a splicing donor signal sequence positioned at the 3’ end of the first coding sequence, and a first detectable marker gene positioned 3’ of the splicing donor signal sequence; and a second nucleic acid vector of the two different nucleic acid vectors includes a second detectable marker gene, a splicing acceptor signal sequence positioned 3’ of the second detectable marker gene, a second coding sequence that encodies a C-terminal portion of a stereocilin protein positioned at the 3’ end of the splicing acceptor signal sequence, and a polyadenylation sequence positioned at the 3’ end of the second coding sequence; where each of the encoded portions is at least 30 amino acid residues in length, where the amino acids
  • At least one of the coding sequences includes a nucleotide sequence spanning two neighboring exons of stereocilin genomic DNA, and lacks an intronic sequence between the two neighboring exons.
  • the first or second detectable marker gene is alkaline phosphatase. In some embodiments of any of the compositions described herein, the first and second detectable marker genes are the same.
  • compositions that include two different nucleic acid vectors, where: a first nucleic acid vector of the two different nucleic acid vectors includes a promoter, a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ to the promoter, a splicing donor signal sequence positioned at the 3’ end of the first coding sequence, and a Fl phage recombinogenic region positioned 3’ to the splicing donor signal sequence; and a second nucleic acid vector of the two different nucleic acid vectors includes a Fl phage recombinogenic region, a splicing acceptor signal sequence positioned 3’ of the Fl phage
  • At least one of the coding sequences includes a nucleotide sequence spanning two neighboring exons of stereocilin genomic DNA, and lacks an intronic sequence between the two neighboring exons.
  • compositions that include: a Cas9 nuclease; a guide RNA that includes at the 5’ end of the guide RNA a complementary region consisting of 20 nucleotides that are complementary to 20 consecutive nucleotides within positions 13955-14151 of SEQ ID NO:5, that can be used in CRISPR/Cas9 RNA- guided genome editing to remove a nonsense mutation at a predetermined site in the endogenous stereocilin pseudogene sequence of SEQ ID NO: 5; and when introduced into a mammalian cell, a nucleic acid encoding a full-length stereocilin protein is reconstituted at the locus of the stereocilin pseudogene.
  • compositions that include at least one nucleic acid vector, wherein the at least one nucleic acid vector includes an adeno-associated virus (AAV) vector that includes an antisense oligonucleotide that is at least 80% complementary to a contiguous nucleotide sequence of SEQ ID NO: 5 at positions 13955-14151, where the antisense oligonucleotide is between 15-30 nucleotides in length; and when introduced into a mammalian cell, a nucleic acid encoding a full-length stereocilin protein is generated at the locus of the stereocilin pseudogene.
  • AAV adeno-associated virus
  • kits that include any of the compositions described herein. Some embodiments of any of the kits described herein further include a pre- loaded syringe containing the composition.
  • the mammal is a human.
  • the mammal has been previously identified as having a defective stereocilin gene.
  • compositions described herein into the mammalian cell In some embodiments of any of the methods described herein, the mammalian cell is a cochlear outer hair cell. In some embodiments of any of the methods described herein, the mammalian cell is a human cell. In some embodiments of any of the methods described herein, the mammalian cell has previously been determined to have a defective stereocilin gene.
  • Also provided herein are methods of increasing expression of a full-length stereocilin protein in an outer hair cell in a cochlea of a mammal that include introducing into the cochlea of the mammal a therapeutically effective amount of any of the compositions described herein.
  • the mammal has been previously identified as having a defective stereocilin gene.
  • the mammal is a human.
  • the subject is a human.
  • Some embodiments of any of the methods described herein further include, prior to the administering step, determining that the subject has a defective stereocilin gene.
  • “a” and“an” refers to one or to more than one (i.e., at least one) of the grammatical object of the article.
  • “an element” encompasses one element and more than one element.
  • mutation in a stereocilin gene refers to a modification in a wildtype stereocilin gene that results in the production of a stereocilin protein having one or more of: a deletion in one or more amino acids, one or more amino acid substitutions, and one or more amino acid insertions as compared to the wildtype stereocilin protein, and/or results in a decrease in the expressed level of the encoded stereocilin protein in a mammalian cell as compared to the expressed level of the encoded stereocilin protein in a mammalian cell not having a mutation.
  • a mutation can result in the production of a stereocilin protein having a deletion in one or more amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 16, 17, 18, 19, or 20 amino acids).
  • the mutation can result in a frameshift in the stereocilin gene.
  • the term“frameshift” is known in the art to encompass any mutation in a coding sequence that results in a shift in the reading frame of the coding sequence.
  • a frameshift can result in a nonfunctional protein.
  • a point mutation can be a nonsense mutation (i.e., result in a premature stop codon in an exon of the gene).
  • a nonsense mutation can result in the production of a truncated protein (as compared to a corresponding wildtype protein) that may or may not be functional.
  • the mutation can result in the loss (or a decrease in the level) of expression of stereocilin mRNA or stereocilin protein or both the mRNA and protein.
  • the mutation can result in the production of an altered stereocilin protein having a loss or decrease in one or more biological activities (functions) as compared to a wildtype stereocilin protein.
  • the mutation is an insertion of one or more nucleotides into a stereocilin gene.
  • the mutation is in a regulatory sequence of the stereocilin gene, i.e., a portion of the gene that is not coding sequence.
  • a mutation in a regulatory sequence may be in a promoter or enhancer region and prevent or reduce the proper transcription of the stereocilin gene.
  • the term“conservative mutation” refers to a mutation that does not change the amino acid encoded at the site of the mutation (due to codon degeneracy).
  • Modifications can be introduced into a nucleotide sequence by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
  • amino acids with basic side chains e.g., lysine, arginine, and histidine
  • acidic side chains e.g., aspartic acid and glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, and tryptophan
  • nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, and methionine
  • beta-branched side chains e.g., threonine, valine, and isoleucine
  • aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, and histidine
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and thus encode the same amino acid sequence.
  • endogenous refers to any material originating from within an organism, cell, or tissue.
  • exogenous refers to any material introduced from or originating from outside an organism, cell, or tissue that is not produced or does not originate from the same organism, cell, or tissue in which it is being introduced.
  • isolated means altered or removed from the natural state.
  • a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is“isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • transfected refers to a process by which exogenous nucleic acid is transferred or introduced into a cell.
  • A“transfected,” “transformed,” or “transduced” mammalian cell is one that has been transfected, transformed or transduced with exogenous nucleic acid.
  • the term“expression” refers to the transcription and/or translation of a particular nucleotide sequence encoding a protein.
  • the term“transient expression” refers to the expression of a non-integrated coding sequence for a short period of time (e.g., hours or days).
  • the coding sequence that is transiently expressed in a cell is lost upon multiple rounds of cell division.
  • subject is intended to include any mammal. In some embodiments,
  • the subject is a rodent (e.g., a rat or mouse), a rabbit, a non-human primate, or a human.
  • the subject has or is at risk of developing non-syndromic deafness.
  • the subject has been previously identified as having a mutation in a stereocilin gene.
  • the subject has been identified as having a mutation in a stereocilin gene and has been diagnosed with non-symptomatic sensorineural hearing loss.
  • the subject has been identified as having non-symptomatic sensorineural hearing loss.
  • a treatment is“therapeutically effective” when it results in a reduction in one or more of the number, severity, and frequency of one or more symptoms of a disease state (e.g., non-symptomatic sensorineural hearing loss) in a subject (e.g., a human).
  • a disease state e.g., non-symptomatic sensorineural hearing loss
  • a therapeutically effective amount of a composition can result in an increase in the expression level of an active stereocilin protein (e.g., a wildtype, full-length stereocilin protein or of a variant of a stereocilin protein that has the desired activity) (e.g., as compared to the expression level prior to treatment with the composition).
  • a therapeutically effective amount of a composition can result in an increase in the expression level of an active stereocilin protein (e.g., a wildtype, full-length stereocilin protein or active variant) in a target cell (e.g., a cochlear outer hair cell).
  • a therapeutically effective amount of a composition can result in an increase in the expression level of an active stereocilin protein (e.g., a wildtype, full-length stereocilin protein or active variant), and/or an increase in one or more activities of a stereocilin protein in a target cell (e.g., as compared to a reference level, such as the level(s) in a subject prior to treatment, the level(s) in a subject having a mutation in a stereocilin gene, or the level(s) in a subject or a population of subjects having non-symptomatic sensorineural hearing loss).
  • an active stereocilin protein e.g., a wildtype, full-length stereocilin protein or active variant
  • a target cell e.g., as compared to a reference level, such as the level(s) in a subject prior to treatment, the level(s) in a subject having a mutation in a stereocilin gene, or the level(s) in a subject or a population of subjects having non-symptom
  • nucleic acid or“polynucleotide” refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), or a combination thereof, in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses complementary sequences as well as the sequence explicitly indicated. In some embodiments of any of the nucleic acids described herein, the nucleic acid is DNA. In some embodiments of any of the nucleic acids described herein, the nucleic acid is RNA.
  • active stereocilin protein means a protein encoded by DNA that, if substituted for both wildtype alleles encoding full-length stereocilin protein in auditory hair cells of what is otherwise a wildtype mammal, and if expressed in the auditory hair cells of that mammal, results in that mammal’s having a level of hearing approximating the normal level of hearing of a similar mammal that is entirely wildtype.
  • active stereocilin proteins are full-length stereocilin proteins (e.g., any of the full-length stereocilin proteins described herein).
  • an active stereocilin protein can include a sequence of a wildtype, full-length stereocilin protein (e.g., a wildtype, human, full-length stereocilin protein) including 1 amino acid substitution to about 160 amino acid substitutions, 1 amino acid substitution to about 155 amino acid substitutions, 1 amino acid substitution to about 150 amino acid substitutions, 1 amino acid substitution to about 145 amino acid substitutions, 1 amino acid substitution to about 140 amino acid substitutions, 1 amino acid substitution to about 135 amino acid substitutions, 1 amino acid substitution to about 130 amino acid substitutions, 1 amino acid substitution to about 125 amino acid substitutions, 1 amino acid substitution to about 120 amino acid substitutions, 1 amino acid substitution to about 115 amino acid substitutions, 1 amino acid substitution to about 110 amino acid substitutions, 1 amino acid substitution to about 105 amino acid substitutions, 1 amino acid substitution to about 100 amino acid substitutions, 1 amino acid substitution to about 95 amino acid substitutions, 1 amino acid substitution to about 90 amino acid substitutions, 1 amino acid substitution to about 85 amino acid substitutions, 1 amino acid substitution to about 80 amino
  • substitutions about 2 amino acid substitutions to about 8 amino acid substitutions, about 2 amino acid substitutions to about 7 amino acid substitutions, about 2 amino acid substitutions to about 6 amino acid substitutions, about 2 amino acid
  • substitutions to about 5 amino acid substitutions about 2 amino acid substitutions to about 4 amino acid substitutions, between about 3 amino acid substitutions to about 160 amino acid substitutions, about 3 amino acid substitutions to about 155 amino acid substitutions, about 3 amino acid substitutions to about 150 amino acid substitutions, about 3 amino acid substitutions to about 145 amino acid substitutions, about 3 amino acid substitutions to about 140 amino acid substitutions, about 3 amino acid substitutions to about 135 amino acid substitutions, about 3 amino acid substitutions to about 130 amino acid substitutions, about 3 amino acid substitutions to about 125 amino acid substitutions, about 3 amino acid substitutions to about 120 amino acid substitutions, about 3 amino acid substitutions to about 115 amino acid substitutions, about 3 amino acid substitutions to about 110 amino acid substitutions, about 3 amino acid substitutions to about 105 amino acid substitutions, about 3 amino acid substitutions to about 100 amino acid substitutions, about 3 amino acid substitutions to about 95 amino acid substitutions, about 3 amino acid substitutions to about 90 amino acid substitutions, about 3 amino acid substitutions to about 85 amino acid substitutions,
  • substitutions to about 6 amino acid substitutions about 3 amino acid substitutions to about 5 amino acid substitutions, between about 4 amino acid substitutions to about 160 amino acid substitutions, about 4 amino acid substitutions to about 155 amino acid substitutions, about 4 amino acid substitutions to about 150 amino acid substitutions, about 4 amino acid substitutions to about 145 amino acid substitutions, about 4 amino acid substitutions to about 140 amino acid substitutions, about 4 amino acid substitutions to about 135 amino acid substitutions, about 4 amino acid substitutions to about 130 amino acid substitutions, about 4 amino acid substitutions to about 125 amino acid substitutions, about 4 amino acid substitutions to about 120 amino acid substitutions, about 4 amino acid substitutions to about 115 amino acid substitutions, about 4 amino acid substitutions to about 110 amino acid substitutions, about 4 amino acid substitutions to about 105 amino acid substitutions, about 4 amino acid substitutions to about 100 amino acid substitutions, about 4 amino acid substitutions to about 95 amino acid substitutions, about 4 amino acid substitutions to about 90 amino acid substitutions, about 4 amino acid substitutions to about 85 amino acid substitutions,
  • substitutions about 5 amino acid substitutions to about 8 amino acid substitutions, about 5 amino acid substitutions to about 7 amino acid substitutions, between about 6 amino acid substitutions to about 160 amino acid substitutions, about 6 amino acid substitutions to about 155 amino acid substitutions, about 6 amino acid substitutions to about 150 amino acid substitutions, about 6 amino acid substitutions to about 145 amino acid substitutions, about 6 amino acid substitutions to about 140 amino acid substitutions, about 6 amino acid substitutions to about 135 amino acid substitutions, about 6 amino acid substitutions to about 130 amino acid substitutions, about 6 amino acid substitutions to about 125 amino acid substitutions, about 6 amino acid substitutions to about 120 amino acid substitutions, about 6 amino acid substitutions to about 115 amino acid substitutions, about 6 amino acid substitutions to about 110 amino acid substitutions, about 6 amino acid substitutions to about 105 amino acid substitutions, about 6 amino acid substitutions to about 100 amino acid substitutions, about 6 amino acid substitutions to about 95 amino acid substitutions, about 6 amino acid substitutions to about 90 amino acid substitutions, about 6 amino acid substitutions to
  • substitutions between about 7 amino acid substitutions to about 160 amino acid substitutions, about 7 amino acid substitutions to about 155 amino acid substitutions, about 7 amino acid substitutions to about 150 amino acid substitutions, about 7 amino acid substitutions to about 145 amino acid substitutions, about 7 amino acid substitutions to about 140 amino acid substitutions, about 7 amino acid substitutions to about 135 amino acid substitutions, about 7 amino acid substitutions to about 130 amino acid substitutions, about 7 amino acid substitutions to about 125 amino acid substitutions, about 7 amino acid substitutions to about 120 amino acid substitutions, about 7 amino acid substitutions to about 115 amino acid substitutions, about 7 amino acid substitutions to about 110 amino acid substitutions, about 7 amino acid substitutions to about 105 amino acid substitutions, about 7 amino acid substitutions to about 100 amino acid substitutions, about 7 amino acid substitutions to about 95 amino acid substitutions, about 7 amino acid substitutions to about 90 amino acid substitutions, about 7 amino acid substitutions to about 85 amino acid substitutions, about 7 amino acid substitutions to about 80 amino acid substitutions, about 7 amino acid substitutions to
  • substitutions to about 55 amino acid substitutions about 8 amino acid substitutions to about 50 amino acid substitutions, about 8 amino acid substitutions to about 45 amino acid substitutions, about 8 amino acid substitutions to about 40 amino acid
  • substitutions about 8 amino acid substitutions to about 35 amino acid substitutions, about 8 amino acid substitutions to about 30 amino acid substitutions, about 8 amino acid substitutions to about 25 amino acid substitutions, about 8 amino acid
  • substitutions to about 20 amino acid substitutions about 8 amino acid substitutions to about 15 amino acid substitutions, about 8 amino acid substitutions to about 10 amino acid substitutions, between about 10 amino acid substitutions to about 160 amino acid substitutions, about 10 amino acid substitutions to about 155 amino acid substitutions, about 10 amino acid substitutions to about 150 amino acid substitutions, about 10 amino acid substitutions to about 145 amino acid substitutions, about 10 amino acid substitutions to about 140 amino acid substitutions, about 10 amino acid substitutions to about 135 amino acid substitutions, about 10 amino acid substitutions to about 130 amino acid substitutions, about 10 amino acid substitutions to about 125 amino acid substitutions, about 10 amino acid substitutions to about 120 amino acid substitutions, about 10 amino acid substitutions to about 115 amino acid substitutions, about 10 amino acid substitutions to about 110 amino acid substitutions, about 10 amino acid substitutions to about 105 amino acid substitutions, about 10 amino acid substitutions to about 100 amino acid substitutions, about 10 amino acid substitutions to about 95 amino acid substitutions, about 10 amino acid substitutions to about 90 amino acid substitutions,
  • amino acids that are conserved between wildtype stereocilin proteins from different species can be mutated without losing activity, while those amino acids that are not conserved between wildtype stereocilin proteins from different species should not be mutated as they are more likely (than amino acids that are not conserved between different species) to be involved in activity.
  • An active stereocilin protein can include, e.g., a sequence of a wildtype, full- length stereocilin protein (e.g., a wildtype, human, full-length stereocilin protein) that has 1 amino acid to about 50 amino acids, 1 amino acid to about 45 amino acids, 1 amino acid to about 40 amino acids, 1 amino acid to about 35 amino acids, 1 amino acid to about 30 amino acids, 1 amino acid to about 25 amino acids, 1 amino acid to about 20 amino acids, 1 amino acid to about 15 amino acids, 1 amino acid to about 10 amino acids, 1 amino acid to about 9 amino acids, 1 amino acid to about 8 amino acids, 1 amino acid to about 7 amino acids, 1 amino acid to about 6 amino acids, 1 amino acid to about 5 amino acids, 1 amino acid to about 4 amino acids, 1 amino acid to about 3 amino acids, about 2 amino acids to about 50 amino acids, about 2 amino acids to about 45 amino acids, about 2 amino acids to about 40 amino acids, about 2 amino acids to about 35 amino acids, about 2 amino acids to about 30 amino acids, about 2 amino acids to about
  • the two or more deleted amino acids can be contiguous in the sequence of the wildtype, full- length protein. In other examples where two or more amino acids are deleted from the sequence of a wildtype, full-length stereocilin protein, the two or more deleted amino acids are not contiguous in the sequence of the wildtype, full-length protein.
  • amino acids that are not conserved between wildtype, full-length stereocilin proteins from different species can be deleted without losing activity, while those amino acids that are conserved between wildtype, full-length stereocilin proteins from different species should not be deleted as they are more likely (than amino acids that are not conserved between different species) to be involved in activity.
  • an active stereocilin protein can, e.g., include a sequence of a wildtype, full-length stereocilin protein that has between 1 amino acid to about 100 amino acids, 1 amino acid to about 95 amino acids, 1 amino acid to about 90 amino acids, 1 amino acid to about 85 amino acids, 1 amino acid to about 80 amino acids, 1 amino acid to about 75 amino acids, 1 amino acid to about 70 amino acids, 1 amino acid to about 65 amino acids, 1 amino acid to about 60 amino acids, 1 amino acid to about 55 amino acids, 1 amino acid to about 50 amino acids, 1 amino acid to about 45 amino acids, 1 amino acid to about 40 amino acids, 1 amino acid to about 35 amino acids, 1 amino acid to about 30 amino acids, 1 amino acid to about 25 amino acids, 1 amino acid to about 20 amino acids, 1 amino acid to about 15 amino acids, 1 amino acid to about 10 amino acids, 1 amino acid to about 9 amino acids, 1 amino acid to about 8 amino acids, 1 amino acid to about 7 amino acids, 1 amino acid to about 6 amino acids, 1 amino acid to about 5 amino acids, 1
  • an active stereocilin protein can, e.g., include the sequence of a wildtype, full-length stereocilin protein where 1 amino acid to 50 amino acids, 1 amino acid to 45 amino acids, 1 amino acid to 40 amino acids, 1 amino acid to 35 amino acids, 1 amino acid to 30 amino acids, 1 amino acid to 25 amino acids, 1 amino acid to 20 amino acids, 1 amino acid to 15 amino acids, 1 amino acid to 10 amino acids, 1 amino acid to 9 amino acids, 1 amino acid to 8 amino acids, 1 amino acid to 7 amino acids, 1 amino acid to 6 amino acids, 1 amino acid to 5 amino acids, 1 amino acid to 4 amino acids, 1 amino acid to 3 amino acids, about 2 amino acids to 50 amino acids, about 2 amino acids to 45 amino acids, about 2 amino acids to 40 amino acids, about 2 amino acids to 35 amino acids, about 2 amino acids to 30 amino acids, about 2 amino acids to 25 amino acids, about 2 amino acids to 20 amino acids, about
  • 2 amino acids to 15 amino acids about 2 amino acids to 10 amino acids, about 2 amino acids to 9 amino acids, about 2 amino acids to 8 amino acids, about 2 amino acids to 7 amino acids, about 2 amino acids to 6 amino acids, about 2 amino acids to 5 amino acids, about 2 amino acids to 4 amino acids, about 3 amino acids to 50 amino acids, about 3 amino acids to 45 amino acids, about 3 amino acids to 40 amino acids, about 3 amino acids to 35 amino acids, about 3 amino acids to 30 amino acids, about
  • 3 amino acids to 25 amino acids about 3 amino acids to 20 amino acids, about 3 amino acids to 15 amino acids, about 3 amino acids to 10 amino acids, about 3 amino acids to 9 amino acids, about 3 amino acids to 8 amino acids, about 3 amino acids to 7 amino acids, about 3 amino acids to 6 amino acids, about 3 amino acids to 5 amino acids, about 4 amino acids to 50 amino acids, about 4 amino acids to 45 amino acids, about 4 amino acids to 40 amino acids, about 4 amino acids to 35 amino acids, about
  • 4 amino acids to 30 amino acids about 4 amino acids to 25 amino acids, about 4 amino acids to 20 amino acids, about 4 amino acids to 15 amino acids, about 4 amino acids to 10 amino acids, about 4 amino acids to 9 amino acids, about 4 amino acids to 8 amino acids, about 4 amino acids to 7 amino acids, about 4 amino acids to 6 amino acids, about 5 amino acids to 50 amino acids, about 5 amino acids to 45 amino acids, about 5 amino acids to 40 amino acids, about 5 amino acids to 35 amino acids, about
  • 5 amino acids to 30 amino acids about 5 amino acids to 25 amino acids, about 5 amino acids to 20 amino acids, about 5 amino acids to 15 amino acids, about 5 amino acids to 10 amino acids, about 5 amino acids to 9 amino acids, about 5 amino acids to 8 amino acids, about 5 amino acids to 7 amino acids, about 6 amino acids to 50 amino acids, about 6 amino acids to 45 amino acids, about 6 amino acids to 40 amino acids, about 6 amino acids to 35 amino acids, about 6 amino acids to 30 amino acids, about
  • the 1 amino acid to 50 amino acids can be inserted as a contiguous sequence into the sequence of a wildtype, full-length protein. In some examples, the 1 amino acid to 50 amino acids (or any subrange thereof) are not inserted as a contiguous sequence into the sequence of a wildtype, full-length protein. As can be appreciated in the art, the 1 amino acid to 50 amino acids can be inserted into a portion of the sequence of a wildtype, full-length protein that is not well- conserved between species.
  • Figure 1 is an exemplary schematic representation of a genetic map of a STRC vector (pITR-20l; SEQ ID NO: 12; 4324 basepairs (bp)) that can be used in any of the present methods described herein.
  • the vector includes an inverted terminal repeat (ITR) sequence (SEQ ID NO: 18), a 5’ FVIII stuffer sequence (SEQ ID NO: 19), a CMV enhancer (SEQ ID NO: 20), a CMV promoter (SEQ ID NO: 21), a 5’ untranslated region (UTR) sequence (SEQ ID NO: 24), a 5’ STRC coding sequence (SEQ ID NO: 25), a splicing donor signal sequence (SD) (SEQ ID NO: 6), a highly recombinogenic sequence from Fl phage (AK; SEQ ID NO: 26), and an ITR sequence (SEQ ID NO: 36).
  • ITR inverted terminal repeat
  • SEQ ID NO: 18 SEQ ID NO: 18
  • SEQ ID NO: 19 a
  • Figure 2 is an exemplary schematic representation of a genetic map of a STRC vector (pITR-202; SEQ ID NO: 13; 4434 bp) that can be used in any of the present methods described herein.
  • the vector includes an ITR sequence (SEQ ID NO: 18), an AK sequence (SEQ ID NO: 26), a SD sequence (SEQ ID NO: 6), a 3’ STRC coding sequence (SEQ ID NO: 28), a 3’ UTR sequence (SEQ ID NO: 33), a bovine growth hormone poly-adenylation signal (bGHpA) (SEQ ID NO: 34), a 3’ FVIII stuffer sequence (SEQ ID NO: 35), and an ITR sequence (SEQ ID NO: 36).
  • Figure 3 is an exemplary schematic representation of a genetic map of a STRC vector (pITR-202GFP; SEQ ID NO: 14; 4693 bp) that can be used in any of the present methods described herein.
  • the vector includes an ITR sequence (SEQ ID NO: 18), an AK sequence (SEQ ID NO: 26), a SD sequence (SEQ ID NO: 6), a 3’ STRC coding sequence (SEQ ID NO: 28), a T2A sequence (SEQ ID NO: 29), a tGFP sequence (SEQ ID NO: 31), a 3’ UTR sequence (SEQ ID NO: 33), a bGHpA sequence (SEQ ID NO: 34), and an ITR sequence (SEQ ID NO: 36).
  • Figure 4 is an exemplary schematic representation of a genetic map of a STRC vector (pITR-203; SEQ ID NO: 15; 4619 bp) that can be used in any of the present methods described herein.
  • the vector includes an ITR sequence (SEQ ID NO: 18), a 5’ FVIII stuffer_500 sequence (SEQ ID NO: 37), a CMV enhancer (SEQ ID NO: 20), a CMV promoter sequence (SEQ ID NO: 21), a 5’ UTR sequence (SEQ ID NO: 24), a 5’ STRC coding sequence (SEQ ID NO: 25), a SD sequence (SEQ ID NO: 6), an AP sequence (AP) (SEQ ID NO: 27), and an ITR sequence (SEQ ID NO: 36).
  • Figure 5 is an exemplary schematic representation of a genetic map of a STRC vector (pITR-204; SEQ ID NO: 16; 4729 bp) that can be used in any of the present methods described herein.
  • the vector includes an ITR sequence (SEQ ID NO: 18), an AP sequence (SEQ ID NO: 27), a splicing acceptor signal (SA) sequence (SEQ ID NO: 7), a 3’ STRC coding sequence (SEQ ID NO: 28), a 3’ UTR sequence (SEQ ID NO: 33), a bGHpA sequence (SEQ ID NO: 34), and an ITR sequence (SEQ ID NO: 36).
  • Figure 6 is an exemplary schematic representation of a genetic map of a STRC vector (pITR-205; SEQ ID NO: 17; 4460 bp) that can be used in any of the present methods described herein.
  • the vector includes an ITR sequence (SEQ ID NO: 18), a CMV enhancer (SEQ ID NO: 20), a chicken b-actin (CBA) promoter (SEQ ID NO: 22), a chimeric intron sequence (SEQ ID NO: 23), a 5’ UTR sequence (SEQ ID NO: 24), a 5’ STRC coding sequence (SEQ ID NO: 25), a SD sequence (SEQ ID NO: 6), an AK sequence (SEQ ID NO: 26), and an ITR sequence (SEQ ID NO: 36).
  • ITR sequence SEQ ID NO: 18
  • CMV enhancer SEQ ID NO: 20
  • CBA chicken b-actin
  • SEQ ID NO: 22 a chimeric intron sequence
  • SEQ ID NO: 23 a 5’ UTR
  • Figure 7 is an image of an immunoblot of STRC protein levels from transfected HEK293FT cells with single or dual STRC vectors 72-hours post- transfection using a polyclonal STRC antibody b-actin (ACTB) was used as a loading control.
  • ACTB polyclonal STRC antibody b-actin
  • Lane 1 Prestrained Page Rule; Lane 2 - 400 ng pITR-20l plus 400 ng pITR-202; Lane 3 - 400 ng pITR-20l plus 400 ng pITR-202GFP; Lane 4 - 400 ng pITR-203 plus 400 ng pITR-204; Lane 5 - 400 ng pITR-205 plus 400 ng pITR-202; Lane 6 - 400 ng pITR-205 plus 400 ng pITR-202GFP; Lane 7 - 800 ng pITR- 202GFP; and Lane 8 - untrasfected control cell lysate.
  • Figure 8 is an image of an immunoblot of STRC protein levels from transduced HEK293FT cells with dual STRC vectors (AAV2.STRC and
  • Anc80.STRC at different MOIs (2.6E5, 8.6E4, 2.6E5, and 8.6E4) 72-hours post transfection using a polyclonal STRC antibody b-actin (ACTB) was used as a loading control.
  • ACTB polyclonal STRC antibody b-actin
  • Figure 9 is a bar graph showing the relative RNA expression of STRC (5’ STRC, 3’ STRC and full-length STRC) relative to GAPDH in HEK293FT cells transduced with AAV2.STRC (at MOI 8.6E4 and MOI 2.6E5) and Anc80.STRC (at MOI 8.6E4 and 2.6E5), respectively.
  • Figure 10 is a bar graph showing the relative RNA expression of STRC (5’ STRC, 3’ STRC and full-length STRC) relative to GAPDH in P 1-3 cochlear explants from WT mice infected l6-hours with AAV2.STRC (at MOI 1.3E10) and
  • Figure 11A is an exemplary fluorescent image of P 1-3 cochlear explants from mock-infected WT mice showing Myo7a and phalloidin staining.
  • Figure 11B is an exemplary fluorescent image of P 1-3 cochlear explants from mock-infected WT mice showing Myo7a and phalloidin staining. Magnification 20x.
  • Figure 11C is an exemplary fluorescent image of P 1-3 cochlear explants from AAV.Anc80.STRC-infected (at MOI 7.8E8 VG/cochlea) WT mice showing Myo7a and phalloidin staining.
  • Figure 11D is an exemplary fluorescent image of P 1-3 cochlear explants from AAVanc80.dSTRC-infected (at MOI 2.6E8 VG/cochlea) WT mice showing Myo7a and phalloidin staining. Magnification 20x.
  • Figure HE is an exemplary fluorescent image of P 1-3 cochlear explants from AAV.Anc80.STRC-infected (at MOI 7.8E8 VG/cochlea) WT mice showing Myo7a and phalloidin staining. Magnification 20x.
  • Figure 12A is an exemplary fluorescent image of P 1-3 cochlear explants from AAV2.STRC-infected (at MOI 7.8E8 VG/cochlea) WT mice showing Myo7a and phalloidin staining.
  • Figure 12B is an exemplary fluorescent image of P 1-3 cochlear explants from AAV2.STRC-infected (at MOI 2.6E8 VG/cochlea) WT mice showing Myo7a and phalloidin staining. Magnification 20x.
  • Figure 12C is an exemplary fluorescent image of P 1-3 cochlear explants from AAV2.STRC-infected (at MOI 7.8E8 VG/cochlea) WT mice showing Myo7a and phalloidin staining. Magnification 20x.
  • compositions that include at least two different nucleic acid vectors, where: each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions being at least 30 amino acid residues in length, where the amino acid sequence of each of the encoded portions may optionally partially overlap with the amino acid sequence of a different one of the encoded portions; no single vector of the at least two different vectors encodes an active stereocilin protein (e.g., a full- length stereocilin protein); at least one of the coding sequences comprises a nucleotide sequence spanning two neighboring exons of stereocilin genomic DNA, and lacks an intronic sequence between the two neighboring exons; and, when introduced into a mammalian cell comprising chromosomal DNA, the at least two different vectors undergo homologous recombination with each other and with the chromosomal DNA of the cell, thereby forming a recombined nucleic acid
  • compositions, kits, and methods are described herein and can be used in any combination without limitation.
  • the STRC gene encodes stereocilin, a protein that is normally expressed in the inner ear and is associated with the stereocilia of specialized hair cells in the inner ear (see, e.g., Verpy et al., Nature 456: 255-258, 2008; and Zhang et al., J Med. Genet.
  • Stereocilia which are about 10-50 pm in length, are important for hearing and balance. Stereocilia play a mechanosensing role in hearing. By bending in response to sound, they form a structure for mechanoreception of sound stimulation.
  • the human STRC gene is located on chromosome l5ql5. It contains 29 exons encompassing -19 kilobases (kb) (Verpy et al., Nature Genetics 29(3): 345- 349, 2001; NCBI Accession No. NG011636.1). The gene is tandemly duplicated on chromosome 15ql 5 in a telomere-to-centromere orientation, with the tandem copies located less than lOOkb apart on the chromosome. The coding sequence of the second copy is interrupted by a stop codon in exon 20, meaning that it is a“pseudogene” that encodes a nonfunctional truncated protein.
  • the full-length STRC protein is a full- length wildtype STRC protein.
  • the full-length wildtype STRC protein expressed from the human STRC gene is 1775 residues in length, and contains a signal peptide and several hydrophobic segments. When the signal peptide is cleaved off during processing of the wildtype protein, the resulting mature wildtype stereocilin protein is 1719 residues in length.
  • a full-length STRC protein can include a heterologous signal peptide positioned N-terminal to an amino acid sequence of a mature wildtype stereocilin protein.
  • Various mutations in the STRC gene have been associated with hearing loss (e.g., non-symptomatic sensorineural hearing loss).
  • hearing loss e.g., non-symptomatic sensorineural hearing loss.
  • DFNB16 autosomal recessive non-syndromic sensorineural deafness- 16
  • Another example found in a family with DFNB16 includes both a 4-bp deletion in exon 5 and a larger deletion encompassing exons 17-29. The two deletions were inherited from the father and mother, respectively.
  • the 4-bp deletion was predicted to result in the translation of 5 out-of-frame amino acids and a premature stop codon in exon 5.
  • Additional exemplary mutations in a stereocilin gene detected in subjects having non-symptomatic sensorineural hearing loss and methods of sequencing a nucleic acid encoding stereocilin are described in, e.g., Verpy et al., Nature 456:255- 259, 2008; Verpy et al., Res. Systems Neurosci. 519: 194-210, 2011; Hofrichter et al., Clinical Genetics 87:49-55, 2015; and Mandelker et al., J. Mol. Diagnostics 16:639- 647, 2014.
  • Methods of detecting mutations in a gene are well-known in the art. Non limiting examples of such techniques include: real-time polymerase chain reaction (RT-PCR), PCR, sequencing, Southern blotting, and Northern blotting.
  • An exemplary human wildtype stereocilin protein is or includes the sequence of SEQ ID NO: 1.
  • Non-limiting examples of nucleic acid encoding a wildtype stereocilin protein are or include SEQ ID NO: 2 and SEQ ID NO: 3.
  • SEQ ID NO: 2 At least some or all of the codons in SEQ ID NO: 2 can be codon-optimized to allow for optimal expression in a non-human mammal or in a human.
  • the stereocilin protein comprises a sequence that is at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 1 or SEQ ID NO: 11.
  • a stereocilin protein can include a sequence that is identical to SEQ ID NO: 1, except that it includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions and/or deletions.
  • a non4imiting example of a human wildtype stereocilin genomic DNA sequence is SEQ ID NO: 4.
  • the exons in SEQ ID NO: 4 are: nucleotide positions 1- 142 (exon 1), nucleotide positions 445-1230 (exon 2), nucleotide positions 1319-1343 (exon 3), nucleotide positions 2111-3368 (exon 4), nucleotide positions 4325-4387 (exon 5), nucleotide positions 4489-4605 (exon 6), nucleotide positions 4748-4914 (exon 7), nucleotide positions 5570-5756 (exon 8), nucleotide positions 5895-6010 (exon 9), nucleotide positions 6292-6424 (exon 10), nucleotide positions 6777-6959 (exon 11), nucleotide positions 7264-7302 (exon 12), nucleotide positions 7486-7653 (exon 13), nucleotide positions 78
  • the introns are located between each of these exons in SEQ ID NO: 4, i.e., at nucleotide positions 143-444 (intron 1), nucleotide positions 1231 to 1318 (intron 2), nucleotide positions 1344-2110 (intron 3), nucleotide positions 3369-4324 (intron 4), nucleotide positions
  • the nucleotide sequence of the human STRC pseudogene is shown in SEQ ID NO: 5.
  • STRCP1 Human Stereocilin Pseudogene 1 (SEQ ID NO: 5)
  • a stereocilin can be encoded by a sequence that is at least 70%, at least 72%, at least 74%, at least 75%, at least 76%, at least 78%, at least 80%, at least 82%, at least 84%, at least 85%, at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 8 or SEQ ID NO: 9.
  • amino acids that are not conserved between the same protein from different species is less likely to have an effect on the function of a protein and therefore, these amino acids should be selected for mutation.
  • Amino acids that are conserved between the same protein from different species should not be mutated, as these mutations are more likely to result in a change in the function of the protein.
  • stereocilin from other mammalian species are shown below.
  • Dog Stereocilin Protein (SEQ ID NO: 9) malslwpvll lltcaatlvs sgiqsldpdl sllksllstm dqapqgslsr sqfsaflani sssfesgrmg egpvgepppl qspalrlhdf lvtlrgspdw epmlgllgdv lallgqeqtp rdflghqagv lgglaevllg alvpigpptp trppcirdgp sdcvlvadwl psllll says rwqalvqvqp svdptnatgl dgrepaphf1 qgllglltpv gelgseealw ggllrtvgap lyaafqegll rvtdslrnev fsilgqpepd angqcq
  • compositions provided herein include at least two (e.g., two, three, four, five, or six) nucleic acid vectors, where: each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions being at least 30 amino acids (e.g., between about 30 amino acids to about 1600 amino acids, about 30 amino acids to about 1550 amino acids, about 30 amino acids to about 1500 amino acids, about 30 amino acids to about 1450 amino acids, about 30 amino acids to about 1400 amino acids, about 30 amino acids to about 1350 amino acids, about 30 amino acids to about 1300 amino acids, about 30 amino acids to about 1250 amino acids, about 30 amino acids to about 1200 amino acids, about 30 amino acids to about 1150 amino acids, about 30 amino acids to about 1100 amino acids, about 30 amino acids to about 1050 amino acids, about 30 amino acids to about 1000 amino acids, about 30 amino acids to about 950 amino acids, about 30 amino acids to about 900 amino acids, about 30 amino acids to about 850
  • one of the nucleic acid vectors can include a coding sequence that encodes a portion of a stereocilin protein, where the encoded portion is, e.g., about 900 amino acids to about 1600 amino acids, about 900 amino acids to about 1550 amino acids, about 900 amino acids to about 1500 amino acids, about 900 amino acids to about 1450 amino acids, about 900 amino acids to about 1400 amino acids, about 900 amino acids to about 1350 amino acids, about 900 amino acids to about 1300 amino acids, about 900 amino acids to about 1250 amino acids, about 900 amino acids to about 1200 amino acids, about 900 amino acids to about 1150 amino acids, about 900 amino acids to about 1100 amino acids, about 900 amino acids to about 1050 amino acids, about 900 amino acids to about 1000 amino acids, about 900 amino acids to about 950 amino acids, about 950 amino acids to about 1600 amino acids, about 950 amino acids to about 1550 amino acids, about 950 amino acids to about 1500 amino acids, about 950 amino acids to about 14
  • At least one of the coding sequences includes a nucleotide sequence spanning two neighboring exons of stereocilin genomic DNA, and lacks the intronic sequence that naturally occurs between the two neighboring exons.
  • the amino acid sequence of none of the encoded portions overlaps even in part with the amino acid sequence of a different one of the encoded portions. In some embodiments, the amino acid sequence of one or more of the encoded portions partially overlaps with the amino acid sequence of a different one of the encoded portions. In some embodiments, the amino acid sequence of each of the encoded portions partially overlaps with the amino acid sequence of a different one of the encoded portions.
  • the overlapping amino acid sequence is between about 30 amino acid residues to about 1000 amino acids (e.g., or any of the subranges of this range described herein) in length.
  • the vectors include two different vectors, each of which comprises a different segment of an intron, wherein the intron includes the nucleotide sequence of an intron that is present in a stereocilin genomic DNA (e.g., any of the exemplary introns in SEQ ID NO: 4 described herein), and wherein the two different segments overlap in sequence by at least 100 nucleotides (e.g., about 100 nucleotides to about 5,000 nucleotides, about 100 nucleotides to about 4,500 nucleotides, about 100 nucleotides to about 4,000 nucleotides, about 100 nucleotides to about 3,500 nucleotides, about 100 nucleotides to about 3,000 nucleotides, about 100 nucleotides to about 2,500 nucleotides, about 100 nucleotides to about 2,000 nucleotides, about 100 nucleotides to about 1,500 nucleotides, about 100 nucleotides to about 1,000 nucleotides
  • the overlapping nucleotide sequence in any two of the different vectors can include part or all of one or more exons of a stereocilin gene (e.g., any one or more of the exemplary exons in SEQ ID NO: 4 described herein).
  • the number of different vectors in the composition is two, three, four, or five.
  • the first of the two different vectors can include a coding sequence that encodes an N-terminal portion of the stereocilin protein.
  • the N-terminal portion of the stereocilin gene is between about 30 amino acids to about 1780 amino acids (or any of the subranges of this range described above) in length.
  • the first vector further includes one or both of a promoter (e.g., any of the promoters described herein or known in the art) and a Kozak sequence (e.g., any of the exemplary Kozak sequences described herein or known in the art).
  • the first vector includes a promoter that is an inducible promoter, a constitutive promoter, or a tissue-specific promoter.
  • the second of the two different vectors includes a coding sequence that encodes a C-terminal portion of the stereocilin protein.
  • the C- terminal portion of the stereocilin protein is between 30 amino acids to about 1780 amino acids (or any of the subranges of this range described above) in length.
  • the second vector further includes a poly(A) sequence.
  • the N-terminal portion encoded by one of the two vectors can include a portion comprising amino acid position 1 to about amino acid position 1,500, about amino acid position 1,490, about amino acid position 1,480, about amino acid position 1,470, about amino acid position 1,460, about amino acid position 1,450, about amino acid position 1,440, about amino acid position 1,430, about amino acid position 1,420, about amino acid position 1,410, about amino acid position 1,400, about amino acid position 1,390, about amino acid position 1,380, about amino acid position 1,370, about amino acid position 1,360, about amino acid position 1,350, about amino acid position 1,340, about amino acid position 1,330, about amino acid position 1,320, about amino acid position 1,310, about amino acid position 1,300, about amino acid position 1,290, about amino acid position 1,280, about amino acid position 1,270, about amino acid position 1,260, about amino acid position 1,250, about amino acid position 1,240, about amino acid position 1,230, about amino acid position 1,220, about amino acid position 1,210
  • amino acid position 220 about amino acid position 210, about amino acid position 200, about amino acid position 190, about amino acid position 180, about amino acid position 170, about amino acid position 160, about amino acid position 150, about amino acid position 140, about amino acid position 130, about amino acid position 120, about amino acid position 110, about amino acid position 100, about amino acid position 90, about amino acid position 80, about amino acid position 70, about amino acid position 60, about amino acid position 50, or about amino acid position 40 of a wildtype stereocilin protein (e.g., SEQ ID NO: 1).
  • a wildtype stereocilin protein e.g., SEQ ID NO: 1
  • the N-terminal portion of the precursor stereocilin protein can include a portion comprising amino acid position 1 to amino acid position 310, amino acid position 1 to about amino acid position 320, amino acid position 1 to about amino acid position 330, amino acid position 1 to about amino acid position 340, amino acid position 1 to about amino acid position 350, amino acid position 1 to about amino acid
  • amino acid position 360 amino acid position 1 to about amino acid position 370, amino acid position 1 to about amino acid position 380, amino acid position 1 to about amino acid position 390, amino acid position 1 to about amino acid position 400, amino acid position 1 to about amino acid position 410, amino acid position 1 to about amino acid position 420, amino acid position 1 to about amino acid position 430, amino acid position 1 to about amino acid position 440, amino acid position 1 to about amino acid position 450, amino acid position 1 to about amino acid position 460, amino acid position 1 to about amino acid position 470, amino acid position 1 to about amino acid position 480, amino acid position 1 to about amino acid position 490, amino acid position 1 to about amino acid position 500, amino acid position 1 to about amino acid position 510, amino acid position 1 to about amino acid position 520, amino acid position 1 to about amino acid position 530, amino acid position 1 to about amino acid position 540, amino acid position 1 to about amino acid position 550, amino acid position 1 to about amino acid position 560, amino acid position 1 to about amino acid position 570,
  • composition means a composition including a
  • polynucleotide capable of carrying at least one exogenous nucleic acid fragment, e.g., a plasmid vector, a transposon, a cosmid, an artificial chromosome (e.g., a human artificial chromosome (HAC), a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), or a Pl -derived artificial chromosome (PAC)) or a viral vector (e.g., any adenoviral vectors (e.g., pSV or pCMV vectors), any retroviral vectors as described herein) and any Gateway® vectors.
  • an artificial chromosome e.g., a human artificial chromosome (HAC), a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), or a Pl -derived artificial chromosome (PAC)
  • a viral vector e.g., any adenoviral vectors (e.
  • a vector can, e.g., include sufficient cis-acting elements for expression; other elements for expression can be supplied by the host mammalian cell or in an in vitro expression system.
  • the term “vector” includes any genetic element (e.g., a plasmid, a transposon, a cosmid, an artificial chromosome, or a viral vector, etc.) that is capable of replicating when associated with the proper control elements.
  • the term includes cloning and expression vectors, as well as viral vectors (e.g., an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, or a retrovirus vector).
  • AAV adeno-associated virus
  • Vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide. Skilled practitioners will be capable of selecting suitable vectors and mammalian cells for making any of the nucleic acids described herein.
  • the vector is a plasmid (i.e. a circular DNA molecule that can autonomously replicate inside a cell).
  • the vector can be a cosmid (e.g., pWE and sCos series (Wahl et al. (1987), Evans et al. (1989)).
  • the vector(s) is an artificial chromosome.
  • An artificial chromosome is a genetically engineered chromosome that can be used as a vector to carry large DNA inserts.
  • the artificial chromosome is human artificial chromosome (HAC) (see, e.g., Kouprina et al., Expert Opin. Drug Deliv 11(4): 517-535, 2014; Basu et al., Pediatr. Clin. North Am. 53: 843-853, 2006; Ren et al., Stem. Cell Rev. 2(l):43-50, 2006; Kazuki et al., Mol. Ther. 19(9): 1591-1601,
  • the vector(s) is a yeast artificial chromosome (YAC) (see, e.g., Murray et al., Nature 305: 189-193, 1983; Ikeno et al. (1998) Nat. Biotech. 16:431-439, 1998).
  • the vector(s) is a bacterial artificial chromosome (BAC) (e.g., pBeloBACl l, pECBACl, and pBACl08L).
  • BAC bacterial artificial chromosome
  • the vector(s) is a Pl -derived artificial chromosome (PAC). Examples of artificial chromosome are known in the art.
  • the vector(s) is a viral vector (e.g., adeno-associated virus, adenovirus, lentivirus, and retrovirus).
  • a viral vector e.g., adeno-associated virus, adenovirus, lentivirus, and retrovirus.
  • viral vectors are described herein.
  • the vector(s) is an adeno-associated viral vector (AAV) (see, e.g., Asokan et ah, Mol. Ther. 20: 699-7080, 2012).
  • AAV adeno-associated viral vector
  • Recombinant AAV vectors or“rAAVs” are typically composed of, at a minimum, a transgene or a portion thereof and a regulatory sequence, and optionally 5' and 3'
  • AAV inverted terminal repeats Such a recombinant AAV vector is packaged into a capsid and delivered to a selected target cell (e.g., an outer hair cell).
  • the AAV sequences of the vector typically comprise the cis-acting 5' and 3' ITR sequences (See, e.g., B. J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 168, 1990).
  • Typical AAV ITR sequences are about 145 nucleotides in length.
  • at least 75% of a typical ITR sequence e.g., at least 80%, at least 85%, at least 90%, or at least 95%) is incorporated into the AAV vector. The ability to modify these ITR sequences is within the skill of the art.
  • any of the coding sequences described herein are flanked by 5' and 3' AAV ITR sequences in the AAV vectors.
  • the AAV ITR sequences may be obtained from any known AAV, including presently identified AAV types.
  • a non-limiting example of a 5’ AAV ITR sequence is SEQ ID NO: 18.
  • a non-limiting example of a 3’ AAV ITR sequence is SEQ ID NO: 36.
  • AAV vectors as described herein may include any of the regulatory elements described herein (e.g., one or more of a promoter, a polyA sequence, and an IRES).
  • the AAV vector is selected from the group consisting of: an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV2.7m8 vector, an AAV8BP2 vector, and an AAV293 vector.
  • Additional exemplary AAV vectors that can be used herein are known in the art. See, e.g., Kanaan et al., Mol. Ther. Nucleic Acids 8: 184-197, 2017; Li et al. , Mol. Ther. 16(7): 1252-1260; Adachi et al., Nat. Commun. 5: 3075, 2014; Isgrig et al., Nat. Commun. 10(1): 427, 2019; and Gao et al., J. Virol. 78(12): 6381-6388.
  • an AAV vector provided herein includes or consists of a sequence that is at least 80% identical (e.g., at least 82%, at least 84%, at least 85%, at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, at least 99%, or 100% identical) to SEQ ID NOs: 12-17.
  • pITR-201 SEQ ID NO: 12
  • the vector(s) is an adenovirus (see, e.g., Dmitriev et al. (1998) J Virol. 72: 9706-9713; and Poulin et al., J. Virol % : 10074-10086, 2010).
  • the vector(s) is a retrovirus (see, e.g., Maier et al. (2010) Future Microbiol 5: 1507-23).
  • the vector(s) is a lentivirus (see, e.g., Matrai et al.
  • a lentiviral vector refers to a vector derived from at least a portion of a lentivirus genome, including especially a self inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453- 1464 (2009).
  • Non-limiting lentivirus vectors that may be used in the clinic include the LENTIVECTOR® gene delivery technology from Oxford BioMedica, the LENTIMAXTM vector system from Lentigen, and the like. Other types of lentiviral vectors are also available and would be known to one skilled in the art.
  • the vectors provided herein can be of different sizes.
  • the choice of vector that is used in any of the compositions, kits, and methods described herein may depend on the size of the vector.
  • the vector(s) is a plasmid and can include a total length of up to about 1 kb, up to about 2 kb, up to about 3 kb, up to about 4 kb, up to about 5 kb, up to about 6 kb, up to about 7 kb, up to about 8kb, up to about 9 kb, up to about 10 kb, up to about 11 kb, up to about 12 kb, up to about 13 kb, up to about 14 kb, or up to about 15 kb.
  • the vector(s) is a plasmid and can have a total length in a range of about 1 kb to about 2 kb, about 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 1 kb to about 6 kb, about 1 kb to about 7 kb, about 1 kb to about 8 kb, about 1 kb to about 9 kb, about 1 kb to about 10 kb, about 1 kb to about 11 kb, about 1 kb to about 12 kb, about 1 kb to about 13 kb, about 1 kb to about 14 kb, or about 1 kb to about 15 kb.
  • the vector(s) is a transposon (e.g., PiggyBac transposon) and can include greater than 200 kb.
  • the vector(s) is a transposon having a total length in the range of about 1 kb to about 10 kb, about 1 kb to about 20 kb, about 1 kb to about 30 kb, about 1 kb to about 40 kb, about 1 kb to about 50 kb, about 1 kb to about 60 kb, about 1 kb to about 70 kb, about 1 kb to about 80 kb, about 1 kb to about 90 kb, about 10 kb to about 20 kb, about 10 kb to about 30 kb, about 10 kb to about 40 kb, about 10 kb to about 50 kb, about 10 kb to about 60 kb, about 10 kb to about 70 kb, about 10 kb to about 90 kb, about 10 k
  • the vector is a cosmid and can have a total length of up to 55 kb.
  • the vector is a cosmid and has a total number of nucleotides of about 1 kb to about 10 kb, about 1 kb to about 20 kb, about 1 kb to about 30 kb, about 1 kb to about 40 kb, about 1 kb to about 50 kb, about 1 kb to about 55 kb, about 10 kb to about 20 kb, about 10 kb to about 30 kb, about 10 kb to about 40 kb, about 10 kb to about 50 kb, about 10 kb to about 55 kb, about 15 kb to about 55 kb, about 15 kb to about 50 kb, about 15 kb to about 40 kb, about 15 kb to about
  • the vector(s) is an artificial chromosome and can have a total number of nucleotides of about 100 kb to about 2000 kb. In some embodiments, the vector(s) is an artificial chromosome and can have a total number of nucleotides of about 100 kb to about 2000 kb. In some
  • the artificial chromosome(s) is a human artificial chromosome (HAC) and can have a total number of nucleotides in the range of about 1 kb to about 10 kb,
  • the artificial chromosome(s) is a yeast artificial chromosome (YAC) and can have a total number of nucleotides up to 1000 kb.
  • the artificial chromosome(s) is a YAC having a total number of nucleotides in the range of about 100 kb to about 1,000 kb, about 100 kb to about 900 kb, about 100 kb to about 800 kb, about 100 kb to about 700 kb, about 100 kb to about 600 kb, about 100 kb to about 500 kb, about 100 kb to about 400 kb, about 100 kb to about 300 kb, about 100 kb to about 200 kb, about 200 kb to about 1,000 kb, about 200 kb to about 900 kb, about 200 kb to about 800 kb, about 200 kb to about 700 kb, about 200 kb to about 600 kb, about 200 kb to about 300 k
  • the artificial chromosome(s) is a bacterial artificial chromosome (BAC) and can have a total number of nucleotides of up to 750 kb.
  • the artificial chromosome(s) is a BAC and can have a total number of nucleotides in the range of about 100 kb to about 750 kb, about 100 kb to about 700 kb, about 100 kb to about 600 kb, about 100 kb to about 500 kb, about 100 kb to about 400 kb, about 100 kb to about 300 kb, about 100 kb to about 200 kb, about 150 kb to about 750 kb, about 150 kb to about 700 kb, about 150 kb to about 600 kb, about 150 kb to about 500 kb, about 150 kb to about 400 kb, about 150 kb to about 300 kb, about 150 kb to about 200 kb, about 150 kb to about
  • the artificial chromosome(s) is a Pl-derived artificial chromosome (PAC) and can have a total number of nucleotides of up to 300 kb.
  • the Pl -derived artificial chromosome(s) can have a total number of nucleotides in the range of about 100 kb to about 300 kb, about 100 kb to about 200 kb, or about 200 kb to about 300 kb.
  • the vector(s) is a viral vector and can have a total number of nucleotides of up to 10 kb.
  • the viral vector(s) can have a total number of nucleotides in the range of about 1 kb to about 2 kb, 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 1 kb to about 6 kb, about 1 kb to about 7 kb, about 1 kb to about 8 kb, about 1 kb to about 9 kb, about
  • the vector(s) is a lentivirus and can have a total number of nucleotides of up to 8 kb.
  • the lentivirus(es) can have a total number of nucleotides of about 1 kb to about 2 kb, about 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 1 kb to about 6 kb, about 1 kb to about 7 kb, about 1 kb to about 8 kb, about 2 kb to about 3 kb, about 2 kb to about 4 kb, about 2 kb to about 5 kb, about 2 kb to about 6 kb, about 2 kb to about 7 kb, about
  • the vector(s) is an adenovirus and can have a total number of nucleotides of up to 8 kb.
  • the adenovirus(es) can have a total number of nucleotides in the range of about 1 kb to about 2 kb, about 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 1 kb to about
  • the vector(s) is an adeno-associated virus (AAV vector) and can include a total number of nucleotides of up to 5 kb.
  • AAV vector(s) can include a total number of nucleotides in the range of about 1 kb to about 2 kb, about 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 2 kb to about 3 kb, about 2 kb to about 4 kb, about 2 kb to about 5kb, about 3 kb to about 4 kb, about 3 kb to about 5 kb, or about 4 kb to about 5 kb.
  • the vector(s) is a Gateway® vector and can include a total number of nucleotides of up to 5 kb.
  • each Gateway® vector(s) includes a total number of nucleotides in the range of about 1 kb to about 2 kb, about 1 kb to about 3 kb, about 1 kb to about 4 kb, about 1 kb to about 5 kb, about 2 kb to about 3 kb, about 2 kb to about 4 kb, about 2 kb to about 5 kb, about 3 kb to about 4 kb, about 3 kb to about 5 kb, or about 4 kb to about 5 kb.
  • the at least two different vectors can be substantially the same type of vector and may differ in size. In some embodiments, the at least two different vectors can be different types of vector, and may have substantially the same size or have different sizes.
  • any of the at least two vectors can have a total number of nucleotides in the range of about 500 nucleotides to about 10,000 nucleotides, about 500 nucleotides to about 9,500 nucleotides, about 500 nucleotides to about 9,000 nucleotides, about 500 nucleotides to about 8,500 nucleotides, about 500 nucleotides to about 8,000 nucleotides, about 500 nucleotides to about 7,800 nucleotides, about 500 nucleotides to about 7,600 nucleotides, about 500 nucleotides to about 7,400 nucleotides, about 500 nucleotides to about 7,200 nucleotides, about 500 nucleotides to about 7,000 nucleotides, about 500 nucleotides to about 6,800 nucleotides, about 500 nucleotides to about 6,600 nucleotides, about 500 nucleotides to about 6,400 nucleotides, about 500 nucleotides to about 500
  • exemplary vectors that can be used in any of the compositions and methods described herein. See, e.g., Figures 1-6.
  • a variety of different methods known in the art can be used to introduce any of vectors disclosed herein into a mammalian cell (e.g., a cochlear outer hair cell).
  • Non-limiting examples of methods for introducing nucleic acid into a mammalian cell include: lipofection, transfection (e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection), or transfection using liposomes (e.g., cationic liposomes)), microinjection, electroporation, cell squeezing, sonoporation, protoplast fusion, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral transfection, and nucleofection.
  • lipofection e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection), or transfection using liposomes (e.g., cationic liposome
  • any of the vectors described herein can be introduced into a mammalian cell by, for example, lipofection, and can be stably integrated into an endogenous gene locus (e.g., a stereocilin gene locus or a stereocilin pseudogene 1 gene locus).
  • an endogenous gene locus e.g., a stereocilin gene locus or a stereocilin pseudogene 1 gene locus.
  • the vectors provided herein stably integrate into an endogenous defective stereocilin gene locus, and thereby replace the defective stereocilin gene with a nucleic acid encoding a functioning (e.g., wildtype) stereocilin protein.
  • Various molecular biology techniques that can be used to introduce a mutation(s) and/or a deletion(s) into an endogenous gene are also known in the art.
  • Non-limiting examples of such techniques include site-directed mutagenesis, CRISPR (e.g., CRISPR/Cas9-induced knock-in mutations and CRISPR/Cas9-induced knock out mutations), and TALENs. These methods can be used to correct the sequence of a defective endogenous gene present in a chromosome of a target cell.
  • any of the vectors described herein can further include a control sequence, e.g., a control sequence selected from the group of a transcription initiation sequence, a transcription termination sequence, a promoter sequence, an enhancer sequence, an RNA splicing sequence, a polyadenylation (polyA) sequence, and a Kozak consensus sequence.
  • a control sequence e.g., a control sequence selected from the group of a transcription initiation sequence, a transcription termination sequence, a promoter sequence, an enhancer sequence, an RNA splicing sequence, a polyadenylation (polyA) sequence, and a Kozak consensus sequence.
  • a promoter can be a native promoter, a constitutive promoter, an inducible promoter, and/or a tissue-specific promoter. Promoters
  • promoter means a DNA sequence recognized by enzymes/proteins in a mammalian cell required to initiate the transcription of a specific gene (e.g., a stereocilin gene).
  • a promoter typically refers to, e.g., a nucleotide sequence to which an RNA polymerase and/or any associated factor binds and at which transcription is initiated. Non-limiting examples of promoters are described herein. Additional examples of promoters are known in the art.
  • a vector encoding an N-terminal portion of a stereocilin protein can include a promoter and/or an enhancer.
  • the vector encoding the N-terminal portion of the stereocilin protein can include any of the promoters and/or enhancers described herein or known in the art.
  • the promoter is an inducible promoter, a constitutive promoter, a mammalian cell promoter, a viral promoter, a chimeric promoter, an engineered promoter, a tissue-specific promoter, or any other type of promoter known in the art.
  • the promoter is a RNA polymerase II promoter, such as a mammalian RNA polymerase II promoter.
  • the promoter is a RNA polymerase III promoter, including, but not limited to, a Hl promoter, a human U6 promoter, a mouse U6 promoter, or a swine U6 promoter.
  • the promoter will generally be one that is able to promote transcription in cochlear cells such as hair cells.
  • the promoter is a cochlea-specific promoter or a cochlea-oriented promoter.
  • promoters are known in the art that can be used herein.
  • Non limiting examples of promoters that can be used herein include: human EFla, human cytomegalovirus (CMV) (US Patent No. 5,168,062), human ubiquitin C (UBC), mouse phosphoglycerate kinase 1, polyoma adenovirus, simian virus 40 (SV40), b- globin, b-actin, a-fetoprotein, g-globin, b-interferon, g-glutamyl transferase, mouse mammary tumor virus (MMTV), Rous sarcoma virus, rat insulin, glyceraldehyde-3- phosphate dehydrogenase, metallothionein II (MT II), amylase, cathepsin, MI muscarinic receptor, retroviral LTR (e.g.
  • human T-cell leukemia virus HTLV human T-cell leukemia virus HTLV
  • AAV ITR interleukin-2, collagenase, platelet-derived growth factor, adenovirus 5 E2, stromelysin, murine MX gene, glucose regulated proteins (GRP78 and GRP94), a-2- macroglobulin, vimentin, MHC class I gene H-2K b, HSP70, proliferin, tumor necrosis factor, thyroid stimulating hormone a gene, immunoglobulin light chain, T- cell receptor, ELLA DQa and ⁇ z)b, interleukin-2 receptor, MHC class II, MHC class II HLA-DRa, muscle creatine kinase, prealbumin (transthyretin), elastase I, albumin gene, c-fos, c-HA-ras, neural cell adhesion molecule (NCAM), H2B (TH2B) histone, rat growth hormone, human serum amyloid (S
  • the promoter is the CMV immediate early promoter. In some embodiments, the promoter is a CMV promoter, e.g., a CMV promoter comprising or consisting of SEQ ID NO: 21. In some embodiments, the promoter is a CAG promoter or a CAG/CBA promoter. In some embodiments, the promoter is a CBA promoter, e.g., a CBA promoter comprising or consisting of SEQ ID NO: 22.
  • RNA refers to a nucleotide sequence that, when operably linked with a nucleic acid encoding a protein (e.g., a stereocilin protein), causes RNA to be transcribed from the nucleic acid in a mammalian cell under most or all physiological conditions.
  • a protein e.g., a stereocilin protein
  • constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter, the cytomegalovirus (CMV) promoter (see, e.g., Boshart et al, Cell 41 :521-530, 1985), the SV40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 -alpha promoter (Invitrogen).
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • SV40 promoter the dihydrofolate reductase promoter
  • beta-actin promoter the beta-actin promoter
  • PGK phosphoglycerol kinase
  • EF1 -alpha promoter Invitrogen
  • Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only.
  • Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech, and Ariad. Additional examples of inducible promoters are known in the art.
  • inducible promoters regulated by exogenously supplied compounds include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. U.S.A. 93:3346-3351, 1996), the tetracycline-repressible system (Gossen et al, Proc. Natl. Acad. Sci. U.S.A.
  • tissue-specific promoter refers to a promoter that is active only in certain specific cell types and/or tissues (e.g., transcription of a specific gene occurs only within cells expressing transcription regulatory proteins that bind to the tissue-specific promoter).
  • the regulatory sequences impart tissue-specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue-specific manner.
  • tissue-specific promoters include but are not limited to the following: a liver-specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-l (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, an alpha-myosin heavy chain (a-MHC) promoter, and a cardiac Troponin T (cTnT) promoter.
  • Additional exemplary promoters include Beta-actin promoter, hepatitis B virus core promoter (Sandig et al., Gene Ther. 3: 1002-1009, 1996), alpha-fetoprotein (AFP) promoter (Arbuthnot et al., Hum. Gene Ther. 7: 1503-1514, 1996), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep. 24: 185-196, 1997); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res. 11 :654-664, 1996), CD2 promoter (Hansal et al., J. Immunol. 161 : 1063-1068,
  • immunoglobulin heavy chain promoter T cell receptor alpha-chain promoter
  • neuronal such as neuron-specific enolase (NSE) promoter
  • NSE neuron-specific enolase
  • neurofilament light-chain gene promoter Piccioli et al., Proc. Natl. Acad. Sci. U.S.A. 88:5611-5615, 1991
  • neuron-specific vgf gene promoter Pieroct al., Neuron 15:373-384, 1995.
  • the tissue-specific promoter is a cochlea-specific promoter. In some embodiments, the tissue-specific promoter is a cochlear hair cell- specific promoter.
  • cochlear hair cell-specific promoters include but are not limited to: a ATOH1 promoter, a POET4F3 promoter, a LHX3 promoter, a MY07A promoter, a MY06 promoter, a a9ACHR promoter, and a alOACHR promoter.
  • the promoter is an outer hair cell- specific promoter such as a PRESTIN promoter or an ONCOMOD promoter. See, e.g., Zheng et al., Nature 405: 149-155, 2000; Tian et al. Dev. Dyn. 231 : 199-203,
  • a vector can include a promoter sequence and/or an enhancer sequence.
  • the term“enhancer” refers to a nucleotide sequence that can increase the level of transcription of a nucleic acid encoding a protein of interest (e.g., a stereocilin protein). Enhancer sequences (50-1500 basepairs in length) generally increase the level of transcription by providing additional binding sites for
  • an enhancer sequence is found within an intronic sequence. ETnlike promoter sequences, enhancer sequences can act at much larger distance away from the transcription start site (e.g., as compared to a promoter).
  • enhancers include a RSV enhancer, a CMV enhancer, and a SV40 enhancer.
  • the CMV enhancer sequence comprises or consists of SEQ ID NO: 20.
  • any of the vectors provided herein can include a poly(A) sequence.
  • Most nascent eukaryotic mRNAs possess a poly(A) tail at their 3’ end which is added during a complex process that includes cleavage of the primary transcript and a coupled polyadenylation reaction (see, e.g., Proudfoot et al., Cell 108:501-512, 2002).
  • the poly(A) tail confers mRNA stability and transferability (Molecular Biology of the Cell, Third Edition by B. Alberts et al., Garland Publishing, 1994).
  • the poly(A) sequence is positioned 3’ to the nucleic acid sequence encoding the C-terminus of the stereocilin protein.
  • polyadenylation refers to the covalent linkage of a polyadenylyl moiety, or its modified variant, to a messenger RNA molecule.
  • mRNA messenger RNA
  • the 3' poly(A) tail is a long sequence of adenine nucleotides (e.g., 50, 60, 70, 100, 200, 500, 1000, 2000, 3000, 4000, or 5000) added to the pre-mRNA through the action of an enzyme, polyadenylate polymerase.
  • poly(A) tail is added onto transcripts that contain a specific sequence, the polyadenylation signal or“poly(A) sequence.”
  • the poly(A) tail and the protein bound to it aid in protecting mRNA from degradation by exonucleases.
  • Polyadenylation is also important for transcription termination, export of the mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but additionally can also occur later in the cytoplasm. After transcription has been terminated, the mRNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase.
  • the cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA has been cleaved, adenosine residues are added to the free 3' end at the cleavage site.
  • a“poly(A) sequence” is a sequence that triggers the endonuclease cleavage of an mRNA and the additional of a series of adenosines to the 3’ end of the cleaved mRNA.
  • poly(A) sequences that can be used, including those derived from bovine growth hormone (bgh) (Woychik et al., Proc. Natl. Acad. Sci. U.S.A. 8l(l3):3944-3948, 1984; U.S. Patent No. 5,122,458), mouse-P-globin, mouse-a- globin (Orkin et al., EMBO J. 4(2):453-456, 1985; Thein et al., Blood 71(2): 313-319, 1988), human collagen, polyoma virus (Batt et al., Mol. Cell Biol.
  • bovine growth hormone bgh
  • mouse-P-globin mouse-a- globin
  • mouse-a- globin Orkin et al., EMBO J. 4(2):453-456, 1985; Thein et al., Blood 71(2): 313-319, 1988
  • human collagen polyoma virus
  • the Herpes simplex virus thymidine kinase gene HSV TK
  • IgG heavy-chain gene polyadenylation signal US 2006/0040354
  • human growth hormone hGH
  • the group consisting of SV40 poly(A) site such as the SV40 late and early poly(A) site (Schek et al., Mol. Cell Biol. 12(12):5386-5393, 1992).
  • the bGH polyA sequence comprises or consists of SEQ ID NO: 34.
  • the poly(A) sequence can a sequence of AATAAA.
  • the AATAAA sequence may be substituted with other hexanucleotide sequences with homology to AATAAA which are capable of signaling polyadenylation, including ATTAAA, AGTAAA, CATAAA, TAT A A A, GAT AAA, ACT AAA, A AT AT A, AAGAAA, AATAAT, AAAAAA, AATGAA, AATCAA, AACAAA, AATCAA, AATAAC, A AT AG A, AATTAA, or A AT A AG (see, e.g., WO 06/12414).
  • the poly(A) sequence can be a synthetic
  • the poly(A) sequence is the polyadenylation signal of soluble neuropilin-l (sNRP) (A A AT A A A AT AC G A A AT G, SEQ ID NO: 38) (see, e g., WO 05/073384).
  • sNRP soluble neuropilin-l
  • a vector encoding the C-terminus of the stereocilin protein can include a polynucleotide internal ribosome entry site (IRES).
  • IRES polynucleotide internal ribosome entry site
  • An IRES sequence is used to produce more than one polypeptide from a single gene transcript.
  • An IRES forms a complex secondary structure that allows translation initiation to occur from any position with an mRNA immediately downstream from where the IRES is located (see, e.g., Pelletier and Sonenberg, Mol. Cell. Biol. 8(3): 1103-1112, 1988).
  • IRES sequences known to those in skilled in the art, including those from, e.g., foot and mouth disease virus (FMDV),
  • EMCV encephalomyocarditis virus
  • HRV human rhinovirus
  • HAV human immunodeficiency virus
  • HAV hepatitis A virus
  • HCV hepatitis C virus
  • PV poliovirus
  • the IRES sequence that is incorporated into the vector that encodes the C-terminus of a stereocilin protein is the foot and mouth disease virus (FMDV).
  • FMDV foot and mouth disease virus
  • the Foot and Mouth Disease Virus 2A sequence is a small peptide
  • reporter sequences include DNA sequences encoding: a beta-lactamase, a beta- galactosidase (LacZ), an alkaline phosphatase, a thymidine kinase, a green fluorescent protein (GFP), a red fluorescent protein, an mCherry fluorescent protein, a yellow fluorescent protein, a chloramphenicol acetyltransferase (CAT), and a luciferase. Additional examples of reporter sequences are known in the art.
  • the reporter sequence When associated with regulatory elements which drive their expression, the reporter sequence can provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence, or other spectrographic assays; fluorescent activating cell sorting (FACS) assays; immunological assays (e.g., enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry).
  • FACS fluorescent activating cell sorting
  • immunological assays e.g., enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry.
  • the reporter sequence is turbo green fluorescent protein (tGFP) (SEQ ID NO: 31).
  • tGFP cDNA SEQ ID NO: 31
  • the reporter sequence is the LacZ gene, and the presence of a vector carrying the LacZ gene in a mammalian cell (e.g., a cochlear outer hair cell) is detected by assays for beta-galactosidase activity.
  • a mammalian cell e.g., a cochlear outer hair cell
  • the reporter is a fluorescent protein (e.g., green fluorescent protein) or luciferase
  • the presence of a vector carrying the fluorescent protein or luciferase in a mammalian cell may be measured by fluorescent techniques (e.g., fluorescent microscopy or FACS) or light production in a
  • the reporter sequence can be used to verify the tissue-specific targeting capabilities and tissue-specific promoter regulatory activity of any of the vectors described herein.
  • any of the vectors described herein can include an untranslated region.
  • a vector can includes a 5’ UTR or a 3’ UTR.
  • Untranslated regions (UTRs) of a gene are transcribed but not translated.
  • the 5' UTR starts at the transcription start site and continues to the start codon but does not include the start codon.
  • the 3' UTR starts immediately following the stop codon and continues until the transcriptional termination signal.
  • the regulatory features of a UTR can be incorporated into any of the vectors, compositions, kits, or methods as described herein to enhance the stability of a stereocilin protein.
  • Natural 5' UTRs include a sequence that plays a role in translation initiation. They harbor signatures like Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus sequence CCR(A/G)CCAUGG, where R is a purine (A or G) three bases upstream of the start codon (AUG), which is followed by another“G”.
  • the 5' UTR have also been known, e.g., to form secondary structures that are involved in elongation factor binding.
  • a 5’ UTR is included in any of the vectors described herein.
  • Non -limiting examples of 5’ UTRs including those from the following genes: albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, and Factor VIII, can be used to enhance expression of a nucleic acid molecule, such as a mRNA.
  • a 5’ UTR from a mRNA that is transcribed by a cell in the cochlea can be included in any of the vectors, compositions, kits, and methods described herein.
  • AU-rich elements can be separated into three classes (Chen et ah, Mol. Cell. Biol. 15:5777-5788, 1995; Chen et ah, Mol. Cell Biol. 15:2010-2018, 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. For example, c-Myc and MyoD mRNAs contain class I AREs.
  • Class II AREs possess two or more overlapping UUAUUUA(U/A) (U/A) nonamers.
  • GM-CSF and TNF- alpha mRNAs are examples that contain class II AREs.
  • Class III AREs are less well defined. These U-rich regions do not contain an AUUUA motif. Two well-studied examples of this class are c-Jun and myogenin mRNAs.
  • HuR binds to AREs of all the three classes.
  • An exemplary human wildtype 5’ UTR is or includes the sequence of SEQ ID NO: 24.
  • An exemplary human wildtype 3’ UTR is or includes the sequence of SEQ ID NO: 33.
  • a 5’ UTR, a 3’ UTR, or both are included in a vector (e.g., any of the vectors described herein).
  • any of the 5’ UTRs described herein can be operatively linked to the start codon in any of the coding sequences described herein.
  • any of the 3’ UTRs can be operatively linked to the 3’- terminal codon (last codon) in any of the coding sequences described herein.
  • UTR comprises at least 10 contiguous (e.g., at least 15 contiguous, at least 20 contiguous, at least 25 contiguous, at least 30 contiguous, at least 35 contiguous, at least 40 contiguous, at least 45 contiguous, at least 50 contiguous, at least 55 contiguous, at least 60 contiguous, at least 65 contiguous, or at least 70 contiguous) nucleotides from anywhere within SEQ ID NO: 24.
  • a 5’ UTR can include or consist of one or more of: nucleotide positions 1 to 70, nucleotide positions 1 to 60, nucleotide positions 1 to 50, nucleotide positions 1 to 40, nucleotide positions 1 to 30, nucleotide positions 1 to 20, nucleotide positions 1 to 10, nucleotide positions 10 to 70, nucleotide positions 10 to 60, nucleotide positions 10 to 50, nucleotide positions 10 to 40, nucleotide positions 10 to 30, nucleotide positions 10 to 20, nucleotide positions 20 to 70, nucleotide positions 20 to 60, nucleotide positions 20 to 50, nucleotide positions 20 to 40, nucleotide positions 20 to 30, nucleotide positions 30 to 70, nucleotide positions 30 to 60, nucleotide positions 30 to 50, nucleotide positions 30 to 40, nucleotide positions 40 to 70, nucleotide positions 40 to 60, nucleot
  • UTR comprises a sequence that is at least 70% (e.g., at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 24.
  • UTR comprises at least 10 contiguous (e.g., at least 15 contiguous, at least 20 contiguous, at least 25 contiguous, at least 30 contiguous, at least 35 contiguous, at least 40 contiguous, at least 45 contiguous, at least 50 contiguous, at least 55 contiguous, at least 60 contiguous, at least 65 contiguous, at least 70 contiguous, at least 75 contiguous, at least 80 contiguous, at least 85 contiguous, at least 90 contiguous, at least 95 contiguous, at least 100 contiguous, or at least 105 contiguous) nucleotides from anywhere within SEQ ID NO: 33.
  • a 3’ UTR can include or consist of one or more of: nucleotide positions 1 to 107, nucleotide positions 1 to 105, nucleotide positions 1 to 100, nucleotide positions 1 to 90, nucleotide positions 1 to 80, nucleotide positions 1 to 70, nucleotide positions 1 to 60, nucleotide positions 1 to 50, nucleotide positions 1 to 40, nucleotide positions 1 to 30, nucleotide positions 1 to 20, nucleotide positions 1 to 10, nucleotide positions 10 to 107, nucleotide positions 10 to 105, nucleotide positions 10 to 100, nucleotide positions 10 to 90, nucleotide positions 10 to 80, nucleotide positions 10 to 70, nucleotide positions 10 to 60, nucleotide positions 10 to 50, nucleotide positions 10 to 40, nucleotide positions 10 to 30, nucleotide positions 10 to 20, nucleotide positions 20
  • UTR comprises a sequence that is at least 70% (e.g., at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 33.
  • the introduction, removal, or modification of 3' UTR AREs can be used to modulate the stability of an mRNA encoding a stereocilin protein.
  • AREs can be removed or mutated to increase the intracellular stability and thus increase translation and production of a stereocilin protein.
  • non-UTR sequences may be incorporated into the 5' or 3' UTRs.
  • introns or portions of intron sequences may be incorporated into the flanking regions of the polynucleotides in any of the vectors, compositions, kits, and methods provided herein. Incorporation of intronic sequences may increase protein production as well as mRNA levels.
  • An intron can be an intron from a stereocilin gene or can be an intron from a heterologous gene, e.g., a hybrid adenovirus/mouse immunoglobulin intron (Yew et ah, Human Gene Ter. 8(5):575- 584, 1997), an SV40 intron (Ostedgaard et al., Proc. Natl. Acad. Sci . U.S.A.
  • Non-limiting examples of a splice donor and splice acceptor sequences are SEQ ID NOs: 6 and 7, respectively.
  • the vector includes a chimeric intron sequence (SEQ ID NO: 23).
  • the vector includes a T2A sequence (SEQ ID NO: 29).
  • T2A cDNA sequence (SEQ ID NO: 29)
  • each vector can be designed to contain a total of about 4,000 base pairs to about 4,700 base pairs, e.g., about 4,000 base pairs to about 4,650 base pairs, about 4,000 base pairs to about 4,600 base pairs, about 4,000 base pairs to about 4,550 base pairs, about 4,000 base pairs to about 4,500 base pairs, about 4,000 base pairs to about 4,450 base pairs, about 4,000 base pairs to about 4,400 base pairs, about 4,000 base pairs to about 4,350 base pairs, about 4,000 base pairs to about 4,300 base pairs, about 4,000 base pairs to about 4,250 base pairs, about 4,000 base pairs to about 4,200 base pairs, about 4,000 base pairs to about 4,150 base pairs, about 4,000 base pairs to about 4,100 base pairs, about 4,000 base pairs to about 4,050 base pairs, about 4,050 base pairs to about 4,700 base pairs, about 4,050 base
  • a stuffer sequence can be any nucleotide sequence, e.g., up to 1000 bp, that can be included in any of the vectors described herein that is not transcribed and that does not serve a regulatory function in order to achieve a desirable vector size (e.g., a vector size of about 4 kb to about 5 kb, or any of the vector sizes provided herein).
  • a stuffer sequence can by any nucleotide sequences of about 100 bp to about 1000 bp (e.g., about 100 bp to about 900 bp, about 100 bp to about 850 bp, about 100 bp to about 800 bp, about 100 bp to about 750 bp, about 100 bp to about 700 bp, about 100 bp to about 650 bp, about 100 bp to about 600 bp, about 100 bp to about 550 bp, about 100 bp to about 500 bp, about 100 bp to about 450 bp, about 100 bp to about 400 bp, about 100 bp to about 350 bp, about 100 bp to about 300 bp, about 100 bp to about 250 bp, about 100 bp to about 200 bp, about 100 bp to about 150 bp, about 150 bp to about 1000 bp, about 150 bp to about 900 b
  • SEQ ID NOs. 19, 35 and 37 are exemplary human factor FVIII stuffer sequences that can be used in any of the vectors described herein. Additional stuffer sequences are known in the art. Exemplary vectors that include stuffer sequences are shown in Figures 1, 2 and 4. Mammalian Cells
  • a cell e.g., a mammalian cell
  • a cell that includes any of the nucleic acids, vectors (e.g., at least two different vectors described herein), or compositions described herein.
  • the nucleic acids and vectors described herein can be introduced into any mammalian cell.
  • Non limiting examples of vectors and methods for introducing vectors into mammalian cells are described herein.
  • the cell is a human cell, a mouse cell, a porcine cell, a rabbit cell, a dog cell, a cat cell, a rat cell, or a non-human primate cell.
  • the cell is a specialized cell of the cochlea.
  • the cell is a cochlear inner hair cell or a cochlear outer hair cell.
  • the cell is a cochlear inner hair cell.
  • the cell is a cochlear outer hair cell.
  • the mammalian cell is in vitro. In some embodiments, the mammalian cell is present in a mammal. In some embodiments, the mammalian cell is autologous cell obtained from a subject and cultured ex vivo.
  • Also provided herein is a method of introducing into a cochlea of a mammal (e.g., a human) a therapeutically effective amount of any of the compositions described herein. Also provided are methods of increasing expression of an active stereocilin protein (e.g., a full-length stereocilin protein) in an outer hair cell in a cochlea of a mammal (e.g., a human) that include introducing into the cochlea of the mammal a therapeutically effective amount of any of the compositions described herein.
  • an active stereocilin protein e.g., a full-length stereocilin protein
  • the mammal has been previously identified as having a defective stereocilin gene (e.g., a stereocilin gene having a mutation that results in a decrease in the expression and/or activity of a stereocilin protein encoded by the gene).
  • Some embodiments of any of these methods further include, prior to the introducing or administering step, determining that the subject has a defective stereocilin gene.
  • Some embodiments of any of these methods can further include detecting a mutation in a stereocilin gene in a subject.
  • Some embodiments of any of the methods can further include identifying or diagnosing a subject as having non-symptomatic sensorineural hearing loss.
  • two or more doses of any of the compositions described herein are introduced or administered into the cochlea of the mammal or subject.
  • Some embodiments of any of these methods can include introducing or administering a first dose of the composition into the cochlea of the mammal or subject, assessing hearing function of the mammal or subject following the introducing or the administering of the first dose, and administering an additional dose of the composition into the cochlea of the mammal or subject found not to have a hearing function within a normal range (e.g., as determined using any test for hearing known in the art).
  • the composition can be formulated for intra-cochlear administration. In some embodiments of any of the methods described herein, the compositions described herein can be administered via intra-cochlear administration or local administration. In some embodiments of any of the methods described herein, the compositions are administered through the use of a medical device (e.g., any of the exemplary medical devices described herein).
  • a medical device e.g., any of the exemplary medical devices described herein.
  • intra-cochlear administration can be performed using any of the methods described herein or known in the art.
  • a composition can be administered or introduced into the cochlea using the following surgical technique: first using visualization with a 0 degree, 2.5-mm rigid endoscope, the external auditory canal is cleared and a round knife is used to sharply delineate an approximately 5-mm tympanomeatal flap. The tympanomeatal flap is then elevated and the middle ear is entered posteriorly. The chorda tympani nerve is identified and divided, and a currette is used to remove the scutal bone, exposing the round window membrane.
  • a surgical laser may be used to make a small 2-mm fenestration in the oval window to allow for perilymph displacement during trans-round window membrane infusion of the composition.
  • the microinfusion device is then primed and brought into the surgical field.
  • the device is maneuvered to the round window, and the tip is seated within the bony round window overhang to allow for penetration of the membrane by the microneedle(s).
  • the footpedal is engaged to allow for a measured, steady infusion of the composition.
  • the device is then withdrawn and the round window and stapes foot plate are sealed with a gelfoam patch.
  • the subject or mammal is a rodent, a non-human primate, or a human. In some embodiments of any of the methods described herein, the subject or mammal is an adult, a teenager, a juvenile, a child, a toddler, an infant, or a newborn.
  • the subject or mammal is 1-5, 1-10, 1-20, 1-30, 1-40, 1- 50, 1-60, 1-70, 1-80, 1-90, 1-100, 1-110, 2-5, 2-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10- 90, 10-100, 10-110, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-100, 20-110, 30-50, 30-60, 30-70, 30-80, 30-90, 30-100, 40-60, 40-70, 40-80, 40-90, 40-100, 50-70, 50- 80, 50-90, 50-100, 60-80, 60-90, 60-100, 70-90, 70-100, 70-110, 80-100, 80-110, or 90-110 years of age. In some embodiments of any of the methods
  • the subject or mammal has or is at risk of developing non-syndromic sensorineural hearing loss.
  • the subject or mammal has been previously identified as having a mutation in a stereocilin gene. (All references here to“stereocilin gene” refer to the gene that is not the stereocilin pseudogene.)
  • the subject or mammal has any of the mutations in a stereocilin gene that are described herein or are known in the art to be associated with non-symptomatic sensorineural hearing loss.
  • the subject or mammal has been identified as being a carrier of a mutation in a stereocilin gene (e.g., via genetic testing). In some embodiments of any of the methods described herein, the subject or human has been identified as having a mutation in a stereocilin gene and has been diagnosed with non-symptomatic sensorineural hearing loss. In some embodiments of any of the methods described herein, the subject or human has been identified as having non-symptomatic sensorineural hearing loss.
  • successful treatment of non-symptomatic sensorineural hearing loss can be determined in a subject using any of the conventional functional hearing tests known in the art.
  • functional hearing tests are various types of audiometric assays (e.g., pure-tone testing, speech testing, test of the middle ear, auditory brainstem response, and otoacoustic emissions).
  • an active stereocilin protein e.g., a full-length stereocilin protein
  • the mammalian cell is a cochlear outer hair cell.
  • the mammalian cell is a human cell (e.g., a human cochlear outer hair cell).
  • the mammalian cell is in vitro.
  • the mammalian cell is in a mammal.
  • the mammalian cell is originally obtained from a mammal and is cultured ex vivo.
  • the mammalian cell has previously been determined to have a defective stereocilin gene.
  • an increase in expression of an active stereocilin protein is, e.g., as compared to a control or to the level of expression of an active stereocilin protein (e.g., a full-length stereocilin protein) prior to the introduction of the vector(s).
  • the level of expression of a stereocilin protein can be detected directly (e.g., detecting stereocilin protein or detecting stereocilin mRNA).
  • techniques that can be used to detect expression and/or activity of stereocilin directly include: real-time PCR, Western blotting,
  • expression of a stereocilin protein can be detected indirectly (e.g., through functional hearing tests).
  • any of the compositions described herein can further include one or more agents that promote the entry of a nucleic acid or any of the vectors described herein into a mammalian cell (e.g., a liposome or cationic lipid).
  • a mammalian cell e.g., a liposome or cationic lipid
  • any of the vectors described herein can be formulated using natural and/or synthetic polymers.
  • Non-limiting examples of polymers that may be included in any of the compositions described herein can include, but are not limited to, DYNAMIC POLYCONJUGATE® (Arrowhead Research Corp., Pasadena,
  • POLYMER TECHNOLOGY® PhaseRX, Seattle, Wash ), DMRI/DOPE, poloxamer, VAXFECTIN® adjuvant from Vical (San Diego, Calif.), chitosan, cyclodextrin from Calando Pharmaceuticals (Pasadena, Calif.), dendrimers and poly (lactic-co-glycolic acid) (PLGA) polymers, RONDELTM (RNAi/Oligonucleotide Nanoparticle Delivery) polymers (Arrowhead Research Corporation, Pasadena, Calif.), and pH responsive co- block polymers, such as, but not limited to, those produced by PhaseRX (Seattle, Wash.). Many of these polymers have demonstrated efficacy in delivering
  • oligonucleotides in vivo into a mammalian cell see, e.g., deFougerolles, Human Gene Ther. 19:125-132, 2008; Rozema et al., Proc. Natl. Acad. Sci. U.S.A. 104: 12982- 12887, 2007; Rozema et al., Proc. Natl. Acad. Sci. U.S.A. 104: 12982-12887, 2007; Hu-Lieskovan et al., Cancer Res. 65:8984-8982, 2005; Heidel et al., Proc. Natl. Acad. Sci. U.S.A. 104:5715-5721, 2007).
  • compositions described herein can be, e.g., a pharmaceutical composition.
  • a pharmaceutical composition can include any of the compositions described herein and one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients.
  • Such compositions may comprise one or more buffers, such as neutral -buffered saline, phosphate-buffered saline, and the like; one or more carbohydrates, such as glucose, mannose, sucrose, and dextran; mannitol; one or more proteins, polypeptides, or amino acids, such as glycine; one or more antioxidants; one or more chelating agents, such as EDTA or glutathione; and/or one or more preservatives.
  • buffers such as neutral -buffered saline, phosphate-buffered saline, and the like
  • carbohydrates such as glucose, mannose, sucrose, and dextran
  • mannitol one or more proteins, polypeptides, or amino acids,
  • the composition includes a pharmaceutically acceptable carrier (e.g., phosphate buffered saline, saline, or bacteriostatic water).
  • a pharmaceutically acceptable carrier e.g., phosphate buffered saline, saline, or bacteriostatic water.
  • solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms such as injectable solutions, injectable gels, drug-release capsules, and the like.
  • the term“pharmaceutically acceptable carrier” includes solvents, dispersion media, coatings, antibacterial agents, antifungal agents, and the like that are compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into any of the compositions described herein.
  • a single dose of any of the compositions described herein can include a total sum amount of the at least two different vectors of at least 1 ng, at least 2 ng, at least 4 ng, about 6 ng, about 8 ng, at least 10 ng, at least 20 ng, at least 30 ng, at least 40 ng, at least 50 ng, at least 60 ng, at least 70 ng, at least 80 ng, at least 90 ng, at least 100 ng, at least 200 ng, at least 300 ng, at least 400 ng, at least 500 ng, at least 1 pg, at least 2 pg, at least 4 pg, at least 6 pg, at least 8 pg, at least 10 pg, at least 12 pg, at least 14 pg, at least 16 pg, at least 18 pg, at least 20 pg, at least 22 pg, at least 24 pg, at least 26 pg, at least 28 pg, at least 30
  • compositions provided herein can be, e.g., formulated to be compatible with their intended route of administration.
  • An intended route of administration is local administration (e.g., intra-cochlear administration).
  • the therapeutic compositions are formulated to include a lipid nanoparticle. In some embodiments, the therapeutic compositions are formulated to include a polymeric nanoparticle. In some embodiments, the therapeutic compositions are formulated to comprise a mini-circle DNA. In some embodiments, the therapeutic compositions are formulated to comprise a CELiD DNA. In some embodiments, the therapeutic compositions are formulated to comprise a synthetic perilymph solution.
  • An exemplary synthetic perilymph solution includes 20-200 mM NaCl; 1-5 mM KC1; 0.1-10 mM CaCl 2 ; 1-10 mM glucose; 2-50 mM HEPES, having a pH of between about 6 and about 9.
  • kits including any of the compositions described herein.
  • a kit can include a solid composition (e.g., a lyophilized composition including the at least two different vectors described herein) and a liquid for solubilizing the lyophilized composition.
  • a kit can include a pre-loaded syringe including any of the compositions described herein.
  • the kit includes a vial comprising any of the compositions described herein (e.g., formulated as an aqueous composition, e.g., an aqueous pharmaceutical composition).
  • kits can include instructions for performing any of the methods described herein.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils kinder ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof e.g., vegetable oils
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal
  • a sterile aqueous medium that can be employed will be known to those of skill in the art.
  • one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,“Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580).
  • Some variation in dosage will necessarily occur depending on the condition of the host.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual host.
  • Sterile injectable solutions are prepared by incorporating the active AAV in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • compositions disclosed herein may also be formulated in a neutral or salt form.
  • Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
  • solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.
  • carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
  • dispersion media includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
  • Supplementary active ingredients can also be incorporated into the compositions.
  • pharmaceutically-acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.
  • Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells.
  • the vector delivered trangenes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
  • Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or any of the vectors disclosed herein.
  • the formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).
  • Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral -based delivery systems.
  • Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trails examining the effectiveness of liposome-mediated drug delivery have been completed.
  • Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs).
  • MLVs generally have diameters of from 25 nm to 4 pm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 .ANG., containing an aqueous solution in the core.
  • SUVs small unilamellar vesicles
  • Nanocapsule formulations of any of the vectors described herein may be used.
  • Nanocapsules can generally entrap substances in a stable and reproducible way.
  • ultrafme particles sized around 0.1 pm
  • Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.
  • Sonophoresis ie., ultrasound
  • U.S. Pat. No. 5,656,016 a device for enhancing the rate and efficacy of drug permeation into and through the circulatory system.
  • Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No.
  • compositions described herein may be administered to a patient trans arterially, subcutaneously, intradermally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally.
  • i.v. intravenous
  • nucleic acid compositions of the present invention are administered to a patient by intradermal or subcutaneous injection.
  • nucleic compositions of the present invention are administered by i.v. injection.
  • the therapeutic delivery systems include i) a medical device capable of creating one or a plurality of incisions in a round window membrane of an inner ear of a human subject in need thereof, and ii) an effective dose of a composition (e.g., any of the compositions described herein).
  • the medical device includes a plurality of micro-needles.
  • surgical methods for treatment of hearing loss e.g., non-symptomatic sensorineural hearing loss).
  • the methods include the steps of: introducing into a cochlea of a human subject a first incision at a first incision point; and administering intra-cochlearly a therapeutically effective amount of any of the compositions provided herein.
  • the composition is administered to the subject at the first incision point.
  • the composition is administered to the subject into or through the first incision.
  • any of the compositions described herein is administered to the subject into or through the cochlea oval window membrane. In some embodiments of any of the methods described herein, any of the compositions described herein is administered to the subject into or through the cochlea round window membrane. In some embodiments of any of the methods described herein, the composition is administered using a medical device capable of creating a plurality of incisions in the round window membrane. In some embodiments, the medical device includes a plurality of micro- needles. In some embodiments, the medical device includes a plurality of micro- needles including a generally circular first aspect, where each micro-needle has a diameter of at least about 10 microns.
  • the medical device includes a base and/or a reservoir capable of holding the composition. In some embodiments, the medical device includes a plurality of hollow micro-needles individually including a lumen capable of transferring the composition. In some embodiments, the medical device includes a means for generating at least a partial vacuum.
  • Recombinant AAV is generated by transfection with an adenovirus-free method as used by Xiao et al. J Virol. 73(5):3994-4003, 1999.
  • the cis plasmids with AAV ITRs, the trans plasmid with AAV Rep and Cap genes, and a helper plasmid with an essential region from an adenovirus genome are co-transfected in 293 cells in a ratio of 1 : 1 :2.
  • the AAV vectors used here express human stereocilin or mouse stereocilin under multiple dual vector strategies using the constructs described below.
  • AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, rh8, rhlO, rh39, rh43, and Anc80 are each prepared to encapsulate three sets of stereocilin constructs to test (i) a
  • Recombinant AAV-l is produced using a triple transfection protocol and purified by two sequential cesium chloride (CsCl) density gradients, as described by Pryadkina et al., Mol. Ther. 2: 15009, 2015. At the end of second centrifugation, 11 fractions of 500 pl are recovered from the CsCl density gradient tube and purified through dialysis in 1 c PBS. The fractions are analyzed by dot blot to determine those containing rAAV genomes. The viral genome number (vg) of each preparation is determined by a quantitative real-time PCR-based titration method using primers and probe corresponding to the ITR region of the AAV vector genome (Bartoli et al.
  • AAV produced at a titer of lel4 vg / mL is prepared at dilutions of 3.2el3, l.0el3, 3.2el2, l.0el2 vg/mL in artificial perilymph.
  • Artificial perilymph is prepared by combining the following reagents: NaCl, 120 mM; KC1, 3.5 mM; CaCl2, 1.5 mM; glucose, 5.5 mM; HEPES, 20 mM.
  • the artificial perilymph is titrated with NaOH to adjust its pH to 7.5 (total Na + concentration of 130 mM) (Chen et al., ./. Controlled Rel. 110:1-19, 2005).
  • the AAV- STRC formulation is delivered to the cochlea using a specialized microcatheter designed for consistent and safe penetration of the round window membrane (RWM).
  • the microcatheter is shaped such that the surgeon performing the delivery procedure can enter the middle ear cavity via the external auditory canal and contact the end of the microcatheter with the RWM.
  • microcatheter is comprised of at least one microneedle with diameter between 10 and 1,000 microns, which produces perforations in the RWM that are sufficient to allow AAV-STRC to enter the cochlear perilymph of the scala tympani at a rate of approximately 1 uL/min, but small enough to heal without surgical repair.
  • the remaining portion of the microcatheter, proximal to the microneedle(s), is loaded with the AAV- STRC /artificial perilymph formulation at a titer of approximately lel3 vg/mL.
  • the proximal end of the microcatheter is connected to a micromanipulator that allows for precise, low volume infusions of approximately 1 uL / min.
  • Example 5 Animal Model 1A: Surgical Method in Aged Mice
  • AAV- STRC prepared in artificial perilymph is administered to the scala tympani in mice as described by Shu et al. ( Human Gene Therapy,
  • mice Six-week-old male mice are anesthetized using an intraperitoneal injection of xylazine (20 mg/kg) and ketamine (100 mg/kg). Body temperature is maintained at 37 °C using an electric heating pad. An incision is made from the right post-auricular region and the tympanic bulla is exposed. The bulla is perforated with a surgical needle and the small hole is expanded to provide access to the cochlea. The bone of the cochlear lateral wall of the scala tympani is thinned with a dental drill so that the membranous lateral wall is left intact.
  • Nanoliter Microinjection System in conjunction with glass micropipette is used to deliver a total of approximately 300 nL of AAV- STRC in artificial perilymph to the scala tympani at a rate of 2 nL/second.
  • the glass micropipette is left in place for 5 minutes post-injection.
  • the opening in the tympanic bulla is sealed with dental cement, and the muscle and skin are sutured.
  • the mice are allowed to awaken from anesthesia and their pain is controlled with 0.15 mg/kg buprenorphine hydrochloride for 3 days.
  • AAV- STRC prepared in artificial perilymph is administered to guinea pigs to assess distribution and toxicity following intracochlear delivery with a reciprocating micropump as described by Tandon et ah, Lab Chip , DOI: l0.l039/c5lc0l396h, 2015.
  • Lidocaine with epinephrine is given subcutaneously at the incision site as a topical anesthetic.
  • a dorsal approach a 5 mm diameter hole is made in the bulla and a cochleostomy is created approximately 0.5 mm distal to the round window membrane.
  • the cannula of the micropump (described below) is inserted into the cochleostomy, threaded into the cochlea 3 mm apically, and glued to the bulla with a common cyanoacrylate glue.
  • CAP compound action potential
  • DPOAEs distortion product otoacoustic emissions
  • AAV- STRC at a maximum titer of lel4 vg/mL is administered to the guinea pig using a micropump as described by Tandon et al. Lab Chip , DOI:
  • the micropump system has 4 selectable ports. These ports are connected to: (i) a large fluidic capacitor used for artificial perilymph storage; (ii) an outlet that connects to the cochlea; (iii) the outlet from an integrated AAV- STRC reservoir; (iv) the inlet to the integrated AAV- STRC reservoir. Each port is fluidically connected to a central pump chamber, and each is individually addressed with a valve.
  • the sequence of events for reciprocating AAV- STRC delivery is as follows: (i) an internal AAV- STRC -refresh loop is run, transferring AAV- STRC from the AAV- STRC reservoir into the main infuse-withdraw line; (ii) AAV- STRC is infused into the cochlea and some artificial perilymph is drained from the artificial perilymph storage capacitor; (iii) the first two steps can be repeated several times for additional doses; (iv) after the AAV- STRC has been allowed to diffuse for some time, a volume of perilymph is withdrawn from the cochlea that is equal to the volume infused in steps (i)-(iii), refilling the artificial perilymph storage capacitor. This process results in net delivery of drug with zero net fluid volume added to the cochlea.
  • the fluidic capacitors in the micropump are cylindrical chambers whose ceilings are a thin (25.4 pm), flexible, polyimide membrane.
  • the pump chamber has a diameter of 3.5 mm
  • the fluidic storage capacitor has a diameter of 14 mm
  • all of the remaining capacitors have diameters of 4 mm.
  • the same membrane is deflected to block flow at each of the valves.
  • the valve chambers have diameters of 3.1 mm.
  • the serpentine channel that comprises the drug reservoir has a square cross section of width 762 pm and a length of 410 mm for a total volume of 238 pL. All of the other microchannels in the pump have a width of 400 pm and a height of 254 pm.
  • the micropump is loaded with AAV- STRC and artificial perilymph, and the cannula inserted into a cochleostomy made in the region of the cochlea between the locations with characteristic frequency sensitivity of 24 and 32 kHz, and threaded apically 3 mm, terminating in the 12-16 kHz region.
  • Baseline DPOAE and CAP hearing tests are performed prior to the start of AAV- STRC /artificial perilymph infusion.
  • the pump is then activated and approximately 1 pL of artificial perilymph is infused every 5 min until a total of approximately 10 pL of artificial perilymph is delivered to the cochlea. After a 20 min wait time, approximately 10 pL of perilymph is withdrawn from the cochlea.
  • AAV- STRC delivery is then initiated at a rate of approximately 1 pL every 5 min until a total of approximately 10 pL of fluid delivered.
  • AAV- STRC prepared in artificial perilymph is administered to juvenile sheep to assess distribution and toxicity following delivery to the cochlea via trans-RWM infusion.
  • IHC inner hair cell
  • OOC outer hair cell
  • ABR and DPOAE measurements are taken again bilaterally 1, 5 and 10 days following the surgical procedure. At 6 months post-procedure, additional bilateral ABR and DPOAE measurements are taken from all animals, and the animals are subsequently sacrificed and their cochleae removed.
  • cochlear tissue samples are collected from the same basal, middle and apical regions as described above, and assayed for stereocilin mRNA transcript.
  • the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene plasmid #42230) is digested with Bsbl, dephosphorylated using Antartic Phosphatase, and the linearized vector is gel purified.
  • pX330-cas9- STRC bicistronic vector
  • a pair of oligos for targeting stereocilin exon 1 is annealed, phosphorylated and ligated to a linearized vector (Cong et al., Science 339(6121):819-23, 2013).
  • the A15 astroglial sheep cell line (Vilette et al., 2000 In Vitro Cell Dev Biol Anim 36(l):45-9) is maintained in DMEM in 10% Fetal Bovine Serum, 2mM glutamine, 1% sodium pyruvate and 1% penicillin/streptomycin.
  • Cells are transfected in 24-well plates with 2 pg of pX330-cas9- STRC co-expressing Cas9 and sgRNA against stereocilin using lipofectamine LTX reagent. Three days later, genomic DNA from transfected cells is extracted and quantified using a NanoDrop2000
  • spectrophotometer measuring A260/A280 and A260/A230 ratios to account for sample purity.
  • Gene mutation activity of sgRNA sequence at the target locus of STRC exon 1 is quantified using the T7EI mismatch detection assay.
  • DNA sequence of interest is PCR-amplified with a high-fidelity polymerase (Herculase II fusion polymerase) using specific primers.
  • the resultant PCR product is then denatured and slowly re annealed (95°C, 2 min; 95°C to 85°C, -2°C/sec; 85°C to 25°C, -l°C/sec) to produce a homoduplex/ heteroduplex mix. This is then digested by 5U of T7EI restriction enzyme at 37°C for 30 minutes. Digestion products are separated by 2% agarose gel electrophoresis.
  • T7 promoter is added to sgRNA template by PCR amplification of the pX330-cas9- STRC plasmid.
  • the PCR product is purified using NucleoSpin® Gel and PCR Clean up. It is used as the template for in vitro transcription using MEGAshortscriptTM T7 kit according to the manufacturer’s manual. Following completion of transcription, DNase I treatment is performed.
  • the Cas9 mRNA is transcribed using a Pmel-digested Cas9 expression JDS246 plasmid (Addgene plasmid # 43861) and the mMESSAGE mMACHINE®
  • the sheep embryos are produced by in vitro fertilization according to routine procedure as described previously (Crispo et al. 2014 Transgenic Res, 24(l):31-41). Briefly, sheep ovaries from a slaughterhouse are transported to the laboratory and cumulus oocyte complexes (COCs) are aspirated in recovery medium. The selected COCs are placed in maturation medium for 24 h in 5% C02 in humidified air atmosphere at 39°C. Then, expanded COCs are inseminated in 100 pl drops with 1 x 106 dose of frozen-thawed semen selected by ascendant migration on a swim up method. Fertilization is carried out in 5% C02 with humidified atmosphere at 39°C for 22 h.
  • injection buffer lOmM Tris pH 7.5, O.lmM EDTA
  • injected and non-injected embryos are transferred to culture medium under mineral oil, in 5% C02, 5% 02 and 90% N2 in humidified atmosphere at 39°C.
  • Cleavage rate on Day 2 (cleaved zygotes per total oocytes) and development rate on Day 6 (morulae and blastocysts per total oocytes) are recorded for all experimental groups.
  • DNA from 20 CRISPR group embryos are analyzed by Sanger sequencing to detect the mutation at the STRC gene level.
  • blastocysts produced by CRISPR/Cas9 zygote microinjection are transferred to recipient females. Only early blastocysts, blastocysts and expanded blastocysts classified as excellent or good (i.e. Grade 1 as defined in Stringfellow et al. 2010, Manual of the International Embryo Transfer Society) are transferred on Day 6 after fertilization. Embryo transfer is performed by minimally invasive surgery assisted by laparoscopy to place the embryos into the cranial side of the ipsilateral uterine horn to the corpus luteum.
  • Recipient ewes are previously synchronized to be on Day 6 of the estrous cycle using a standard protocol to control ovulation described previously, as described by
  • Pregnancy diagnosis and fetal development are performed on Day 30 and 105, respectively, by using B-mode ultrasonography equipped with a 5 and 3.5 MHz probe.
  • Day 0 of the experiment is defined as the moment of embryo fertilization.
  • Several parameters are measured to study the development of fetuses at Day 105 of gestation: thoracic diameter, biparietal diameter, occipitonasal length and heart rate.
  • Samples from skin and limb muscle of the lambs are taken seven days after birth and T7EI assay, western blot test and histology examinations are performed in order to identify and characterize KO founders and off-target sites.
  • Total DNA is isolated from skin biopsies for all animals and from muscle for some animals.
  • Genotyping of STRC exon 1 is performed by direct sequencing of PCR amplicons and in muscle biopsies by additional sequencing of isolated bacterial clones with individual amplicon sequences.
  • Western blotting is performed to determine the presence of myostatin in the muscle fiber. Equal amounts of total proteins are run on 12% (v/v) gel electrophoresis and electrophoretically transferred to a PVDF membrane. Monoclonal mouse anti- stereocilin antibody is used in the western blotting. The washed membranes are incubated with 1 :50000 dilution of secondary antibody linked to horseradish peroxidase (HPR). HPR activity is detected using western blot chemiluminescence.
  • HPR horseradish peroxidase
  • AAV- STRC prepared in artificial perilymph is administered to STRC knockout transgenic sheep to assess the ability to restore normal hearing function following delivery to the cochlea via trans-RWM infusion.
  • IHC inner hair cell
  • OOC outer hair cell
  • ABR and DPOAE measurements are taken again bilaterally 1, 5 and 10 days following the surgical procedure. At 6 months post-procedure, additional bilateral ABR and DPOAE measurements are taken from all animals, and the animals are subsequently sacrificed and their cochleae removed.
  • the patient is put under general anesthesia.
  • the surgeon approaches the tympanic membrane from external auditory canal, makes a small incision at the inferior edge of the external auditory canal where it meets the tympani membrane, and lifts the tympanic membrane as a flap to expose the middle ear space.
  • a surgical laser is used to make a small opening (approximately 2 mm) in the stapes footplate.
  • the surgeon then penetrates the round window membrane with a microcatheter loaded with a solution of AAV- STRC prepared in artificial perilymph at a titer of lel3 vg/mL.
  • the microcatheter is connected to a micromanipulator that infuses
  • Maternal blood samples (20-40 mL) are collected into Cell-free DNA tubes.
  • At least 7 mL of plasma is isolated from each sample via a double centrifugation protocol of 2,000 g for 20 minutes, followed by 3,220 g for 30 minutes, with supernatant transfer following the first spin.
  • cfDNA is isolated from 7-20 mL plasma using a QIAGEN QIAmp Circulating Nuclei Acid kit and eluted in 45 pL TE buffer. Pure maternal genomic DNA is isolated from the huffy coat obtained following the first centrifugation.
  • the targets include a genomic sequence in chromosome 15 known to be the site of a stereocilin loss-of-function mutation (Mandelker et al., ./. Mol. Diagnostics l6(6):639-647, 2014).
  • the amplicons are then sequenced using an Illumina HiSeq sequencer. Genome sequence alignment is performed using commercially available software.
  • At least two different nucleic acid vectors can be to reconstitute an active stereocilin gene (e.g., a full-length stereocilin gene) within a cell following intermolecular concatamerization and trans-splicing. See, e.g., Yan et al., Proc. Natl. Acad. Sci. U.S.A. 97: 12; 6716-6721, 2000, incorporated in its entirety herein.
  • a first nucleic acid vector can include a promoter (e.g., any of the promoters described herein), a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter (e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the N-terminal portions of a stereocilin protein described herein), and a splicing donor signal sequence positioned at the 3’ end of the first coding sequence.
  • a promoter e.g., any of the promoters described herein
  • a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the N-terminal portions of a stereocilin protein described herein
  • a splicing donor signal sequence positioned at the 3’ end of the first coding sequence.
  • a second nucleic acid vector can include a splicing acceptor signal sequence, a second coding sequence that encodes a C- terminal portion of a stereocilin protein (i.e., the entire portion of the stereocilin protein that is not included in the N-terminal portion) positioned at the 3’ end of the splicing acceptor signal sequence (e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the C-terminal portions of a stereocilin protein described herein), and a polyadenylation sequence at the 3’ end of the second coding sequence (e.g., any of the polyadenylation sequences described herein).
  • each of the encoded portions is at least 30 amino acid residues in length (e.g., at least 50 amino acids, at least 75 amino acids, or at least 100 amino acids in length), the amino acid sequence of each of the encoded portions does not overlap with the sequence of the other encoded portion, and no single vector of the two different vectors encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • splicing occurs between the splicing donor signal sequence and the splicing acceptor signal sequence, thereby forming a recombined nucleic acid that encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • an active stereocilin protein e.g., a full-length stereocilin protein.
  • three different nucleic acid vectors can be used.
  • a first nucleic acid vector can include a portion of a promoter sequence (e.g., any of the promoter sequences described herein), a first coding sequence of a stereocilin gene that encodes a first portion of a stereocilin protein (e.g., any of the stereocilin coding sequences described herein) positioned 3’ of the promoter, and a first splicing donor signal sequence positioned at the 3’ end of the first coding sequence.
  • a promoter sequence e.g., any of the promoter sequences described herein
  • a first coding sequence of a stereocilin gene that encodes a first portion of a stereocilin protein (e.g., any of the stereocilin coding sequences described herein) positioned 3’ of the promoter
  • a first splicing donor signal sequence positioned at the 3’ end of the first coding sequence.
  • a second nucleic acid vector can include a first splicing acceptor signal sequence, a second coding sequence of a stereocilin gene that encodes a second portion of a stereocilin protein positioned at the 3’ end of the first splicing acceptor signal sequence, and a second splicing donor signal sequence positioned at the 3’ end of the second coding sequence (e.g., any of the splicing donor signals described herein).
  • a feature of the second nucleic acid vector will be that self-splicing cannot occur (i.e., splicing will not occur between the second splicing donor signal sequence and the first splicing acceptor signal sequence of the second nucleic acid vector).
  • the splicing donor signal sequence of the first nucleic acid vector and the second splicing donor signal of the second nucleic acid vector are the same (e.g., any of the splicing donor signals described herein or known in the art). In some embodiments, the first splicing donor signal sequence of the first nucleic acid vector and the second splicing donor signal sequence of the second nucleic acid vector are different (e.g., any of the splicing donor signal sequences described herein or known in the art).
  • a third nucleic acid vector will include a second splicing acceptor signal sequence, a third coding sequence of a stereocilin gene that encodes a third portion of a stereocilin protein positioned at the 3’ end of the second splicing acceptor signal sequence, and a polyadenylation sequence positioned at the 3’ end of the third coding sequence (e.g., any of the polyadenylation sequences described herein).
  • the first splicing donor sequence and the first splicing acceptor sequence can assemble together (recombine) and the second slicing donor sequence and the second slicing acceptor sequence can assemble together
  • stereocilin protein encoded by the first, second, and third coding sequences do not overlap, and when introduced into a mammalian cell (e.g., any of the mammalian cells described herein), splicing occurs between the first splicing donor sequence and the first splicing acceptor sequence, and between the second splicing donor sequence and the second splicing acceptor sequence, to form a recombined nucleic acid that encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • an active stereocilin protein e.g., a full-length stereocilin protein
  • the amino acid sequence of each of the encoded portions do not overlap, and no single vector encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • Each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein
  • each of the encoded portions can be at least 30 amino acids (e.g., between about 30 amino acids to about 1600 amino acids, or any of the other subranges of this range described herein).
  • each of the coding sequences can include at least one exon and at least one intron of SEQ ID NO: 4 (e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons and at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns).
  • at least two exons and at least one intron e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons and at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns.
  • each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein
  • each of the encoded portions can encode up to 80% of the amino acid sequence of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1) such that each of the encoded portions is non overlapping.
  • each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding up to 80% of the amino acid sequence of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1), such that each of the encoded portions is non-overlapping.
  • each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding up to 80% of the amino acid sequence of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1), such that each of the encoded portions is non-overlapping.
  • Each of the at least two nucleic acid vectors may further include an inverted terminal repeat (ITR) to allow head-to-tail recombination.
  • ITR inverted terminal repeat
  • the ITR could be a palindromic double-D ITR as described in Yan et al., Proc. Natl. Acad. Sci. U.S.A. 97(l2):67l6- 6721, 2000, incorporated in its entirety herein.
  • the ITR could be a AAV serotype-2 ITR as described in Gosh et al., Mol. Ther. 16: 124-130, 2008, and Gosh et al., Human Gene Ther. 22: 77-83, 2011.
  • the vector can include a 5’ ITR and/or a 3’ ITR.
  • the 5’ ITR includes or consists of SEQ ID NO: 18.
  • the 3’ ITR includes or consists of SEQ ID NO: 36.
  • splicing acceptor and/or donor signal sequences are known in the art. See, e.g., Reich et al., Human Gene Ther. l4(l):37-44, 2003, and Lai et al. (2005) Nat. Biotechnol. 23(11): 1435-1439, 2005, 2005.
  • the splicing donor and acceptor signal sequences can be any endogenous intron splicing signal of a gene (e.g., a stereocilin gene).
  • the splicing donor signal sequence can be: 5’- GT AAGT AT C AAGGTT AC AAGAC AGGTTT A AGGAGACC AAT AGA AACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCT-3’ (SEQ ID NO: 6) and the splicing acceptor signal can be 5’-GATAGGCACCTATTGGTCTTACTG AC ATCCACTTTGCCTTTCTCTCCAC AG-3’ (SEQ ID NO: 7) (see, e.g, Trapani et al, EMBO Mol. Med. 6(2): 194-211, 2014). Methods of evaluating splicing and splicing efficiency are known in the art (see, e.g, Lai et al, Nat. Biotechnol. 23(11): 1435-1439, 2005).
  • AP phosphatase
  • At least two (e.g, two, three, four, five, or six) different nucleic acid vectors can also be used in any of the methods described herein to reconstitute an active stereocilin gene (e.g, a full-length stereocilin gene) within a cell following intermolecular concatamerization, marker gene-mediated recombination, and trans-splicing.
  • This strategy is a hybrid strategy as it will include homologous recombination and/or trans-splicing. See, e.g. Gosh et al. Mol. Ther. 16: 124-130, 2008; Gosh et al. Human Gene Ther.
  • a detectable marker gene can be a highly recombinogenic DNA sequence that will allow for coding sequence-independent recombination.
  • An non-limiting example of a detectable marker gene is an alkaline phosphatase (AP) gene.
  • AP alkaline phosphatase
  • the detectable marker gene can be the middle one-third of the human placental AP complementary DNA, which is 872 bp in length (see, e.g. Gosh et al, 2008).
  • At least two different nucleic acid vectors will contain a detectable marker gene (e.g, any of the detectable marker genes described herein). Since the hybrid vector will be constructed based on a trans-splicing vector as described in Example 10, an active stereocilin gene (e.g, a full-length stereocilin gene) may be reconstituted using either ITR-mediated recombination and trans-splicing or detectable marker gene-mediated (e.g., AP-gene mediated) recombination and trans-splicing. After trans-splicing, an active stereocilin gene (e.g., a full-length stereocilin gene) will be reconstituted in the genomic DNA of a mammalian cell (e.g., any mammalian cell described herein).
  • a detectable marker gene e.g, any of the detectable marker genes described herein.
  • a first nucleic acid vector can include a promoter (e.g., any of the promoters described herein), a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter (e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the N-terminal portions of a stereocilin protein described herein), a splicing donor signal sequence positioned at the 3’ end of the first coding sequence, and a first detectable marker gene positioned 3’ of the splicing donor signal sequence.
  • a promoter e.g., any of the promoters described herein
  • a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the N-terminal portions of a stereocilin protein described herein
  • a second nucleic acid vector can include a second detectable marker gene, a splicing acceptor signal sequence positioned 3’ of the second detectable marker gene, a second coding sequence that encodes a C-terminal portion of a stereocilin protein positioned at the 3’ end of the splicing acceptor signal sequence (e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the C-terminal portions of a stereocilin protein described herein), and a polyadenylation sequence at the 3’ end of the second coding sequence (e.g., any of the polyadenylation sequences described herein).
  • each of the encoded portions is at least 30 amino acid residues in length (e.g., at least 50 amino acids, at least 75 amino acids, or at least 100 amino acids in length), the amino acid sequence of each of the encoded portions do not overlap, and no single vector of the two different vectors encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • an active stereocilin protein e.g., a full-length stereocilin protein.
  • a first nucleic acid vector can include a portion of promoter sequence (e.g., any of the promoter sequences described herein), a first coding sequence of a stereocilin gene that encodes a first portion of a stereocilin protein (e.g., any of the stereocilin coding sequences described herein) positioned 3’ of the promoter, a first splicing donor signal sequence positioned at the 3’ end of the first coding sequence, and a first detectable marker gene.
  • promoter sequence e.g., any of the promoter sequences described herein
  • a first coding sequence of a stereocilin gene that encodes a first portion of a stereocilin protein (e.g., any of the stereocilin coding sequences described herein) positioned 3’ of the promoter
  • a first splicing donor signal sequence positioned at the 3’ end of the first coding sequence
  • a first detectable marker gene e.g., any of the promoter sequences described herein
  • a second nucleic acid vector can include a second detectable marker gene, a first splicing acceptor signal sequence positioned 3’ of the second detectable marker gene, a second coding sequence of a stereocilin gene that encodes a second portion of a stereocilin protein positioned at the 3’ end of the first splicing acceptor signal sequence, a second splicing donor signal sequence positioned at the 3’ end of the second coding sequence (e.g., any of the splicing donor signals described herein), and a third detectable marker gene.
  • a feature of the second nucleic acid vector will be that self-splicing cannot occur (i.e., splicing will not occur between the second splicing donor signal sequence and the first splicing acceptor signal sequence of the second nucleic acid vector).
  • the splicing donor signal sequence of the first nucleic acid vector and the second splicing donor signal of the second nucleic acid vector are the same (e.g., any of the splicing donor signals described herein or known in the art).
  • the first splicing donor signal sequence of the first nucleic acid vector and the second splicing donor signal sequence of the second nucleic acid vector are different (e.g., any of the splicing donor signal sequences described herein or known in the art).
  • a third nucleic acid vector can include a fourth detectable marker gene, a second splicing acceptor signal sequence positioned 3’ of the fourth detectable marker gene, a third coding sequence of a stereocilin gene that encodes a third portion of a stereocilin protein positioned at the 3’ end of the second splicing acceptor signal sequence, and a polyadenylation sequence positioned at the 3’ end of the third coding sequence (e.g., any of the polyadenylation sequences described herein).
  • the first splicing donor sequence and the first splicing acceptor sequence can assemble together (recombine) and the second slicing donor sequence and the second slicing acceptor sequence can assemble together (recombine), and the portion of stereocilin protein encoded by the first, second, and third coding sequences do not overlap, and when introduced into a mammalian cell (e.g., any of the mammalian cells described herein), splicing occurs between the first splicing donor sequence and the first splicing acceptor sequence, and between the second splicing donor sequence and the second splicing acceptor sequence, to form a recombined nucleic acid that encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • a mammalian cell e.g., any of the mammalian cells described herein
  • two of the at least two different nucleic acid vectors can include a detectable marker gene (e.g., an AP marker gene) and one of the at least two different nucleic acid vectors may include a splicing acceptor signal sequence that is complementary to a splicing donor signal sequence in a nucleic acid vector that includes a detectable marker gene.
  • the first and second nucleic acid vectors can include a detectable marker gene (e.g., an AP marker gene), and the third nucleic acid vector will include a splicing acceptor signal sequence that is
  • the third nucleic acid vector will not include a detectable marker gene (e.g., an AP marker gene).
  • the second and third nucleic acid vector can include a detectable marker gene (e.g., an AP marker gene)
  • the first nucleic acid vector will include a splicing donor signal sequence that is complementary to the splicing acceptor signal sequence in the second nucleic acid vector and the first nucleic acid vector will not include a detectable marker gene (e.g., an AP marker gene).
  • the coding sequences provided in the at least two nucleic acid vectors will not be overlapping.
  • Each of the at least two different vectors can include a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions being, e.g., at least 30 amino acids (e.g., about 30 amino acids to about 1600 amino acids, or any of the other subranges of this range described herein).
  • each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding at least one exon and at least one intron of SEQ ID NO: 4 (e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns).
  • SEQ ID NO: 4 e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns.
  • each of the at least two different vectors include a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding up to 80% of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, up to 70% of SEQ ID NO: 1) such that each of the encoded portions is non overlapping.
  • SEQ ID NO: 1 e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, up to 70% of SEQ ID NO: 1
  • each of the at least two different vectors include a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding up to 80% of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1), such that each of the encoded portions is non-overlapping.
  • SEQ ID NO: 1 e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1
  • each of the at least two nucleic acid vectors may further include an inverted terminal repeat (ITR) to allow head-to-tail recombination.
  • ITR inverted terminal repeat
  • the ITR will be subsequently removed via splicing. Examples of ITRs and splicing acceptor and/or donor signal sequences are known in the art and have been described in Example 10.
  • Example 13 Hybrid Vector Trans-Splicing Strategy using a FI phage highly recombinogenic exogenous gene region (AK)
  • At least two (e.g., two, three, four, five, or six) different nucleic acid vectors can also be used in any of the methods described herein to reconstitute an active stereocilin gene (e.g., a full-length stereocilin gene) within a cell following intermolecular concatamerization, marker gene-mediated recombination, and trans-splicing.
  • This strategy is a hybrid strategy as it will include homologous recombination and/or trans-splicing. See, e.g., Trapani et al., EMBO Mol. Med.
  • an Fl phage recombinogenic region (AK) will be used to allow coding sequence-independent recombination.
  • the Fl phage recombinogenic region may be a 77 bp recombinogenic region from the Fl phage genome as described in Trapani et al. (2014). At least two different nucleic acid vectors will contain an Fl phage recombinogenic region.
  • a nucleic acid encoding an active stereocilin protein may be generated using either ITR-mediated recombination and trans-splicing or Fl phage recombinogenic region-induced recombination and trans splicing.
  • a nucleic acid encoding an active stereocilin protein e.g., a full-length stereocilin protein
  • a mammalian cell e.g., any of the mammalian cells described herein.
  • a first nucleic acid vector can include a promoter (e.g., any of the promoters described herein), a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter (e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the N-terminal portions of a stereocilin protein described herein), a splicing donor signal sequence positioned at the 3’ end of the first coding sequence, and an Fl phage recombinogenic region positioned 3’ of the splicing donor signal sequence.
  • a promoter e.g., any of the promoters described herein
  • a first coding sequence that encodes an N-terminal portion of a stereocilin protein positioned 3’ of the promoter e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the N-terminal portions of a stereocilin protein described herein
  • a second nucleic acid vector can include an Fl phage recombinogenic region, a splicing acceptor signal sequence positioned 3’ of the Fl phage recombinogenic region, a second coding sequence that encodes a C-terminal portion of a stereocilin protein positioned at the 3’ end of the splicing acceptor signal sequence (e.g., any of the sizes of a portion of a stereocilin protein described herein and/or any of the C-terminal portions of a stereocilin protein described herein), and a polyadenylation sequence at the 3’ end of the second coding sequence (e.g., any of the polyadenylation sequences described herein).
  • each of the encoded portions is at least 30 amino acid residues in length (e.g., at least 50 amino acids, at least 75 amino acids, or at least 100 amino acids in length), the amino acid sequence of each of the encoded portions do not overlap, and no single vector of the two different vectors encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • an active stereocilin protein e.g., a full-length stereocilin protein.
  • a first nucleic acid vector can include a portion of promoter sequence (e.g., any of the promoter sequences described herein), a first coding sequence of a stereocilin gene that encodes a first portion of a stereocilin protein (e.g., any of the stereocilin coding sequences described herein) positioned 5’ of the promoter, a first splicing donor signal sequence positioned at the 3’ end of the first coding sequence, and an Fl phage recombinogenic region.
  • promoter sequence e.g., any of the promoter sequences described herein
  • a first coding sequence of a stereocilin gene that encodes a first portion of a stereocilin protein
  • a first splicing donor signal sequence positioned at the 3’ end of the first coding sequence
  • Fl phage recombinogenic region e.g., Fl phage recombinogenic region
  • a second nucleic acid vector can include an Fl phage recombinogenic region, a first splicing acceptor signal sequence positioned 3’ of the Fl phage recombinogenic region, a second coding sequence of a stereocilin gene that encodes a second portion of a stereocilin protein positioned at the 3’ end of the first splicing acceptor signal sequence, a second splicing donor signal sequence positioned at the 3’ end of the second coding sequence (e.g., any of the splicing donor signals described herein), and an Fl phage recombinogenic region.
  • a feature of the second nucleic acid vector will be that self-splicing cannot occur (i.e., splicing will not occur between the second splicing donor signal sequence and the first splicing acceptor signal sequence of the second nucleic acid vector).
  • the splicing donor signal sequence of the first nucleic acid vector and the second splicing donor signal of the second nucleic acid vector are the same (e.g., any of the splicing donor signals described herein or known in the art).
  • the first splicing donor signal sequence of the first nucleic acid vector and the second splicing donor signal sequence of the second nucleic acid vector are different (e.g., any of the splicing donor signal sequences described herein or known in the art).
  • a third nucleic acid vector can include an Fl phage recombinogenic region, a second splicing acceptor signal sequence positioned 3’ of the Fl phage recombinogenic region, a third coding sequence of a stereocilin gene that encodes a third portion of a stereocilin protein positioned at the 3’ end of the second splicing acceptor signal sequence, and a polyadenylation sequence positioned at the 3’ end of the third coding sequence (e.g., any of the polyadenylation sequences described herein).
  • the first splicing donor sequence and the first splicing acceptor sequence can assemble together (recombine) and the second slicing donor sequence and the second slicing acceptor sequence can assemble together
  • stereocilin protein encoded by the first, second, and third coding sequences do not overlap, and when introduced into a mammalian cell (e.g., any of the mammalian cells described herein), splicing occurs between the first splicing donor sequence and the first splicing acceptor sequence, and between the second splicing donor sequence and the second splicing acceptor sequence, to form a recombined nucleic acid that encodes an active stereocilin protein (e.g., a full-length stereocilin protein).
  • a mammalian cell e.g., any of the mammalian cells described herein
  • two of the different nucleic acid vectors can include an Fl phage recombinogenic region and one of the different nucleic acid vectors may include a splicing acceptor signal sequence that is complementary to a splicing donor signal sequence in a nucleic acid vector that includes an Fl phage recombinogenic region.
  • the first and second nucleic acid vectors can include an Fl phage recombinogenic region
  • the third nucleic acid vector will include a splicing acceptor signal that is complementary to the splicing donor signal sequence in the second nucleic acid vector, and the third nucleic acid vector will not include an Fl phage recombinogenic region (e.g., an AP marker gene).
  • the second and third nucleic acid vector can include an Fl phage recombinogenic region and the first nucleic acid vector will include a splicing donor signal sequence that is complementary to the splicing acceptor signal sequence in the second nucleic acid vector and the first nucleic acid vector will not include an Fl phage recombinogenic region.
  • each of the at least two nucleic acid vectors (e.g., two, three, four, five or six) will not be overlapping.
  • Each of the at least two different vectors include a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions being at least 30 amino acids (e.g., about 30 amino acids to about 1600 amino acids, or any of the subranges of this range described herein).
  • each of the at least two different vectors include a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding at least one exon and at least one intron of SEQ ID NO: 4 (e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns).
  • SEQ ID NO: 4 e.g., at least two exons and at least one intron, at least two exons and at least two introns, at least three exons at least one intron, at least three exons and at least two introns, or at least three exons and at least three introns.
  • each of the at least two different vectors includes a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding up to 80% of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1) such that each of the encoded portions is non-overlapping.
  • SEQ ID NO: 1 e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1
  • each of the at least two different vectors include a coding sequence that encodes a different portion of a stereocilin protein, each of the encoded portions encoding up to 80% of SEQ ID NO: 1 (e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1), such that each of the encoded portions is non-overlapping.
  • SEQ ID NO: 1 e.g., up to 10%, up to 20%, up to 30%, up to 40%, up to 50%, up to 60%, or up to 70% of SEQ ID NO: 1
  • each of the at least two nucleic acid vectors may further include an inverted terminal repeat (ITR) to allow head-to-tail recombination.
  • ITR inverted terminal repeat
  • the ITR will be subsequently removed via splicing.
  • ITRs and splicing acceptor and/or donor signals are known in the art and have been described in Example 10.
  • Example 14 CRISPR-Cas9-Mediated Knockin STRC Pseudogene Lacking Undesired Residues
  • pseudogene are 98.9% identical and the coding regions are 99.6% homologous (Francey et al., Am. J Med. Genet. A. 158A(2):298-308, 2012). Francey et al.
  • a nonsense mutation in exon 20 of the STRC pseudogene rendered the protein expressed from the pseudogene inactive (Verpy et al., Nat. Genet. 29:345-349, 2001).
  • Expression of a functional STRC gene may be obtained using a composition including a CRISPR-Cas9 vector to correct (e.g., modify, replace) the nonsense mutation in exon 20 of the STRC pseudogene (SEQ ID NO: 5) to generate a sequence encoding an active stereocilin protein (e.g., a full-length stereocilin protein) in a mammalian cell, and thereby treat non-syndromic sensorineural hearing loss in a subject in need thereof.
  • an active stereocilin protein e.g., a full-length stereocilin protein
  • CRISRP-Cas9 techniques that can be used to introduce a mutation into an endogenous gene are also known in the art. See, e.g., Merkle et al., Cell Rep. 11(6): 875-883, 2015; He et al., Nucleic Acids Res. 44(9):e85, 2016; Wang et al., Mol. Ther. Nucleic Acids 5: e396, 2016, and Verma et al., Methods Mol. Biol. 1513: 119-140, 2017.
  • compositions including a Cas9 nuclease (e.g., Streptococcus pyogenes) and a guide RNA that includes at the 5’ end of the guide RNA a complementary region consisting of about 20 nucleotides (e.g.,
  • RNA-guided genome editing to remove a nonsense mutation at a predetermined site in an endogenous stereocilin pseudogene sequence of SEQ ID NO: 5; and when introduced into a mammalian cell, a nucleic acid encoding an active stereocilin protein (e.g., a full-length stereocilin protein) is reconstituted at the locus of the stereocilin pseudogene.
  • an active stereocilin protein e.g., a full-length stereocilin protein
  • An additional approach to generate a functional STRC transcript from the STRC pseudogene will include using AAV-mediated antisense oligonucleotide delivery via exon skipping. See, e.g., Chamorro et al., Mol. Ther. Nucleic Acids 5: e307, 2016; Kawecka et al, Curr. Gene Ther. 15(4):395-415, 2015; Bremer et al., Mol. Ther. 5:e3379, 2016; Tei et al., Biochem. Biophys. Res. Commun. 461 (3):481 - 486, 2015; and Jirka et al., Nucleic Acid Ther. 24(l):25-36, 2014. As shown in Bremer et al., antisense oligonucleotides can be designed to bind to a particular exon of interest and lead to in-frame exon skipping at the RNA level, thereby restoring gene function.
  • a study can be conducted to determine the eligibility of exon 20 of the STRC pseudogene as a target for exon skipping, using techniques such as those used in Bremer et al. (2016).
  • antisense oligonucleotides with sequences corresponding to 17-23 base pairs in exon 20 can be generated and analyzed for their melting temperature, GC-content, off-target binding and binding energy.
  • the oligonucleotides will be synthesized as 2’-0- methyl phosphorothioate antisense oligonucleotides and analyzed for exon skipping by RT-PCR.
  • cells e.g., a mammalian cell, a human cell, or any cell described herein
  • a nucleic acid vector e.g., an AAV vector
  • an antisense oligonucleotide of a stereocilin gene e.g., an antisense oligonucleotide corresponding to part of exon 20 of a STRC pseudogene
  • expression of the corrected STRC pseudogene will be determined using methods such as RT-PCR, immunofluorescence, or Western blot, as well as functional biochemical assays for a stereocilin protein.
  • a composition including a nucleic acid vector that includes an antisense oligonucleotide that is complementary to at least a portion e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides, at least 15 contiguous nucleotides, at least 20 contiguous nucleotides, at least 25 contiguous nucleotides, at least 30 contiguous nucleotides, at least 35 contiguous nucleotides, at least 40 contiguous nucleotides, at least 45 contiguous nucleotides, at least 50 contiguous nucleotides, at least 55 contiguous nucleotides, at least 60 contiguous nucleotides, at least 65 contiguous nucleotides, at least 70 contiguous nucleotides, at least 75 contiguous nucleotides, at least 80 contiguous nucleotides, at least 85 contiguous nucleotides, at least 90
  • oligonucleotide e.g., an antisense oligonucleotide of SEQ ID NO: 5 complementary to sequence within the region defined by positions 13955-14141
  • oligonucleotide will be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range of numbers having one of those numbers at the low end and a higher number at the high end.
  • the antisense oligonucleotides of exon 20 will be 20 nucleotides in length.
  • the antisense oligonucleotides of exon 20 will be 20 nucleotides in length.
  • the antisense oligonucleotides of exon 20 will be 20 nucleotides in length.
  • oligonucleotides of exon 20 (e.g., an antisense oligonucleotide of SEQ ID NO: 5 complementary to sequence comprising of positions 13955-14141) will be 15 to 30 nucleotides in length.
  • the antisense oligonucleotides of exon 20 (e.g., an antisense oligonucleotide of SEQ ID NO: 5) will be at least 80% identical (e.g., at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
  • HEK293FT cells were seeded overnight at 7E4 cells/well in a 24-well format and were transfected with exemplary single or dual STRC vectors using jetprime reagent. 72 hours post-transfection, HEK293FT cells were harvested with 200 pL RIPA buffer/well. Thirty microliters of samples were loaded into each well onto a 4- 12% Bis-Tris protein gel. STRC protein expression was determined using a STRC polyclonal antibody. Beta-actin (ACTB) was used as a loading control.
  • ACTB Beta-actin
  • HEK293FT cells were transduced with dual STRC vectors at different MOIs and were seeded overnight at 1.2E5 cells/well in a 24-well format with etoposide reagent.
  • HEK293FT cells were harvested 72 hours post-infection with 200 pL RIPA buffer/well.
  • HEK293FT cells transduced with AAV2 vectors showed higher expression of full-length STRC protein as compared to HEK293FT cells transduced with AAV.Anc80 vector.
  • Figure 9 showed high levels of STRC RNA expression relative to GAPDH in HEK293FT cells infected with either Anc80.STRC (at MOI 8.6E4 and MOI 2.6E5) or AAV2.STRC (at MOI 8.6E4 and MOI 2.6E5).
  • P2 cochlear from WT mice were infected after plating and were harvested for RNA and immunofluorescence 72 hours after infection. As shown in Figure 10, full- length STRC was efficiently expressed in cochlear explants infected with
  • outer hair cells and inner cells of Pl-3 cochlear explants expressed Myo7a and phalloidin when transduced with
  • FIG. 11 A and 11B showed the natural cochlear structure, in which Myo7a is expressed in both outer and inner hair cells, while phalloidin is expressed exclusively in the inner hair cells. A similar staining pattern was observed in Pl-3 cochlear explants transduced with AAV. Anc80. STRC ( Figures 11C-E), and in Pl-3 cochlear explants transduced with AAV2.STRC

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Environmental Sciences (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2019/041625 2018-07-13 2019-07-12 Methods of treating non-syndromic sensorineural hearing loss Ceased WO2020014625A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CN201980057626.7A CN112639108A (zh) 2018-07-13 2019-07-12 治疗非综合征性感觉神经性听力损失的方法
CA3106261A CA3106261A1 (en) 2018-07-13 2019-07-12 Methods of treating non-syndromic sensorineural hearing loss
AU2019300045A AU2019300045A1 (en) 2018-07-13 2019-07-12 Methods of treating non-syndromic sensorineural hearing loss
EP19833536.6A EP3821019A4 (en) 2018-07-13 2019-07-12 METHODS OF TREATMENT OF NONSYNDROMIC INNER EAR DEAF
JP2021500888A JP2021530227A (ja) 2018-07-13 2019-07-12 非症候性感音性聴力喪失の治療方法
US17/259,661 US12226493B2 (en) 2018-07-13 2019-07-12 Methods of treating non-syndromic sensorineural hearing loss
JP2024079983A JP2024109708A (ja) 2018-07-13 2024-05-16 非症候性感音性聴力喪失の治療方法
US19/015,387 US20260000787A1 (en) 2018-07-13 2025-01-09 Methods of treating non-syndromic sensorineural hearing loss

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862697652P 2018-07-13 2018-07-13
US62/697,652 2018-07-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/259,661 A-371-Of-International US12226493B2 (en) 2018-07-13 2019-07-12 Methods of treating non-syndromic sensorineural hearing loss
US19/015,387 Division US20260000787A1 (en) 2018-07-13 2025-01-09 Methods of treating non-syndromic sensorineural hearing loss

Publications (1)

Publication Number Publication Date
WO2020014625A1 true WO2020014625A1 (en) 2020-01-16

Family

ID=69142651

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/041625 Ceased WO2020014625A1 (en) 2018-07-13 2019-07-12 Methods of treating non-syndromic sensorineural hearing loss

Country Status (7)

Country Link
US (2) US12226493B2 (https=)
EP (1) EP3821019A4 (https=)
JP (2) JP2021530227A (https=)
CN (1) CN112639108A (https=)
AU (1) AU2019300045A1 (https=)
CA (1) CA3106261A1 (https=)
WO (1) WO2020014625A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022241302A3 (en) * 2021-05-14 2022-12-22 Rescue Hearing Inc. Gene therapy constructs and methods for treatment of hearing loss
WO2022235933A3 (en) * 2021-05-05 2022-12-29 Decibel Therapeutics, Inc. Compositions and methods for treating sensorineural hearing loss using stereocilin dual vector systems
WO2023064388A3 (en) * 2021-10-12 2023-08-24 Decibel Therapeutics, Inc. Stereocilin promoters and uses thereof
US12226493B2 (en) 2018-07-13 2025-02-18 Akouos, Inc. Methods of treating non-syndromic sensorineural hearing loss

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7846626B2 (ja) * 2020-02-07 2026-04-15 ザ チルドレンズ メディカル センター コーポレーション 大型遺伝子ベクターならびにその送達および使用の方法
US11946065B2 (en) * 2020-07-29 2024-04-02 The Board Of Regents Of The University Of Texas System Transgene cassettes, AAV vectors, and AAV viral vectors for expression of human codon-optimized CSTB

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160076054A1 (en) * 2013-04-18 2016-03-17 Fondazione Telethon Effective delivery of large genes by dual aav vectors
WO2017100791A1 (en) * 2015-12-11 2017-06-15 Massachusetts Eye And Ear Infirmary Materials and methods for delivering nucleic acids to cochlear and vestibular cells
WO2018039375A1 (en) * 2016-08-23 2018-03-01 Akouos, Inc. Compositions and methods for treating non-age-associated hearing impairment in a human subject

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5168062A (en) 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
US5549910A (en) 1989-03-31 1996-08-27 The Regents Of The University Of California Preparation of liposome and lipid complex compositions
US5252334A (en) 1989-09-08 1993-10-12 Cygnus Therapeutic Systems Solid matrix system for transdermal drug delivery
JP3218637B2 (ja) 1990-07-26 2001-10-15 大正製薬株式会社 安定なリポソーム水懸濁液
JP2958076B2 (ja) 1990-08-27 1999-10-06 株式会社ビタミン研究所 遺伝子導入用多重膜リポソーム及び遺伝子捕捉多重膜リポソーム製剤並びにその製法
US5795587A (en) 1995-01-23 1998-08-18 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
US5697899A (en) 1995-02-07 1997-12-16 Gensia Feedback controlled drug delivery system
US5738868A (en) 1995-07-18 1998-04-14 Lipogenics Ltd. Liposome compositions and kits therefor
US5656016A (en) 1996-03-18 1997-08-12 Abbott Laboratories Sonophoretic drug delivery system
US5797898A (en) 1996-07-02 1998-08-25 Massachusetts Institute Of Technology Microchip drug delivery devices
US5783208A (en) 1996-07-19 1998-07-21 Theratech, Inc. Transdermal drug delivery matrix for coadministering estradiol and another steroid
US5779708A (en) 1996-08-15 1998-07-14 Cyberdent, Inc. Intraosseous drug delivery device and method
CA2553676A1 (en) 2004-01-28 2005-08-11 Research Development Foundation Human soluble neuropilin-1 primary polyadenylation signal and uses thereof
US20060040354A1 (en) 2004-07-20 2006-02-23 O'keefe Theresa L Novel polyadenylation signal for use in expression vectors
WO2015048577A2 (en) * 2013-09-27 2015-04-02 Editas Medicine, Inc. Crispr-related methods and compositions
WO2020014625A1 (en) 2018-07-13 2020-01-16 Akouos, Inc. Methods of treating non-syndromic sensorineural hearing loss
EP4054653A4 (en) 2019-11-04 2023-11-29 Decibel Therapeutics, Inc. PROMOTERS OF COCHLEAR EXTERNAL HAIR CELLS AND THEIR USES
JP7846626B2 (ja) 2020-02-07 2026-04-15 ザ チルドレンズ メディカル センター コーポレーション 大型遺伝子ベクターならびにその送達および使用の方法
US20240016955A1 (en) 2020-09-14 2024-01-18 President And Fellows Of Harvard College Dual-aav vector delivery of pcdh15 and uses thereof
JP2024517843A (ja) 2021-05-05 2024-04-23 デシベル セラピューティクス インコーポレイテッド ステレオシリン二重ベクター系を使用して感音性難聴を治療するための組成物及び方法
IL308328A (en) 2021-05-14 2024-01-01 Rescue Hearing Inc Structures and methods of gene therapy to treat hearing loss
EP4416294A2 (en) 2021-10-12 2024-08-21 Decibel Therapeutics, Inc. Stereocilin promoters and uses thereof
JP2025504263A (ja) 2021-12-23 2025-02-10 ユニバーシティ オブ ロチェスター 内耳への薬剤の送達のためのｃｓｆ輸送経路
WO2024151703A2 (en) 2023-01-12 2024-07-18 Ohio State Innovation Foundation Gene therapy for treating hearing loss disorders

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160076054A1 (en) * 2013-04-18 2016-03-17 Fondazione Telethon Effective delivery of large genes by dual aav vectors
WO2017100791A1 (en) * 2015-12-11 2017-06-15 Massachusetts Eye And Ear Infirmary Materials and methods for delivering nucleic acids to cochlear and vestibular cells
WO2018039375A1 (en) * 2016-08-23 2018-03-01 Akouos, Inc. Compositions and methods for treating non-age-associated hearing impairment in a human subject

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI, GenBank 9 March 2017 (2017-03-09), "Homo sapiens stereocilin pseudogene 1 (STRCP1), non-coding RNA", XP055674877, Database accession no. NR_146078.1 *
See also references of EP3821019A4 *
VERPY, E. ET AL.: "Mutations in a new gene encoding a protein of the hair bundle cause non-syndromic deafness at the DFNB16 locus", NATURE GENETICS, vol. 29, 2001, pages 345 - 349, XP055674879 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12226493B2 (en) 2018-07-13 2025-02-18 Akouos, Inc. Methods of treating non-syndromic sensorineural hearing loss
WO2022235933A3 (en) * 2021-05-05 2022-12-29 Decibel Therapeutics, Inc. Compositions and methods for treating sensorineural hearing loss using stereocilin dual vector systems
JP2024517843A (ja) * 2021-05-05 2024-04-23 デシベル セラピューティクス インコーポレイテッド ステレオシリン二重ベクター系を使用して感音性難聴を治療するための組成物及び方法
EP4333905A4 (en) * 2021-05-05 2025-03-26 Decibel Therapeutics, Inc. COMPOSITIONS AND METHODS FOR TREATING SENSORINEURAL HEARING LOSS USING DUAL-VECTOR STEREOCYLIN SYSTEMS
WO2022241302A3 (en) * 2021-05-14 2022-12-22 Rescue Hearing Inc. Gene therapy constructs and methods for treatment of hearing loss
JP2024518552A (ja) * 2021-05-14 2024-05-01 レスキュー ヒヤリング インコーポレイテッド 難聴治療のための遺伝子治療用構築物および方法
US20240252681A1 (en) * 2021-05-14 2024-08-01 Rescue Hearing Inc. Gene therapy constructs and methods for treatment of hearing loss
WO2023064388A3 (en) * 2021-10-12 2023-08-24 Decibel Therapeutics, Inc. Stereocilin promoters and uses thereof

Also Published As

Publication number Publication date
CN112639108A (zh) 2021-04-09
JP2021530227A (ja) 2021-11-11
US12226493B2 (en) 2025-02-18
CA3106261A1 (en) 2020-01-16
AU2019300045A1 (en) 2021-01-07
US20260000787A1 (en) 2026-01-01
US20210330814A1 (en) 2021-10-28
EP3821019A4 (en) 2022-10-05
EP3821019A1 (en) 2021-05-19
JP2024109708A (ja) 2024-08-14

Similar Documents

Publication Publication Date Title
US12264317B2 (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
US20260000787A1 (en) Methods of treating non-syndromic sensorineural hearing loss
US12305191B2 (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
EP3755805A1 (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
AU2026201371A1 (en) Methods of treating CLRN1-associated hearing loss and/or vision loss
CN117642187A (zh) 用于治疗听力损失的基因疗法构建体和方法
JP7244547B2 (ja) Ｆ８遺伝子機能を回復させるためのアデノ随伴ウイルス組成物及びその使用の方法
KR20230041965A (ko) Slc26a4-연관 청력손실을 치료하기 위한 조성물 및 방법
HK40098362A (en) Compositions and methods for treating non-age-associated hearing impairment in a human subject
EA045887B1 (ru) Способы лечения clrn1-ассоциированной потери слуха и/или потери зрения
EA049403B1 (ru) Способы лечения clrn1-ассоциированной потери слуха и/или потери зрения

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19833536

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019300045

Country of ref document: AU

Date of ref document: 20190712

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3106261

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021500888

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019833536

Country of ref document: EP

Effective date: 20210215

WWW Wipo information: withdrawn in national office

Ref document number: 2019833536

Country of ref document: EP