WO2019241721A2 - Compositions et méthodes relatives à des lymphocytes b mémoires à igm - Google Patents

Compositions et méthodes relatives à des lymphocytes b mémoires à igm Download PDF

Info

Publication number
WO2019241721A2
WO2019241721A2 PCT/US2019/037334 US2019037334W WO2019241721A2 WO 2019241721 A2 WO2019241721 A2 WO 2019241721A2 US 2019037334 W US2019037334 W US 2019037334W WO 2019241721 A2 WO2019241721 A2 WO 2019241721A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
light chain
heavy chain
Prior art date
Application number
PCT/US2019/037334
Other languages
English (en)
Other versions
WO2019241721A3 (fr
Inventor
David J. Rawlings
Christopher THOUVENEL
Marion PEPPER
Jason Mark NETLAND
Mary Francesca FONTANA
Yu Chen
Original Assignee
Seattle Children's Hospital D/B/A Seattle Children's Research Institute
University Of Washington
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seattle Children's Hospital D/B/A Seattle Children's Research Institute, University Of Washington filed Critical Seattle Children's Hospital D/B/A Seattle Children's Research Institute
Publication of WO2019241721A2 publication Critical patent/WO2019241721A2/fr
Publication of WO2019241721A3 publication Critical patent/WO2019241721A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/002—Protozoa antigens
    • A61K39/015—Hemosporidia antigens, e.g. Plasmodium antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/20—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans from protozoa
    • C07K16/205—Plasmodium
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present disclosure relates to the isolation of antigen-specific memory B cells and compositions and methods related to and derived therefrom.
  • MBCs Memory B cells induced by vaccine or infection are critical components of a protective humoral response. MBCs can persist for long periods of time and rapidly respond to subsequent infection through the production of antibody secreting cells, formation of new germinal centers (GCs) and repopulation of the memory pool (Tarlinton and Good-Jacobson, 2013).
  • Classically defined MBCs express class-switched, somatically hypermutated B cell receptors (BCRs) after undergoing a GC reaction. These cells produce high affinity antibodies within days of a secondary challenge, making them the gold standard for vaccine development.
  • MBCs are heterogeneous. They have been shown to express either isotype switched or unswitched BCRs that have undergone various degrees of somatic hypermutation (Kaji et al., 2012; Pape et al., 2011; Toyama et al., 2002). MBC subsets also exhibit varied expression of surface markers associated with T cell interactions such as CD73, CD80 and PDL2, revealing varied developmental histories and receptor ligand
  • IgM antibodies exert a dramatic protective benefit not predicted by previous observations. Specifically, while it is generally accepted in the art that early IgM responses can promote partial early immune protection, essentially all models of adaptive immunity propose that high- affinity IgG antibodies comprise the major protective component of the humoral response. In contrast, the data described herein support the opposite, in that the data shows, completely unexpectedly, that IgM antibodies can exert an even greater protective effect, which depending on the pathogen or tumor antigen can allow for markedly greater clinical benefits. While a very high-affinity IgG vs. IgM memory -derived IgM antibodies were not directly compared, the K D studies described herein strongly indicate that, regardless of IgG affinity, the additional benefits rendered by IgM avidity will lead to a greater protective effect even in that scenario.
  • IgM antibodies can exert this very strong protective benefit despite having many fewer somatic mutations compared to IgG antibodies. Without wishing to be bound or limited by theory, this latter fact could reflect higher affinity of the germline IgM that triggers generation of an IgM memory B cell. As described herein, despite the lower affinity, IgM antibodies can outperform high-affinity IgG.
  • a screening method in which memory B cells are panned from a biological sample for binding to an antigen of interest, followed by the cloning of heavy and light chain IgM memory B cell receptor antigen-binding domains from the bound cells.
  • This approach reliably provides antigen-binding domains from IgM memory B cells that specifically bind the antigen of interest with high affinity.
  • Polypeptide constructs generated from the cloned antigen-binding domains have low somatic mutation, on the order of 8 or fewer, e.g., 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, or even 3 or fewer somatic mutations and have high affinity, specific binding to the antigen of interest, but provoke less anti -immunoglobulin immune response in a human subject relative to constructs using more highly somatically mutated antigen binding domains.
  • Such constructs can, for example, be repeatedly administered for therapy, with a reduced likelihood of provoking an anti immunoglobulin immune response. It is also contemplated that antigen binding domains derived from antigen-specific B cells expressing IgM may be more easily tolerized for therapeutic purposes than those isolated B cells expressing IgG.
  • IgM antigen-binding domains isolated from memory B cells be less immunogenic, but, given the high affinity binding of recombinant constructs including multimers of these binding domains, e.g., in an IgM format, a broader range of high affinity, antigen specific IgM polypeptide constructs with lower somatic mutation is available than previously achievable.
  • memory B cell IgM antigen receptors may have reduced affinity relative to more somatically mutated antigen binding domains isolated from IgG’s
  • the finding herein that memory B cell IgM antigen receptors bind with surprisingly lower KD’S than one might expect even when an anticipated decrease in KD via avidity for the multimeric binding domains is considered, means that memory B cell IgM antigen-binding domains provide a considerably broader range source of antigen-specific binding constructs than previously appreciated.
  • libraries of memory B cell IgM antigen receptors with a greater proportion, e.g., at least 10% greater, 20% greater, 30% greater, 40% greater, 50% greater, 60% greater, 70% greater, 80% greater, 90% greater, 100% greater, 2-old, 5-fold, lO-fold, 50-fold, or lOO-fold or more greater proportion of antigen- specific binding domains that provide high affinity binding than a library based upon antibody binding domains from a class-switched B cell population. It is also specifically contemplated that the more native/less somatically mutated or modified an antigen binding domain is, the more its core activity will be preserved.
  • antigen binding polypeptides that have a native B cell IgM antigen receptor.
  • naive B cells e.g., by selecting a CD19+, CD27-, IgD+ B cell population and cloning the IgM antigen receptor coding sequences, a library of native B cell IgM antigen receptor molecules can be generated. When these are expressed as a recombinant IgM as described herein, high affinity antigen-binding domains substantially without somatic mutation can be prepared.
  • This library can be expressed and panned for binding to an antigen of interest in order to isolate the IgM antigen receptors that bind the antigen of interest.
  • nucleic acid constructs encoding an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds an antigen of interest, in an IgM isotype acceptor antibody framework.
  • a nucleic acid construct is provided that encodes a light chain antigen binding domain from a memory B cell IgM antigen receptor, a light chain constant domain, a heavy chain antigen binding domain from a memory B cell IgM antigen receptor and a heavy chain constant domain.
  • the heavy chain and light chain constant domains are IgM constant domains.
  • the antigen-binding domains encoded by such constructs have 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, or even 3 or fewer somatic mutations.
  • nucleic acid constructs encoding an antigen-binding domain isolated from an IgM native B cell receptor that specifically binds an antigen of interest, in an IgM isotype acceptor antibody framework.
  • a nucleic acid construct is provided that encodes a light chain antigen binding domain from a native B cell IgM antigen receptor, a light chain constant domain, a heavy chain antigen binding domain from a native B cell IgM antigen receptor and a heavy chain constant domain.
  • the heavy chain and light chain constant domains are IgM constant domains.
  • the antigen-binding domains encoded by such constructs have substantially no somatic mutation. By substantially no is meant 1 or fewer somatic mutations.
  • a naive B cell would have no somatic mutations in the V regions; without wishing to be limited by theory, somatic mutations found in isolates prepared from naive B cells identified on the basis of a CD19+, CD27-, IgD+ surface marker profile would likely arise from contaminating non-naive B cells in the preparation.
  • a recombinant antigen-binding polypeptide comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds an antigen of interest, in an IgM isotype acceptor antibody framework.
  • the antigen-binding domain has 8 or fewer somatic mutations relative to a naive B cell receptor.
  • the recombinant antigen-binding polypeptide has a Kd for the antigen of interest of 10 10 M or below.
  • the recombinant antigen-binding polypeptide has a Kd for the antigen of interest of 10 11 M or below.
  • the recombinant antigen-binding polypeptide has a Kd for the antigen of interest of 10 12 M or below.
  • the recombinant antigen-binding polypeptide comprises human antigen-binding and constant domains.
  • a recombinant polypeptide construct comprising an antigen-binding unit comprising heavy and light chain variable domains of a B cell receptor of a naive B cell, and an IgM heavy chain constant domain.
  • the recombinant antigen-binding polypeptide construct described herein comprises a plurality of IgM isotype antigen binding units. In some embodiments, the construct comprises a plurality of antigen binding units.
  • the construct comprises five or seven antigen binding units.
  • the recombinant polypeptide construct comprises a J chain sequence.
  • the recombinant polypeptide is an antigen expressed by a pathogen, or a tumor antigen.
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds a. Plasmodium antigen, in an IgM isotype acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises variable domain complementarity determining regions (CDRs) selected from the group consisting of:
  • the CDRs are grafted into an IgM acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgM antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgM antigen-binding units.
  • an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds a Plasmodium antigen, in an IgG isotype acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct comprises variable domain complementarity determining regions (CDRs) selected from the group consisting of:
  • CDR2 having the amino acid sequence of SEQ ID NO: 118; a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 119; a light chain CDR1 having the amino acid sequence of SEQ ID NO: 122; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 123; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 124;
  • CDR2 having the amino acid sequence of SEQ ID NO: 128; a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 129; a light chain CDR1 having the amino acid sequence of SEQ ID NO: 132; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 133; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 134;
  • CDR2 having the amino acid sequence of SEQ ID NO: 108; a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 109; a light chain CDR1 having the amino acid sequence of SEQ ID NO: 112; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 113; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 114;
  • the CDRs are grafted into an IgG acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgG antigen-binding units.
  • the recombinant antigen-binding polypeptide construct comprises five or six IgG antigen-binding units.
  • MSP-l Plasmodium falciparum merozoite surface protein 1
  • the recombinant antigen-binding polypeptide construct comprises CDRs
  • the CDRs are grafted into an IgM acceptor antibody framework.
  • the CDRs are grafted into an IgG acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgM antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgM antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgG antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgG antigen-binding units.
  • AMA Plasmodium falciparum apical membrane antigen 1
  • the recombinant antigen-binding polypeptide construct comprises CDRs
  • the CDRs are grafted into an IgM acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgM antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgM antigen-binding units.
  • the CDRs are grafted into an IgG acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgG antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgG antigen-binding units.
  • CSP Plasmodium falciparum circumsporozoite protein
  • the CDRs are grafted into an IgM acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgM antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgM antigen-binding units.
  • the CDRs are grafted into an IgG acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgG antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgG antigen-binding units.
  • polypeptide construct comprising heterologous CDRs grafted into an IgM acceptor antibody framework.
  • the recombinant antigen-binding polypeptide described herein specifically binds to Plasmodium falciparum MSP-l, AMA, or CSP.
  • the CDRs are selected from the group consisting of:
  • a multimeric IgG construct comprising five or six IgG antigen binding units that specifically binds an antigen of interest, wherein the heavy chain of each IgG antigen binding unit has a leucine to a cysteine mutation in the C H 2 domain at the position corresponding to L309 of the wild-type human IgG of SEQ ID NO: 180, and wherein the heavy chain of each IgG antigen-binding unit comprises an IgM tail piece.
  • the IgG is IgGl, IgG2, IgG3, or IgG4.
  • the IgM tail piece comprises the amino acid sequence of SEQ ID NO: 155 (PTLYNV SLVMSDTAGTCY) .
  • each IgG moiety comprises CDRs isolated from a memory B cell receptor that specifically binds an antigen of interest.
  • the antigen of interest is an antigen of a pathogen.
  • the antigen of interest is a Plasmodium falciparum antigen.
  • the Plasmodium falciparum antigen is MSP-l, AMA, or CSP.
  • the antigen of interest is a tumor antigen.
  • the multimeric IgG construct described herein comprises an MSP- 1 -specific CDR selected from the group consisting of:
  • the multimeric IgG construct comprises an AMA-specific CDR selected from the group consisting of:
  • step (b) separating a population of antigen-bound cells from non-antigen-bound cells of step (a); and c. isolating cells expressing CD21, CD27, and IgM from the population antigen-bound cells.
  • the biological sample is a blood sample.
  • the subject has had an infection with or is currently infected with a
  • pathogen that comprises or expresses the antigen of interest.
  • a biological sample is obtained from a subject.
  • the isolating step (c) comprises flow cytometry.
  • step (c) optionally comprises isolating cells expressing a plasmablast marker.
  • the plasmablast marker is B220 or CD138.
  • an antibody construct comprising an antigen-binding domain from a memory B cell and that specifically binds to an antigen of interest, the method comprising:
  • step (a) amplifying heavy chain and light chain variable domain sequences from the memory B cell population of step (a);
  • step (b) ligating heavy chain variable domain sequences amplified in step (b) into a heavy chain
  • step (c) to a cell and culturing the cell under conditions that permit expression of antibody polypeptides from the expression vector sequences;
  • the method further comprises prior to step (a), a step of vaccinating a subject and obtaining a biological sample.
  • step (e) comprises contacting antibody polypeptides with the antigen of interest immobilized on a solid support
  • the method further comprises prior to step (e), collecting cell culture
  • described herein is an antibody composition produced by any one of the methods described herein.
  • described herein is a method of treating or preventing a disease or disorder, the method comprising administering a recombinant antigen-binding polypeptide construct described herein, or a cell expressing such a polypeptide, or a vector encoding such a polypeptide to a subject in need thereof.
  • the subject is a human.
  • the disease or disorder is an infectious disease.
  • the infectious disease is a parasitic infectious disease.
  • the disease or disorder is cancer.
  • the administering comprises intravenous administration.
  • described herein is a method of immunizing a subject against a pathogen, the method comprising: administering a recombinant antigen-binding polypeptide construct described herein, or a cell expressing such a polypeptide construct, or a vector encoding such a polypeptide construct to an individual in need thereof.
  • the administering comprises intravenous administration.
  • the subject is a human.
  • the pathogen is a parasite, bacteria, fungus, virus, or prion.
  • the parasite is selected from the group consisting of: Plasmodium
  • the bacteria is selected from the group consisting of: E. coli, Psuedomonas aeruginosa, M. tuberculosis, Group B Streptococcus, Streptococcus epidermidis, Streptococcus pneumoniae, Haemophilus influenzae, Bacillus anthracis, Erysipelothrix rhusiopathiae, Klebsiella pneumoniae, Brucella abortus, Nocadia brasiliensis, Borrelia hermsii, and Borrelia burgdorferi.
  • a biological sample obtained from a subject having had prior exposure to an antigen of interest with an agent comprising the antigen or a portion thereof; and sorting a cell population comprising IgM memory B cells based on binding to the agent comprising the antigen.
  • the method further comprises sorting the population comprising antigen-specific IgM memory B cells using an agent specific for CD21, an agent specific for CD27, an agent specific for IgM isotype, or any combination thereof to isolate a population of IgM memory B cells specific for the antigen.
  • the agent comprising the antigen comprises a multimer of the antigen. In some embodiments, the agent comprising the antigen comprises a dimer, trimer or tetramer of the antigen.
  • the antigen is from an infectious organism.
  • the method further comprises one or more steps of sequencing one or more B cell receptors (BCRs) of the cell population comprising IgM memory B cells.
  • BCRs B cell receptors
  • the method further comprises one or more steps of cloning the one or more BCRs, or antigen binding domains thereof, and expressing the one or more BCRs or antigen-binding domains thereof as one or more recombinant antigen-binding polypeptides.
  • the biological sample comprises a blood sample.
  • recombinant cells producing an antigen-binding polypeptide comprising a variable heavy chain immunoglobulin sequence, a variable light chain immunoglobulin sequence, or both, from an IgM memory B cell obtained using any of the methods described herein.
  • recombinant antigen-binding polypeptides isolated from a recombinant cell as described herein.
  • recombinant antigen-binding polypeptides comprising an antigen-binding domain of an IgM memory B cell receptor.
  • the antigen binding domain comprises a variable light chain sequence, a variable heavy chain sequence, or both.
  • the IgM memory B cell receptor antigen-binding domain is comprised in a non-IgM isotype antibody framework.
  • the non-IgM isotype antibody framework is an IgG antibody framework.
  • the IgM memory B cell receptor antigen-binding domain is a human IgM memory B cell receptor antigen binding domain.
  • the IgM memory B cell is CD21+CD27+.
  • the recombinant antigen-binding polypeptide comprises an scFv polypeptide, a single-domain antibody construct, a chimeric antibody construct or a bispecific antibody construct.
  • the polypeptide binds its antigen with a KD of 10 6 nM or lower.
  • variable light chain immunoglobulin sequence, variable heavy chain immunoglobulin sequence, or both has one or more somatic mutations relative to a variable heavy chain immunoglobulin sequence or variable light chain immunoglobulin sequence from a naive B cell. In some embodiments, the variable light chain sequence, variable heavy chain sequence, or both has one to eight somatic mutations relative to a variable heavy chain sequence or variable light chain sequence from a naive B cell. In some embodiments, variable light chain sequence, variable heavy chain sequence, or both has one to eight somatic mutations relative to a variable heavy chain sequence or variable light chain sequence from a naive B cell. In some
  • the antigen-binding domain of the IgM memory B cell receptor has fewer than 5 somatic mutations.
  • the IgM memory B cell receptor antigen-binding domain specifically binds an antigen comprised or expressed by an infectious organism.
  • the infectious organism is a blood-borne pathogen.
  • the infectious organism is a virus, a bacterium, a fungus or a parasite.
  • the infectious organism is P. falciparum.
  • the antigen is P.
  • MSP1 falciparum merozoite surface protein 1
  • AMA apical membrane antigen 1
  • the IgM memory B cell receptor antigen-binding domain specifically binds a tumor antigen.
  • compositions comprising a population of antigen-specific IgM memory B cells bound via their B cell receptors to antigen immobilized on a solid support.
  • the antigen immobilized on the solid support comprises a multimer construct comprising the antigen.
  • the multimer construct comprises a dimer, trimer or tetramer of the antigen.
  • the antigen is an antigen expressed by an infectious organism.
  • the infectious organism is a blood-bome pathogen.
  • the infectious organism is a virus, a bacterium, a fungus or a parasite.
  • the infectious organism is P. falciparum.
  • the antigen is P. falciparum merozoite surface protein 1 (MSP1) or apical membrane antigen 1 (AMA).
  • the IgM memory B cell receptor antigen-binding domain specifically binds a tumor antigen.
  • populations of at least 100 recombinant antigen-binding molecules each comprising an antigen-binding domain of an IgM memory B cell receptor, and each binding its antigen with a KD of 10 6 nM or lower.
  • the average frequency of somatic mutation is eight or fewer per molecule. In some embodiments, the average frequency of somatic mutation is five or fewer per molecule.
  • the population binds the same antigen.
  • the antigen is an antigen expressed or comprised by an infectious organism.
  • the infectious organism is a blood-bome pathogen.
  • the infectious organism is a virus, a bacterium, a fungus, or a parasite.
  • the infectious organism is P. falciparum.
  • the antigen is P. falciparum merozoite surface protein 1 (MSP1) or apical membrane antigen 1 (AMA).
  • compositions comprising any of the compositions described herein and a pharmaceutically acceptable carrier.
  • vaccine compositions comprising a composition as described herein.
  • kits for treating a subject in need of treatment for a disease caused by an infectious organism comprising administering a composition comprising an antigen-binding polypeptide as described herein to the subject, wherein the antigen-binding polypeptide specifically binds an antigen comprised by the infectious organism.
  • kits for reducing the likelihood of contracting a disease caused by an infectious organism comprising administering to an individual at risk of contracting the disease a composition comprising an antigen-binding polypeptide as described herein to the subject, wherein the antigen-binding polypeptide specifically binds an antigen comprised by the infectious organism.
  • kits for treating a subject in need of treatment for a tumor that expresses a tumor antigen comprising administering a composition comprising an antigen binding polypeptide as described herein to the subject, wherein the antigen-binding polypeptide specifically binds the tumor antigen.
  • MBCs Plasmodium- specific IgM memory B cells
  • methods of sorting Plasmodium- specific IgM memory B cells comprising: generating B cell tetramers specific for blood or liver stage Plasmodium antigens; providing the B cell tetramers to a biological sample obtained from a subject infected with malaria; and sorting the Plasmodium- specific IgM MBCs based on binding to the tetramers.
  • the method further comprises one or more steps of sequencing the Plasmodium- specific IgM MBC B cell receptors (BCRs). [00122] In some embodiments of these aspects and all such aspects described herein, the method further comprises one or more steps of cloning the BCRs and expressing the BCRs as recombinant antibodies.
  • BCRs Plasmodium-specific IgM MBC B cell receptors
  • the subject is a mammal. In some embodiments, the subject is a human.
  • provided herein are isolated or recombinant antibody-producing B-cells produced by using any of the methods described herein. In some aspects, provided herein are recombinant antibodies produced from the isolated or recombinant antibody-producing B-cell.
  • recombinant antibodies comprising a variable region from Plasmodium- specific memory B cells and an immunoglobulin heavy chain isotype.
  • the recombinant antibody is for the treatment of or protection from malaria infection in a subject.
  • the recombinant antibody is for vaccination against malaria.
  • the recombinant antibody is for the treatment of multi-drug resistant malaria.
  • pharmaceutical composition comprising such recombinant antibodies.
  • a recombinant antibody as described herein.
  • the subject is a mammal.
  • the subject is immunocompromised.
  • kits for treating multi-drug resistant malaria in a subject comprising administering a therapeutically effective amount of a recombinant antibody as described herein.
  • the subject is a mammal.
  • the subject is a human.
  • the subject is immunocompromised.
  • a subject in some aspects, is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is immunocompromised.
  • the recombinant antibody is administered in an amount effective to provide short-term protection against a malaria infection.
  • the short-term protection is at least about 2 months. In some embodiments, the short-term protection is at least about 3 months.
  • kits for assessing an effective vaccine strategy for malaria infection in a subject comprising: generating B cell tetramers specific for blood or liver stage Plasmodium antigens; providing the B cell tetramers to a biological sample obtained from the subject; and sorting or enumerating the Plasmodium- specific IgM MBCs based on binding to the tetramers.
  • the method further comprises a step of sequencing the Plasmodium- specific IgM MBC B cell receptors (BCRs).
  • BCRs Plasmodium- specific IgM MBC B cell receptors
  • the subject is a mammal.
  • the subject is a human.
  • the subject is immunocompromised.
  • recombinant antibodies comprising a variable region from a Plasmodium- specific memory B cell and an IgG or IgM isotype acceptor antibody framework or scaffold.
  • AMA malarial antigen apical membrane antigen 1
  • CDRs heavy chain complimentarity determining regions
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 27
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 28
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 29;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 57
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 58
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 59;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 77
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 78
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 79;
  • CDR2 having the amino acid sequence of SEQ ID NO: 148; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 149.
  • AMA malarial antigen apical membrane antigen 1
  • CDRs light chain complimentarity determining regions
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 32
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 33
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 34;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 62; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 63; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 64;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 82
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 83
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 84;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 142
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 143
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 144
  • AMA malarial antigen apical membrane antigen 1
  • CDRs heavy and light chain complimentarity determining regions
  • recombinant antibodies or antigen-binding fragments thereof that specifically bind to the malarial antigen Merozoite Surface Protein 1 (MSP1) and comprises heavy chain complimentarity determining regions (CDRs) selected from the group consisting of:
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 67
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 68
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 69;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 97; a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 98; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 99;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 117; a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 118; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 119;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 127
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 128
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 129.
  • recombinant antibodies or antigen-binding fragments thereof that specifically bind to the malarial antigen Merozoite Surface Protein 1 (MSP1) and comprises light chain complimentarity determining regions (CDRs) selected from the group consisting of:
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 72
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 73
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 74;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 132
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 133
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 134.
  • recombinant antibodies or antigen-binding fragments thereof that specifically bind to the malarial antigen Merozoite Surface Protein 1 (MSP1) and comprises heavy and light chain complimentarity determining regions (CDRs) selected from the group consisting of:
  • MCCs Plasmodium-s Qcifc IgM memory B cells
  • Plasmodium antigens providing the B cell tetramers to a biological sample obtained from a subject infected with malaria; and sorting the Plasmodium-specific IgM MBCs based on binding to the tetramers.
  • the method further includes a step of sequencing the Plasmodium-specific IgM
  • the method further includes a step of cloning the BCRs and expressing the BCRs as recombinant antibodies.
  • described herein are isolated or recombinant antibody-producing B-cells produced by the aforementioned method. In some embodiments, described herein are recombinant antibodies produced from the isolated or recombinant antibody-producing B-cell.
  • recombinant antibodies including a variable region from Plasmodium- specific memory B cells and any heavy chain isotype.
  • the recombinant antibodies are for the treatment of or protection from malaria infection in a subject.
  • the recombinant antibodies are for vaccination against malaria.
  • the recombinant antibodies are for the treatment of multi-drug resistant malaria.
  • compositions comprising any of the aforementioned recombinant antibodies.
  • a method of treating or preventing malaria infection in a subject by administering a therapeutically effective amount of any of the aforementioned recombinant antibodies.
  • the malaria infection is a multi -drug resistant malaria infection.
  • the recombinant antibody provides short-term protection against a malaria infection.
  • the short-term protection is at least about 2 months, or at least about 3 months.
  • kits for assessing an effective vaccine strategy for malaria infection in a subject including: generating B cell tetramers specific for blood or liver stage Plasmodium antigens; providing the B cell tetramers to a biological sample obtained from the subject;
  • Plasmodium-specific IgM MBCs sorting the Plasmodium-specific IgM MBCs based on binding to the tetramers.
  • the method further includes a step of sequencing the Plasmodium- specific IgM MBC B cell receptors (BCRs).
  • the subject is a mammal.
  • the subject is a human.
  • the subject is a mammal.
  • Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), He (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H).
  • Naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe.
  • Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
  • Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gln or into His; Asp into Glu; Cys into Ser; Gln into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gln; Ile into Leu or into Val; Leu into Ile or into Val; Lys into Arg, into Gln or into Glu; Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into Ile or into Leu.
  • amino acid sequences e.g., SEQ ID NOs: 1-187
  • amino acid sequences e.g., SEQ ID NOs: 1-187
  • conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.
  • a given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn).
  • Other such conservative substitutions e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known.
  • Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. ligand-mediated receptor activity and specificity of a native or reference polypeptide is retained.
  • FIGs. 1A-1B show human Plasmodium- specific IgM and IgG memory B cells (MBCs) are somatically hypermutated.
  • FIG. 1A shows the flow cytometry sorting strategy of CDl9 + B Cells co positive for pfMSPl/AMAl (left), followed by flow cytometry sorting of CD27+ and CD21+ B cells (middle), the remaining B cells were then sorted for IgG+ and IgM+ (right).
  • FIG. IB shows somatic hypermutation (SHM) frequencies for the V H chain (left), V k chain (middle), and V, chain (right) for IgM and IgG positive MBCs. Individual % frequencies are shown; solid lines represent the median for each data set.
  • SHM somatic hypermutation
  • FIGs. 2A-2B show the expression of recombinant B cell receptors (BCRs) as IgGl reveals specificity and that both IgM and IgG clones bind with high affinity to plasmodium-specific antigens.
  • BCRs B cell receptors
  • Merozoite Surface Protein 1 (MSP-l) specific antibodies are shown (FIG. 2A, left) and apical membrane antigen 1 (APA1) antibodies are shown (FIG. 2B, right).
  • Graphs plot the optical density at 450nm absorbance against antibody (mAh) dilution concentrations.
  • FIGs. 3A-3B demonstrate antibodies are pentamers/hexamers by cryoEM that bind protein and parasites.
  • FIG. 3A shows negative stain electron microscopy of IgG and IgM pentamer and hexamers (i). Enlarged images of the hexamers and pentamers of IgM are shown in (ii-iv).
  • FIG. 3B shows immunohistochemistry images of MSP-l IgG controls (left), novel IgM (middle), and DAPI stained image (right).
  • FIG. 4 shows that IgG purification.
  • SDS-PAGE (4-20%) protein gel analysis of purified IgG -003 in the reduced and non-reduced forms (+/-). Both proteins are obtained through transient transfection of 293T cells.
  • IgG is purified using protein-G column.
  • FIG. 5 shows IgM purification. SDS-PAGE (4-20%) protein gel analysis of purified IgM-003 in the reduced and non-reduced forms (+/-). IgM is concentrated from harvested cell culture supernatant using 100K MWCO concentrator. The heavy chain of IgM appears to have two glycosylation forms.
  • FIG. 6 shows negative stain electron microscopy of IgG-003 pentamers and hexamers.
  • IgG- 003 was diluted to 0.01 mg/mL and 0.02 mg/mL, respectively, in 20 mM Tris-HCl, pH 7.9. Diluted samples were applied to glow-discharged carbon-coated grids and stained with 0.7% uranyl formate, then imaged on a Morgagni microscope (FEI co.) operating at 100 kV. Images were collected at 22,000X magnification on an Orius SC1000 CCD camera (Gatan, Inc.). Scale bar for top image is 50nm.
  • FIG. 7 demonstrates negative stain electron microscopy of IgM-003. The method described in Fig. 6 was repeated for IgM-003. Scale bar for top image is 50nm and lOnm for the enlarged images of pentamers and hexamers.
  • FIGs. 8A-8B show representative plots of the avidity of IgG and IgM dissociation rates using a label free analysis system (Octet).
  • FIG. 8A represents IgG avidity at l .5625nm, 3T25nm, 6.25nm, l2.5nm, 25nm, 50nm, and lOOnm over time (seconds).
  • FIG. 8B represents IgM avidity at 0.78 l25nm, l .5625nm, 3T25nm, 6.25nm, l2.5nm, 25nm, and 50nm over time (seconds).
  • FIGs. 9A-9C demonstrate the method of determining if Plasmodium-specific IgM protects from infection in vivo.
  • FIG. 9A shows the structure of P. berhei MSP1 protein 1-19 (Pb-pbMl9, top, grey regions) and P. berhei with the P. falciparum MSP1 protein (pb-PfMl9, bottom, red regions)
  • FIG. 9B demonstrates FITC and rhodamine expression by wild-type P. berhei (Pbwt), pb-PfMl9 with rhodamine expression only, and Pb-pbMl9.
  • FIG. 9A shows the structure of P. berhei MSP1 protein 1-19 (Pb-pbMl9, top, grey regions) and P. berhei with the P. falciparum MSP1 protein (pb-PfMl9, bottom, red regions)
  • FIG. 9B demonstrates FITC and rho
  • FIG. 10 shows murine percentage survival after P. bergei infection following administration of 500 pg of control IgM or anti-MSPl-l9 delivered IP daily for 3 days (day 1-3). Control animals died within 10 days of infection by acute lethal malaria. Anti -MSP 1 treated mice survived past 10 days post infection with Pb-Pf l9.
  • FIG. 11 demonstrates that IgM treated mice are protected from acute infection. Percent survival for animals treated with control IgM (dashed line), MSP1 IgM (solid line), and MSP1 IgG (dotted line) up to 20 days post-infection with P. bergei (top left). Percentage parasitemia up to 10 days post-infection with P. bergei following treatment with control IgM, MSP1 IgM, and MSP1 IgG (top right). Temperature of animals post-infection with P. bergei following treatment with IgM, MSP1 IgM, and MSP1 IgG (bottom left). Animal mass (grams, g) post-infection following treatment with IgM,
  • FIG. 12 shows flow cytometry of Pseudomonas- specific B cells after immunization positive for IgM, IgD, and exotoxin A tetramer in naive mice (top) and 8 days post immunization (bottom).
  • FIG. 13 demonstrates flow cytometry of Pseudomonas- specific B cells after immunization expressing IgD (left), IgG (middle), and IgM (right) that were also co-positive for CD73 and CD80 in naive mice (top) and 8 days post immunization (bottom).
  • FIG. 14 demonstrates the protective IgM responses as demonstrated by mAh
  • FIG. 15 shows that healthy human adult subjects possess IgM+ memory B cells specific for tetanus toxoid C fragment (TTCF), a component of the tetanus vaccine.
  • TTCF tetanus toxoid C fragment
  • FIGs. 16A-16C shows a schematic representation of the strategy used to convert IgGl monomers to IgG multimers.
  • FIG. 16A shows IgGl
  • FIG. 16B shows IgGl with L309C mutation and IgM tail piece (ptp) added
  • FIG. 16C shows a IgGl hexamer. Disulfide bridges are indicated as gray lines.
  • FIG. 17 shows SDS-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of MSP19 specific multimer IgGl (m-IgG-003) after purification by protein G affinity column.
  • FIG. 18 demonstrates the structural analysis of monomer and multimer IgGls.
  • FIG. 19 demonstrates ELISA (enzyme-linked immunosorbent assay) analysis of monomer and corresponding multimer IgGls binding to MSP1-19 protein.
  • FIG. 20 shows IFA (Indirect Immunofluorescence Assay) analysis of IgGl multimer (m- IgG-003) binding to malaria parasites (merozoites).
  • IgM + and IgD + memory B cells are unique populations of cells with distinct phenotypic, functional and survival properties.
  • the studies described herein demonstrate that antigen-specific IgM + MBCs express high affinity, somatically hypermutated B cell receptors (BCRs) and rapidly respond to produce antibodies prior to IgG + MBCs.
  • IgM + MBCs are high affinity, rapid, plastic, early responders that can initiate the secondary response. Accordingly, antigen-specific IgM+ MBCs and antibodies and antigen binding fragments derived from these cells have significant therapeutic applications in vaccine strategies and treatment of infectious diseases and other indications, including cancer.
  • Humoral immunity comprises pre-existing antibodies expressed by long-lived plasma cells and rapidly reactive memory B cells (MBC).
  • MBC rapidly reactive memory B cells
  • Recent studies of MBC development and function after protein immunization have uncovered significant MBC heterogeneity.
  • malaria remains difficult to prevent by vaccination.
  • the knowledge gained from the studies described herein in regard to malaria is applicable for memory B cell-derived compositions and methods permitting the targeting of any of a wide range of additional antigens. That is, while the studies described herein focus on malaria as an example of an intractable vaccine target, the methods described herein are applicable to the isolation of memory B cell- derived antigen-binding polypeptide constructs specific for essentially any antigen.
  • Plasmodium-specific MBCs were generated that identify Plasmodium-specific MBCs in both humans and mice.
  • Long-lived murine Plasmodium-specific MBCs were found to be made up of three populations: a somatically hypermutated IgM+ subset, a somatically hypermutated IgG+ MBC subset, and an unmutated IgD+ MBC population. Rechallenge experiments revealed that high affinity, somatically hypermutated Plasmodium-specific IgM+ MBCs proliferated and gave rise to antibody secreting cells that dominated the early secondary response to parasite rechallenge.
  • IgM+ MBCs also gave rise to T cell-dependent IgM+ and IgG+B220+CD l38+ plasmablasts or T cell-independent B220-CD138+ IgM+ plasma cells.
  • IgM+ MBCs are rapid, plastic, early responders to a secondary Plasmodium rechallenge and thus are novel targets for vaccine strategies.
  • B cells play a critical role in immune protection to the blood stage of Plasmodium infection.
  • the protective role for antibody was first demonstrated via passive transfer of hyperimmune
  • MSP1 Merozoite Surface Protein 1
  • B cells function in the humoral immunity of the adaptive immune system to secrete antibodies during an immune response to a pathogen to prevent infections and disease.
  • B cells collectively refer to a subset of lymphocytes having an antigen-specific receptor termed an immunoglobulin or B cell receptor.
  • Mature B cells differentiate into plasma cells, which produce antibodies, and memory B cells.
  • a "B cell progenitor" is a cell that can develop into a mature B cell.
  • B cell progenitors include stem cells, early pro-B cells, late pro-B cells, large pre-B cells, small pre-B cells, and immature B cells and transitional B cells.
  • Immature B cells can develop into mature B cells, which can produce immunoglobulins (e.g., IgA, IgG or IgM). Mature B cells have acquired surface IgM and IgD, are capable of responding to antigen, and express characteristic markers such as CD21 and CD23 (CD23 hl CD2l hl cells). Common biological sources of B cells and B cell progenitors include bone marrow, peripheral blood, spleen and lymph nodes.
  • B cells that encounter antigen for the first time are known as "naive" B cells and have cell- surface IgM and IgD expression.
  • a mature plasma cell secretes immunoglobulins in response to a specific antigen.
  • a memory B cell is a B cell that initiates a unique differentiation program and also undergoes affinity selection and somatic hypermutation (with or without isotype switching) that is generally found during a secondary immune response (a subsequent antigen exposure following a primary exposure), but can also be detected during a primary antigen response.
  • the development of memory B cells typically takes place in germinal centers (GC) of lymphoid follicles where antigen-driven lymphocytes undergo somatic hypermutation and affinity selection.
  • GC germinal centers
  • B cell receptor high affinity antigen-specific immunoglobulin
  • memory B cells generally express cell- surface CD27 and CD20 as well.
  • Memory B cells differentiate following contact with an antigen to allow for a rapid response to that antigen when the antigen is presented in a secondary immune response.
  • IgM+ memory B cells are part of a germinal center reaction where mature B cells proliferate, differentiate, and mutate their antibody genes or undergo immunoglobulin isotype switching during an immune response to permit a rapid and antigen- specific immune response.
  • memory B-cells isolated by any of the methods described herein, that express a B cell receptor that specifically binds an antigen of interest.
  • MSP1+ MBCs were composed of three distinct subsets including: classically defined, somatically hypermutated, high affinity IgG+ MBCs; an IgM lo " IgD'" 81 ' population that resembled naive B cells; and a third IgM hlgh IgD low MBC population that expressed somatically hypermutated BCRs that exhibit equivalent affinity to their IgG+ MBC counterparts.
  • ASCs antibody-secreting cells
  • IgM+ MBCs produced both IgM and IgG antibody in response to rechallenge, thereby also contributing to the IgG+ antibody response two days later.
  • a biological sample obtained from a subject having had prior exposure to an antigen of interest with an agent comprising the antigen or a portion thereof; and (ii) isolating or sorting a cell population comprising IgM MBCs based on binding of the BCRs on the MBC surface to the agent comprising the antigen.
  • the high affinity, antigen-specific IgM binding domain from such IgM MBCs can be used to prepare, for example, high affinity recombinant antibodies or antigen binding polypeptide constructs for therapeutic and/or diagnostic purposes, as described herein.
  • antigen-specific IgM memory B cells are a subset of B cells expressing antigen-specific, high affinity IgM molecules.
  • the term“antigen-specific IgM memory B cells”, as used herein, refers to a sub-population of B cells expressing cell-surface IgM that are high affinity for an antigen, have undergone somatic hypermutation, and can rapidly respond to antigen challenge to produce antibodies.
  • Cell-surface expression molecules such as CD21, CD27, or both CD21 and CD27 can also be used to identify such MBCs.
  • Other cell-surface molecules that can be used to identify such MBCs include CD73, CD80, or both CD73 and CD80.
  • Memory B cells generally can refer to IgM memory B cells or any other type of memory B cell (MBC).
  • one way of identifying IgM memory B cells having cell-surface IgM specific for an antigen of interest is to use a multimeric form of the antigen of interest, i.e., multimeric antigen complexes, in order to increase the binding avidity of the memory B cells having antigen-specific, cell-surface IgM.
  • the agent comprising an antigen refers to a multimer comprising two or more monomer units of an antigen of interest, /. e. , a dimer, a trimer, a tetramer, a pentamer, etc.
  • the agent comprising an antigen refers to a multimer comprising four monomer units of an antigen of interest, i.e., a tetramer.
  • A“tetramer,” as used herein, refers to an agent comprised of four monomer units each comprising all or a portion of the antigen of interest.
  • Such tetramer agents enable sensitive identification and isolation of IgM memory B cells specific for the antigen of interest by flow cytometry, or other methods known in the art, despite their low frequency.
  • Subjects from which IgM memory B cells can be derived or isolated for use in the compositions and methods described herein include any subject that can be exposed to an antigen of interest and from whom IgM memory B cells can subsequently be identified and isolated.
  • a "subject" refers to a mammal, including, but not limited to, a human or non-human mammal, such as a rodent, including mice and rats, bovine, equine, canine, ovine, feline, or non-human primate.
  • the subject is a human.
  • the term “patient” can be used interchangeably with subject in the compositions and methods described herein.
  • the subject from which such memory B cells are derived should have had a primary infection with or been previously exposed to a sufficient amount of the infectious organism from which the antigen of interest or portion thereof is derived, or, alternatively, been exposed to (e.g., vaccinated with) the antigen of interest so as to have generated a memory B cell response or memory B cell population.
  • a biological sample being obtained from“a subject having had prior exposure to an antigen of interest” such a subject has previously or currently been exposed to the antigen of interest or infected with an infectious organism or pathogen known to express an antigen of interest.
  • a subject previously having had malaria or having been exposed to P. falciparum is one who has had prior exposure to any antigen expressed or produced by P . falciparum, such as MSP1 or AMA, such that a population of memory B cells was generated in the subject.
  • P . falciparum such as MSP1 or AMA
  • MBCs expressing high affinity BCRs for an antigen of interest can be induced by, for example, administering an antigen of interest, e.g., a specific polypeptide or other antigenic fragment, to a subject.
  • an antigen of interest e.g., a specific polypeptide or other antigenic fragment
  • Biological samples refer to any biological sample obtained from a subject from which B cells or B cell progenitor cells can be isolated and include bone marrow, spleen, lymph node, blood, e.g., peripheral blood, tissue biopsies or samples, surgical specimens, fine needle aspirates, autopsy material, and the like.
  • a biological sample refers to a sample isolated from a subject, such as a peripheral blood sample, which is then further processed, for example, by cell sorting (e.g., magnetic sorting and/or FACS), to obtain a population of antigen-specific IgM memory B cells.
  • cell sorting e.g., magnetic sorting and/or FACS
  • a biological sample comprising IgM memory B cells refers to an in vitro or ex vivo culture of expanded antigen- specific IgM memory B cells. Such a sample is enriched for antigen-specific IgM memory B cells relative to the proportion of such cells that might occure in, e.g., a blood sample from a subject exposed to the antigen.
  • the biological sample comprises a peripheral blood sample.
  • the methods comprise sorting the population comprising IgM MBCs using a combination of agents specific for CD21, CD27, and IgM isotype to isolate a population of IgM MBCs.
  • antigen-binding polypeptide constructs or recombinant antibodies produced or derived from memory B-cells isolated as described herein.
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds an antigen of interest, in an IgM isotype acceptor antibody framework or scaffold.
  • the antigen-binding domain will generally comprise both a variable heavy chain polypeptide and a variable light chain polypeptide, but it is contemplated that the antigen-binding domain can comprise only a V H domain polypeptide or only a V L domain polypeptide, so long as such domain specifically binds to the antigen of interest.
  • an antigen-binding polypeptide refers to a polypeptide that specifically binds to a desired antigen of interest and that is an Ig-like protein comprising one or more of the antigen binding domains described herein linked to a linker or an immunoglobulin constant domain.
  • a binding protein can be, in some embodiments, a dual variable domain (DVD-Ig) binding protein.
  • an antigen-binding polypeptide comprises CDRs of a B cell or antigen receptor in a framework that permits specific binding to the antigen.
  • the term“antigen binding domain”, refers to the portion of a B cell receptor, an antibody or antigen binding fragment thereof that physically contacts and provides specific binding to an antigen (e.g., antigen of interest).
  • An antigen binding domain most often comprises V H and V L polypeptide sequences.
  • the V H and V L polypeptide sequences can be on separate polypeptides for example, in an IgG or IgM format, or they can be parts of a single polypeptide for example, in an ScFv construct (i.e. wherein the V L and V H polypeptides are joined by a linker polypeptide).
  • a "linker polypeptide” comprises two or more amino acid residues joined by peptide bonds and are used to link one or more antigen binding portions.
  • Such linker polypeptides are well known in the art (see e.g., Holliger et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak (1994) Structure 2:
  • the length at of the linker peptide or polypeptide can be important for determining whether two domains such as a V H and V L domain can interact to form a functional molecule (e.g., a functional antigen-binding domain). Linker length necessary to permit V H and V L polypeptide sequences to form an antigen-binding domain are known to those of skill in the art.
  • the term“IgM antigen binding unit” refers to an antibody or antigen-binding polypeptide construct which comprises two light chains and two IgM heavy chains. It should be understood that an IgM antigen-binding unit is typically bivalent (i.e., it has two antigen binding domains). An IgM antigen binding unit has the capacity to multimerize via interactions between heavy chains, including heavy chain tailpiece interactions. The IgM heavy chain is a mu (m) heavy chain.
  • IgG antigen binding unit refers to an antibody or antigen-binding polypeptide construct which comprises two light chains and two IgG heavy chains. It should be understood that an IgG antigen-binding unit is typically bivalent (i.e., it has two antigen binding domains). IgG has a gamma (g) heavy chain. An IgG typically has two antigen-binding domains.
  • the antigen-binding domain comprises variable heavy chain and variable light chain amino acid sequences from the IgM memory B cell.
  • described herein is a recombinant polypeptide construct comprising an antigen-binding unit comprising heavy and light chain variable domains of a B cell receptor of a naive B cell, and an IgM heavy chain constant domain.
  • An immunoglobulin constant domain refers to a heavy or light chain constant domain.
  • Human IgG heavy chain and light chain constant domain amino acid sequences are known in the art, ( e.g ., see SEQ ID NO: 197, 198, 199 and 200 of US Application 2016/0200813, which is incorporated herein in its entirety by reference for representative examples).
  • the binding proteins and antibodies disclosed herein can comprise any of the constant domains of SEQ ID NO: 197, 198, 199 and 200 of US Application 2016/0200813. See also, Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991), which describes heavy and light chain sequences for various isotype classes and subtypes of antibodies.
  • immunoglobulin (Ig) molecule and immunologically active portions of immunoglobulin molecules comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope binding features of an Ig molecule.
  • immunoglobulin molecules i.e., molecules that contain an antigen binding site that immunospecifically bind an antigen
  • immunoglobulin molecules comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope binding features of an Ig molecule.
  • Such mutant, variant, or derivative antibody formats are known in the art.
  • Non-limiting embodiments of such are discussed below, and include but are not limited to a variety of forms, including full length antibodies and antigen-binding portions thereof; including, for example, an immunoglobulin molecule, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a human antibody, a humanized antibody, a single chain antibody, a Fab, a F(ab'), a F(ab')2, a Fv antibody, fragments produced by a Fab expression library, a disulfide linked Fv, a scFv, a single domain antibody (dAb), a diabody, a multispecific antibody, a dual specific antibody, an anti-idiotypic antibody, a bispecific antibody, a functionally active epitope binding fragment thereof, bifunctional hybrid antibodies (e.g., Fanzavecchia et al., Eur.
  • bifunctional hybrid antibodies e.g., Fanzavecchia et al., Eur.
  • Antibodies also refer to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain antigen or target binding sites or "antigen-binding fragments.”
  • the antibody or immunoglobulin molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule, as is understood by one of skill in the art.
  • the light chain can be a kappa chain or a lambda chain.
  • high affinity CDRs from IgM+ memory B cells can be used to construct or derive other recombinant antibodies or polypeptide constructs having those CDRs, but different class types, for example.
  • any IgM provides a framework or scaffold from which the CDRs can be removed or replaced with CDRs from another antibody, whether they are from an IgM or other isotype (e.g., IgA, IgD, IgE, or IgG).
  • the IgM isotype acceptor antibody framework can be derived from any species (e.g, mammalian).
  • the IgM isotype acceptor antibody framework can be multimeric, and approaches that generate multimeric IgG are also described herein.
  • the term“IgM isotype acceptor antibody framework,” refers to the heavy and light chain constant domains of an IgM, onto which heterologous V H , V L , and/or CDRs from a V H and/or V L can be or have been grafted. It should be understood that an IgM isotype acceptor antibody framework permits multimerization into, for example, a pentameric or hexameric configuration.
  • the IgM isotype acceptor antibody framework can be thought of as a scaffold for heterologous antigen binding domains or CDRs thereof.
  • each heavy chain is comprised of a heavy chain variable domain (abbreviated herein as HCVR or V H ) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains: CM, C H 2, and C H 3.
  • Each light chain is comprised of a light chain variable domain (abbreviated herein LCVR as V L ) and a light chain constant region.
  • the light chain constant region is comprised of one domain, C L .
  • the V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved regions, termed framework regions (FR).
  • CDRs complementarity determining regions
  • Each V H and V L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • This structure is well-known to those skilled in the art. In naturally occurring antibodies and in many antigen-binding polypeptide constructs, the chains are usually linked to one another via disulfide bonds.
  • CDRs Complementarity Determining Regions
  • CDR1, CDR2, and CDR3 refers to the amino acid residues of a heavy or light chain variable domain the presence of which are necessary for specific antigen binding.
  • Each variable domain typically has three CDR regions identified as CDR1, CDR2 and CDR3.
  • Each complementarity determining region can comprise amino acid residues from a "complementarity determining region" as defined by Rabat (i.e., about residues 24-34 (Ll), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (Hl), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Rabat et ah, Sequences of Proteins of Immunological Interest,
  • a complementarity determining region can include amino acids from both a CDR region defined according to Rabat and a hypervariable loop.
  • CDR set refers to a group of three CDRs that occur in a single heavy or light chain variable region capable of binding the antigen.
  • the exact boundaries of these CDRs have been defined differently according to different systems.
  • the system described by Rabat (Rabat et al, Sequences of Proteins of Immunological Interest (National Institutes ofHealth, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs.
  • These CDRs may be referred to as Rabat CDRs.
  • Chothia and coworkers Chothia and coworkers (Chothia & Lesk, J. Mol.
  • CDRs can also be described as comprising amino acid residues from a "complementarity determining region" as defined by the IMGT, in some embodiments.
  • An immunoglobulin constant (C) domain refers to a heavy (C H ) or light (C L ) chain constant domain.
  • Murine and human IgG heavy chain and light chain constant domain amino acid sequences are known in the art.
  • the heavy chain of an antibody described herein can comprise an alpha (a), delta (D), epsilon (s), gamma (g) or mu (m) heavy chain.
  • Non-limiting examples of human constant region sequences have been described in the art, e.g., see U.S. Pat. No. 5,693,780 and Kabat E A et al., (1991) supra.
  • the mu (m) heavy chain of IgM is a protein of about 576 amino acids, and includes a variable domain (V H ) of about 110 amino acids, four distinct constant region domains (Cpl, Cp2, Cp3, Cp4, each -110 amino acids) and a“tailpiece” of -20 amino acids.
  • the terms “donor” and “donor antibody” refer to an antibody providing one or more CDRs.
  • the donor antibody is an antibody from a species different from the antibody from which the framework regions are obtained or derived.
  • the donor antibody is of a different isotype than the acceptor antibody.
  • the term “donor antibody” refers to a non-human antibody providing one or more CDRs.
  • the terms “acceptor” and “acceptor antibody” refer to the antibody providing or nucleic acid sequence encoding at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% of the amino acid sequences of one or more of the framework regions.
  • the term “acceptor” refers to the antibody amino acid providing or nucleic acid sequence encoding the constant region(s).
  • the term “acceptor” refers to the antibody amino acid providing or nucleic acid sequence encoding one or more of the framework regions and the constant region(s).
  • the term "acceptor” refers to a human antibody amino acid or nucleic acid sequence that provides or encodes at least 80%, preferably, at least 85%, at least 90%, at least 95%, at least 98%, or 100% of the amino acid sequences of one or more of the framework regions.
  • an acceptor may contain at least 1, at least 2, at least 3, least 4, at least 5, or at least 10 amino acid residues that does (do) not occur at one or more specific positions of a human antibody.
  • acceptor framework region and/or acceptor constant region(s) may be, e.g., derived or obtained from a germline antibody gene, a mature antibody gene, a functional antibody (e.g., antibodies well known in the art, antibodies in development, or antibodies commercially available).
  • Human heavy chain and light chain acceptor sequences are known in the art.
  • the human heavy chain and light chain acceptor sequences are selected from the sequences listed from V-base (found on the worldwide web at vbase.mrc-cpe.cam.ac.uk/) or from IMGTTM the international IMMUNOGENETICS INFORMATION SYSTEMTM (found on the worldwide web at imgt.cines.fr/textes/IMGTrepertoire/LocusGenes/).
  • the human heavy chain and light chain acceptor sequences are selected from the sequences described in Table 3 and Table 4 of U.S. Patent Publication No. 2011/0280800, incorporated by reference herein in their entireties.
  • the recombinant polypeptides and antibodies described herein comprise an IgM CM domain sequence of IMGT Accession: X14940, K01307, X57331, AC254827.
  • the recombinant polypeptides and antibodies described herein comprise an IgM C H 2 domain sequence of IMGT Accession: X14940, K01308, K01309, X57331, and/or AC254827.
  • the recombinant polypeptides and antibodies described herein comprise an IgM C H 3 domain sequence of IMGT Accession: V00561, X14940, K01309, X57331, and/or AC254827.
  • the recombinant polypeptides and antibodies described herein comprise an IgM C H 4 domain sequence of IMGT Accession: J00260, X14940, X57331, and/or AC254827.
  • multimeric IgM comprises a J chain and an IgM tail piece that permit formation of pentamers and hexamers.
  • J chain refers to a 137 residue polypeptide, encoded by the IGJ gene that allows for joining of the pentameric immunoglobulin structures. Sequences for the human IGJ gene are known in the art, for example, (IGMT Accesion: J00256, X86355, M25625, AJ879487). The J chain establishes the disulfide bridges between IgM antibodies to form multimeric structures such as pentamers. See, for example, S0rensen et al. International Immunology, (2000), Pages 19-27, which is incorporated herein in its entirety for the structural requirements for incorporation of J chain into human IgM and IgA isotypes. It should be noted that the native hexameric IgM never contains a J chain; pentameric IgM can be formed so as to include or not include J chain.
  • a recombinant antigen-binding polypeptide construct described herein comprises a J chain sequence.
  • IgM tail piece refers to an 18-amino acid extension on the C-terminal constant domain of the IgM antibody.
  • the tailpiece includes a cysteine residue that forms a disulfide bond between heavy chains to permit formation of an IgM multimer (e.g., pentamers or hexamers of IgM).
  • an IgM multimer e.g., pentamers or hexamers of IgM.
  • two additional cysteine residues in the heavy chain (Cys4l4) and (Cys337) are availabile fo linking heavy chains in the multimer as well.
  • IgA also has a secretory tailpiece that is homologous with the IgM tailpiece by 11 of the 18 amino acids.
  • the term "germline antibody gene” or “germline antibody gene fragment” refers to immunoglobulin-encoding nucleic acid sequence encoded by non-lymphoid cells that have not undergone the maturation process that leads to genetic rearrangement and mutation for expression of a particular immunoglobulin. (See, e.g., Shapiro et al. (2002) Crit. Rev. Immunol.
  • germline antibody sequences e.g., for one or more constant domains, stems from the recognition that germline antibody genes are more likely than mature antibody genes to conserve essential amino acid sequence structures characteristic of individuals in the species, hence less likely to be recognized as from a foreign source when used therapeutically in that species.
  • key residues refers to certain residues within the variable domain that have more impact on the binding specificity and/or affinity of an antibody, in particular a humanized antibody, than others.
  • a key residue includes, but is not limited to, one or more of the following: a residue that is adjacent to a CDR, a potential glycosylation site (can be either N- or O-glycosylation site), a rare residue, a residue capable of interacting with the antigen, a residue capable of interacting with a CDR, a canonical residue, a contact residue between heavy chain variable domain and light chain variable domain, a residue within the Vernier zone, and a residue in the region that overlaps between the Chothia definition of a variable heavy chain CDR/and the Rabat definition of the first heavy chain framework.
  • a recombinant antigen-binding polypeptide construct described herein comprises human antigen-binding and constant domains.
  • humanized antibody refers to antibodies that comprise heavy and light chain variable domain sequences from a non-human species (e.g., a mouse) but in which at least a portion of the VH and/or VL sequence has been altered to be more "human-like", i.e., more similar to human germline variable sequences. Accordingly, “humanized” antibodies are a form of a chimeric antibody, that are engineered or designed to comprise minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient or acceptor antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • donor antibody such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • humanized antibodies can comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence.
  • the humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • a“composite human antibody” or“deimmunized antibody” are specific types of engineered or humanized antibodies designed to reduce or eliminate T cell epitopes from the variable domains.
  • compositions and methods described herein can, in some embodiments, comprise “antigen-binding fragments” or“antigen-binding portions” of an antibody.
  • the term "antigen-binding fragment” of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen.
  • Antigen-binding functions of an antibody can be performed by fragments of a f ill-length antibody.
  • Such antibody fragment embodiments may also be incorporated in bispecific, dual specific, or multi-specific formats such as a dual variable domain (DVD-Ig) format; specifically binding to two or more different antigens.
  • DVD-Ig dual variable domain
  • Non-limiting examples of antigen-binding fragments encompassed within the term "antigen-binding portion" of an antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and C’H 1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and C’H 1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al.
  • VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, for example, Bird et al. (1988) Science 242: 423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883).
  • scFv single chain Fv
  • single chain antibodies are also intended to be encompassed within the term "antigen-binding portion" of an antibody.
  • Other forms of single chain antibodies, such as diabodies are also encompassed.
  • Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see, for example, Holliger et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448; Poljak (1994) Structure 2: 1121-1123); Kontermann and Dubel eds., Antibody Engineering, Springer-Verlag,
  • single chain antibodies also include "linear antibodies” comprising a pair of tandem Fv segments (V H -C H l-V H -C H l) which, together with
  • the term "Fc region” is used to define the C-terminal region of an immunoglobulin heavy chain, which may be generated by papain digestion of an intact antibody.
  • the Fc region may be a native sequence Fc region or a variant Fc region.
  • the Fc region of an immunoglobulin generally comprises two constant domains, a C H 2 domain, and a C H 3 domain, and optionally comprises a CH4 domain.
  • Fc portion of an antibody mediates several important effector functions, for example, cytokine induction, antibody-dependent cell cytotoxicity (ADCC), phagocytosis, complement dependent cytotoxicity (CDC), and half-life/clearance rate of antibody and antigen-antibody complexes. In some cases, these effector functions are desirable for therapeutic antibody but in other cases might be unnecessary or even deleterious, depending on the therapeutic objectives.
  • ADCC antibody-dependent cell cytotoxicity
  • CDC complement dependent cytotoxicity
  • half-life/clearance rate of antibody and antigen-antibody complexes are desirable for therapeutic antibody but in other cases might be unnecessary or even deleterious, depending on the therapeutic objectives.
  • Neonatal Fc receptors are the critical components determining the circulating half-life of antibodies.
  • at least one amino acid residue is replaced in the constant region of the antibody, for example the Fc region of the antibody, such that effector functions of the antibody are altered.
  • DNA sequences encoding the antibodies or antigen-binding fragments that specifically bind an antigen of interest described herein, e.g., antibodies or antigen-binding fragments specifically binding a malarial or other antigen of interest can also be modified, for example, by substituting the coding sequence for human heavy- and light-chain constant domains or framework regions in place of the homologous murine sequences (U.S. Pat. No. 4,816,567; Morrison, et al, Proc. Natl. Acad. Sci. USA, 81:6851 (1984)), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide, as also described elsewhere herein.
  • non-immunoglobulin polypeptides can be substituted for the constant domains of an antibody, or they can be substituted for the variable domains of one antigen-binding site of an antibody to create a chimeric bivalent antibody comprising one antigen- binding site having specificity for one antigen of interest and another antigen- binding site having specificity for a different antigen of interest.
  • homologous refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar amino acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position.
  • Expression as a percentage of homology refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences.
  • a sequence which is "unrelated" or “non- homologous” shares less than 40% identity. Determination of homologs of the genes or peptides described herein may be easily ascertained by the skilled artisan. [00219]
  • the sequences provided here can be modified, comprise conservative amino acid substitutions, or have additional amino acids that can improve targeting or efficacy of the composition described herein.
  • the first polypeptide has an amino acid sequence with at least 99% homology to the second polypeptide.
  • the third polypeptide has an amino acid sequence with at least 99% homology to the fourth polypeptide.
  • the first polypeptide has an amino acid sequence that is non-homologous to the second polypeptide.
  • the third polypeptide has an amino acid sequence that is non-homologous to the fourth polypeptide.
  • the first or second polypeptide has an amino acid sequence that is non-homologous to the third and/or fourth polypeptides.
  • conservative substitution refers to substituting an amino acid residue for a different amino acid residue that has similar chemical properties.
  • Conservative amino acid substitutions include replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Constant amino acid substitutions result from replacing one amino acid with another having similar structural and/or chemical properties, such as the replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • a “conservative substitution” of a particular amino acid sequence refers to substitution of those amino acids that are not critical for polypeptide activity or substitution of amino acids with other amino acids having similar properties (e.g., acidic, basic, positively or negatively charged, polar or non-polar, etc.) such that the substitution of even critical amino acids does not substantially alter activity.
  • Conservative substitution tables providing functionally similar amino acids are well known in the art.
  • the following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I),
  • Memory B cell receptor antigen-binding domains isolated as described herein are readily isolated from a human (e.g., through use of a human blood sample). Nonetheless, if also desired, memory B cell antigen binding domains can be isolated from non-human sources.
  • humanized antibodies and antigen-binding fragments for use in the compositions and methods described herein.
  • Humanized forms of non-human (e.g., murine) antibodies refer to chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • donor antibody such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • Fv framework region (FR) residues of the human immunoglobulin can be replaced by corresponding non-human residues.
  • humanized antibodies can comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
  • a humanized antibody can comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence.
  • the humanized antibody optionally also can comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al, Science, 239: 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • variable domains and CDRs of any B cell receptor expressed by an MBC CDRs of murine MBCs exemplified herein can be used to generate humanized antibody constructs. Accordingly, in some embodiments, humanized antibodies comprising one or more variable domains comprising one or more CDRs encoded by the variable heavy chain sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23, and/or one or more CDRs encoded by the variable light chain sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 19, 20, 22, and 24, are provided.
  • the CDR sequences encoded by the variable heavy chain sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23, and/or the CDRs encoded by the variable light sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 19, 20, 22, and 24 can be used to generate, for example, CDR-grafted, chimeric, humanized, or composite human antibodies or antigen-binding fragments, as described elsewhere herein.
  • any variant, CDR-grafted, chimeric, humanized, or composite antibodies or antigen-binding fragments derived from any of these sequences will maintain the ability to immunospecifically bind the antigen of interest, such that the variant, CDR-grafted, chimeric, humanized, or composite antibody or antigen-binding fragment thereof has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% , at least 100%, or any amount greater than the binding affinity to the antigen of interest relative to the original antibody from which it is derived.
  • the antigen-binding construct, antibody or antigen-binding fragment thereof comprises one, two, three, or four of the framework regions of a heavy chain variable region sequence which is at least 75%, 80%, 85%, 90%, 95% or 100% identical to one, two, three or four of the framework regions of the heavy chain variable region sequence from which it is derived.
  • the heavy chain variable framework region that is derived from said amino acid sequence consists of said amino acid sequence but for the presence of up to 10 amino acid substitutions, deletions, and/or insertions, preferably up to 10 amino acid substitutions.
  • the heavy chain variable framework region that is derived from said amino acid sequence consists of said amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues being substituted for an amino acid found in an analogous position in a corresponding non human, primate, or human heavy chain variable framework region.
  • the antigen-binding construct, antibody or antigen-binding fragment further comprises one, two, three or all four VH framework regions derived from the VH of a human or primate antibody.
  • the primate or human heavy chain framework region of the antibody selected for use with the heavy chain CDR sequences described herein can have, for example, at least 70% identity with a heavy chain framework region of the non-human parent antibody.
  • the primate or human antibody selected can have the same or substantially the same number of amino acids in its heavy chain complementarity determining regions encoded by the variable heavy chain sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23.
  • the primate or human heavy chain framework region amino acid residues are from a natural primate or human antibody heavy chain framework region having at least 75% identity, at least 80% identity, at least 85% identity (or more) with the heavy chain framework regions of any of the antibodies described herein.
  • the antigen binding construct, antibody or antigen-binding fragment further comprises one, two, three or all four VH framework regions derived from a human heavy chain variable subfamily (e.g., one of subfamilies 1 to 7).
  • the antigen-binding construct, antibody or antigen-binding fragment thereof comprises one, two, three or four of the framework regions of a light chain variable region sequence which is at least 75%, 80%, 85%, 90%, 95%, or 100% identical to one, two, three or four of the framework regions of the light chain variable region sequence from which it is derived.
  • the light chain variable framework region that is derived from said amino acid sequence consists of said amino acid sequence but for the presence of up to 10 amino acid substitutions, deletions, and/or insertions, preferably up to 10 amino acid substitutions.
  • the light chain variable framework region that is derived from said amino acid sequence consists of said amino acid sequence with 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues being substituted for an amino acid found in an analogous position in a
  • the antigen-binding construct, antibody or antigen-binding fragment further comprises one, two, three or all four VL framework regions derived from the VL of a human or primate antibody.
  • the primate or human light chain framework region of the antibody selected for use with the light chain CDR sequences described herein can have, for example, at least 70% identity with a light chain framework region of the non-human parent antibody.
  • the primate or human antibody selected can have the same or substantially the same number of amino acids in its light chain CDRs to that of the light chain complementarity determining regions encoded by the variable light chain sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 19, 20, 22, and 24.
  • the primate or human light chain framework region amino acid residues are from a natural primate or human antibody light chain framework region having at least 75% identity, at least 80% identity, at least 85% identity (or more) with the light chain framework regions of any of the the antigen-binding constructs or antibodies described herein.
  • the antigen-binding construct, antibody or antigen binding fragment further comprises one, two, three or all four VL framework regions derived from a human light chain variable kappa subfamily. In some embodiments, the the antigen-binding construct, antibody or antigen-binding fragment further comprises one, two, three or all four VL framework regions derived from a human light chain variable lambda subfamily.
  • the position of one or more CDRs along the VH (e.g., CDR1, CDR2, or CDR3) and/or VL (e.g., CDR1, CDR2, or CDR3) region of an the antigen binding construct or antibody described herein can vary, i.e., be shorter or longer, by one, two, three, four, five, or six amino acid positions so long as immunospecific binding to the antigen of interest is maintained (e.g., substantially maintained, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the binding of the original antibody or B cell receptor from which it is derived).
  • the position defining a CDR can vary, i.e., be shorter or longer, by shifting the N-terminal and/or C-terminal boundary of the CDR by one, two, three, four, five, or six amino acids, relative to the CDR position of any one of the antibodies described herein, so long as immunospecific binding to the antigen of interest is maintained (e.g., substantially maintained, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the binding of the original antibody from which it is derived).
  • the length of one or more CDRs along the VH (e.g., CDR1, CDR2, or CDR3) and/or VL (e.g., CDR1, CDR2, or CDR3) region of an antibody described herein can vary (e.g., be shorter or longer) by one, two, three, four, five, or more amino acids, so long as immunospecific binding to the antigen of interest is maintained (e.g., substantially maintained, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% of the binding of the original antibody or B cell receptor from which it is derived).
  • one, two or more mutations are introduced into the Fc region of an antibody described herein or an antigen-binding fragment thereof (e.g., C H domain (residues 231-340 of human IgGl) and/or C H 3 domain (residues 341- 447 of human IgGl) and/or the hinge region, with numbering according to the Kabat numbering system (e.g., the EU index in Kabat)) to increase or decrease the affinity of the antibody for an Fc receptor (e.g., an activated Fc receptor) on the surface of an effector cell or to alter one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding and/or antigen-dependent cellular cytotoxicity.
  • an Fc receptor e.g., an activated Fc receptor
  • Mutations in the Fc region of an antibody or fragment thereof that decrease or increase the affinity of an antibody for an Fc receptor and techniques for introducing such mutations into the Fc receptor or fragment thereof are known to one of skill in the art. Examples of mutations in the Fc receptor of an antibody that can be made to alter the affinity of the antibody for an Fc receptor are described in, e.g., Smith P et al., (2012) PNAS 109: 6181-6186, U.S. Pat. No. 6,737,056, and International Publication Nos. WO 02/060919; WO 98/23289; and WO 97/34631, which are incorporated herein by reference.
  • one, two or more mutations are introduced into the hinge region of the Fc region (CH 1 domain) such that the number of cysteine residues in the hinge region are altered (e.g., increased or decreased) as described in, e. g ; U.S. Pat. No. 5,677,425.
  • the number of cysteine residues in the hinge region of the CM domain can be altered to, e.g., facilitate assembly of the light and heavy chains, or to alter (e.g., increase or decrease) the stability of the antigen-binding construct or antibody.
  • CDR-grafted antibody refers to antibodies which comprise heavy and light chain variable region sequences from one antigen-binding domain, but in which the sequences of one or more of the CDR regions of VH and/or VL are replaced with CDR sequences of another antigen-binding domain, such as antibodies having human heavy and light chain variable regions in which one or more of the human CDRs (e.g., CDR3) has been replaced with mouse CDR sequences.
  • CDR-grafted antibodies described herein comprise heavy and light chain variable region sequences from a human antibody wherein one or more of the CDR regions of VH and/or VL are replaced with CDR sequences of a B cell receptor, such as a memory B cell receptor, such as an IgM memory B cell receptor.
  • Grafting can put one or more non-human CDRs, e.g., encoded by the variable heavy chain sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23, and/or one or more CDRs encoded by the variable light chain sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 19, 20, 22, and 24 into an antigen-binding construct or antibody described herein.
  • the memory B cell receptor (e.g., IgM MBC) antigen-binding domain is a human IgM memory B cell receptor antigen binding domain.
  • amino acid sequences for heavy chain antigen binding domains derived from malarial antigen-specific human IgM memory B cells SEQ ID NOs: 26, 36, 46, 56, 66, 76, 86, 96, 106, 116, 126, 136, and 146) and amino acid sequences for light chain antigen binding domains derived from malarial antigen-specific human IgM memory B cells (SEQ ID NOs: 31, 41, 51, 61, 71, 81, 91, 101, 111, 121, 131, 141, and 151).
  • the IgM memory B cell is CD21+CD27+.
  • the recombinant antibody has an IgM isotype framework.
  • the recombinant antibody has a non-IgM isotype framework.
  • the recombinant antigen-binding polypeptide construct comprises an scFv polypeptide, a single-domain antibody construct, a chimeric antibody construct or a bispecific antibody construct, each including CDRs or an antigen binding domain derived from a memory B cell, (e.g., an IgM memory B cell).
  • the polypeptide binds its antigen with a K D of 10 7 M or lower, 10 8 M or lower, 10 9 M or lower, 10 10 M or lower, 10 11 M or lower, 10 12 M or lower.
  • sequencing of receptors derived from IgM+ memory B cells demonstrates that these cells, like conventional IgG+ memory B cells, undergo somatic hypermutation in their variable heavy and light chains relative to germline variable heavy and light chains sequences.
  • “somatic hypermutation” is a cellular mechanism by which B cell receptors are further diversified to increase affinity of a B cell receptor for its cognate antigen.
  • Somatic hypermutation involves a programmed process of introducing point mutations into the variable regions of immunoglobulin genes, thereby increasing antibody diversity, and then using further positive selection to select antibodies that bind with higher affinity to the antigen. Somatic hypermutation has been estimated to expand the ultimate scope of antibody diversity 10 to lOO-fold or more.
  • an antigen binding domain derived from an IgM memory B cell receptor for use in the compositions and methods described herein has undergone at least one or more, at least two or more, at least three or more, at least four or more, at least five or more, at least six or more, at least seven or more, but less than eight, somatic hypermutations relative to germline variable heavy and light chains sequences.
  • an antigen binding domain derived from an IgM memory B cell receptor for use in the compositions and methods described herein has undergone fewer than five somatic hypermutations, . e.. between one to five somatic hypermutations, between one to four somatic hypermutations, and between one to three somatic
  • variable light chain immunoglobulin sequence, variable heavy chain immunoglobulin sequence, or both has one or more somatic mutations relative to a variable heavy chain immunoglobulin sequence or variable light chain immunoglobulin sequence from a naive B cell.
  • variable light chain sequence, variable heavy chain sequence, or both has one to eight somatic mutations relative to a variable heavy chain sequence or variable light chain sequence from a naive B cell.
  • the memory B cell receptor antigen-binding domain (e.g., an IgM MBC receptor antigen-binding domain) specifically binds an antigen comprised or expressed by an infectious organism.
  • the infectious organism is a blood-bome pathogen.
  • the infectious organism is a virus, a bacterium, a fungus or a parasite.
  • the infectious organism is P. falciparum.
  • CDRs heavy chain complimentarity determining regions
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 27
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 28
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 29;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 57
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 58
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 59;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 77
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 78
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 79;
  • chain CDR2 having the amino acid sequence of SEQ ID NO: 108; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 109; g. a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 137; a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 138; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 139; and
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 147; a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 148; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 149.
  • recombinant antibodies or antigen-binding fragments thereof that specifically bind to the malarial antigen AMA and comprise light chain complimentarity determining regions (CDRs) selected from the group consisting of:
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 32
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 33
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 34;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 62; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 63; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 64;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 82
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 83
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 84;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 142
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 143
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 144
  • CDRs heavy and light chain complimentarity determining regions
  • recombinant antibodies or antigen-binding fragments thereof that specifically bind to the malarial antigen MSP 1 and comprise heavy chain complimentarity determining regions (CDRs) selected from the group consisting of:
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 67
  • a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 68
  • a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 69;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 97; a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 98; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 99;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 117; a heavy chain CDR2 having the amino acid sequence of SEQ ID NO: 118; and a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 119;
  • CDRs light chain complimentarity determining regions
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 72
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 73
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 74;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 102
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 103
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 104;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 122
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 123
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 124;
  • a light chain CDR1 having the amino acid sequence of SEQ ID NO: 132
  • a light chain CDR2 having the amino acid sequence of SEQ ID NO: 133
  • a light chain CDR3 having the amino acid sequence of SEQ ID NO: 134;
  • recombinant antibodies or antigen-binding fragments thereof that specifically bind to the malarial antigen MSP 1 and comprise heavy and light chain complimentarity determining regions (CDRs) selected from the group consisting of:
  • chain CDR2 having the amino acid sequence of SEQ ID NO: 118; a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 119; a light chain CDR1 having the amino acid sequence of SEQ ID NO: 122; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 123; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 124;
  • a heavy chain CDR1 having the amino acid sequence of SEQ ID NO: 127; a heavy
  • chain CDR2 having the amino acid sequence of SEQ ID NO: 128; a heavy chain CDR3 having the amino acid sequence of SEQ ID NO: 129; a light chain CDR1 having the amino acid sequence of SEQ ID NO: 132; a light chain CDR2 having the amino acid sequence of SEQ ID NO: 133; and a light chain CDR3 having the amino acid sequence of SEQ ID NO: 134.
  • the CDRs are grafted into an IgM acceptor antibody framework. In another embodiment, the CDRs are grafted into an IgG acceptor antibody framework.
  • the recombinant antigen-binding polypeptide construct described herein comprises a multimer of IgM antigen-binding units or a multimer of IgG antigen-binding units.
  • the recombinant antigen-binding polypeptide construct described herein comprises five or six IgM antigen-binding units.
  • Antigen-binding polypeptide constructs and antibodies described herein can be used, for example, for the treatment or prevention of diseases, including for example, infectious disease and/or cancer.
  • a subject suffering from or diagnosed with a disease e.g., infectious disease or cancer
  • an antigen-binding polypeptide construct or antibody as described herein to therby treat the disease or disorder.
  • Administration comprises administering the antigen-binding polypeptide construct or antibody directly or, for example administering a cell that produces and expresses the construct or administering a vector encoding the construct under control of sequence elements that provide its expression upon entry or introduction to the cell.
  • a subject at rick of developing a disease e.g., infectious disease or cancer
  • Treatment of prevention of infactious disease using the constructs described herein can be thought of, in one regard, as passive immunization, i.e.. providing antibody or antibody-like constructs that circulate and can bind to an antigen expressing or an infecting pathogen and thereby targeting it for killing or inactivation.
  • the binding of the construct as described herein to an antigen expressed by a pathogen can, for example, interfere with cellular entry of an intracellular pathogen, e.g., a virus or a microbe such as a malaria pathogen.
  • the construct can interfere with growth or replication of a pathogen due to a sheer number of construct molecule binding to the pathogen, or as a further alternative, due to activation of immune pathways, e.g., the complement cascade or antibody-mediated recruitment of other immune effector cells.
  • “prevention” of an infectious disease means that a productive infection is limited to an extent that disease symptoms are substantially reduced (e.g., by 90% or more relative to non-treatment) or do not occur at all following exposure of the treated individual to the pathogen. Unless cells or a vector encoding a construct as described herein are administered so as to permit continued expression or delivery of the construct, it is anticipated that lasting prevention can require repeated administration.
  • Treatment of an established infectious disease can also be effected using constructs as described herein that bind an antigen expressed by or on the pathogen.
  • the constructs can inhibit further growth or replication of the pathogen, e.g., by interfering with pathogen cellular function due to the number of construct molecules binding to the pathogen surface, and/or by interfering with the entry of additional pathogen organisms to their target cells, and/or by recruiting or activating additional immune functions or effector cells (e.g., complement activation, effector T cell recruitment, activation, etc.).
  • additional immune functions or effector cells e.g., complement activation, effector T cell recruitment, activation, etc.
  • Treatment of cancer via administration of a construct as described herein that targets one or more tumor antigens can involve as non-limiting examples, recruitment of cytotoxic T cells or NK cells to the site of construct-provoked inflammatory signaling.
  • the construct comprise antibody constant domain motifs or sequences that interact with immune system components that mediate such signaling effective for provoking antibody-dependent cellular cytotoxicity, e.g., Fc sequences that interact with Fc-receptor bearing immune cells can be included or a construct.
  • Antibody Fc domains and modifications to them that increase or otherwith modulate interaction with Fc receptors and cells that express them are known to those of ordinary skill in the art.
  • described herein is a method of treating or preventing a disease or disorder, the method comprises: administering a recombinant antigen-binding polypeptide construct described herein, or a cell expressing such a polypeptide, or a vector encoding such a polypeptide to a subject in need thereof.
  • kits for treating a subject in need of treatment for a disease caused by an infectious organism comprising administering an antigen-binding compositions as described herein, wherein the antigen-binding polypeptide of the composition specifically binds an antigen comprised by the infectious organism.
  • kits reducing the likelihood of contracting a disease caused by an infectious organism comprising administering to an individual at risk of contracting the disease an antigen-binding composition as described herein, wherein the antigen-binding polypeptide specifically binds an antigen comprised by the infectious organism.
  • the recombinant antibody described herein is for the treatment of or protection from malaria infection in a subject.
  • kits for treating malaria infection in a subject comprising administering a therapeutically effective amount of any a recombinant antibody as described herein.
  • kits for treating multi -drug resistant malaria in a subject comprising administering a therapeutically effective amount of a recombinant antibody as described herein.
  • a method of immunizing a subject against a pathogen comprising: administering a recombinant antigen-binding polypeptide construct described herein, or a cell expressing such a polypeptide construct, or a vector encoding such a polypeptide construct to an individual in need thereof.
  • recombinant antibody or polypeptides described herein are for vaccination against malaria.
  • the recombinant antibody is for the treatment of multi -drug resistant malaria.
  • infectious organism refers to any organism, particularly microscopic organisms, that can infect a subject and lead to an infectious disease or disorder.
  • infectious organisms or pathogens include, but are not limited to, viruses, bacteria, protozoa, mycoplasma, and fungi. Infectious diseases can impact any bodily system, be acute (short-acting) or chronic/persistent (long-acting), occur with or without fever, strike any age group, and overlap with other infectious organisms.
  • pathogen refers to an organism that causes a disease or disorder in a subject.
  • pathogens include but are not limited to viruses, fungi, bacteria, parasites and other infectious organisms or molecules therefrom, as well as taxonomically related macroscopic organisms within the categories algae, fungi, yeast, protozoa, or the like.
  • the pathogen is a human pathogen.
  • compositions and methods described herein are useful against persistent infections, in some embodiments.
  • a "persistent infection,” as used herein, refers to an infection in which the infectious agent (such as a virus, mycoplasma, bacterium, parasite, or fungus) is not cleared or eliminated from the infected host, even after the induction of an immune response.
  • Persistent infections can be chronic infections, latent infections, or slow infections.
  • A“latent infection” is characterized by the lack of demonstrable infectious virus between episodes of recurrent disease.“Chronic infection” is characterized by the continued presence of infectious virus following the primary infection and can include chronic or recurrent disease.“Slow infection” is characterized by a prolonged incubation period followed by progressive disease.
  • slow infection may not begin with an acute period of viral multiplication. While acute infections are relatively brief (lasting a few days to a few weeks) and resolved from the body by the immune system, persistent infections can last for example, for months, years, or even a lifetime. These infections may also recur frequently over a long period of time, involving stages of silent and productive infection without cell killing or even producing excessive damage to the host cells. Persistent infections often involve stages of both silent and productive infection without rapidly killing or even producing excessive damage of the host cells. During persistent viral infections, the viral genome can be either stably integrated into the cellular DNA or maintained episomally.
  • Persistent infection occurs with viruses such as human T-Cell leukemia viruses, Epstein-Barr virus, cytomegalovirus, herpesviruses, varicella-zoster virus, measles, papovaviruses, prions, hepatitis viruses, adenoviruses, parvoviruses and papillomaviruses, among others.
  • viruses such as human T-Cell leukemia viruses, Epstein-Barr virus, cytomegalovirus, herpesviruses, varicella-zoster virus, measles, papovaviruses, prions, hepatitis viruses, adenoviruses, parvoviruses and papillomaviruses, among others.
  • a“parasitic infection” refers to any infection caused by a parasite.
  • a parasitic infection as described herein can be caused by any parasite currently known, or yet to be discovered that results in a pathogenic disease.
  • Exemplary parasites include, but are not limited to, malaria ( Plasmodium ), roundworms (nematodes), tapeworms (cestodes), flukes (trematodes), Cooperia, their species, or any other parasite known in the art.
  • a parasitic infection can be treated with, for example, a deworming agent or antibiotics.
  • “malarial infection” refers to infection of a host subject caused by Plasmodium.
  • Malaria is a mosquito-bome infectious disease that affects mammalian subjects and causes symptoms such as fever, tiredness, vomiting, yellowing of the skin, seizures, coma, and can be lethal.
  • the disease is spread by mosquito saliva that upon contact with a host subject, permits the transfer of parasites such as Plasmodium into the host subject’s blood.
  • Several medications are available to prevent malaria such as sulfadoxine/pyrimethamine.
  • sulfadoxine/pyrimethamine are available to prevent malaria such as sulfadoxine/pyrimethamine.
  • no effective vaccine for malaria exists.
  • Non-limiting examples of treatments for malaria include chloroquine, hydroxychloroquine, amodiaquine,
  • the parasites can be resistant to these treatments and cause forms of drug resistant malarial infections.
  • compositions and methods described herein are contemplated for use against other infectious organisms, i. e. , when the antigen of interest comprises an antigen of interest derived from other infectious organisms, such as protozoan parasites.
  • infectious organisms such as protozoan parasites, include Plasmodium falciparum, exemplified herein, Shistosoma mansoni,
  • compositions and methods described herein are contemplated for use against infections caused by Plasmodium falciparum, Shistosoma mansoni, Trypanosoma cruzi, Trichinella spiralis, and Strongyloides ratti, among others.
  • Plasmodium refers to a genus of parasites described herein that affect a host subject by growing within vertebrate tissues and enter the blood stream.
  • the Plasmodium destroy the red blood cells of the host subject.
  • the genus Plasmodium consists of over 200 species known in the art. Non-limiting examples of Plasmodium include Plasmodium falciparum, Plasmodium chahaudi chahaudi, Plasmodium yoelii, Plasmodium vivax, and Plasmodium herghei.
  • a“viral infection” refers to any infection caused by a virus.
  • a viral infection as described herein can be caused by any virus type currently known, or yet to be discovered that results in a pathogenic disease.
  • Exemplary viruses include, but are not limited to, coronavirus, respiratory syncytial virus, bovine diarrhea virus, rabies virus, Herpes virus, retrovirus, lentivirus, or any other virus known in the art.
  • the compositions and methods described herein are contemplated for use against viral infections, i.e. , when the antigen of interest comprises a viral antigen of interest.
  • infectious viruses include: Retroviridae (for example, HIV); Picornaviridae (for example, polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (such as strains that cause gastroenteritis); Togaviridae (for example, equine encephalitis viruses, rubella viruses); Flaviridae (for example, dengue viruses, encephalitis viruses, yellow fever viruses, West Nile virus, Zika virus); Coronaviridae (for example, coronaviruses); Rhabdoviridae (for example, vesicular stomatitis viruses, rabies viruses); Filoviridae (for example, ebola viruses); Paramyxovi
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • VZV varicella zoster virus
  • HSV-l and -2 mucositis HSV-6 encephalitis, BK-virus hemorrhagic cystitis
  • viral influenza influenza
  • AIDS caused by HIV
  • hepatitis A, B or C hepatitis A, B or C.
  • compositions and methods described herein are contemplated for use against viral infections caused by enteroviruses, Flaviridae, for example, dengue viruses, encephalitis viruses, yellow fever viruses, West Nile virus, Zika and virus; Filoviridae, for example, ebola viruses; Orthomyxoviridae, for example, influenza viruses; Arena viridae, for example, hemorrhagic fever viruses; and Reoviridae, e.g., reoviruses, orbiviurses and rotaviruses.
  • enteroviruses Flaviridae, for example, dengue viruses, encephalitis viruses, yellow fever viruses, West Nile virus, Zika and virus
  • Filoviridae for example, ebola viruses
  • Orthomyxoviridae for example, influenza viruses
  • Arena viridae for example, hemorrhagic fever viruses
  • Reoviridae e.g., reoviruses, orbiviurses and rotaviruse
  • a“bacterial infection” refers to any infection caused by a bacterium.
  • a bacterial infection as described herein can be caused by any bacteria type currently known, or yet to be discovered that results in a pathogenic disease. Pathogenic bacteria and diseases are well known in the art.
  • compositions and methods described herein are contemplated for use against bacterial infections, i.e., when the antigen of interest comprises an antigen of interest derived from bacteria.
  • infectious bacteria include: E. coli, Psuedomonas aeruginosa, Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (such as. M.
  • tuberculosis M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A
  • Streptococcus Streptococcus
  • Streptococcus agalactiae Group B Streptococcus
  • Streptococcus (viridans group), Streptococcus faecalis, Streptococcus epidermidis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Brucella abortus, Pasteurella multocida, Bacteroides sp., Fusobacter
  • Haemophilus influenzae Bacillus anthracis, Erysipelothrix rhusiopathiae, Klebsiella pneumoniae,
  • a“fungal infection” refers to any infection caused by a fungus.
  • a fungal infection as described herein can be caused by any fungi currently known, or yet to be discovered that results in a pathogenic disease.
  • a fungal infection can be treated with antifungals, for example, fluconazole, ketoconazole, or amphotericin B.
  • compositions and methods described herein are contemplated for use against fungal infections, i.e., when the antigen of interest comprises an antigen of interest derived from a fungus.
  • fungal infections include but are not limited to: aspergillosis; thrush (caused by Candida albicans), ⁇ cryptococcosis (caused by Cryptococcus), ⁇ and histoplasmosis.
  • infectious fungi include, but are not limited to, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis , Pneumocystis carinii, Chlamydia trachomatis, and Candida albicans.
  • the compositions and methods described herein are contemplated for use against fungal infections caused by Candida albicans, Cryptococcus neoformans, and Pneumocystis carinii.
  • kits for treating a subject in need of treatment for a tumor that expresses a tumor antigen comprising administering an antigen binding composition as described herein to the subject, wherein the antigen-binding polypeptide of the composition specifically binds the tumor antigen.
  • cancer refers to a hyperproliferation of cells that exhibit a loss of normal cellular control that results in unregulated growth, lack of differentiation, local tissue invasion, and metastasis.
  • the methods and compositions described herein can be used for the treatment of solid tumors (e.g ., cancer) or non-solid tumors, such as leukemia, blood cell cancers, and the like.
  • Solid tumors can be found in bones, muscles, the brain, or organs, and can be sarcomas or carinomas.
  • compositions described herein can overcome barriers of tumor treatment, including, but not limited to barriers to treatment or inhibition of metastases, it is contemplated that aspects of the technology described herein can be used to treat all types of solid and non-solid tumor cancers, including cancers not listed in the instant specification.
  • the compositions and methods described herein include methods of treating cancer, methods of inhibiting metastases, and methods of inducing an anti-tumor immune response.
  • Infectious organisms can express a number of surface antigens, including but not limied to antigens that relate to their ability to infect a host subject and proliferate.
  • the surface antigens described herein can be used, for example, to detect the organism’s presence in a host subject, produce antibodies to the surface antigens, or identify novel antigens to generate new therapeutics for infection.
  • Plasmodium surface antigens of particular use in the methods described herein include merozoite surface protein-l (MSP1), apical membrane antigen 1 (AMA1), and circumsporozoite protein (CSP).
  • MSP1 merozoite surface protein-l
  • AMA1 apical membrane antigen 1
  • CSP circumsporozoite protein
  • the terms“merozoite surface protein 1” or“MSP1” or“MSP-l” or“MSP1 polypeptide” are used interchangeably to refer to the MSP1 surface polypeptide expressed on parasites ( e.g Plasmodium).
  • MSP1 is a key surface protein expressed by the parasite and is required for erythrocyte invasion. See for example, Kadekoppala and Holder, 2010 which is incorporated herein by reference in its entirety.
  • Amino acid sequences for MSP1 are known in the art, for example, Plasmodium falciparum (UnitProt Accession: P19598, SEQ ID NO: 186).
  • Antibodies generated by a host or subject against the l9kD C-terminus region of MSP 1 potently inhibit erythrocyte invasion and animals actively, or passively, immunized against MSP1 are protected against subsequent infection (Blackman et ah, 1990;
  • AMA apical membrane antigen 1
  • AMA apical membrane antigen 1
  • the terms“apical membrane antigen 1 (AMA)” or“AMA” or“AMA1” or“AMA polypeptide” can be used interchangeably to refer to the AMA surface polypeptide expressed on parasite (e.g., Plasmodium).
  • the AMA polypeptide is a 66kDa polypeptide that is transported to the Plasmodium cell surface prior to the schizont stage of malarial infection. Genomic and amino acid sequences for AMA are known in the art, for example, Plasmodium falciparum (NCBI Gene ID: 810891 and GenBank: CAB97194.1, SEQ ID NO: 187).
  • recombinant cells producing a surface antigen-binding polypeptide comprising a variable heavy chain immunoglobulin sequence, a variable light chain immunoglobulin sequence, or both, from an IgM memory B cell obtained using any of the methods described herein.
  • the antigen is a blood stage malaria surface antigen or a sporozoite stage surface antigen.
  • the blood stage malaria surface antigen or sporozoite stage surface antigen is selected from P. falciparum merozoite surface protein 1 (MSP1), AMA, and CSP (circumsporozoite protein).
  • the IgM memory B cell receptor antigen-binding domain specifically binds a tumor antigen.
  • Tumor antigens are generally polypeptides or other antigens expressed on the surface of a tumor cell. Tumor antigens are generally experienced to a greater extent on a tumor cell than or corresponding non-tumor tissues. Many tumor antigens confer a growth advantage on the tumor cell, e.g., endothelial growth factor receptor (EGFR). EGFR is a growth factor receptor often overexpressed by tumors that render the tumor cells sensitive to small concentrations of the growth factor-mutated, e.g., constituitively active forms of such receptors are also known to by tumor antigens.
  • EGFR endothelial growth factor receptor
  • Non-limiting examples of tumor antigens to which an IgM memory B cell receptor antigen-binding domain can specifically bind include Acute myelogenous leukemia Wilms tumor 1 (WT1), preferentially expressed antigen of melanoma (PRAME), PR1, proteinase 3, elastase, cathepsin G, Chronic myelogenous WT1, Myelodysplastic syndrome WT1, Acute lymphoblastic leukemia PRAME, Chronic lymphocytic leukemia Survivin, Non-Hodgkin's lymphoma Survivin, Multiple myeloma New York esophagus 1 (NY-Esol), Malignant melanoma MAGE, MART-l/Melan-A, Tyrosinase, GP100, Breast cancer WT1, Lung cancer WT1, Prostate-specific antigen (PSA), prostatic acid phosphatase, (PAP) Carcinoembryonic antigen (CEA), mucins (e.
  • the multimer construct comprises a dimer, trimer, or tetramer of the antigen.
  • Described herein is a method of isolating memory B cells that specifically bind an antigen of interest, the method comprises: (a) contacting a biological sample containing memory B cells from a subject having had prior exposure to the antigen of interest with the antigen of interest or a portion thereof, wherein the antigen of interest is immobilized on a solid support; (b) separating a population of antigen-bound cells from non-antigen-bound cells of step (a); and (c) isolating cells expressing CD21, CD27, and IgM from the population antigen-bound cells.
  • a biological sample is obtained from a subject.
  • the biological sample is a blood sample.
  • the term“contacting” when used in reference to a cell or organ encompasses both introducing or administering the composition or pathogen or antigen described herein, an agent, surface, hormone, etc. to the cell, tissue, or organ in a manner that permits physical contact of the cell with the composition, antigen, agent, surface, hormone etc., and/or introducing an element, such as a genetic construct or vector, that permits the expression of the compositions described herein by a cell or population thereof.
  • the isolating step (c) comprises flow cytometry. Methods of flow cytometry are known in the art. See, for example, Malleret et al., Sci Rep (2011); Robbiani et al, Cell (2015), which are incorporated herein by reference in their entirety.
  • step (c) further comprises isolating cells expressing a plasmablast marker.
  • the plasmablast marker is B220 or CD138.
  • a“plasmablast” refers to B cells that have differentiated into an immature plasma cell. These cells will eventually produce large volumes of antibodies in response to an antigen. Plasmablasts are capable of rapid division and are capable of internalizing antigens and presenting them to T cells.
  • the IgM+ MBCs described herein can give rise to T cell-dependent IgM+ and
  • a method of making an antibody construct comprising an antigen-binding domain from a memory B cell and that specifically binds to an antigen of interest, the method comprises: (a) isolating a population of IgM expressing memory B cells from a biological sample as described herein; (b) amplifying heavy chain and light chain variable domain sequences from the memory B cell population of step (a); (c) ligating heavy chain variable domain sequences amplified in step (b) into a heavy chain expression vector sequence and ligating light chain variable domain sequences amplified in step (b) into a light chain expression vector sequence; (d) introducing one or more vectors encoding heavy chain and light chain expression vector sequences of step (c) to a cell and culturing the cell under conditions that permit expression of antibody polypeptides from the expression vector sequences; (e) contacting antibody polypeptides expressed by the cell with an antigen of interest; and (f) isolating antibodies that bind to the anti
  • the method further comprises, prior to step (a), a step of immunizing a subject and obtaining a biological sample.
  • the method further comprises, prior to step (e), collecting cell culture medium from cells of step (d).
  • step (e) comprises contacting antibody polypeptides with the antigen of interest immobilized on a solid support.
  • the antigen-binding polypeptides and antibody constructs described herein can be expressed in a vector (e.g., an expression vector).
  • a vector refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells.
  • a vector can be viral or non-viral.
  • the term“vector” encompasses any genetic element that is capable of replication when associated with the proper control elements and that can transfer gene sequences to cells.
  • a vector can include, but is not limited to, a cloning vector, an expression vector, a plasmid, phage, transposon, cosmid, artificial chromosome, virus, virion, etc.
  • viral vector refers to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle.
  • the viral vector can contain a nucleic acid encoding a polypeptide as described herein in place of non-essential viral genes.
  • the vector and/or particle may be utilized for the purpose of transferring nucleic acids into cells either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
  • expression vector refers to a vector that directs expression of an RNA or polypeptide (e.g., the antigen-binding polypeptide constructs described herein) from nucleic acid sequences contained therein linked to transcriptional regulatory sequences on the vector.
  • the sequences expressed will often, but not necessarily, be heterologous to the cell.
  • An expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification.
  • RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene.
  • gene means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences.
  • the gene may or may not include regions preceding and following the coding region, e.g. 5’ untranslated (5’UTR) or “leader” sequences and 3’ UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons).
  • Integrating vectors have their delivered RNA/DNA permanently incorporated into the host cell chromosomes. Non-integrating vectors remain episomal which means the nucleic acid contained therein is never integrated into the host cell chromosomes. Examples of integrating vectors include retroviral vectors, lentiviral vectors, hybrid adenoviral vectors, and herpes simplex viral vector.
  • Non-integrative viral vectors eliminate the risks posed by integrative retroviruses, as they do not incorporate their genome into the host DNA.
  • One example is the Epstein Barr oriP/Nuclear Antigen- 1 (“EBNAl”) vector, which is capable of limited self-replication and known to function in mammalian cells.
  • EBNAl Epstein Barr oriP/Nuclear Antigen- 1
  • binding of the EBNAl protein to the virus replicon region oriP maintains a relatively long-term episomal presence of plasmids in mammalian cells. This particular feature of the oriP/EBNAl vector makes it ideal for generation of integration-free host cells.
  • Non-integrative viral vectors include adenoviral vectors and the adeno-associated viral (AAV) vectors.
  • AAV adeno-associated viral
  • Another non-integrative viral vector is RNA Sendai viral vector, which can produce protein without entering the nucleus of an infected cell.
  • the F-deficient Sendai virus vector remains in the cytoplasm of infected cells for a few passages, but is diluted out quickly and completely lost after several passages (e.g., 10 passages).
  • Minicircle vectors are circularized vectors in which the plasmid backbone has been released leaving only the eukaryotic promoter and cDNA(s) that are to be expressed.
  • the antigen-binding polypeptide constructs described herein are encoded by one vector.
  • the antigen-binding polypeptide construct described herein is encoded by multiple vectors (e.g., heavy or light chains in seperated vectors).
  • multiple expression vectors can be used and expressed to make the antigen-binding polypeptide construct or antibody contructs comprising an antigen-binding domains as described herein from a memory B cell.
  • kits for sorting Plasmodium- specific IgM memory B cells (MBCs), comprising: contacting a biological sample obtained from a subject infected with or having been vaccinated against malaria with a tetramer comprising a Plasmodium antigen; and sorting a cell population comprising Plasmodium- specific IgM MBCs based on binding to the tetramer.
  • MBCs Plasmodium- specific IgM memory B cells
  • the method further comprises generating tetramers comprising blood or liver stage Plasmodium antigens prior to the contacting step.
  • blood or liver stage Plasmodium antigens include MSP-l, CSP, and AMA.
  • the methods further comprise a step of sequencing one or more BCRs, or at least the antigen-binding domains thereof, expressed by the cell population comprising IgM MBCs. In some embodiments of these aspects and all such aspects described herein, the methods further comprise a step of sequencing Plasmodium- specific IgM MBC BCRs.
  • the methods further comprise a step of cloning the one or more BCRs and expressing the one or more BCRs as recombinant antibodies or antigen-binding fragments thereof. See, for example, Tiller et al. J Immunol Methods (2009), which is incorporated herein by reference in its entirety.
  • populations comprising at least 100 recombinant antigen binding molecules, each comprising an antigen-binding domain of an IgM memory B cell receptor, and each binding its antigen with a K D of 10 7 nM or lower.
  • the recombinant antigen-binding molecules of the population can be derived from BCR antigen-binding sequences of a population of antigen-specific MBCs isolated as described herein.
  • the average frequency of somatic mutation is eight or fewer per molecule for the population.
  • the average frequency of somatic mutation is five or fewer per molecule for the population.
  • the population binds the same antigen.
  • the population binds the same antigen, but different epitopes on the same antigen.
  • compositions comprising a population of antigen-specific IgM memory B cells bound via their B cell receptors to antigen immobilized on a solid support.
  • a "solid support" for use in immobilizing, restraining, or capturing a population of antigen- specific IgM memory B cells can be any suitable solid support to which an antigen of interest can be attached or bound, and includes, for example, glass (e.g., a glass slide), plastic, chips, pins, filters, beads (e.g., magnetic beads, polystyrene beads, etc.), paper, membrane (e.g., nylon, nitrocellulose,
  • PVDF polyvinybdene fluoride
  • fiber bundles or any other suitable substrate.
  • the antigen of interest generally can be immobilized or restrained on the solid support via covalent or noncovalent interactions (e.g., ionic bonds, hydrophobic interactions, hydrogen bonds, Van der Waals forces, dipole- dipole bonds).
  • the antigen immobilized on the solid support comprises a multimer construct comprising the antigen.
  • compositions described herein selectively bind the antigen of interest.
  • Methods of measuring binding of a polypeptide to an antigen are known in the art (e.g., ELISA or ELISPOT assays).
  • the terms“selectively binds,”“specifically binds,” or“specific for” refer, with respect to an antigen of interest, such as MSP1, or apical membrane antigen 1 (AMA), or tetanus toxoid C fragment (TTCF) among others, to the preferential association of an IgM memory B cell, in whole or part, with a cell or tissue bearing that antigen, or an epitope thereof, and not to cells or tissues or samples lacking that antigen, with a KD of 10 5 M (10000 nM) or less, e.g., 10 6 M or less, 10 7 M or less, 10 8 M or less, 10 9 M or less, 10 10 M or less, 10 11 M or less, or 10 12 M or less.
  • an antigen of interest such as MSP1, or apical membrane antigen 1 (AMA), or tetanus toxoid C fragment (TTCF) among others
  • MSP1 apical membrane antigen 1
  • TTCF te
  • Specificity of binding can be assayed, for example, by competition assays using the antigen of interest, in comparison to competition with one or more unrelated or different antigens.
  • a variety of immunoassay formats are appropriate for selecting agents, such as multimers, like tetramers, antibodies, or other ligands that specifically bind a given IgM memory B cell.
  • Specific binding can be influenced by, for example, the affinity and avidity of the polypeptide agent and the concentration of polypeptide agent.
  • the person of ordinary skill in the art can determine appropriate conditions under which the agents described herein selectively bind the IgM memory B cells using any suitable methods, such as titration of an agent in a suitable cell binding assay.
  • KD refers to the "equilibrium dissociation constant", and refers to the value obtained in a titration measurement at equilibrium, or by dividing the dissociation rate constant (Koff) by the association rate constant (Kon).
  • the association rate constant (Kon), the dissociation rate constant (Koff), and the equilibrium dissociation constant (KD are used to represent the binding affinity of a binding protein to an antigen. Methods for determining association and dissociation rate constants are well known in the art. Fluorescence -based techniques offer high sensitivity and the ability to examine samples in physiological buffers at equilibrium. Other experimental approaches and instruments such as a BIAcoreTM.
  • Biomolecular interaction analysis assay can also be used (e.g., instrument available from BIAcore International AB, a GE Healthcare company, Uppsala, Sweden) to determine dissociateion kinetics and measure KD. Additionally, a KinExATM (Kinetic Exclusion Assay) assay, available from Sapidyne Instruments (Boise, Id.) can also be used. See also, Bee et al. PLOS One. (2013), Bee et al. PLOS One. (2012), Drake et al Anal Biochem (2004), and Landry et al. J Immunol Methods (2015), which are incorporated herein by reference in their entirety.
  • antigen-specific IgM memory B cells are a sub-population of B cells expressing cell-surface IgM that are high affinity, have undergone limited somatic hypermutation, and can rapidly respond, upon subsequent exposure to the same antigen, to produce high-affinity, secreted antibodies.
  • high affinity sequences corresponding to variable heavy and variable light chain sequences, as well as corresponding CDRs can be obtained and used to generate novel antigen-binding constructs, antibodies and antigenbinding fragments thereof, and recombinant cells that produce such novel antigen-binding constructs, antibodies and antigen-binding fragments thereof.
  • Antigen-specific IgM antibodies selected for cloning and sequencing typically have a high binding affinity for the antigen of interest, for example, typically having a KD value between 10 7 M to 10 10 M, or better.
  • compositions comprising any of the antigen-binding constructs, antibodies, antigen-binding polypeptides, or BCR-derived compositions described herein, and a pharmaceutically acceptable carrier.
  • pharmaceutical compositions comprises any of the antigen-binding constructs or recombinant antibodies described herein.
  • vaccine compositions comprising any of the compositions described herein.
  • a vaccine composition can be used, for example, to protect or treat an organism against disease.
  • the terms“immunize” and“vaccinate” tend to be used interchangeably in the field.
  • immunize refers to the passive protection conferred by the administered construct. While the
  • administered antigen-binding construct may recruit or promote components of the immune system, it is not administered to raise an antibody response against the antigen.
  • administration of antigen-binding constructs or antibodies or antigen-binding fragments thereof described herein can include formulation into pharmaceutical compositions or pharmaceutical formulations for parenteral administration, e.g., intravenous; mucosal, e.g., intranasal; ocular, or other mode of administration.
  • the antigen-binding polypeptide constructs, antibodies or antigen-binding fragments thereof described herein can be administered along with any pharmaceutically acceptable carrier compound, material, or composition which results in an effective treatment in the subject.
  • a pharmaceutical formulation for use in the methods described herein can contain antigen-binding polypeptide constructs, antibodies or antigen-binding fragments thereof as described herein in combination with one or more pharmaceutically acceptable ingredients.
  • phrases“pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable carrier means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, media, encapsulating material, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in maintaining the stability, solubility, or activity of, an antibody or antigen-binding fragment thereof.
  • manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
  • solvent encapsulating material involved in maintaining the stability, solubility, or activity of, an antibody or antigen-binding fragment thereof.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
  • excipient "carrier”, “pharmaceutically acceptable carrier” or the like are used interchangeably herein.
  • the antigen-binding polypeptide constructs, antibodies or antigen-binding fragments thereof described herein can be specially formulated for administration of the compound to a subject in solid, liquid or gel form, including those adapted for the following: (1) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (2) transdermally; or (3) transmucosally. Additionally, an antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof can be implanted into a patient or injected using a drug delivery system. See, for example, Urquhart, et al, Ann. Rev. Pharmacol. Toxicol.
  • Therapeutic formulations of the antigen-binding constructs or antibodies or antigen-binding fragments thereof described herein can be prepared for storage by mixing the antibodies or antigen-binding fragments having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences l6th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as
  • octadecyldimethylbenzyl ammonium chloride hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or
  • Zn-protein complexes Zn-protein complexes
  • non-ionic surfactants such as TWEENTM, PLURONICSTMor polyethylene glycol (PEG).
  • TWEENTM TWEENTM
  • PLURONICSTM polyethylene glycol
  • PEG polyethylene glycol
  • the formulations comprising the compositions described herein contain a pharmaceutically acceptable salt, typically, e.g., sodium chloride, and preferably at about physiological concentrations.
  • the formulations of the invention can contain a pharmaceutically acceptable preservative.
  • the preservative concentration ranges from 0.1 to 2.0%, typically v/v.
  • Suitable preservatives include those known in the pharmaceutical arts. Benzyl alcohol, phenol, m-cresol, methylparaben, and propylparaben are examples of preservatives.
  • the formulations of the invention can include a pharmaceutically acceptable surfactant at a concentration of 0.005 to 0.02%.
  • compositions comprising antibodies and antigen-binding fragments thereof described herein can also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • the composition can comprise a cytotoxic agent, cytokine, or growth inhibitory agent, for example.
  • cytotoxic agent cytokine
  • growth inhibitory agent for example.
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • compositions comprising antibodies or antigen-binding fragments described herein can also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example,
  • hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • sustained-release preparations can be used.
  • suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing antigen-binding polypeptide constructs, the antibodies or antigen-binding fragments in which the matrices are in the form of shaped articles, e.g., fdms, or microcapsule.
  • sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and y ethyl-L-glutamate non- degradable ethylene-vinyl acetate
  • degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
  • poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene -vinyl acetate and lactic acid- glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
  • encapsulated antigen-binding polypeptide constructs When encapsulated antigen-binding polypeptide constructs, antibodies remain in the body for a long time, they can denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S— S bond formation through thio-disulfide interchange, stabilization can be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • the therapeutic formulations to be used for in vivo administration, such as parenteral administration, in the methods described herein can be sterile, which is readily accomplished by filtration through sterile filtration membranes, or other methods known to those of skill in the art.
  • Antigen-binding polypeptide construct, antibodies and antigen-binding fragments thereof are formulated, dosed, and administered in a fashion consistent with good medical practice.
  • Factors for consideration in this context include the particular disorder being treated, the particular subject being treated, the clinical condition of the individual subject, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners.
  • the "therapeutically effective amount" of the antibodies and antigen-binding fragments thereof to be administered are governed by such considerations, and refers to the minimum amount necessary to ameliorate, treat, or stabilize an infection, the cancer; to increase the time until progression (duration of progression free survival) or to treat or prevent the occurrence or recurrence of an infection or tumor.
  • the antigen-binding polypeptide constructs, antibodies and antigen-binding fragments thereof are optionally formulated, in some embodiments, with one or more additional therapeutic agents currently used to prevent or treat the infection, for example.
  • the effective amount of such other agents depends on the amount of antibodies and antigen-binding fragments thereof present in the formulation, the type of disorder or treatment, and other factors discussed above. These are generally used in the same dosages and with administration routes as used herein before or about from 1 to 99% of the heretofore employed dosages.
  • the dosage ranges for the therapeutic agents depend upon the potency, and encompass amounts large enough to produce the desired effect.
  • the dosage should not be so large as to cause unacceptable adverse side effects.
  • the dosage will vary with the age, condition, and sex of the patient and can be determined by one of skill in the art.
  • the dosage can also be adjusted by the individual physician in the event of any complication.
  • the dosage ranges from 0.001 mg/kg body weight to 100 mg/kg body weight.
  • the dose range is from 5 pg/kg body weight to 100 pg/kg body weight.
  • the dose range can be titrated to maintain serum levels between 1 pg/mL and 1000 pg/mL.
  • subjects can be administered a therapeutic amount, such as, e.g., 0.1 mg/kg, 0.5 mg/kg, 1.0 mg/kg, 2.0 mg/kg, 2.5 mg/kg, 5 mg/kg, 7.5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg,
  • a therapeutic amount such as, e.g., 0.1 mg/kg, 0.5 mg/kg, 1.0 mg/kg, 2.0 mg/kg, 2.5 mg/kg, 5 mg/kg, 7.5 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg,
  • doses can be administered by one or more separate administrations, or by continuous infusion.
  • the treatment is sustained until, for example, the cancer is treated, as measured by the methods described above or known in the art.
  • other dosage regimens can be useful.
  • the term“effective amount” as used herein refers to the amount of an antibody or antigen binding fragment thereof needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect, e.g., reduce an infectious organism or tumor load or reduce pathology or any symptom associated with or caused by the infectious organism or tumor load.
  • the term “therapeutically effective amount” therefore refers to an amount of an antibody or antigen-binding fragment thereof using the methods as disclosed herein, that is sufficient to effect a particular effect when administered to a typical subject.
  • an effective amount as used herein would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. Thus, it is not possible to specify the exact“effective amount.” However, for any given case, an appropriate“effective amount” can be determined by one of ordinary skill in the art using only routine experimentation. [00333] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized.
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50/ED50.
  • Compositions and methods that exhibit large therapeutic indices are preferred.
  • a therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i-e., the concentration of the antibody or antigen-binding fragment thereof), which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model.
  • Levels in plasma can be measured, for example, by high performance liquid chromatography.
  • the effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
  • the recombinant antigen-binding polypeptide constructs comprising an antigen-binding domain of an IgM memory B cell receptor as described herein can be administered to a subject in need thereof by any appropriate route which results in an effective treatment in the subject.
  • administering and“introducing” are used interchangeably and refer to the placement of an antigen binding polypeptide construct, antibody or antigen-binding fragment thereof into a subject by a method or route which results in at least partial localization of such agents at a desired site, such as a site of infection or cancer, such that a desired effect(s) is produced.
  • An antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof can be administered to a subject by any mode of administration that delivers the agent systemically or to a desired surface or target, and can include, but is not limited to, injection, infusion, instillation, and inhalation administration.
  • “Injection” includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion.
  • phrases“parenteral administration” and“administered parenterally” as used herein, refer to modes of administration other than enteral and topical administration, usually by injection.
  • the phrases “systemic administration,”“administered systemically”,“peripheral administration” and“administered peripherally” as used herein refer to the administration of a therapeutic agent other than directly into a target site, tissue, or organ, such as a tumor site, such that it enters the subject’s circulatory system and, thus, is subject to metabolism and other like processes.
  • the antibody or antigen-binding fragment thereof is administered locally, e.g. , by direct injections, when the disorder or location of the infection permits, and the injections can be repeated periodically.
  • the terms “treat,” “treatment,” “treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with, a disease or disorder.
  • the term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with an infection or a cancer.
  • Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a disease is reduced or halted.
  • treatment includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening of symptoms that would be expected in absence of treatment.
  • Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • treatment also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
  • prevention refers to any methodology where the disease state does not occur due to the actions of the methodology (such as, for example, administration of a composition or construct as described herein). In one aspect, it is understood that prevention can also mean that the disease is not established to the extent that occurs in untreated controls. Accordingly, prevention of a disease encompasses a reduction in the likelihood that a subject can develop the disease, relative to an untreated subject (e.g. a subject who is not treated with the methods or compositions described herein).
  • the duration of a therapy using the methods described herein will continue for as long as medically indicated or until a desired therapeutic effect (e.g., those described herein) is achieved.
  • the administration of the antigen-binding polypeptide construct, antibody or antigen-binding fragment described herein is continued for 1 month, 2 months, 4 months, 6 months, 8 months, 10 months, 1 year, 2 years, 3 years, 4 years, 5 years, 10 years, 20 years, or for a period of years up to the lifetime of the subject.
  • appropriate dosing regimens for a given composition can comprise a single administration/immunization or multiple ones.
  • Subsequent doses may be given repeatedly at time periods, for example, about two weeks or greater up through the entirety of a subject's life, e.g., to provide a sustained preventative effect.
  • Subsequent doses can be spaced, for example, about two weeks, about three weeks, about four weeks, about one month, about two months, about three months, about four months, about five months, about six months, about seven months, about eight months, about nine months, about ten months, about eleven months, or about one year after a primary immunization.
  • the precise dose to be employed in the formulation will also depend on the route of administration and should be decided according to the judgment of the practitioner and each patient's circumstances. Ultimately, the practitioner or physician will decide the amount of protein or vaccine composition to administer to particular subjects.
  • the antigen binding polypeptide construct, recombinant antibody is administered in an amount effective to provide short-term protection against a malaria infection.
  • “short-term protection” refers to protection from an infection, such as a malarial infection, lasting at least about 2 weeks, at least about 1 month, at least about 6 weeks, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.
  • Such protection can involve repeated dosing.
  • alleviating a symptom of a persistent infection is ameliorating any condition or symptom associated with the persistent infection.
  • alleviating a symptom of a persistent infection can involve reducing the infectious microbial (such as viral, bacterial, fungal or parasitic) load in the subject relative to such load in an untreated control.
  • such reduction or degree of prevention is at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, or 100% as measured by any standard technique.
  • the persistent infection is completely cleared as detected by any standard method known in the art, in which case the persistent infection is considered to have been treated.
  • a patient who is being treated for a persistent infection is one who a medical practitioner has diagnosed as having such a condition.
  • Diagnosis may be by any suitable means. Diagnosis and monitoring may involve, for example, detecting the level of microbial load in a biological sample (for example, a tissue biopsy, blood test, or urine test), detecting the level of a surrogate marker of the microbial infection in a biological sample, detecting symptoms associated with persistent infections, or detecting immune cells involved in the immune response typical of persistent infections (for example, detection of antigen specific T cells that are anergic and/or functionally impaired).
  • a patient in whom the development of a persistent infection is being prevented may or may not have received such a diagnosis.
  • a biological sample for example, a tissue biopsy, blood test, or urine test
  • detecting the level of a surrogate marker of the microbial infection in a biological sample for example, detecting symptoms associated with persistent infections, or detecting immune cells involved in the immune response typical of persistent infections (for example, detection of antigen
  • an antibody or antigen-binding fragment thereof for the treatment of diseases, as described herein, the appropriate dosage of an antibody or antigen-binding fragment thereof will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the antigen-binding polypeptide construct, antibody or antigen binding fragment thereof is administered for preventive or therapeutic purposes, previous therapeutic indications, the subject's clinical history and response to the antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof , and the discretion of the attending physician.
  • the antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof is suitably administered to the subject at one time or over a series of treatments.
  • the antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof and the one or more additional therapeutic agents described herein are administered in a therapeutically effective or synergistic amount.
  • a therapeutically effective amount is such that co-administration of an antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof and one or more other therapeutic agents, or administration of a composition described herein, results in reduction or inhibition of a disease or disorder as described herein.
  • a therapeutically synergistic amount is that amount of an antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof and one or more other therapeutic agents necessary to synergistically or significantly reduce or eliminate conditions or symptoms associated with a particular disease.
  • the antigen-binding polypeptide construct, antibody or antigen-binding fragment thereof can be co administered with one or more additional therapeutically effective agents to give an additive effect resulting in a significantly reduction or elimination of conditions or symptoms associated with a particular disease, but with a much reduced toxicity profile due to lower dosages of one or more of the additional
  • SEQ ID NOs: 1-154 Provided herein as SEQ ID NOs: 1-154 are nucleotide and corresponding amino acid sequences, and heavy and light chain CDR amino acid sequences sequenced from malarial antigen-specific memory B cell clones for MSP 1 and AMA obtained using the methods described herein.
  • Clone B6-3P1 uses a V H IMGT of IGHVl-64*0l, a J H IMGT of IGHJ4*0l and has a V H light chain nucleotide sequence of:
  • Clone B6-3P1 uses a V K IMGT of IGKV8-24*0l, a J K IMGT of IGKJ2*0land has a V K light chain nucleotide sequence of:
  • Clone B2-3P3 uses a V H IMGT of IGHVl-l8*0l, a J H IMGT of IGHJ2*0l and has a V H light chain nucleotide sequence of:
  • Clone B2-3P3 uses a V K IMGT of IGKV6-l5*0l, a J K IMGT of IGKJ2*0land has a VK light chain nucleotide sequence of: GACATTGTGATGACTCAGTCTCAAAAATTCATGTCCACATCAGTAGGAGACAGGGTCAGCGTCACCTGCAAGGCCAGT
  • Clone C3-3P3 uses a V H IMGT of IGHV3-6*0l, a J H IMGT of IGHJ4*0l and has a VH light chain nucleotide sequence of:
  • Clone C3-3P3 uses a V K IMGT of IGKVl2-46*0l, a J K IMGT of IGKJ4*0land has a VK light chain nucleotide sequence of:
  • Clone A 1 -3P3 uses a V H IMGT of IGHV 1 -77* 01 , a J H IMGT of IGHJ2* 01 and has a VH light chain nucleotide sequence of:
  • Clone A1-3P3 uses a V K IMGT of IGKV6-32*0l, a J K IMGT of IGKJ2*0land has a VK light chain nucleotide sequence of:
  • Clone F1-3P3 uses a V H IMGT of IGHVl-64*0l, a J H IMGT of IGHJ2*0l and has a VH light chain nucleotide sequence of:
  • Clone F1-3P3 uses a V K IMGT of IGKV3-2*0l, a J K IMGT of IGKJl*0land has a VK light chain nucleotide sequence of:
  • Clone F5-3P3 uses a V H IMGT of IGHV3-6*0l, a J H IMGT of IGHJ4*0l and has a VH light chain nucleotide sequence of:
  • Clone F5-3P3 uses a V K IMGT of IGKVl2-46*0l, a J K IMGT of IGKJl*0land has a VK light chain nucleotide sequence of:
  • Clone A3-1P2 uses a V H IMGT of IGHVl-64*0l, a J H IMGT of IGHJ2*0l and has a VH light chain nucleotide sequence of:
  • Clone A3-1P2 uses a V K IMGT of IGKV3-2*0l, a J K IMGT of IGKJl*0land has a VK light chain nucleotide sequence of:
  • Clone B3-1P2 uses a V H IMGT of IGHV3-6*0l, a J H IMGT of IGHJ4*0l and has a VH light chain nucleotide sequence of:
  • Clone B3-1P2 uses a V K IMGT of IGKVl2-46*0l, a J K IMGT of IGKJ5*0land has a VK light chain nucleotide sequence of:
  • Clone B2-1P2 uses a V H IMGT of IGHVl-64*0l, a J H IMGT of IGHJ2*0l and has a VH light chain nucleotide sequence of:
  • Clone B2-1P2 uses a V K IMGT of IGKV3-2*0l, a J K IMGT of IGKJl*0land has a VK light chain nucleotide sequence of:
  • Clone A6B-1P2 uses a V H IMGT of IGHV3-6*0l, a J H IMGT of IGHJ2*0l and has a VH light chain nucleotide sequence of:
  • Clone A6B-1P2 uses a V K IMGT of IGKVl2-46*0l, a J K IMGT of IGKJ2*0land has a VK light chain nucleotide sequence of: GACATCCAGATGACTCAGTCTCCAGCCTCCCTATCTGTATCTGTGGGAGAAACTGTCACCATCACATGTCGAGCAAGT
  • Human malaria antigen AMA-specific IgM clone A8P1-A1 uses a V H IMGT of IGHV4- 31*03, a J H IMGT of IGHJ3*02 and has a VH light chain nucleotide sequence of:
  • amino acid sequence of the V H domain of AMA-specific IgM clone A8P1-A1 corresponding to SEQ ID NO: 25 is:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 26 according to the IMGT sequence numbering is: GGSISSSGYY (SEQ ID NO: 27).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 26 according to the IMGT sequence numbering is: IYYSGST (SEQ ID NO: 28).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 26 according to the IMGT sequence numbering is: ARGYFSGTYSGAFDI (SEQ ID NO: 29)
  • Human malaria antigen AMA-specific IgM clone A8P1-A1 uses a V, IMGT of IGLV2-23*0l and IGLV2-23*03, a IMGT of IGLJ3*02 and has a VL light chain nucleotide sequence of:
  • amino acid sequence of the V L domain of AMA-specific IgM clone A8P1-A1 corresponding to SEQ ID NO: 30 is:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 31 according to the IMGT sequence numbering is: SSDVGSYNL (SEQ ID NO: 32).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 31 according to the IMGT sequence numbering is: EGS (SEQ ID NO: 33).
  • the amino acid sequence of the CDR3 of the VL domain of SEQ ID NO: 31 according to the IMGT sequence numbering is: CSYAGSSTWV (SEQ ID NO: 34).
  • Human malaria antigen AMA-specific IgM clone A8P1-B1 uses a VH IMGT of IGHV3- 11*01, a JH IMGT of IGHJ4*02 and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VH domain of SEQ ID NO: 36 according to the IMGT sequence numbering is: GFTFSDYY (SEQ ID NO: 37).
  • the amino acid sequence of the CDR2 of the VH domain of SEQ ID NO: 36 according to the IMGT sequence numbering is: ISSSGSTI (SEQ ID NO: 38).
  • the amino acid sequence of the CDR3 of the VH domain of SEQ ID NO: 36 according to the IMGT sequence numbering is: ARERGSGSYWVDY (SEQ ID NO: 39).
  • Human malaria antigen AMA-specific IgM clone A8P1-B1 uses a V, IMGT of IGLV4-69*0l, a Jx IMGT of IGLJ2*0l and IGLJ3*0l and has a VL light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VL domain of SEQ ID NO: 41 according to the IMGT sequence numbering is: SGHSNYA (SEQ ID NO: 42).
  • the amino acid sequence of the CDR2 of the VL domain of SEQ ID NO: 41 according to the IMGT sequence numbering is: VNSDGSH (SEQ ID NO: 43).
  • the amino acid sequence of the CDR3 of the VL domain of SEQ ID NO: 41 according to the IMGT sequence numbering is: QTWTTGIRV (SEQ ID NO: 44).
  • Human malaria antigen AMA-specific IgM clone A8P1-B10 uses a V H IMGT of IGHV3- 15*01, a J H IMGT of IGHJ4*02 and has a VH light chain nucleotide sequence of:
  • amino acid sequence of the V H domain of AMA-specific IgM clone A8P1-B10 corresponding to SEQ ID NO: 45 is:
  • amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 46 according to the IMGT sequence numbering is: GFTFDNAW (SEQ ID NO:
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 46 according to the IMGT sequence numbering is: IKSKSDGVTT (SEQ ID NO: 48).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 46 according to the IMGT sequence numbering is: TTGGNQYSFFDS (SEQ ID NO: 49).
  • Human malaria antigen AMA-specific IgM clone A8P1-B10 uses a V, IMGT of IGLV3-9*0l, a IMGT of IGLJ2*0l and IGLJ3*0l and has a VL light chain nucleotide sequence of:
  • amino acid sequence of the V L domain of AMA-specific IgM clone A8P1-B10 corresponding to SEQ ID NO: 50 is:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 51 according to the IMGT sequence numbering is: NIGRKN (SEQ ID NO: 52).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 51 according to the IMGT sequence numbering is: KDR (SEQ ID NO: 53).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 51 according to the IMGT sequence numbering is: QVWDSSAAGVL (SEQ ID NO: 54).
  • Human malaria antigen AMA-specific IgG clone A8P1-D10 uses a V H IMGT of IGHV4- 59*01 and IGHV4-59*08, a J H IMGT of IGHJ4*02 and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VH domain of SEQ ID NO: 56 according to the IMGT sequence numbering is: GDSINFYYW (SEQ ID NO: 57).
  • the amino acid sequence of the CDR2 of the VH domain of SEQ ID NO: 56 according to the IMGT sequence numbering is: SNRGDST (SEQ ID NO: 58).
  • the amino acid sequence of the CDR3 of the VH domain of SEQ ID NO: 56 according to the IMGT sequence numbering is: ALWSSYFRGYFDY (SEQ ID NO: 59).
  • Human malaria antigen AMA-specific IgG clone A8P1-D10 uses a V K IMGT of IGKV3- 15*01, a J K IMGT of IGKJ3*0l and has a VL light chain nucleotide sequence of:
  • amino acid sequence of the complementarity determining region 1 or CDR1 of the VL domain of SEQ ID NO: 61 according to the IMGT sequence numbering is: QSVSTN (SEQ ID NO: 62).
  • the amino acid sequence of the CDR2 of the VL domain of SEQ ID NO: 61 according to the IMGT sequence numbering is: ASS (SEQ ID NO: 63).
  • the amino acid sequence of the CDR3 of the VL domain of SEQ ID NO: 61 according to the IMGT sequence numbering is: QQYGHWPPYT (SEQ ID NO: 64).
  • Human malaria antigen MSP 1 -specific IgM clone A8P2-B7 uses a VH IMGT of IGHV4-
  • QVQLQQWGAGLLKP ETLS LTCAVYGGS FS GYYWTWI RQP PGKGLEWI GEINNS GKTNYNP S LKS RVS I S I DT S KNQF SLKVT SVTAADTAVYYCARGPQQHLEP P FDYWGHGTLVTVS S (SEQ ID NO: 66).
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 66 according to the IMGT sequence numbering is: GGSFSGYY (SEQ ID NO: 67).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 66 according to the IMGT sequence numbering is: INNSGKT (SEQ ID NO: 68).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 66 according to the IMGT sequence numbering is: ARGPQQHLEPPFDY (SEQ ID NO: 69).
  • Human malaria antigen MSP 1 -specific IgM clone A8P2-B7 uses a V, IMGT of IGLV1-
  • Jx IMGT of IGLJ3*02 has a VL light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 71 according to the IMGT sequence numbering is: NSNIATNY (SEQ ID NO: 72).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 71 according to the IMGT sequence numbering is: RTD (SEQ ID NO: 73).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 71 according to the IMGT sequence numbering is: ATWDDSLSAWV (SEQ ID NO: 74).
  • Human malaria antigen AMA-specific IgM clone A8P2-E5 uses a V H IMGT of IGHVl-8*02, a J H IMGT of IGHJ6*03 and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 76 according to the IMGT sequence numbering is: MNPNSGET (SEQ ID NO: 78).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 76 according to the IMGT sequence numbering is: ARGGFCTSTSCYYHYMDV (SEQ ID NO: 79)
  • Human malaria antigen AMA-specific IgM clone A8P2-E5 uses a V K IMGT of IGKVl-5*03, a J K IMGT of IGKJ2*0l and has a VL light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 81 according to the IMGT sequence numbering is: QSVNSW (SEQ ID NO: 82).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 81 according to the IMGT sequence numbering is: KAT (SEQ ID NO: 83).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 81 according to the IMGT sequence numbering is: QQYNDFPYT (SEQ ID NO: 84).
  • Human malaria antigen MSP 1 -specific IgM clone A8P2-E6 uses a V H IMGT of IGHV4-
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 86 according to the IMGT sequence numbering is: GGSFTGHY (SEQ ID NO: 87).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 86 according to the IMGT sequence numbering is: INHRGGT (SEQ ID NO: 88).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 86 according to the IMGT sequence numbering is: ARGHGRYYYSYLDS (SEQ ID NO: 89)
  • Human malaria antigen MSP 1 -specific IgM clone A8P2-E6 uses a V K IMGT of IGKVl-5*03, a J K IMGT of IGKJ2*0l and IGKJ2*02, and has a VL light chain nucleotide sequence of:
  • amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 91 according to the IMGT sequence numbering is: QAISPW (SEQ ID NO: 92).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 91 according to the IMGT sequence numbering is: QAS (SEQ ID NO: 93).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 91 according to the IMGT sequence numbering is: QQYGRYST (SEQ ID NO: 94).
  • Human malaria antigen MSPl-specific IgG clone A8P2-E12 uses a V H IMGT of IGHV4- 34*01, a J H IMGT of IGHJ4*02 and IGHJ5*02 and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 96 according to the IMGT sequence numbering is: GGSFTGYY (SEQ ID NO: 97).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 96 according to the IMGT sequence numbering is: INHRGGT (SEQ ID NO: 98).
  • Human malaria antigen MSPl-specific IgM clone A8P2-E12 uses a V K IMGT of IGKV1- 5*03, a J K IMGT of IGKJ2*0l and IGKJ2*02, and has a VL light chain nucleotide sequence of:
  • amino acid sequence of the V L domain of MSP 1 -specific IgM clone A8P2-E12 corresponding to SEQ ID NO: 100 is:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 101 according to the IMGT sequence numbering is: QAISPW (SEQ ID NO: 102).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 101 according to the IMGT sequence numbering is: QAS (SEQ ID NO: 103).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 101 according to the IMGT sequence numbering is: QQYGRYST (SEQ ID NO: 104).
  • Human malaria antigen AMA-specific IgM clone A8P3-B5 uses a V H IMGT of IGHV4- 61*02, a J H IMGT of IGHJ6*02, and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 106 according to the IMGT sequence numbering is: GGSISSGSYY (SEQ ID NO: 107).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 106 according to the IMGT sequence numbering is: IYTSGST (SEQ ID NO: 108).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 106 according to the IMGT sequence numbering is: ARVMVRGVIGSYGMDV (SEQ ID NO: 109)
  • Human malaria antigen AMA-specific IgM clone A8P3-B5 uses a V L IMGT of IGLV3-2l*02, a J L IMGT of IGLJ3*02, and has a VL light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 111 according to the IMGT sequence numbering is: NIGSKS (SEQ ID NO: 112).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 111 according to the IMGT sequence numbering is: DDS (SEQ ID NO: 113).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 111 according to the IMGT sequence numbering is: QVWDSSSDHEV (SEQ ID NO: 114).
  • Human malaria antigen MSPl-specific IgG clone A8P3-C10 uses a V H IMGT of IGHV3- 23*01, IGHV3-23*04, and IGHV3-23D*0l, a J H IMGT of IGHJ4*02, and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 116 according to the IMGT sequence numbering is: GFTFSSYA (SEQ ID NO: 117).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 116 according to the IMGT sequence numbering is: ISSGGFIT (SEQ ID NO: 118).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 116 according to the IMGT sequence numbering is: AKGMGSNIYVGFDY (SEQ ID NO: 119)
  • Human malaria antigen MSPl-specific IgG clone A8P3-C10 uses a V K IMGT of IGKV3- 20*01, a J K IMGT of IGKJl*0l, and has a VL light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V L domain of SEQ ID NO: 121 according to the IMGT sequence numbering is: QIVSSNY (SEQ ID NO: 122).
  • the amino acid sequence of the CDR2 of the V L domain of SEQ ID NO: 121 according to the IMGT sequence numbering is: GAS (SEQ ID NO: 123).
  • the amino acid sequence of the CDR3 of the V L domain of SEQ ID NO: 121 according to the IMGT sequence numbering is: HQYGSSPGT (SEQ ID NO: 124).
  • Human malaria antigen MSP 1 -specific IgM clone A8P3-E4 uses a V H IMGT of IGHV4-
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the V H domain of SEQ ID NO: 126 according to the IMGT sequence numbering is: GGSISNSY (SEQ ID NO: 127).
  • the amino acid sequence of the CDR2 of the V H domain of SEQ ID NO: 126 according to the IMGT sequence numbering is: IYYSGGT (SEQ ID NO: 128).
  • the amino acid sequence of the CDR3 of the V H domain of SEQ ID NO: 126 according to the IMGT sequence numbering is: ARGKIYFDY (SEQ ID NO: 129).
  • Human malaria antigen MSPl-specific IgM clone A8P3-E4 uses a V K IMGT of IGKVl-5*03, a J K IMGT of IGKJl*0l, and has a VL light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VL domain of SEQ ID NO: 131 according to the IMGT sequence numbering is: QSISSW (SEQ ID NO: 132).
  • the amino acid sequence of the CDR2 of the VL domain of SEQ ID NO: 131 according to the IMGT sequence numbering is: KAS (SEQ ID NO: 133).
  • the amino acid sequence of the CDR3 of the VL domain of SEQ ID NO: 131 according to the IMGT sequence numbering is: QQYNSYALA (SEQ ID NO: 134).
  • Human malaria antigen AMA-specific IgG clone A8P3-H8 uses a VH IMGT of IGHV4-
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VH domain of SEQ ID NO: 136 according to the IMGT sequence numbering is: GGSISSSLYY (SEQ ID NO: 137).
  • the amino acid sequence of the CDR2 of the VH domain of SEQ ID NO: 136 according to the IMGT sequence numbering is: IYYSGIT (SEQ ID NO: 138).
  • the amino acid sequence of the CDR3 of the VH domain of SEQ ID NO: 136 according to the IMGT sequence numbering is: AREILTGDPSVGGDPFDY (SEQ ID NO: 139)
  • Human malaria antigen AMA-specific IgG clone A8P3-H8 uses a V L IMGT of IGLVl-5 l*02, a J L IMGT of IGLJ2*0l and IGLJ3*0l, and has a VL light chain nucleotide sequence of:
  • CAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGC TCCAACATTGGGAATAATTATGTTTCTTGGTATCGACAACTCCCAGGAACAGCCCCCAAACTCCTCGTCTATGAAAGT AATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGCCACGTCAGCCACCCTGGGCATCACCGGA CTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATACCAGCCTGAGTGCTGTGGTATTCGGCGGAGGG ACCAAACTGACCGTCCTAG (SEQ ID NO: 140).
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VL domain of SEQ ID NO: 141 according to the IMGT sequence numbering is: SSNIGNNY (SEQ ID NO: 142).
  • the amino acid sequence of the CDR2 of the VL domain of SEQ ID NO: 141 according to the IMGT sequence numbering is: ESN (SEQ ID NO: 143).
  • the amino acid sequence of the CDR3 of the VL domain of SEQ ID NO: 141 according to the IMGT sequence numbering is: GTWDTSLSAVV (SEQ ID NO: 144).
  • Human malaria antigen AMA-specific IgG clone A8P2-G6 uses a VH IMGT of IGHV4-38- 2*02, a JH IMGT of IGHJ4*02, and has a VH light chain nucleotide sequence of:
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VH domain of SEQ ID NO: 146 according to the IMGT sequence numbering is: NFPIASSYY (SEQ ID NO: 147).
  • the amino acid sequence of the CDR2 of the VH domain of SEQ ID NO: 146 according to the IMGT sequence numbering is: VYFSGST (SEQ ID NO: 148).
  • the amino acid sequence of the CDR3 of the VH domain of SEQ ID NO: 146 according to the IMGT sequence numbering is: AKGDTSRLATNFDD (SEQ ID NO: 149)
  • Human malaria antigen AMA-specific IgG clone A8P2-G6 uses a V K IMGT of IGKV4- 1*01, a J K IMGT of IGKJ4*0l and IGKJ4*02, and has a VL light chain nucleotide sequence of:
  • GGCGGAG (SEQ ID NO: 150).
  • the amino acid sequence of the complementarity determining region 1 or CDR1 of the VL domain of SEQ ID NO: 151 according to the IMGT sequence numbering is: QTLLFTSNNKDY (SEQ ID NO: 152).
  • the amino acid sequence of the CDR2 of the VL domain of SEQ ID NO: 151 according to the IMGT sequence numbering is: WAS (SEQ ID NO: 153).
  • the amino acid sequence of the CDR3 of the VL domain of SEQ ID NO: 151 according to the IMGT sequence numbering is: QQYLTTPLT (SEQ ID NO: 154).
  • amino acid sequence of the IgM tail piece of any IgM or IgG hexamer or tetramer described herein corresponding to SEQ ID NO: 155 is: PTLYNV SLVMSDTAGTCY (SEQ ID NO: 155).
  • GenBank Accession number for SEQ ID NO: 180 is GenBank: ARA90393.1. L309 is in bold above.
  • NVFSCSVMHE GLHNHYTQKS LSLSPGK (SEQ ID NO: 183). C309 is in bold above.
  • the reference sequence encoding the human IgGl described herein corresponding to SEQ ID NO: 184 is: GenBank: LT615368.1 (SEQ ID NO: 184).
  • GenBank accession number for SEQ ID NO: 185 is GenBank: SC094948.1
  • proteins and “peptides” and “polypeptides” are used interchangeably herein to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
  • “protein” is often used in reference to relatively large polypeptides
  • “peptide” is often used in reference to small polypeptides, usage of these terms in the art overlaps and varies.
  • the term“peptide” as used herein refers to peptides, polypeptides, proteins and fragments of proteins, unless otherwise noted.
  • the terms“protein” and“peptide” are used interchangeably herein when referring to a gene product and fragments thereof.
  • exemplary peptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
  • an “antigen” is a molecule that is bound by a binding site comprised by the variable region of an immunoglobulin- related or derived polypeptide agent, such as an antibody or antibody fragment or BCR, or antigen-binding fragment thereof.
  • an antigen is bound by antibody ligands and are capable of raising or causing an antibody immune response in vivo.
  • An antigen can be a polypeptide, protein, nucleic acid or other molecule.
  • the binding site as defined by the variable loops (Ll, L2, L3 and Hl, H2, H3) is capable of binding to the antigen.
  • antigenic determinant refers to an epitope on the antigen recognized by an antigen-binding molecule, and more particularly, by the antigen-binding site of said molecule.
  • the antigen of interest is from an infectious organism.
  • epitope is a region or portion of an antigen that is bound by a binding protein, and includes any polypeptide determinant capable of specific binding to an immunoglobulin or T-cell receptor.
  • epitope determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain embodiments, may have specific three dimensional structural characteristics, and/or specific charge characteristics.
  • An epitope can be determined by obtaining an X-ray crystal structure of an antibody: antigen complex and determining which residues on the antigen are within a specified distance of residues on the antibody of interest, wherein the specified distance is, 5 ⁇ or less, e.g., 5 A, 4A, 3A, 2A, lA or any distance in between.
  • an "epitope" can be formed on a polypeptide both from contiguous amino acids, or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents.
  • An epitope typically includes at least 3, and more usually, at least 5, about 9, or about 8-10 amino acids in a unique spatial conformation.
  • An “epitope” includes the unit of structure conventionally bound by an immunoglobulin V H /V L pair. Epitopes define the minimum binding site for an antibody, and thus represent the target of specificity of an antibody. In the case of a single domain antibody, an epitope represents the unit of structure bound by a variable domain in isolation.
  • the terms "antigenic determinant" and "epitope" can also be used
  • epitope determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain embodiments, may have specific three dimensional structural characteristics, and/or specific charge characteristics.
  • agent comprising the antigen refers to any agent comprising all or a part of an antigen of interest to which an IgM memory B cell specific for that antigen of interest specifically binds.
  • an agent comprising malarial MSP1 merozoite surface protein 1
  • TTCF tetanus toxoid C fragment
  • Such agents include, but are not limited to, portions or active fragments thereof of recombinant proteins, fusion proteins, peptides, multimers, tetramers, that specifically bind to the variable region of the cell-surface IgM expressed by an IgM memory B cell.
  • an“appropriate control” refers to an untreated, otherwise identical cell or population (e.g., a subject who was not administered the composition described herein, or was administered by only a subset of agents provided herein, as compared to a non-control cell).
  • a“reference level” can refer to one or more parameters or markers as measured for a normal, otherwise unaffected cell population or tissue (e.g., a biological sample obtained from a healthy subject, or a biological sample obtained from the subject at a prior time point, or a biological sample that has not yet been contacted with a pathogen as described herein).
  • a level determined prior to treatment or earlier in treatment can also provide a reference level for a given parameter or value.
  • module refers to an effect including increasing or decreasing a given parameter as those terms are defined herein.
  • the terms“increased,”“increase,”“increases,” or“enhance” or“activate” are all used herein to generally mean an increase of a property, level, or other parameter by a statistically significant amount; for the avoidance of any doubt, the terms“increased”,“increase” or“enhance” or“activate” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10- 100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a lO-fold increase, at least about a 20-fold increase, at least about a 50-fold increase, at least about
  • “decrease”,“reduced”,“reduction”, or“inhibit” are all used herein to mean a decrease or lessening of a property, level, or other parameter by a statistically significant amount.
  • “reduce,”“reduction” or“decrease” or“inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g., the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more.
  • “reduction” or“inhibition” does not encompass a complete inhibition or reduction as compared to a reference level.
  • “Complete inhibition” is a 100% inhibition as compared to a reference level.
  • a decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
  • the term “consisting essentially of' refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment. [00473] The term “consisting of' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain
  • IgM memory B cell receptor that specifically binds an antigen of interest, in an IgM isotype acceptor antibody framework.
  • antigen-binding domain comprises variable heavy chain and variable light chain amino acid sequences from the IgM memory B cell.
  • a recombinant polypeptide construct comprising an antigen-binding unit comprising heavy and light chain variable domains of a B cell receptor of a naive B cell, and an IgM heavy chain constant domain.
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds a Plasmodium antigen, in an IgM isotype acceptor antibody framework.
  • CDRs variable domain complementarity determining regions
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds a Plasmodium antigen, in an IgG isotype acceptor antibody framework.
  • CDRs variable domain complementarity determining regions
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds a Plasmodium falciparum merozoite surface protein 1 (MSP-l) polypeptide.
  • MSP-l Plasmodium falciparum merozoite surface protein 1
  • a recombinant antigen-binding polypeptide construct comprising an antigen-binding domain isolated from an IgM memory B cell receptor that specifically binds Plasmodium falciparum apical membrane antigen 1 (AMA) polypeptide.
  • AMA Plasmodium falciparum apical membrane antigen 1

Landscapes

  • Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des constructions comprenant des domaines de liaison à l'antigène de récepteurs antigéniques de lymphocytes B mémoires à IgM, notamment mais de façon non limitative, des constructions recombinées comprenant des domaines de liaison à l'antigène de récepteurs antigéniques de lymphocytes B mémoires à IgM qui se lient à un antigène d'intérêt, exprimé dans une structure d'anticorps accepteur d'isotype IgM. L'invention concerne également des procédés de préparation et des méthodes d'utilisation de telles constructions pour le traitement ou la prévention d'une maladie ou d'un trouble.
PCT/US2019/037334 2018-06-14 2019-06-14 Compositions et méthodes relatives à des lymphocytes b mémoires à igm WO2019241721A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862684882P 2018-06-14 2018-06-14
US62/684,882 2018-06-14

Publications (2)

Publication Number Publication Date
WO2019241721A2 true WO2019241721A2 (fr) 2019-12-19
WO2019241721A3 WO2019241721A3 (fr) 2020-01-30

Family

ID=68843276

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/037334 WO2019241721A2 (fr) 2018-06-14 2019-06-14 Compositions et méthodes relatives à des lymphocytes b mémoires à igm

Country Status (1)

Country Link
WO (1) WO2019241721A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023279121A3 (fr) * 2020-08-03 2023-08-17 Swartz Roger EXPRESSION D'IMMUNOGLOBULINE A DIMÈRE ET D'IMMUNOGLOBULINE A POLYMÈRE PAR VECTEUR À ARNm LENTIVIRAL ET GAMMARÉTROVIRAL À INTÉGRATION ÉPISOMIQUE ET GÉNOMIQUE POUR PERMETTRE UNE IMMUNITÉ/PROTECTION MUQUEUSE ET HÉMATOLOGIQUE PAR THÉRAPIE GÉNIQUE CONTRE DES ALLERGÈNES, DES VIRUS, LE VIH, DES BACTÉRIES, LA PNEUMONIE, DES INFECTIONS, DES PROTÉINES ASSOCIÉES À UNE PATHOLOGIE, DES PATHOLOGIES SYSTÉMIQUES, LE CANCER, LES TOXINES ET DES VIRUS NON NATURELS. EXPRESSION D'IMMUNOGLOBULINE DIMÈRE A ET D'IMMUNOGLOBULINE POLYMÈRE A PAR DES CELLULES IMMUNITAIRES MODIFIÉES PAR CAR ET NON MODIFIÉES PAR CAR

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3081575A1 (fr) * 2015-04-12 2016-10-19 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Anticorps anti-plasmodium pour parasite
WO2017059387A1 (fr) * 2015-09-30 2017-04-06 Igm Biosciences, Inc. Molécules de liaison à chaîne j modifiée
US20190183997A1 (en) * 2016-07-22 2019-06-20 University Of Washington Identification and production of high affinity igm antibodies and derivatives thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023279121A3 (fr) * 2020-08-03 2023-08-17 Swartz Roger EXPRESSION D'IMMUNOGLOBULINE A DIMÈRE ET D'IMMUNOGLOBULINE A POLYMÈRE PAR VECTEUR À ARNm LENTIVIRAL ET GAMMARÉTROVIRAL À INTÉGRATION ÉPISOMIQUE ET GÉNOMIQUE POUR PERMETTRE UNE IMMUNITÉ/PROTECTION MUQUEUSE ET HÉMATOLOGIQUE PAR THÉRAPIE GÉNIQUE CONTRE DES ALLERGÈNES, DES VIRUS, LE VIH, DES BACTÉRIES, LA PNEUMONIE, DES INFECTIONS, DES PROTÉINES ASSOCIÉES À UNE PATHOLOGIE, DES PATHOLOGIES SYSTÉMIQUES, LE CANCER, LES TOXINES ET DES VIRUS NON NATURELS. EXPRESSION D'IMMUNOGLOBULINE DIMÈRE A ET D'IMMUNOGLOBULINE POLYMÈRE A PAR DES CELLULES IMMUNITAIRES MODIFIÉES PAR CAR ET NON MODIFIÉES PAR CAR

Also Published As

Publication number Publication date
WO2019241721A3 (fr) 2020-01-30

Similar Documents

Publication Publication Date Title
JP7317272B2 (ja) Ｔｉｇｉｔ抗体、その抗原結合断片及びその医療用途 本願は、２０１９年９月２９日に出願された出願番号ｃｎ２０１７１０９０８５６５．３に基づいたものであり、その優先権を主張する。その開示は、その全体が参照により本明細書に組み込まれる。
ES2966890T3 (es) Nuevos anticuerpos anti-PD-L1
TWI735491B (zh) 人類免疫不全病毒中和抗體
CA3190879A1 (fr) Anticorps anti-ccr8 et application correspondante
IL294330A (en) Anti-ccr8 antibodies and their uses
TW201716436A (zh) 特異性針對過度磷酸化τ蛋白之抗體及其使用方法
US11529415B2 (en) Antibodies specific for IL-21 and uses thereof
DK2668208T3 (en) The cross-reactive antibody Staphylococcus Aureus
US20160244511A1 (en) Cross-reactive staphylococcus aureus antibody sequences
MX2010009885A (es) Composiciones y métodos para la terapia y diagnóstico de citomegalovirus.
US10081675B2 (en) Antibodies targeting M-CSF
KR20170136637A (ko) 항-스타필로코커스 아우레우스 항체 배합 제제
JP2017505758A (ja) 黄色ブドウ球菌のｌｕｋｇｈ（ｌｕｋａｂ）毒素に対する抗体及び抗体配列
US20190183997A1 (en) Identification and production of high affinity igm antibodies and derivatives thereof
US9605083B2 (en) JAML specific binding agents, antibodies, and uses related thereto
WO2019241721A2 (fr) Compositions et méthodes relatives à des lymphocytes b mémoires à igm
US20210308256A1 (en) Sequential immunization strategies to guide the maturation of antibodies against human immmunodeficiency virus
US9611318B2 (en) Anti-plasmodium parasite antibodies
WO2020221451A1 (fr) Anticorps se liant à la protéine circumsporozoïte de plasmodium et leurs utilisations
KR20230136604A (ko) 개과 항체 불변 영역에서의 돌연변이
EP3283518B1 (fr) Anticorps anti-plasmodium pour parasite
RU2822550C2 (ru) Антитело против клаудина 18.2 и его применение
KR20180129791A (ko) 혈 중에서 합토글로빈에 결합하여 다가의 면역 복합체를 형성하는 항체를 유효 성분으로 하는 자기 면역 질환 치료제
US10465005B2 (en) JAML specific binding agents, antibodies, and uses related thereto
CN114901309A (zh) 药物组合及其用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19819947

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19819947

Country of ref document: EP

Kind code of ref document: A2