WO2019232517A1 - Compositions and methods for treatment of dominant retinitis pigmentosa - Google Patents

Compositions and methods for treatment of dominant retinitis pigmentosa Download PDF

Info

Publication number
WO2019232517A1
WO2019232517A1 PCT/US2019/035159 US2019035159W WO2019232517A1 WO 2019232517 A1 WO2019232517 A1 WO 2019232517A1 US 2019035159 W US2019035159 W US 2019035159W WO 2019232517 A1 WO2019232517 A1 WO 2019232517A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
rho
seq
nucleotide sequence
raav
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/035159
Other languages
English (en)
French (fr)
Inventor
Alfred S. Lewin
William W. Hauswirth
Michael T. MASSENGILL
William BELTRAN
Gustavo D. Aguirre
Artur CIDECIYAN
Samuel Jacobson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Florida
University of Pennsylvania Penn
University of Florida Research Foundation Inc
Original Assignee
University of Florida
University of Pennsylvania Penn
University of Florida Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP19812143.6A priority Critical patent/EP3802836A4/en
Priority to CN201980036506.9A priority patent/CN112204145B/zh
Priority to AU2019276645A priority patent/AU2019276645B2/en
Priority to CN202410254122.7A priority patent/CN118480544A/zh
Priority to CA3102095A priority patent/CA3102095A1/en
Priority to JP2020567085A priority patent/JP7563694B2/ja
Application filed by University of Florida, University of Pennsylvania Penn, University of Florida Research Foundation Inc filed Critical University of Florida
Priority to US17/059,815 priority patent/US12203074B2/en
Publication of WO2019232517A1 publication Critical patent/WO2019232517A1/en
Priority to IL279091A priority patent/IL279091B1/en
Anticipated expiration legal-status Critical
Priority to US18/976,035 priority patent/US20250215437A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/072Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/121Hammerhead
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/122Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14142Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • adRP Autosomal dominant retinitis pigmentosa
  • RHO rhodopsin gene
  • compositions and methods for treating retinitis pigmentosa relate to compositions and methods for treating retinitis pigmentosa (e.g., dominant retinitis pigmentosa) in a subject (e.g., in a human).
  • retinitis pigmentosa e.g., dominant retinitis pigmentosa
  • one or both alleles of the rhodopsin gene ( RHO gene) of a subject are silenced by administering a short hairpin RNA (shRNA) molecule to a subject (e.g., to a subject having retinitis pigmentosa, for example to a human having dominant retinitis pigmentosa).
  • shRNA short hairpin RNA
  • a replacement RHO coding sequence also is administered to the subject to provide a functional RHO protein, e.g., to restore photoreceptor function to the subject.
  • the replacement RHO coding sequence has one or more nucleotide substitutions relative to the endogenous gene allele(s) that render the replacement gene resistant to the effects of the interfering RNA.
  • the replacement RHO coding sequence is a human RHO coding sequence (e.g., a wild-type human RHO coding sequence) that includes one or more (e.g., 1, 2, 3, 4, 5, or more) substitutions to render the gene resistant (also referred to as“hardened”) to degradation mediated by the shRNA.
  • the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GUGGCAUUCUACAUCUUCA (SEQ ID NO: 1), an antisense strand comprising the nucleotide sequence
  • UGAAGAUGUAGAAUGCCAC (SEQ ID NO: 2), and a loop comprising the nucleotide sequence UUCAAGAGA (SEQ ID NO: 3).
  • the disclosure provides a short hairpin RNA (shRNA) comprising a sense strand comprising the nucleotide sequence GErGGCAUErCETACAUCETErCA (SEQ ID NO: 1), an antisense strand comprising the nucleotide sequence
  • UGAAGAUGUAGAAUGCCAC (SEQ ID NO: 2), and a loop.
  • the loop may consist of nine nucleotides.
  • the shRNA comprises the nucleotide sequence:
  • the shRNA consists of the nucleotide sequence
  • the shRNA comprises the nucleotide sequence:
  • the shRNA consists of the nucleotide sequence
  • the disclosure provides a short hairpin RNA (shRNA) molecule comprising: a) a sense and antisense strand comprising one of the following sets of sequences: i) a sense strand comprising the nucleotide sequence
  • CUGCCUACAUGUUUCUGCU SEQ ID NO: 21
  • an antisense strand comprising the nucleotide sequence AGCAGAAACAUGUAGGCAG
  • a sense strand comprising the nucleotide sequence CCUACAUGUUUCUGCUGAU (SEQ ID NO: 23) and an antisense strand comprising the nucleotide sequence AUCAGCAGAAACAUGUAGG (SEQ ID NO: 24)
  • a sense strand comprising the nucleotide sequence
  • GCAUGGUCAUCAUCAUGGU SEQ ID NO: 25
  • an antisense strand comprising the nucleotide sequence ACC AU GAU GAU GACC AU GC (SEQ ID NO: 26); or iv) a sense strand comprising the nucleotide sequence GUGGCAUUCUACAUCUUCA (SEQ ID NO: 1) and an antisense strand comprising the nucleotide sequence UGAAGAUGUAGAAUGCCAC (SEQ ID NO: 2); and b) a loop comprising the nucleotide sequence UUCAAGAGA (SEQ ID NO: 3).
  • the disclosure provides a short hairpin RNA (shRNA) molecule comprising: a) a sense and antisense strand comprising one of the following sets of sequences: i) a sense strand comprising the nucleotide sequence
  • CUGCCUACAUGUUUCUGCU SEQ ID NO: 21
  • an antisense strand comprising the nucleotide sequence AGCAGAAACAUGUAGGCAG
  • a sense strand comprising the nucleotide sequence CCUACAUGUUUCUGCUGAU (SEQ ID NO: 23) and an antisense strand comprising the nucleotide sequence AUCAGCAGAAACAUGETAGG (SEQ ID NO: 24)
  • a sense strand comprising the nucleotide sequence
  • GCAUGGETCAUCAUCAUGGET SEQ ID NO: 25
  • an antisense strand comprising the nucleotide sequence ACCAUGAUGAUGACCAUGC
  • a sense strand comprising the nucleotide sequence GErGGCAUErCErACAUCErErCA (SEQ ID NO: 1) and an antisense strand comprising the nucleotide sequence UGAAGAUGErAGAAUGCCAC (SEQ ID NO: 2); and b) a loop consisting of nine nucleotides.
  • the short hairpin RNA (shRNA) molecule comprising or consists of one of the following nucleotide sequences:
  • CUGCCUACAUGUUUCUGCUUUCAAGAGAAGCAGAAACAUGUAGGCAG SEQ ID NO: 27
  • CCUACAUGUUUCUGCUGAUUUCAAGAGAAUCAGCAGAAACAUGUAGG SEQ ID NO: 28
  • the short hairpin acid (shRNA) molecule comprising or consists of one of the following nucleotide sequences:
  • the disclosure provides a vector encoding an shRNA of any one of the above-mentioned embodiments or as otherwise described herein.
  • the shRNA coding sequence is operably linked to a promoter, e.g., a human Hl RNA promoter.
  • the vector further comprises a recombinant RHO coding sequence that does not contain a sequence targeted by the shRNA.
  • the recombinant RHO coding sequence is codon-optimized for expression in a human cell.
  • the recombinant RHO coding sequence comprises a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 5.
  • the recombinant RHO coding sequence comprises a nucleotide sequence that is one, two, three, four, five or between five and ten nucleotides different from the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the recombinant RHO coding sequence comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the recombinant RHO coding sequence is operably linked to a promoter, e.g., a human opsin proximal promoter. In some embodiments, the vector is a plasmid. In some embodiments, the vector is a viral vector. In some embodiments,
  • the viral vector is a recombinant adeno-associated viral (rAAV) vector.
  • rAAV adeno-associated viral
  • the rAAV vector is self-complementary.
  • the disclosure provides a vector comprising a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 6.
  • the recombinant RHO coding sequence comprises a nucleotide sequence that is one, two, three, four, five or between five and ten nucleotides different from the nucleotide sequence of SEQ ID NO: 6.
  • the vector comprises the nucleotide sequence of SEQ ID NO: 6.
  • the vector is a plasmid.
  • the vector is a viral vector.
  • the viral vector is a recombinant adeno-associated viral (rAAV) vector.
  • the rAAV vector is self-complementary.
  • the disclosure provides a recombinant adeno-associated viral (rAAV) particle comprising any one of the rAAV vectors described above or as otherwise described herein.
  • the rAAV particle is an rAAV serotype 5 (rAAV5) particle.
  • the disclosure provides a composition comprising any one of the shRNAs, vectors, or rAAV particles described above or as otherwise described herein and a pharmaceutically acceptable carrier.
  • the disclosure provides a method of modulating RHO expression in a subject (e.g., a human subject), the method comprising administering to the subject the composition.
  • the disclosure provides a method of treating retinitis pigmentosa in a subject (e.g., a human subject), the method comprising administering to the subject the composition.
  • the subject is a mammal.
  • the mammal is a rodent or a dog.
  • the mammal is a human (e.g., a human having or known to have, for example diagnosed as having, retinitis pigmentosa, for example dominant retinitis pigmentosa).
  • the composition is for use in treating retinitis pigmentosa.
  • the composition is for use in the manufacture of a medicament to treat retinitis pigmentosa.
  • FIGs. 1A-1H show shRNA-mediated knockdown of wild type (WT), P23H, T17M, and shRNA820-resistant ( RHOsio ) variants of human rhodopsin ( RHO ).
  • HEK293T cells were transfected with a plasmid expressing either WT, P23H, T17M or shRNA820-resistant ( RHO820 ) human RHO with a C-terminal turboGFP tag ( RHO-tGFP ) as well as with a rAAV2 plasmid (denoted with lane labels) encoding either empty DNA (no shRNA), a control shRNA, shRNA , shRNA i . , or shRNAsio .
  • FIGs. 1A, 1C, 1E, 1G Immunoblots of protein samples isolated from transfected HEK293T cells probed for turboGFP tag and b-tubulin as the loading control.
  • FIGs. 1B, 1D, 1F, 1H Relative quantification of the monomeric form of RHO-GFP (top row) and of the monomeric and aggregated forms of RHO-GFP (lower row).
  • the first lane of each western blot contained the Chameleon Duo Pre- stained Protein Fadder from Fi-Cor. Bars denote mean value of three technical replicates, error bars denote SEM. ns.
  • FIGs. 2A-2H show suppression of rhodopsin with shRNAsx ) in wildtype (WT) retinas.
  • FIGs. 2A-2C In vivo imaging results from representative WT eyes 7-8 weeks post injection with scAAV2/5-H 1 -shRNAnin at lxlO 11 (FIG. 2B) and 5xl0 n vg/mL (FIG. 2C) titers as compared to uninjected control (FIG. 2A).
  • FIG. 2D Shown are OCT scans (left), normalized inner/outer segment (IS/OS) intensity topography (middle) and outer nuclear layer (ONL) thickness topography (right). Dotted lines, injection bleb boundaries. Arrows, location of the OCTs shown on left.
  • FIGs. 2D, 2E Normalized IS/OS intensity (FIG. 2D) and ONL thickness (FIG. 2E) sampled within the injected blebs (horizontal line shaded circles, upper panels) and uninjected control locations (diagonal line shaded circles, lower panels) in ten eyes injected with a range of titers. Symbols represent group averages ( ⁇ SD) from 33 to 95 samples (see FIG. 12).
  • FIG. 2F Microphotographs of hematoxylin/eosin stained (top row) and rhodopsin (RHO)
  • FIG. 2G Schematic representation of the retinas of WT dogs treated with 1- 50 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of rhodopsin (RNA and protein) expression 7-8 weeks post-injection. Dashed lines, bleb boundaries; stippled area: tapetal region.
  • FIGs. 3A-3D show suppression of rhodopsin with shRNAsio in ////G- mutant retinas.
  • FIG. 3A Schematic representation of the fundus of four RHO-mutant dog eyes injected with scAAV2/5-H 1 -shRNAnx ) at 1-10 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of rhodopsin (RNA and protein) expression at 8-10 weeks post-injection. Dashed lines, bleb boundaries; stippled area: tapetal region. (FIG.
  • FIG. 3B Quantification of the levels of endogenous canine RHO RNA remaining in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with different titers. Representative immunoblot and quantification of the levels of endogenous canine RHO protein remaining in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with 1- 50 xlO 11 vg/mL titers.
  • FIG. 3C Outer nuclear layer (ONL) thickness topography two weeks post light exposure (8-10 weeks post- injection) in four RHO- mutant dog eyes treated with 1-10 xlO 11 vg/mL titers. Dotted lines, bleb boundaries; dashed lines, ONL rescue boundaries. Insets, maps of significance showing retinal regions with ONL thickness (left) and IS/OS intensity (right) values compared point by point to the 99 th percentile confidence intervals of uninjected controls.
  • FIG. 3D shows
  • FIGs. 4A-4G show suppression and replacement of rhodopsin with single vector prevents retinal degeneration in //7/G-mutant retinas.
  • FIGs. 4A-4B Outer nuclear layer (ONL) thickness topography after injection/before light exposure (post Inj.) and two weeks post light exposure (post LE) in two //7/G-mutant eyes injected with scAAV2/5-hOP- RHO S20 -H1- shRNAsio at 5 xlO 11 vg/mL titer. Dotted lines, bleb boundaries; dashed lines, ONL rescue boundaries. Insets, maps of significance described in FIGs. 3A-3E. (FIGs.
  • Rhodopsin RHO
  • human cone arrestin hCA
  • co-immunolabeled retinal cryosections showing morphology of the ONL and outer segments (OS) in treated and untreated (UnTx) areas of the same eyes shown in (FIGs. 4A-4B).
  • FIG. 4E Schematic representation of the fundus of four //7/G-mutant dog eyes injected with a 5xl0 n vg/mL titer showing the location of neuroretinal punches used for quantification of rhodopsin (RNA and protein) expression. Dashed lines, bleb boundaries; stippled area: tapetal region.
  • FIGs. 5A-5D show protection of retinal structure and function in RHO-mutant retinas treated with single vector that combines suppression and replacement of rhodopsin of up to 5 weeks.
  • FIG. 5A Upper, Timeline showing time-points of injection of scANV2/5-RHOs 20 - shRNAsio (5 xlO 11 vg/mL titer) in one eye of two /7/70-mutant dogs (contralateral eye injected with BSS), light exposures (LE1-LE4), OCT imaging and ERG sessions.
  • FIG. 5C Representative ERG traces of rod (-1.7 log cd.s.m 2 ), mixed rod-cone (0.51 log cd.s.m 2 ) recorded dark adapted, and cone responses to single stimuli (0.51 log cd.s.m 2 ) or 29-Hz cone flicker (0.26 log cd.s.m 2 ) recorded light adapted at ⁇ 2 weeks after each of four light exposure sessions in a 77770-mutant dog injected in one eye with sc A A V 2/5 -RHOs Ki -shRNA s2o (solid line) and with BSS (dashed line) in the contralateral eye.
  • FIG. 5D Longitudinal quantification of maximal amplitudes of mixed rod- cone a- and b-waves (upper panel), and of cone lHz and 29Hz flicker responses (lower panel) in two 77770-mutant dogs injected in one eye with sc A A V 2/5- RHOsm-shRN A s2o (horizontal line shading) and in the contralateral eye with BSS (diagonal line shading) at similar time- points as shown in (FIG. 5C).
  • FIG. 6 shows a diagram of the transgene plasmid A AV -shRNAsio-RHOsio-
  • FIG. 7 shows an amino acid sequence of human rhodopsin illustrating sites of known mutations and deletions (based on review from Athanasiou et al.(l5)) and target sites of shRNAs and ribozyme knock down reagents evaluated in this current study.
  • FIG. 8 shows the digestion of human rhodopsin mRNA by hammerhead ribozyme 525 ( 7z525).
  • * P ⁇ 0.05 for resistant/hardened 77770 relative to wild type 77770 by Student’s t test.
  • FIG. 9A-9C show the suppression of RHO expression with Rz525 in WT canine retinas.
  • FIG. 9A Schematic representation of the retinas of RHO WT dogs injected subretinally with AAV2/5 -Rz525 at 20 or 50 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of canine rhodopsin (RNA and protein) expression. Dashed lines, bleb boundaries; stippled area: tapetal region.
  • FIG. 9B shows the suppression of RHO expression with Rz525 in WT canine retinas.
  • FIG. 9C Representative immunoblot (upper) and quantification of the levels of endogenous canine RHO protein remaining (lower) in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with 20 or 50 xlO 11 vg/mL titers.
  • OSasOD designation refers to left eye being displayed as right eye for comparability.
  • FIGs. 10A-10E show the suppression of RHO expression with Rz525 in RHO mutant canine retinas.
  • FIG. 10A Schematic representation of the retinas of RHO mutant dogs injected with BSS or AAV2/5 -Rz525 at 20 or 100 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of canine rhodopsin (RNA and protein) expression. Dashed lines, bleb boundaries; stippled area: tapetal region.
  • FIG. 10B Schematic representation of the retinas of RHO mutant dogs injected with BSS or AAV2/5 -Rz525 at 20 or 100 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of canine rhodopsin (RNA and protein) expression. Dashed lines, bleb boundaries; stippled area: tapetal region.
  • FIG. 10B shows the suppression of RHO expression with Rz525
  • FIG. 10C Representative immunoblot (upper) and quantification of the levels of endogenous canine RHO protein remaining (lower) in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with BSS or AAV2/5 -Rz525 at 20 or 100 xlO 11 vg/mL titers.
  • FIG. 10C Representative immunoblot (upper) and quantification of the levels of endogenous canine RHO protein remaining (lower) in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with BSS or AAV2/5 -Rz525 at 20 or 100 xlO 11 vg/mL titers.
  • Multifocal dark lesions visible by NIR cSLO imaging (upper and lower left panels) in both retinas of a RHO mutant dog treated 8 weeks earlier with AAV2/5 -Rz525 at 100 xlO 11 vg/mL correspond on the OCT B scan (upper right panel) to focal nodules of increased reflectivity (white arrows) located in the subretinal space and RPE/choroid, and by histology (lower right panel) to focal inflammatory cell infiltrates. Retinal separation is visible on the OCT B scan (white arrowheads). Dashed lines, bleb boundaries; dotted line represents location of OCT B scan.
  • FIGs. 11A-11C show inefficient suppression of RHO expression with shRNAm in WT canine retinas.
  • FIG. 11A Schematic representation of the fundus of eyes of RHO WT dogs injected with scWY2/5-shRNAi 3i at 10 or 50 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of canine rhodopsin (RNA and protein) expression at 8 weeks post-injection. Dashed lines, bleb boundaries; stippled area: tapetal region.
  • FIG. 11A Schematic representation of the fundus of eyes of RHO WT dogs injected with scWY2/5-shRNAi 3i at 10 or 50 xlO 11 vg/mL titers showing the location of neuroretinal punches used for quantification of canine rhodopsin (RNA and protein) expression at 8 weeks post-injection. Dashed lines, bleb boundaries; stippled area: tape
  • FIG. 11B Quantification of the levels of endogenous canine RHO RNA remaining in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with 10 or 50 xlO 11 vg/mL titers.
  • FIG. 11C Representative immunoblot and quantification of the levels of endogenous canine RHO protein remaining in the treated retinal area as a percentage of levels measured in the untreated area of eyes injected with 10 or 50 xlO 11 vg/mL titers.
  • OSasOD designation refers to left eye being displayed as right eye for comparability.
  • FIG. 12 shows individual topographic results of all 10 RHO WT eyes injected with scAAY2/5-shRNA 820 over a range of titers from lx to 50xl0 n vg/mL.
  • ONL thickness left
  • normalized IS/OS intensity middle
  • loci chosen within (squares on the right with surrounding dotted line) and outside (squares on the left) the bleb (right) for quantitation.
  • 2194-OD and similar labels designate the individual animal and eye. All eyes are shown as equivalent right eyes to allow easier comparison.
  • OSasOD designation refers to left eye being displayed as right eye for comparability.
  • FIGs. 13A-13G show suppression and replacement of rhodopsin with two separate vectors: incomplete protection of rods and retinal toxicity in RHO mutant eyes.
  • FIGs. 13A-13C OCT imaging and histological analysis of retinal protection against light exposure (LE) in a RHO mutant eye co-injected with 5xl0 n vg/mL of sc A A V 2/5-shRNA H 2 O and 5xl0 n vg/mL of sc A A V 2/5 -RHO sit ) (Treatment 1:1).
  • FIG. 13A ONL thickness topography 7 weeks after injection/before light exposure (post Inj.) and four weeks post light exposure (post LE) Dotted lines, bleb boundaries; white arrow, location of OCT B scan shown in lower panel.
  • Rhodopsin Rho
  • hCA human cone arrestin
  • FIG. 13B Rhodopsin/human cone arrestin (hCA) co- immunolabeled retinal cryo section showing morphology of the outer nuclear layer (ONL) and outer segments (OS) in treated and untreated (UnTx) areas of the same eye shown in (FIG. 13A).
  • FIG. 13C H&E stained retinal microphotograph taken within the treated area showing maximal rescue effect.
  • FIG. 13D-13F Similar analysis as in (FIGs.
  • FIG. 13A-13C in a RHO mutant eye co-injected with 5xl0 n vg/mL of sc A A V 2/5-shRNA sin and 10 xlO 11 vg/mL of scAAV2/5 -RHOsio (Treatment 1:2).
  • FIG. 13D ONL thickness topography. Dotted lines, bleb boundaries; dashed lines, ONL rescue boundaries; white arrow corresponds to location of OCT B scan shown in lower panel; white arrows on OCT B scan show increased perivascular thickening and reflectivity.
  • FIG. 13E Double fluorescence IHC (Rhodopsin; human cone arrestin).
  • FIG. 13F H&E stained retinal microphotograph taken within the treated area showing limited ONL rescue and severe lesions of perivascular cell infiltration (arrows).
  • FIG. 13G OCT imaging 11 weeks post injection in a RHO mutant eye co-injected with 5xl0 n vg/mL of cAAM2/5-shRNA, 2 o and 10 xlO 11 vg/mL of scAAV2/5 -RHOsio (Treatment 1:2) but that was not exposed to light. Dotted lines, bleb boundaries; grey and white arrows show locations of single OCT B scans (right panel). OSasOD designation refers to left eye being displayed as right eye for comparability.
  • FIGs. 14A-14D show suppression and replacement of rhodopsin with single vector prevents retinal degeneration in RHO mutant retinas (additional data to FIGs. 4A-4H).
  • FIG. 14A-14B ONL thickness topography after injection/before light exposure (post Inj.) and two weeks post light exposure (post LE) in two RHO mutant dog eyes injected with scAAV2/5- RHOsio-shRNAsio at 5 xlO 11 vg/mL titer. Dotted lines, bleb boundaries; dashed lines, ONL rescue boundaries.
  • FIGs. 14C-14D Rhodopsin (Rho)/human cone arrestin (hCA) co-immunolabeled retinal cryosections showing morphology of the outer nuclear layer (ONL) and outer segments (OS) in treated and untreated (UnTx) areas of the same eyes shown in (FIGs. 14A-14B).
  • OSasOD designation refers to left eye being displayed as right eye for comparability.
  • FIGs. 15A-15C show the natural history of disease in RHO mutant (RHO t4r/+ ) dogs housed under different conditions of ambient illumination.
  • FIGs. 15A, 15B Pseudocolor ONL topographies of representative dogs housed under cyclic dim-red light (FIG. 15 A) or cyclic standard white kennel illumination (FIG. 15B). All eyes are shown as equivalent right eyes.
  • the optic nerve head (black circle) and major blood vessels (white lines), tapetum boundary (grey line), and fovea-like region ( ellipse) are overlaid
  • FIG. 15C Schematic, loci selected in five retinal regions for quantitation of ONL thickness.
  • C central; ST,
  • FIGs. 16A-16E show recombinant AAV2/5 vector constructs used in the study.
  • FIG. 16A Single- stranded AAV carrying a mouse opsin proximal promoter (mOP) driving the expression of a hammerhead ribozyme ( Rz525 ) designed to cleave murine, canine and human RHO mRNA.
  • FIG. 16B Self-complementary AAV carrying an Hl RNA polymerase III promoter (Hl) driving the expression of a short hairpin RNA ( shRNA ) designed to cleave canine and human RHO mRNA.
  • Hl Hl RNA polymerase III promoter
  • FIG. 16C Self complementary AAV carrying an Hl RNA polymerase III promoter (Hl) driving the expression of a short hairpin RNA ( shRNAsio ) designed to cleave canine and human RHO mRNA.
  • Hl Hl RNA polymerase III promoter
  • shRNAsio short hairpin RNA
  • RHOsio replacement human RHO mRNA
  • FIG. 16E Self complementary AAV carrying both the knockdown reagent shRNAsio and the human resistant replacement RHOsio .
  • TR AAV2 inverted terminal repeat
  • mTR mutant TR
  • wtTR wild type TR
  • SV40 SD/SA splice donor/acceptor element derived from simian virus 40
  • hp Rz Hl RNA polymerase III promoter
  • SV40 pA SV40 derived polyadenylation terminal signal
  • HSV TK pro human herpes simplex virus derived thymidine kinase promoter
  • Neo R neomycin resistance gene.
  • bGH pA bovine growth hormone polyadenylation terminal signal
  • hGFP humanized GFP.
  • FIG. 17 is an illustration of the experimental design of the long-term study of the AAV therapy in dogs.
  • Each dog had its right eye (OD) subretinally-injected with 150 pL of the AAV construct at a titer of 5 x 10 11 vg/mL, while the contralateral left eye (OS) was subretinally-injected with a similar volume of balanced salt solution (BSS).
  • PI Post-Injection
  • LE Light Exposure
  • OCT Optical
  • FIGs. 18A-18D show representative ERG traces of rod (-1.7 log cd.s.m 2 , FIG. 18A), mixed rod-cone (0.51 log cd.s.m 2 , FIG. 18B) recorded dark adapted, and cone responses to single stimuli (0.51 log cd.s.m 2 , FIG. 18C) or 29-Hz cone flicker (0.26 log cd.s.m 2 , FIG. 18D) recorded light adapted at ⁇ 2 weeks after each of four light exposure sessions in a 77770- mutant dog injected in one eye with scAAV2/5-hOP-/7/70S > 2O-H 1 -shRNA820 (dotted line) and with BSS (solid line) in the contralateral eye.
  • FIGs. 19A-19C show longitudinal quantification of maximal amplitudes of rod b- waves (FIG. 19A), mixed rod-cone a- and b-waves (FIG. 19B), and of cone lHz and 29Hz flicker responses (FIG. 19C) in four 77770-mutant dogs injected in one eye with scAAV2/5- RH0820-shRNA820 (horizontal line shading) and in the contralateral eye with BSS (diagonal line shading) at similar time-points as shown in FIGs. 18A-18D.
  • AAV scAAV2/5 -RHO820- shRNA820.
  • FIGs. 20A-20D show for each of the four RHO- mutant dogs outer nuclear layer (ONL) thickness maps and inner segment-outer segment (IS/OS) intensity maps prior to injection (pre-inj.), 12 weeks post- injection (before the first light exposure event), and 50 weeks post-injection (2 weeks after the fourth light exposure event).
  • ONL outer nuclear layer
  • IS/OS inner segment-outer segment
  • FIG. 21 shows rhodopsin (RHO)/human cone arrestin (hCA) co-immunolabeled retinal cryosection from a RHO- mutant dog illustrating the morphology of the outer nuclear layer (ONL) and outer segments (OS) in untreated and treated areas of the same eye.
  • the ONL thickness maps shows the approximate location (asterisk) of the retinal untreated and treated areas shown in the upper image.
  • FIG. 22 shows OCT measurements of outer nuclear layer (ONL) thickness in mice treated with sc A A V 2/5- RHO, 2o-shRN A IO or AAV2/5-GFP.
  • P23H RHO C57B1/6 mice were treated with either AAV2/5-GFP or sc A A V 2/5 -RHOxio-shRNA , 2o i n one eye, and ONL thickness was analyzed at varying intervals: a) pre-treatment (“Pre”), b) 1 month post injection, c) 2 months post-injection, or d) 3 months post-injection.
  • Pre pre-treatment
  • FIG. 23 shows longitudinal quantification of maximal amplitudes of rod and mixed rod-cone a- and b-waves in P23H RHO mice injected in one eye with scAAV2/5 -RHO820- shRNA820 (circles and dashed line) or AAV2/5-GFP (squares and solid line). These two groups of mice were subjected to brief light flashes of varying intensities (-20 decibels (dB), - 10 dB and 0 dB). Electrical responses of these mice were analyzed at 1 month, 2 months, and 3 months post-injection.
  • FIG. 24 shows the sequences of most frequent short mRNAs expressed in HEK293 cells following transfection with sc A A V 2/5 -RHO820-shRNA 820, after size fractionation.
  • FIG. 25 shows the consensus sequence of the top“hits” of short mRNAs expressed in transfected HEK293 cells. As indicated by arrows, 52% of RNA molecules had 2 extra uridines at the 3’ end. The sequence of the 5’ end of the guide strand (UAG) in 73% of the RNA molecules was equivalent to what was predicted.
  • a short hairpin RNA (shRNA) is provided that targets human, dog and/or mouse rhodopsin (RHO) mRNA.
  • the shRNA comprises a sense strand comprising the nucleotide sequence GUGGCAUUCUACAUCUUCA (SEQ ID NO: 1), an antisense strand comprising the nucleotide sequence
  • the shRNA comprises a sense strand that comprises a nucleotide sequence that is one, two, or three nucleotides different from the sequence of SEQ ID NO: 1, and an antisense strand that comprises a nucleotide sequence that is one, two, or three nucleotides different from the sequence of SEQ ID NO: 2.
  • the loop comprises a sequence having a length of 5 to 10 nucleotides.
  • the loop comprises a sequence having a length of 9 nucleotides.
  • the loop comprises ETETCAAGAGA (SEQ ID NO: 3).
  • the loop is SEQ ID NO: 3.
  • the loop comprises a nucleotide sequence that is one or two nucleotides different from the sequence of SEQ ID NO: 3.
  • the shRNA comprises a sense strand comprising the nucleotide sequence GErGGCAUErCErACAUCErErCA (SEQ ID NO: 1), an antisense strand comprising the nucleotide sequence UGAAGAUGUAGAAUGCCAC (SEQ ID NO: 2), and a loop comprising the nucleotide sequence UUCAAGAGA (SEQ ID NO: 3).
  • the shRNA comprises a sense strand comprising the nucleotide sequence GUGGCAUUCUACAUCUUCA (SEQ ID NO: 1), an antisense strand comprising the nucleotide sequence U GAAGAU GUAGAAU GCC ACUU (SEQ ID NO: 10), and a loop comprising the nucleotide sequence UUCAAGAGA (SEQ ID NO: 3).
  • the shRNA comprises a sense strand that comprises a nucleotide sequence that is one, two, or three nucleotides different from the sequence of SEQ ID NO: 1 ; an antisense strand that comprises a nucleotide sequence that is one, two, or three nucleotides different from the sequence of SEQ ID NO: 10; and a loop that comprises a nucleotide sequence that is one or two nucleotides different from the sequence of SEQ ID NO: 3.
  • the shRNA comprises or consists of the sequence of SEQ ID NO: 4 shown below.
  • the shRNA comprises a nucleotide sequence that is one, two, or three nucleotides different from the sequence of SEQ ID NO: 4.
  • the shRNA comprises a sense and antisense strand comprising one of the following sets of sequences: i) a sense strand comprising the nucleotide sequence CUGCCUACAUGUUUCUGCU (SEQ ID NO: 21) and an antisense strand comprising the nucleotide sequence AGCAGAAACAUGETAGGCAG (SEQ ID NO: 22); ii) a sense strand comprising the nucleotide sequence CCETACAUGETErErCErGCErGAU (SEQ ID NO: 23) and an antisense strand comprising the nucleotide sequence
  • AUCAGCAGAAACAUGUAGG SEQ ID NO: 24
  • a sense strand comprising the nucleotide sequence GCAUGGUCAUCAUCAUGGU
  • an antisense strand comprising the nucleotide sequence ACCAUGAUGAUGACCAUGC
  • the shRNA comprises: i) a sense strand comprising a nucleotide sequence that is one, two, or three nucleotides different from SEQ ID NO: 21, and an antisense strand comprising a nucleotide sequence that is one, two, or three nucleotides different from SEQ ID NO: 22; ii) a sense strand comprising a nucleotide sequence that is one, two, or three nucleotides different from SEQ ID NO: 23, and an antisense strand comprising a nucleotide sequence that is one, two, or three nucleotides different from SEQ ID NO: 24; or iii) a sense strand comprising a nucleotide sequence that is one, two, or three nucleotides different from SEQ ID NO: 25, and an antisense strand comprising a nucleotide sequence that is one, two, or three nucleotides different from SEQ ID NO: 26.
  • the shRNA can be delivered using a vector as an shRNA driven by a promoter (e.g., a human Hl RNA promoter).
  • a promoter e.g., a human Hl RNA promoter
  • the vector is a plasmid.
  • the vector is a viral vector, such as an adeno-associated virus (AAV) vector.
  • the vector sequence encoding the shRNA comprises the sequence
  • the promoter driving shRNA expression comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence:
  • the same vector comprises a coding sequence that encodes normal (e.g., wild-type) rhodopsin protein but is resistant to the action of the shRNA expressed by the vector.
  • a normal (e.g., wild-type) rhodopsin (RHO) coding sequence that is hardened to an shRNA as described herein can have a sequence based on the human RHO gene (e.g., having a sequence shown in Accession No. NG_009l l5.l).
  • the normal RHO coding sequence is modified to include one or more (e.g., 2,
  • the RHO coding sequence comprises the sequence GTGGCTTTTTATATATTCA (SEQ ID NO: 11) which may be resistant to an shRNA as described herein.
  • the RHO coding sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 5 below.
  • the RHO coding sequence is driven by a promoter (e.g., a human opsin proximal promoter).
  • the promoter comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:7 below.
  • the vector as described herein comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 6 below.
  • rAAV recombinant adeno-associated virus
  • the rAAV particles comprise a capsid protein as described herein, e.g., an AAV5 capsid protein.
  • the vector contained within the rAAV particle encodes an RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO: 4) and comprises a replacement RHO coding sequence (e.g., comprising the sequence of SEQ ID NO: 5).
  • Recombinant AAV (rAAV) vectors contained within an rAAV particle may comprise at a minimum (a) one or more heterologous nucleic acid regions (e.g., encoding an shRNA and/or a RHO protein) and (b) one or more regions comprising inverted terminal repeat (ITR) sequences (e.g., wild-type ITR sequences or engineered ITR sequences) flanking the one or more heterologous nucleic acid regions.
  • the heterologous nucleic acid region encodes an RNA of interest (e.g., an shRNA comprising the sequence of SEQ ID NO: 4) and comprises a replacement RHO coding sequence (e.g., comprising the sequence of SEQ ID NO: 5).
  • the rAAV vector is between 4kb and 5kb in size (e.g., 4.2 to 4.7 kb in size). This rAAV vector may be encapsidated by a viral capsid, such as an AAV5 capsid.
  • the rAAV vector is single- stranded.
  • the rAAV vector is double- stranded.
  • a double- stranded rAAV vector may be, for example, a self-complementary vector that contains a region of the vector that is complementary to another region of the vector, initiating the formation of the double-strandedness of the vector.
  • the rAAV particle may be of any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2/1, 2/5, 2/8, or 2/9).
  • the serotype of an rAAV particle refers to the serotype of the capsid proteins.
  • the rAAV particle is AAV5.
  • Non-limiting examples of derivatives and pseudotypes include rAAV2/l, rAAV2/5, rAAV2/8, rAAV2/9, AAV2-AAV3 hybrid, AAVrh.lO, AAVhu.l4, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShHlO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.
  • the rAAV particle is a pseudotyped rAAV particle, which comprises (a) a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2) and (b) a capsid comprised of capsid proteins derived from another serotype (e.g., AAV5).
  • rAAV particles and rAAV vectors are also known in the art and commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Numbers US 2007/0015238 and US20120322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.).
  • a plasmid containing the rAAV vector may be combined with one or more helper plasmids, e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (e.g., encoding VP1, VP2, and VP3, including a modified VP3 region as described herein), and transfected into a producer cell line such that the rAAV particle can be packaged and subsequently purified.
  • helper plasmids e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (e.g., encoding VP1, VP2, and VP3, including a modified VP3 region as described herein)
  • the one or more helper plasmids include a first helper plasmid comprising a rep gene and a cap gene (e.g., encoding a rAAV capsid protein as described herein) and a second helper plasmid comprising a Ela gene, a Elb gene, a E4 gene, a E2a gene, and a VA gene.
  • the rep gene is a rep gene derived from AAV2 or AAV5 and the cap gene is derived from AAV2 or AAV5 and may include modifications to the gene in order to produce the modified capsid protein described herein.
  • Helper plasmids and methods of making such plasmids, are known in the art and commercially available (see, e.g., pDM, pDG, pDPlrs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E/R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Diego, CA;
  • helper plasmids are produced or obtained, which comprise rep and cap ORFs for the desired AAV serotype and the adenoviral VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters.
  • the cap ORF may also comprise one or more modifications to produce a modified capsid protein as described herein.
  • HEK293 cells (available from ATCC®) are transfected via CaP04-mediated transfection, lipids or polymeric molecules such as Polyethylenimine (PEI) with the helper plasmid(s) and a plasmid containing a nucleic acid vector described herein. The HEK293 cells are then incubated for at least 60 hours to allow for rAAV particle production.
  • PEI Polyethylenimine
  • Sf9-based producer stable cell lines are infected with a single recombinant baculovirus containing the nucleic acid vector.
  • HEK293 or BHK cell lines are infected with a HSV containing the nucleic acid vector and optionally one or more helper HSVs containing rep and cap ORFs as described herein and the adenoviral VA, E2A (DBP), and E4 genes under the transcriptional control of their native promoters.
  • the HEK293, BHK, or Sf9 cells are then incubated for at least 60 hours to allow for rAAV particle production.
  • the rAAV particles can then be purified using any method known the art or described herein, e.g., by iodixanol step gradient, CsCl gradient, chromatography, or polyethylene glycol (PEG) precipitation.
  • the disclosure also contemplates host cells that comprise an shRNA, a vector, or an rAAV particle as described herein.
  • host cells include mammalian host cells, with human host cells being preferred, and may be isolated, e.g., in cell or tissue culture. In some embodiments, the host cell is a cell of the eye.
  • the disclosure also contemplates host cells that comprise an shRNA, a vector, an rAAV particle, and the mRNA expressed after infection of the host cell by the rAAV particles described herein or transfection by the constructs described herein.
  • the host cells provided herein comprise short mRNA sequences that are different from those found in nature.
  • the host cells comprise short mRNA sequences having at least 95% or 99.5% sequence identity with any one of SEQ ID NOs: 40-46.
  • the host cells may comprise short mRNA sequences comprising the sequence of any one of SEQ ID NOs: 40-46.
  • Such host cells include mammalian host cells, with human host cells being preferred, and may be isolated, e.g., in cell or tissue culture.
  • the host cell is a cell of the eye.
  • Exemplary mammalian cells include human cells, rodent cells and canine cells.
  • the mammalian cells are derived from a human (e.g., a human having or known to have, for example diagnosed as having, retinitis pigmentosa, for example dominant retinitis pigmentosa).
  • a composition which comprises an shRNA, a vector, or an rAAV particle as described herein and optionally a pharmaceutically acceptable carrier.
  • the compositions described herein can be administered to a subject in need of treatment.
  • the subject has or is suspected of having one or more conditions, diseases, or disorders of the brain and/or eye (e.g., retinitis pigmentosa such as dominant retinitis pigmentosa).
  • the subject has or is suspected of having one or more of the conditions, diseases, and disorders disclosed herein (e.g., retinitis pigmentosa such as dominant retinitis pigmentosa).
  • the subject has one or more endogenous mutant rho alleles (e.g., associated with or that cause a disease or disorder of the eye or retina). In some embodiments, the subject has at least one dominant mutant rho allele (e.g., that causes dominant retinitis pigmentosa). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate.
  • Non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus macaques), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans.
  • Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.
  • the dose of rAAV particles administered to a cell or a subject may be on the order ranging from 10 6 to 10 14 particles/mL or 10 3 to 10 15 particles/mL, or any values therebetween for either range, such as for example, about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 particles/mL. In one embodiment, rAAV particles of higher than 10 13 particles/mL are be administered.
  • the dose of rAAV particles administered to a subject may be on the order ranging from 10 6 to 10 14 vector genomes(vgs)/mL or 10 3 to 10 15 vgs/mL, or any values therebetween for either range, such as for example, about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 vgs/mL.
  • rAAV particles of higher than 10 13 vgs/mL are be administered.
  • the rAAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated.
  • 0.0001 mL to 10 mLs are delivered to a subject in a dose.
  • rAAV particle titers range from 1 x l0 10 -5 x 10 13 vg/ml. In some embodiments, rAAV particle titers can be 1 x 10 10 , 2.5 x 10 10 , 5 x 10 10 , 1 x 10 11 , 2.5 x 10 11 , 5 x 10 11 , 1 x 10 12 , 2.5 x 10 12 , 5 x 10 12 , 1 x 10 13 , 2.5 x 10 13 , or 5 x 10 13 vg/mL. In some embodiments, particle titers are less than 1 x 10 10 vg/mL.
  • rAAV particle titers are greater than 1 x 10 15 vg/mL. In one embodiment, rAAV particle titers are greater than 5 x 10 13 vgs/mL. In some embodiments, rAAV particles are administered via methods further described herein (e.g., subretinally or intravitreally).
  • the rAAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated. In some embodiments, the rAAV particles are administered over a period of days or weeks. In some embodiments, from 1 to 500 microliters of a composition (e.g., comprising an rAAV particle) described in this application is administered to one or both eyes of a subject. For example, in some embodiments, about 1, about 10, about 50, about 100, about 200, about 300, about 400, or about 500 microliters can be administered to each eye. However, it should be appreciated that smaller or larger volumes could be administered in some embodiments.
  • the rAAV particles, compositions and methods of treatment disclosed herein preserve the integrity of the structure of rod photoreceptors in the subject, preserve ONL thickness and/or confer protection from degeneration of at least about 12 weeks, at least about 18 weeks, at least about 24 weeks, at least about 30 weeks, at least about 36 weeks, at least about 42 weeks, at least about 48 weeks, at least about 54 weeks, or at least about 60 weeks for retinal structure and function in the subject following a single administration to the eye.
  • the disclosure provides formulations of one or more rAAV- based compositions disclosed herein in pharmaceutically acceptable solutions for
  • rAAV particle or nucleic acid vectors may be administered in combination with other agents as well, such as, e.g., proteins or polypeptides or various pharmaceutically- active agents, including one or more systemic or topical administrations of therapeutic polypeptides, biologically active fragments, or variants thereof.
  • agents such as, e.g., proteins or polypeptides or various pharmaceutically- active agents, including one or more systemic or topical administrations of therapeutic polypeptides, biologically active fragments, or variants thereof.
  • agents e.g., proteins or polypeptides or various pharmaceutically- active agents, including one or more systemic or topical administrations of therapeutic polypeptides, biologically active fragments, or variants thereof.
  • agents e.g., proteins or polypeptides or various pharmaceutically- active agents, including one or more systemic or topical administrations of therapeutic polypeptides, biologically active fragments, or variants thereof.
  • the rAAV particles may thus be delivered along with various other agents as required in
  • Formulation of pharmaceutically-acceptable excipients and carrier solutions is well- known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including e.g., oral, parenteral, intravenous, intranasal, intra- articular, and intramuscular administration and formulation.
  • these formulations may contain at least about 0.1% of the therapeutic agent (e.g., rAAV particle) or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation.
  • the amount of therapeutic agent(s) (e.g., rAAV particle) in each therapeutically-useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound.
  • an shRNA, a vector, or an rAAV particle as described herein in suitably formulated pharmaceutical compositions disclosed herein either subcutaneously, intraocularly, intravitreally, parenterally,
  • subcutaneously intravenously, intracerebro-ventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection to one or more cells, tissues, or organs by direct injection.
  • compositions suitable for injectable use include sterile aqueous solutions or dispersions.
  • the form is sterile and fluid to the extent that easy syringability exists.
  • the form is stable under the conditions of manufacture and storage and is preserved against the contaminating action of
  • the carrier can be a solvent or dispersion medium containing, for example, water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • a coating such as lecithin
  • surfactants for example, water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the shRNA, vector, or rAAV particle as described herein is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum oil such as mineral oil, vegetable oil such as peanut oil, soybean oil, and sesame oil, animal oil, or oil of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers.
  • compositions of the present disclosure can be delivered to the eye through a variety of routes. They may be delivered intraocularly, by topical application to the eye or by intraocular injection into, for example the vitreous (intravitreal injection) or subretinal (subretinal injection) inter-photoreceptor space. In some embodiments, they are delivered to rod photoreceptor cells. Alternatively, they may be delivered locally by insertion or injection into the tissue surrounding the eye. They may be delivered systemically through an oral route or by subcutaneous, intravenous or intramuscular injection.
  • they may be delivered by means of a catheter or by means of an implant, wherein such an implant is made of a porous, non-porous or gelatinous material, including membranes such as silastic membranes or fibers, biodegradable polymers, or proteinaceous material. They can be administered prior to the onset of the condition, to prevent its occurrence, for example, during surgery on the eye, or immediately after the onset of the pathological condition or during the occurrence of an acute or protracted condition.
  • an implant is made of a porous, non-porous or gelatinous material, including membranes such as silastic membranes or fibers, biodegradable polymers, or proteinaceous material.
  • the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, intravitreal, subcutaneous and intraperitoneal administration.
  • a sterile aqueous medium that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” l5th Edition, pages 1035-1038 and 1570-1580).
  • Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations should meet sterility, pyrogenicity, and the general safety and purity standards as required by, e.g., FDA Office of Biologies standards.
  • Sterile injectable solutions may be prepared by incorporating an shRNA, a vector, or an rAAV particle as described herein in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • compositions e.g., comprising an shRNA, a vector, or an rAAV particle as described herein
  • time of administration of such composition will be within the purview of the skilled artisan having benefit of the present teachings. It is likely, however, that the administration of therapeutically-effective amounts of the disclosed compositions may be achieved by a single administration, such as for example, a single injection of sufficient numbers of rAAV particles to provide therapeutic benefit to the patient undergoing such treatment. Alternatively, in some circumstances, it may be desirable to provide multiple, or successive administrations of the composition, either over a relatively short, or a relatively prolonged period of time, as may be determined by the medical practitioner overseeing the administration of such compositions.
  • rod cells remain structurally intact and/or viable upon silencing of cellular rhodopsin gene expression.
  • rods cells in which cellular rhodopsin gene expression is silenced have shortened outer segments which would normally contain rhodopsin.
  • the length of the outer segments can be maintained or restored (e.g., partially or completely) using the exogenously added (hardened) rhodopsin gene, the expression of which is resistant to silencing using the compositions described in this application.
  • administration of a composition described herein to a subject having retinitis pigmentosa preserves the integrity of the structure of rod photoreceptors in the subject, preserves ONL thickness and/or confers protection from degeneration of at least about 12 weeks, at least about 18 weeks, at least about 24 weeks, at least about 30 weeks, at least about 36 weeks, at least about 42 weeks or at least about 48 weeks, at least about 54 weeks, or at least about 60 weeks for retinal structure and function in the subject.
  • retinitis pigmentosa e.g., dominant retinitis pigmentosa
  • To“treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject (e.g., retinitis pigmentosa).
  • the compositions described above are typically administered to a subject in an effective amount, that is, an amount capable of producing a desirable result.
  • an effective amount of a rAAV particle may be an amount of the particle that is capable of transferring a heterologous nucleic acid to a host organ, tissue, or cell.
  • Toxicity and efficacy of the compositions utilized in methods of the disclosure can be determined by standard pharmaceutical procedures, using either cells in culture or experimental animals to determine the LD50 (the dose lethal to 50% of the population).
  • the dose ratio between toxicity and efficacy the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • Those compositions that exhibit large therapeutic indices are preferred. While those that exhibit toxic side effects may be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects.
  • the dosage of compositions as described herein lies generally within a range that includes an ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • Inherited retinal degenerations are caused by mutations in > 250 genes that affect photoreceptor cells or the retinal pigment epithelium and cause vision loss.
  • For autosomal recessive and X-linked retinal degenerations significant progress has been achieved in the field of gene therapy as evidenced by the growing number of clinical trials, and the recent commercialization of the first gene therapy for a form of congenital blindness.
  • adRP autosomal dominant retinitis pigmentosa
  • RHO rhodopsin
  • shRNA short hairpin RNA
  • AAV adeno-associated viral
  • shRNA was combined with a human RHO replacement cDNA made resistant to RNA interference, and this construct (referred to hereafter as“scAPYfUS-RHOsio-shRNAsio”, see FIG. 6) was tested in a naturally- occurring canine model of RHO-adRP.
  • Subretinal vector injections led to near complete suppression of endogenous canine RHO RNA while the human RHO replacement cDNA resulted in up to 30% of normal RHO protein levels.
  • Non-invasive retinal imaging showed complete protection of photoreceptors from retinal degeneration in treated areas.
  • electroretinography indicated stable structural and functional preservation. Efficacy of this gene therapy in a clinically relevant large animal model paves the way for treating patients with RHO-adRP.
  • Such mutation-independent“knockdown and replacement” strategy aims at addressing the high allelic heterogeneity in RHO-adRP, while circumventing the technical and financial challenges that would be inherent in developing multiple gene therapies for individual RHO mutations.
  • the retinal co-delivery of the two components using either two separate(42), or a single AAV vector (41, 43) have been explored in transgenic mice by separate research groups. However complete prevention or arrest of the ongoing rod degeneration was not achieved.
  • shRNAxio a highly effective short hairpin RNA, shRNAxio, was identified that targets human RHO in a mutation-independent manner.
  • shRNAxio a highly effective short hairpin RNA, shRNAxio, was identified that targets human RHO in a mutation-independent manner.
  • AAV adeno-associated viral
  • shRNAsio The most potent shRNA to suppress expression of both WT and mutant (P23H and T17M) human RHO protein in vitro was shRNAsio (FIGs. 1A-1F).
  • shRNAsio codon- modified form of human RHO, RHOsio , that contained four altered nucleotides at
  • shRNAsio degenerate/wobble positions within the target site of shRNAsio was confirmed to be resistant to shRNAsio suppression (FIGs. 1G, 1H). Once confirmed that shRNAsio targeted RHO in a mutation-independent manner, it was selected as the lead knockdown reagent for further evaluation in WT and ///70-mutant dogs.
  • ONL thickness topography in the uninjected WT eye was also relatively homogeneous with incrementally greater values in the central retina supero-temporal to the optic nerve head (ONH), and incrementally smaller values in the non-tapetal areas of superior and inferior retina (FIG. 2A, right column).
  • Lower and intermediate titer injections represented by eyes injected with vector at lxlO 11 vg/mL (FIG. 2B), or 5xl0 u vg/mL (FIG. 2C) showed no qualitative structural changes between the injected and neighboring uninjected regions.
  • retinal locations were systematically sampled (FIG. 12).
  • a great majority of the injected locations for the two lowest titers (lx and 2.5xlO n vg/mL) were comparable to uninjected control eyes with respect to IS/OS intensity and ONL thickness (FIGs. 2D, 2E, upper panels).
  • a great majority of the injected locations for the two highest titers (lOxlO 11 and 50xl0 n vg/mL) showed reduced IS/OS intensity expected from RHO knockdown (FIG. 2D) and some ONL thickening suggesting photoreceptor stress (FIG. 2E).
  • Table 1 Summary of the experimental procedures performed in dogs.
  • LE light exposure protocol
  • OD right eye
  • OS left eye
  • F female
  • M male
  • IVit male
  • subRPE under the retinal pigment epithelium
  • cSLO confocal scanning laser ophthalmoscopy
  • OCT optical coherence tomography
  • RN A/Protein Quantification of rhodopsin RNA and protein levels
  • ERG electroretinography
  • H&E histology with hematoxylin & eosin staining
  • IHC immunohistochemistry.
  • Subretinal injections of ANV-shRNA820-RHOs20 were performed in eight // /70-mutant eyes at the previously determined optimal titer of 5xl0 u vg/mL (Table 1, group H).
  • In all four eyes there was substantial retention of ONL thickness 2 weeks after light exposure FIGs. 4A, 4B; FIGs. 14A, 14B). Most significantly, all four eyes had in the treated area a detectable IS/OS signal.
  • Structural analysis of photoreceptors by IHC (FIGs.
  • FIGs. 14C, 14D confirmed the in vivo results: in treated areas a normal number of photoreceptor cell bodies was retained in the ONL, and rod outer segments were detected. Preservation of elongated rod outer segments was associated with improved morphology of cone inner and outer segments.
  • Four contralateral eyes that had been injected with a similar dose of ANV-shRNA820-RHOs20 but not light exposed were collected at similar time-points (9 and 13 weeks post-injection), and processed for RHO RNA and protein quantification in treated and untreated areas (FIG. 4E). As anticipated, canine RHO RNA (FIG. 4F) at 9 weeks post-injection was considerably reduced in the treated areas (15-16% of that found in untreated areas) of the two eyes.
  • Electroretinography (ERG) measurements were performed 2.1 - 2.4 weeks after each light exposure to assess retinal function (FIG. 5A, upper row, timeline).
  • ERGs showed consistently better rod- and cone-mediated function in the AAV -shRNAsio-RHO sio treated eye FIG. 5C, solid line traces) versus the contralateral BSS-injected eye (FIG. 5C, dashed line traces) of a 77770-mutant dog; substantial ERG asymmetry was present between vector and BSS-treated eyes, and the asymmetry increased after each light exposure (FIG. 5C).
  • amplitudes of rod-dominated ERG traces showed a tendency to decrease over time in both the AAV and BSS injected eyes, likely due to continued photoreceptor degeneration occurring in the peripheral retina outside treatment areas (FIG. 5D, upper panel). Cone function appeared overall to be more stable throughout the 37 week post injection period with four intervening light exposures (FIG. 5D, lower panel). Importantly, at each time point, there were substantially greater rod and cone responses in treated eyes.
  • AAV-shRNAx2o-RHOx2o preserves the integrity of the entire structure of rod photoreceptors, and confers protection of up to 37 weeks of retinal structure and function from the degeneration that otherwise rapidly occurs in untreated RHO ⁇ mutant eyes.
  • the efficiency of AAV2/5 -Rz525 at reducing expression of endogenous canine RHO at the RNA level was measured only in the eye injected with the highest titer (50xl0 n vg/mL). In the treated area there was complete silencing of RHO expression at the RNA level (FIG.
  • Rz525 was subsequently tested in five heterozygous // /70-mutant eyes (Table 1, group F) that were subretinally-injected with AAV2/5-/3 ⁇ 4525 at either 20xl0 n (3 eyes) or lOOxlO 11 vg/mL (2 eyes). An additional mutant eye was injected with BSS and served as a negative control. At 8 weeks post injection, prominent silencing of RHO expression was seen with the highest titer (lOOxlO 11 vg/mL) both at RNA (13% remaining) and protein (0.1% remaining) levels in the treated area of EM396-OD (FIGs. 10A-10C).
  • Table 2 Codon frequency ( per thousand) at target site of WT RHO and at codon- modified resistant site of hRHO820 (based on Codon Usage Database, kazusa.or.jp/codon/).
  • a knockdown reagent ( shRNA ) that had been shown to reduce expression of WT human RHO in cell culture (FIGs. 1A-1H) was packaged in an AAV2/5 vector and subretinally injected in two WT canine eyes at 10 and 50xl0 n vg/mL titers (FIG. 11 A; Table 1, group B).
  • the efficiency of WY2/5-shRNAi 3i at reducing expression of endogenous canine RHO both at the RNA and protein level was limited. Even with the highest titer (50xl0 n vg/mL) there was still 50% of normal levels of endogenous canine RHO RNA (FIG. 11B) and 70% of endogenous canine RHO protein (FIG. 11C) remaining within the treated areas 8 weeks post-injection. As a result, further investigations in dogs on the use of shRNA as a potential candidate for RHO suppression were not pursued.
  • the efficacy of the AAV2/5 vector over a period of fifty weeks was evaluated in mutant RHO t4r/+ canines.
  • Ability of the vector to confer stable protection of photoreceptors against light- induced retinal degeneration in untreated RHO t4r/+ dog retinas was evaluated structurally by OCT and IHC and functionally by ERG.
  • OCT and ERG examination were conducted during the course of the study.
  • retinal tissues were processed for IHC. An illustration of the experimental design is shown in FIG. 17.
  • FIGs. 18A-18D show representative ERG traces of rod (-1.7 log cd.s.m 2 ), mixed rod-cone (0.51 log cd.s.m 2 ) recorded dark-adapted, and cone responses to single stimuli (0.51 log cd.s.m 2 ) or 29-Hz cone flicker (0.26 log cd.s.m 2 ) recorded light-adapted, at ⁇ 2 weeks after each light exposure event in a dog injected in one eye with scAA V2/5-hOP-////G,s 2 -H 1 -.shRNAtoo (dotted line) and with BSS (solid line) in the contralateral eye.
  • the four RHO- mutant dogs were injected in one eye with scAAV2/5 -RHOsio- shRNAsio (horizontal line shading) and in the contralateral eye with BSS (diagonal line shading) at similar time-points as shown.
  • Longitudinal quantification of maximal amplitudes of rod b-wave, mixed rod-cone a- and b-waves, and of cone lHz and 29Hz flicker responses are displayed in FIGs. 19A-19C.
  • the electrical response from photoreceptors is termed the a- wave and the electrical response from the bipolar cells of the retina is termed the b-wave.
  • OCT analysis showed preservation of outer nuclear layer (ONL) thickness in the AAV-treated areas while no protection was seen outside of the treated areas nor in the BSS- treated regions.
  • ONL thickness maps and inner segment-outer segment (IS/OS) intensity maps are shown in FIGs. 20A-20D prior to injection (pre-inj.), 12 weeks post- injection (before the first light exposure event), and 50 weeks post-injection (2 weeks after the fourth light exposure event).
  • a rhodopsin (RHO)/human cone arrestin (hCA) co-immunolabeled retinal cryosection from a RHO-mutant dog illustrates the morphology of the outer nuclear layer (ONL) and outer segments (OS) in untreated and treated areas of the same eye (see FIG. 21).
  • the ONL thickness maps in the lower panel of FIG. 21 shows the approximate location (asterisk) of the retinal untreated and treated areas shown in the upper panel.
  • the transition zone between treated and untreated areas of the eye is shown for reference.
  • results show that the A A V2/5-hOP-////(3 ⁇ 4 22 -H 1 -shRNAxio construct confers stable structural protection of photoreceptors against light-induced retinal degeneration up to 50 weeks post-injection in a canine model of RHO-adRP.
  • results further show that the A A V2/5-hOP-A , /7CL' 2 o-H 1 -shRNAwo construct confers stable functional (electroretinography) protection of photoreceptors against light-induced retinal degeneration up to 50 weeks post injection in a canine model of RHO-adRP.
  • knockdown and replacement components when both knockdown and replacement components are co-delivered in the same viral vector, they provide increased efficacy and a better safety profile than when delivered separately. Rapid assessment of gene therapy efficacy in a naturally-occurring large animal model of RHO-adRP
  • the RHO T4R mutant dog was used, which is the only naturally-occurring model of R//(9-adRP(56). Besides its translational value for its human-sized eye, and its phenotypic similarities with Class B patients (56), the RHO T4R/+ dog expresses equal amounts of mutant and WT RHO proteins(57). Both forms traffic normally to the rod outer segments(57) and sustain normal retinal structure and function until progressive areas of photoreceptor loss are detected in the inferior-temporal (FIGs. 15A-15C) and central retina (56) within the first two years of life.
  • Sensitivity to light which has been recognized in other models of RHO-adRP (47) and suspected in Class B patients (19, 45, 58-60), has been well characterized in the canine RHO T4R model.
  • RHO-adRP RHO-adRP
  • a light exposure protocol was previously developed to experimentally trigger a rapid and synchronized loss of photoreceptors and accelerate the natural disease course.
  • RHO- mutant (but not WT) dogs undergo a complete loss of rods in the central to mid-peripheral retina within two weeks following an acute (1 minute) light exposure using intensity levels encountered in clinical patient settings.
  • this“disease-acceleration” approach was used to obtain a rapid read-out of the effect of gene therapy intervention on preventing rod degeneration in RHO- mutants.
  • RHO suppression the need for a potent knockdown component
  • Evidence from several animal model studies suggests that a toxic gain-of-function mechanism is associated with a number of RHO mutations including P23H(55, 61, 62) Tl7M(63, 64) and T4R/T4K(45, 64). This toxicity may be exacerbated following exposure to light in many RHO-adRP models including the /7770-mutant dog (47).
  • the T4R mutation produces a protein that is highly toxic once bleached, but stable when bound to chromophore (57), and that efficient protection of rods would require significant knockdown of the mutant transcript.
  • This study examined the efficiency of several RHO knockdown reagents including three shRNAs and a
  • hammerhead ribozyme with the goal of identifying the most potent reagent capable of suppressing RHO expression.
  • Rz525 tested in the 77770-mutant dog produced a 64% reduction in endogenous canine RHO protein that was not sufficient to confer protection from light- induced retinal degeneration (FIGs. 10C-10D). This confirmed the high toxicity of the native mutant T4R protein, since remaining amounts as low as 18% of physiological levels of RHO were sufficient to cause disease in a heterozygous mutant retina, and argued for the need to achieve more efficient suppression.
  • Hl RNA polymerase III promoter used in the vector is considered safer that the more potent U6 promoter, which leads to a very high level of shRNA expression and, potentially, to saturation of the processing system for endogenous miRNAs. Nevertheless, Hl RNA is expressed abundantly, and the promoter used here functions in all cell types tested. (72, 73) This could explain why at 9 weeks post-injection there was already prominent reduction ( ⁇ 84%) of endogenous RHO RNA levels while RHOsio RNA levels reached only 5-9% of normal (FIGs. 4F-4G).
  • Example 2 The construct can protect against retinal degeneration in mice
  • the ANV-shRNA820-RHO820 construct provided long-term protection against retinal degeneration in a mouse model of RHO-adRP.
  • mice transgenic for human P23H RHO are subject to retinal degeneration due to the presence of the mutant rhodopsin gene, even in the presence of dim red lighting without exposure to bright light (33,34,43).
  • mice of this genotype were treated with a subretinal injection of either AAV2/5-GFP or sc A A V 2/5 -RHOs 2 o-shRNA 820 into one eye.
  • the two groups of mice were analyzed at varying intervals: a) pre-treatment, b) 1 month post-injection, c) 2 months post-injection, and d) 3 months post-injection.
  • Subretinal injection induced temporary retinal detachment that ultimately resolved. Contralateral eyes were not treated.
  • ONL thickness was substantially reduced 2 months and 3 months post-injection relative to pre-treatment.
  • treatment with sc A A V 2/5- RHOs 2 o-shRN A 820 led to a statistically significant preservation of ONL thickness relative to AAV2/5-GFP treatment at all post injection intervals (see FIG. 22).
  • HEK293T cells were transfected with the sc A A V 2/5- RHO.vo-shRN A H 2 ⁇ > construct. 48 hours later, total RNA was extracted. Extracted RNA was size fractionated and short RNA sequences were subjected to RNA sequencing. RNA molecules with sequences derived from shRNA820were analyzed to determine their sizes and 5’ and 3’ ends (see FIG. 24). The summary of the sequencing reads is shown in FIG. 25. The sequence of the 5’ end of the guide strand (UAG) in 73% of the RNA molecules was equivalent to the expected sequence. 13% of the molecules were shortened by one nucleotide at the 5’ end.
  • SEQ ID NOs: 40-46 are provided as the sequences of the most frequent short RNAs derived from shRNAxio (top hits from both strands).
  • a number of gene augmentation strategies are entering clinical trials for the treatment of inherited retinal blindness.
  • Gene therapy for autosomal dominant diseases faces significant obstacles that include allelic heterogeneity and the potential need to silence the mutated gene.
  • a single gene therapy vector that combines knockdown of the causative gene with its replacement by a resistant wild type copy can prevent photoreceptor cell death and vision loss in canine and mouse models of autosomal dominant retinitis pigmentosa.
  • HEK293T cells (CRL- 11268, ATCC, Manassas, VA) were transfected with the dual luciferase plasmid psiCHECKTM-2 (Promega, Madison, Wi) expressing a 100 nucleotide target region of either wild type or resistant (hardened) human RHO cDNA linked to the Renilla luciferase expressed by the SV40 promoter. RHO transcript levels were measured in six replicates by luciferase assay. The luciferase plasmid was co-transfected with a plasmid expressing Rz525 from the tRNAval promoter. Results were normalized to the same fusion transcript measured following co-transfection with a plasmid lacking ribozyme.
  • a plasmid containing the CMV-promoter, the human WT -RHO open reading frame (ORF) with a C-terminal turboGFP tag, and BGH-PolyA signal (also encoding ampicillin resistance and neomycin resistance genes) was used to express RHO in vitro.
  • P23H RHO, T17M RHO, and RHOsio versions of the CMV-hRHO-turboGFP-BGH-PolyA plasmid were created using the Q5® Site-Directed Mutagenesis Kit (New England Biosciences, Ipswich, MA., USA) according to the manufacturer’s instructions, except with the PCR parameters described here.
  • the 23 rd codon of the hRHO ORF of the CMV-hRHO-turboGFP-BGH-PolyA plasmid was changed from CCC to CAC with the following primers: Forward - CACACCCGTCGCATTGGA (SEQ ID NO: 30), and Reverse - GTACGCAGCCACTTCGAGTAC (SEQ ID NO: 31).
  • nucleotides 816 to 825 of the hRHO ORF in the CMV-hRHO-turboGFP-BGH-PolyA plasmid were changed from ATTCTACATC (SEQ ID NO: 32) to TTTTTATATA (SEQ ID NO: 33) with the following primers: Forward: ATATATTCACCCACCAGGGCTCCAAC (SEQ ID NO: 34), and Reverse: AAAAAGCCA CGCTGGCGTAGGGC (SEQ ID NO: 35).
  • the PCR reaction parameters were as follows: initial denaturation at 98°C for 30 seconds, 25 cycles of denaturation (98°C for 10 seconds, annealing for 30 seconds, extension at 72°C for 5 minutes), final extension at 72°C for 2 minutes.
  • the annealing temperatures used for the P23H RHO and RHOsio PCR reactions were 68° and 72°C, respectively.
  • 25 pg of the CMV- hRHO-turboGFP-BGH-PolyA plasmid was used as the template for each reaction.
  • the AAV- T17M-GFP was a gift of Dr. Marina Gorbatyuk.(76)
  • HEK293T cells (ATCC) were seeded in a l2-well plate and transfected the following day when the cells reached 70-90% confluency.
  • 500 ng of the CMV-hRHO- turboGFP-BGH-PolyA plasmid expressing either wild-type human RHO, human P23H RHO, human T17M RHO, or RHOsio was transiently co-transfected with lpg of a self
  • the medium was aspirated, and the cells were re-suspended in phosphate buffered saline (PBS) and pelleted by centrifugation at 3,000xg. The PBS was then removed and the cells were re-suspended and sonicated in l50pL of 0.23M sucrose in PBS. 50pL of loading buffer (200 mM Tris-Cl pH 6.8 + 400 mM DTT + 8% SDS + 40% glycerol + bromophenol blue) was applied to each sample and mixed by pipetting. The samples were incubated at room temperature for 30 minutes before being passed through a 28 gauge insulin syringe to shear co-extracted DNA.
  • PBS phosphate buffered saline
  • the total protein concentration of each sample was measured using the PierceTM 660nm Protein Assay Reagent and the Pierce Ionic Detergent Compatibility Reagent (Thermo Fisher, Waltham, MA., USA). The amount of total protein loaded in to each well (15-20 pg) was constant within each experiment.
  • the samples were run on a 10% Mini-PROTEAN ® TGXTM Precast Protein Gels (Biorad, Hercules, CA., USA) adjacent to the Li-COR Chameleon ladder (Li-Cor, Lincoln, NE, USA) and transferred to a iBlot PVDF Transfer Stack using Invitrogen’s iBlot system (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.
  • Membranes were incubated with methanol for 5 minutes, washed with diH 2 0 3 times, and blocked for 1 hour at room temperature with Odyssey blocking buffer (Li-Cor, Lincoln, NE, USA). Membranes were then incubated with mouse anti-TurboGFP (1:2000; Origene, Rockville, MD, USA) and rabbit anti- b -tubulin (1:5000; Millipore, Burlington, MA, USA) in blocking buffer overnight at 4°C, and washed three times with 0.1% Tween20 in PBS before incubation with IRDye 800CW donkey-anti-rabbit and IRDye 680RD goat-anti-mouse (Both 1:5,000; Li-Cor, Lincoln, NE, USA) for 45 minutes at room temperature.
  • Odyssey blocking buffer Li-Cor, Lincoln, NE, USA
  • Membranes were washed three times with 0.1% Tween20 in PBS and imaged with an Odyssey CLx system (Li-Cor, Lincoln, NE, USA). Band intensity was measured with the ImageJ software. To measure the band intensity of the predicted monomeric form of RHO-GFP, a box was drawn around the prominent band appearing at ⁇ 65kDa whereas the aggregated forms were measured using a box drawn from the highest molecular weight marker (260kDa) to the visible band just below 50kDa. Band intensity of RHO was corrected for loading by measuring and dividing by the band intensity of b-tubulin. Values were reported as relative intensity, which was calculated as the corrected band intensity of each sample divided by the average corrected band intensity for the control shRNA condition. Statistical significance was determined via one-way ANOVA followed by Tukey’s multiple comparisons test.
  • Adeno-associated virus (AAV) vectors with type 2 terminal repeats (TRs) were packaged in serotype 5 capsids as described by Zolotukhin et al. (2002).
  • AAV5 capsids permit efficient transduction of photoreceptor cells following subretinal injection.
  • Vectors designed to knockdown human and canine rhodopsin without replacement contained a 488 bp region (positions 916-1396) of the mouse Rho gene (GenBank M55171.2) and a humanized GFP gene cloned in reverse orientation. This orientation was used to provide a spacer for efficient packaging of AAV without over-expression of GFP.
  • a 536 bp region positions 4547-5083 from the human RHO gene (GenBank Accession number NG_009l 15.1) was employed as the human rhodopsin proximal promoter (hOP).
  • the promoter was followed by a 163 synthetic intron (SD/SA) from SV40 which preceded 125 base pairs from the RHO 5’ UTR the human RHO cDNA (1046 nt), or a codon-modified version ( RHOsio ) made resistant to shRNAsm (see below). This was followed by a polyadenylation signal from SV40.
  • SD/SA 163 synthetic intron
  • RHOsio codon-modified version
  • shRNA sense and antisense sequences are shown below, which in each case were connected with the loop sequence UUCAAGAGA (SEQ ID NO: 3).
  • AAV2/5 vectors for shRNA expression were packaged as self-complementary AAV(77) and expression of shRNAs was directed by the human Hl RNA promoter
  • the shRNAs contained 19 bp of double stranded sequence connected by a 9 nucleotide loop (UUCAAGAGA, encoded by the sequence TTCAAGAGA).
  • efficient packaging required maintenance of at least 2.2 kb of DNA between the terminal repeat sequences of AAV.
  • sequence of humanized GFP (80) was inserted in reverse orientation behind either the mouse opsin proximal promoter or the human opsin proximal promoter (see above).
  • shRNAsio and a human rhodopsin cDNA ( RHOsio ) made resistant to shRNAsio by introducing silent mutations in the target sequence were packaged together as self complementary AAV2/5.
  • a self-complementary construct was chosen to accelerate the rate of RHO replacement (with RHOsio ) in order to preserve, or rapidly reform rod outer segment structure in the context of a highly efficient KD reagent (shRNAsio).
  • All normal (WT dogs) were housed under standard kennel cyclic (12 hours ON, 12 hours OFF) white light illumination (175-350 lux at the level of the“standard” dog eye).
  • All RHO mutant dogs studied were heterozygous for the T4R mutant allele, and are referred to in text as RHO mutants, and as RHO t4r/+ in Table 1 and in the figures to emphasize the heterozygosity.
  • All but 3 mutant RHO dogs were housed under cyclic dim red illumination (9-20 lux at the level of the“standard” dog eye) from birth until termination to prevent any acceleration of retinal degeneration triggered by environmental white light. All
  • Subretinal injections of BSS or vector were performed under direct visualization through an operating microscope (Zeiss OPMI 6; Carl Zeiss Inc, Oberkochen, Germany) and a contact vitrectomy lens using a subretinal cannula as previously reported(65)
  • an operating microscope Zeiss OPMI 6; Carl Zeiss Inc, Oberkochen, Germany
  • a contact vitrectomy lens using a subretinal cannula as previously reported(65)
  • dim red illumination was set up in the operating room, and subretinal injections were performed under near infrared light using an infrared bandpass filter (RT-830; Hoya Optics, Inc, Fremont, California) placed in the operating miscroscope’s light path and monocular infrared image intensifiers (Owl Nitemare Third generation: BE Meyers & Co,
  • This night vision system allows the surgeon to perform subretinal injections in the light-sensitive RHO mutant dogs without causing any surgical light-induced retinal degeneration.
  • Successful subretinal injection of a -150 uL volume produced a bleb that covered -15% of the retinal surface. The location of the subretinal bleb was recorded immediately after each injection. This was done in normal dogs by fundus photography (Retcam shuttle, Clarity Medical Systems, Pleasanton, CA), and in // /0-mutant dogs by drawings of the bleb on near infrared cSLO composite images captured prior to the injection.
  • a one minute exposure to white (6500K) light at a comeal irradiance of 1 mW/cm 2 was performed using a monocular Ganzfeld stimulator (ColorBurst; Diagnosys LLC, Lowell, MA, USA) from an ERG system (Espion, Diagnosys LLC). Eyes that were not exposed were kept shielded with a black photographic cloth during the light exposure procedure in the contralateral eye.
  • OCT optical coherence tomography
  • Enface and retinal cross-sectional imaging was performed with the dogs under general inhalation anesthesia as described above. Overlapping enface images of reflectivity with near-infrared illumination (820 nm) were obtained (Spectralis HRA+OCT, Heidelberg, Germany) with 30° and 55° diameter lenses to delineate fundus features such as optic nerve, retinal blood vessels, boundaries of injection blebs, retinotomy sites and other local changes. Custom programs (MatLab 7.5; The MathWorks, Natick, MA) were used to digitally stitch individual photos into a retina-wide panorama. Two methods were used to overlay injection blebs onto panoramic images. In WT eyes, photos of blebs taken at the time of the surgery were registered and bleb boundaries were transferred. In RHO- mutant eyes, sketches of blebs drawn at the time of the surgery were transferred onto panoramic images.
  • SD-OCT Spectral-domain optical coherence tomography
  • Spectralis HRA+OCT Spectralis HRA+OCT, Heidelberg, Germany
  • Overlapping (30°x20°) raster scans were recorded covering large regions of the retina.
  • Post-acquisition processing of OCT data was performed with custom programs (MatLab 7.5; The MathWorks, Natick, MA).
  • integrated backscatter intensity of each raster scan was used to locate its precise location and orientation relative to retinal features visible on the retina wide panorama.
  • LRPs longitudinal reflectivity profiles
  • OPL outer plexiform layer
  • ELM external limiting membrane
  • the normalized IS/OS backscatter intensity was calculated by subtracting the mean backscatter intensity of the 5 axial samples vitreal to the OPL boundary from the mean backscatter intensity of the 5 axial samples scleral to the ELM boundary; the latter included the IS/OS peak.(44, 74) IS/OS intensities were only mapped in regions of retained inner and outer segment length since compromise of the latter made it impossible to distinguish the IS/OS signal from the RPE/tapetum signal. Topographic results from uninjected control eyes were registered by the center of the ONH and the canine fovea(83) and maps of control variability were generated defining the 99 th percentile confidence intervals. Injected eyes were compared locus-by-locus to the control confidence intervals to generate maps of significant change.
  • Waveforms were processed with a digital low-pass (50 Hz) filter to reduce recording noise if necessary. Amplitudes of the a- and b- waves of the scotopic mixed rod-cone ERG, and the peak to peak amplitudes of the photopic single flash and 29.4 Hz cone flicker were measured.
  • rod opsin (cat#
  • MAB5316 1:200 dilution; EMD Millipore, Billerica, MA), goat anti-human cone arrestin (W. Beltran, Univ. of Pennsylvania; 1:100).
  • the antigen-antibody complexes were visualized with fluorochrome-labeled secondary antibodies (Alexa Fluor, 1:200; Molecular Probes, Kalamazoo, MI), and Hoechst 33342 nuclear stain (Molecular Probes) was used to label cell nuclei.
  • H&E-stained sections were examined by widefield microscopy (Axioplan; Carl Zeiss Meditec, Dublin, CA), and the images were digitally captured (Spot 4.0 camera; Diagnostic Instruments, Sterling Heights, MI) and imported into a graphics program (Illustrator; Adobe, San Jose, CA) for display.
  • Sections labeled for fluorescent immunohistochemistry were examined by confocal microscopy (Leica TCS SP5; Leica Microsystems, Buffalo Grove, IL), and digital images were taken, processed using the Leica Application suite program, and imported into a graphics program (Illustrator; Adobe).
  • TAGGTTGAGCAGGATGTAGTTGAGA (SEQ ID NO: 20)).
  • the SYBR green platform was used for the analysis using a primer concentration of 0.15 mM.
  • Real-time PCR was performed in a total volume of 25 pL in 96-well microwell plates on the Applied Biosystems 7500 Real-Time PCR System. All PCRs were performed using cDNA generated from 0.1 ng DNAase-treated RNA. The RT-PCR product was used for construction of an absolute standard curve for individual amplicons representing the canine and human RHO. The number of copies of a template was calculated as previously described. (82) The dynamic range of the calibration curves was between 10 3 and 10 7 molecules. Amplification data were analyzed with the 7500 Software version 2.0.1 (Applied Biosystems).
  • Protein retinal extracts were prepared from 3 mm biopsy punches collected (under dim red illumination for RHO mutant dogs) from treated and untreated neuroretinal areas. After sonication in a buffer containing 0.23M Sucrose, 2 mM EDTA, 5mM TrisHCl, pH 7.4, and protease inhibitors (Halt Protease Inhibitor cocktail, cat. No. 87786, Thermo Fisher Scientific, Waltham, MA.), samples were centrifuged and total protein concentration in the supernatant was measured by the Bradford method.
  • Jacobson SG Phenotypes of stop codon and splice site rhodopsin mutations causing retinitis pigmentosa. Invest Ophthalmol Vis Sci 35(5):252l-2534. Cideciyan AV, et al. (1998) Disease sequence from mutant rhodopsin allele to rod and cone photoreceptor degeneration in man. Proc Natl Acad Sci U S A 95(12):7103- 7108.
  • Rhodopsin targeted transcriptional silencing by DNA-binding. eLife 5:el2242.
  • Rhodopsin mutant P23H destabilizes rod photoreceptor disk membranes.
  • inventive embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed.
  • inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
  • a reference to“A and/or B”, when used in conjunction with open-ended language such as“comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
  • “or” should be understood to have the same meaning as“and/or” as defined above.
  • “or” or“and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as“only one of’ or“exactly one of,” or, when used in the claims,“consisting of,” will refer to the inclusion of exactly one element of a number or list of elements.
  • the phrase“at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
  • This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase“at least one” refers, whether related or unrelated to those elements specifically identified.
  • “at least one of A and B” can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Ophthalmology & Optometry (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
PCT/US2019/035159 2018-06-01 2019-06-03 Compositions and methods for treatment of dominant retinitis pigmentosa Ceased WO2019232517A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN201980036506.9A CN112204145B (zh) 2018-06-01 2019-06-03 用于治疗显性视网膜色素变性的组合物和方法
AU2019276645A AU2019276645B2 (en) 2018-06-01 2019-06-03 Compositions and methods for treatment of dominant retinitis pigmentosa
CN202410254122.7A CN118480544A (zh) 2018-06-01 2019-06-03 用于治疗显性视网膜色素变性的组合物和方法
CA3102095A CA3102095A1 (en) 2018-06-01 2019-06-03 Compositions and methods for treatment of dominant retinitis pigmentosa
JP2020567085A JP7563694B2 (ja) 2018-06-01 2019-06-03 優性網膜色素変性症の処置のための組成物および方法
EP19812143.6A EP3802836A4 (en) 2018-06-01 2019-06-03 COMPOSITIONS AND METHODS FOR THE TREATMENT OF DOMINANT RETINITIS PIGMENTOSA
US17/059,815 US12203074B2 (en) 2018-06-01 2019-06-03 Compositions and methods for treatment of dominant retinitis pigmentosa
IL279091A IL279091B1 (en) 2018-06-01 2020-11-30 Compositions and methods for treating dominant retinitis pigmentosa
US18/976,035 US20250215437A1 (en) 2018-06-01 2024-12-10 Compositions and methods for treatment of dominant retinitis pigmentosa

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201862679585P 2018-06-01 2018-06-01
US62/679,585 2018-06-01
US201962809539P 2019-02-22 2019-02-22
US62/809,539 2019-02-22

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/059,815 A-371-Of-International US12203074B2 (en) 2018-06-01 2019-06-03 Compositions and methods for treatment of dominant retinitis pigmentosa
US18/976,035 Continuation US20250215437A1 (en) 2018-06-01 2024-12-10 Compositions and methods for treatment of dominant retinitis pigmentosa

Publications (1)

Publication Number Publication Date
WO2019232517A1 true WO2019232517A1 (en) 2019-12-05

Family

ID=68698456

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/035159 Ceased WO2019232517A1 (en) 2018-06-01 2019-06-03 Compositions and methods for treatment of dominant retinitis pigmentosa

Country Status (8)

Country Link
US (2) US12203074B2 (https=)
EP (1) EP3802836A4 (https=)
JP (1) JP7563694B2 (https=)
CN (2) CN112204145B (https=)
AU (1) AU2019276645B2 (https=)
CA (1) CA3102095A1 (https=)
IL (1) IL279091B1 (https=)
WO (1) WO2019232517A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021212686A1 (zh) * 2020-04-21 2021-10-28 北京中因科技有限公司 RHO-adRP基于基因编辑的方法和组合物
US20220098615A1 (en) * 2020-09-30 2022-03-31 NGGT, Inc. Dual functional expression vectors and methods of use thereof
CN114521214A (zh) * 2020-07-24 2022-05-20 尔知渃米斯股份有限公司 视紫红质转录体特异性反式剪接核酶及其用途
WO2024211266A1 (en) * 2023-04-07 2024-10-10 University Of Houston System Downregulation of rhodopsin as a therapeutic strategy for peripherin-2-associated inherited retinal disorders

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7334346B2 (ja) * 2020-07-24 2023-08-28 アールズィーノミクス・インコーポレイテッド ロドプシン転写体に特異的なトランススプライシングリボザイム及びその用途

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016138353A1 (en) * 2015-02-26 2016-09-01 Ionis Pharmaceuticals, Inc. Allele specific modulators of p23h rhodopsin
WO2017151823A1 (en) * 2016-03-01 2017-09-08 University Of Florida Research Foundation, Inc. Aav vectors for treatment of dominant retinitis pigmentosa
US20170348387A1 (en) * 2016-02-29 2017-12-07 The Trustees Of The University Of Pennsylvania Aav-mediated gene therapy for nphp5 lca-ciliopathy

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8551970B2 (en) 1996-04-02 2013-10-08 Optigen Patents Limited Genetic suppression and replacement
US20040234999A1 (en) 1996-04-02 2004-11-25 Farrar Gwenyth Jane Genetic suppression and replacement
GB9606961D0 (en) 1996-04-02 1996-06-05 Farrar Gwyneth J Genetic strategy III
WO2004022722A2 (en) * 2002-09-06 2004-03-18 Massachusetts Institute Of Technology Lentiviral vectors, related reagents, and methods of use thereof
CA2522730A1 (en) 2003-04-18 2004-11-04 The Trustees Of The University Of Pennsylvania Compositions and methods for sirna inhibition of angiopoietin 1 and 2 and their receptor tie2
US20070009899A1 (en) 2003-10-02 2007-01-11 Mounts William M Nucleic acid arrays for detecting gene expression in animal models of inflammatory diseases
EP1735442A2 (en) 2004-03-24 2006-12-27 Oncotherapy Science, Inc. Compositions and methods for treating pancreatic cancer
US20080221057A1 (en) 2007-02-16 2008-09-11 Wyeth Secreted protein ccdc80 regulates adipocyte differentiation
US8257969B2 (en) 2007-04-12 2012-09-04 The Provost Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Genetic suppression and replacement
US20110129825A1 (en) 2007-08-03 2011-06-02 Melba Stinnett Ketchum Compositions, methods and systems for the simultaneous determination of parentage, identity, sex, genotype and/or phenotype and breed determination in animals
US8450473B2 (en) * 2009-04-30 2013-05-28 The Research Foundation Of State University Of New York Compositions and methods for therapy of macular degeneration
CN102061308B (zh) 2010-10-29 2013-05-08 北京未名凯拓作物设计中心有限公司 一种用百草枯筛选转基因植物的方法
CN102061305B (zh) * 2010-12-15 2012-07-18 深圳市百恩维生物科技有限公司 一种多ShRNA高效协同沉默基因方法及载体
US20130064815A1 (en) 2011-09-12 2013-03-14 The Trustees Of Princeton University Inducing apoptosis in quiescent cells
EP2855684A1 (en) 2012-05-25 2015-04-08 Commissariat à l'Énergie Atomique et aux Énergies Alternatives Vector for the selective silencing of a gene in astrocytes
WO2014138792A1 (en) 2013-03-14 2014-09-18 Commonwealth Scientific And Industrial Research Organisation Double-stranded rna
EP3071592B1 (en) 2013-11-20 2021-01-06 Fondazione Telethon Artificial dna-binding proteins and uses thereof
FI3628334T3 (fi) 2014-03-21 2023-09-15 Genzyme Corp Geenihoito verkkokalvon pigmenttirappeuma
IL248102B (en) * 2014-05-02 2022-07-01 Genzyme Corp aav vectors for gene therapy of the central nervous system and retina
PL3265568T3 (pl) 2015-03-06 2020-11-30 Massachusetts Eye & Ear Infirmary Terapie augmentacji genów w przypadku wrodzonego zwyrodnienia siatkówki spowodowanego mutacjami genu prpf31
EP3289080B1 (en) 2015-04-30 2021-08-25 The Trustees of Columbia University in the City of New York Gene therapy for autosomal dominant diseases
WO2017137493A1 (en) 2016-02-09 2017-08-17 Fondazione Telethon Synthetic promoters and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016138353A1 (en) * 2015-02-26 2016-09-01 Ionis Pharmaceuticals, Inc. Allele specific modulators of p23h rhodopsin
US20170348387A1 (en) * 2016-02-29 2017-12-07 The Trustees Of The University Of Pennsylvania Aav-mediated gene therapy for nphp5 lca-ciliopathy
WO2017151823A1 (en) * 2016-03-01 2017-09-08 University Of Florida Research Foundation, Inc. Aav vectors for treatment of dominant retinitis pigmentosa

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FROEBEL, BR ET AL.: "Effects of Pathogenic Variations in the Human Rhodopsin Gene (hRHO) on the Predicted Accessibility for a Lead Candidate Ribozyme", INVESTIGATIVE OPHTHALMOLOGY AND VISUAL SCIENCES, vol. 58, no. 9, 1 July 2017 (2017-07-01), pages 3576 - 3591, XP055661212 *
ROSAS, LE ET AL.: "Patterns of scAAV Vector Insertion Associated with Oncogenic Events in a Mouse Model for Genotoxicity", MOLECULAR THERAPY, vol. 20, no. 11, 18 September 2012 (2012-09-18), pages 2098 - 2110, XP055630342, DOI: 10.1038/mt.2012.197 *
See also references of EP3802836A4 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021212686A1 (zh) * 2020-04-21 2021-10-28 北京中因科技有限公司 RHO-adRP基于基因编辑的方法和组合物
CN114521214A (zh) * 2020-07-24 2022-05-20 尔知渃米斯股份有限公司 视紫红质转录体特异性反式剪接核酶及其用途
US20220098615A1 (en) * 2020-09-30 2022-03-31 NGGT, Inc. Dual functional expression vectors and methods of use thereof
WO2024211266A1 (en) * 2023-04-07 2024-10-10 University Of Houston System Downregulation of rhodopsin as a therapeutic strategy for peripherin-2-associated inherited retinal disorders

Also Published As

Publication number Publication date
IL279091B1 (en) 2026-01-01
IL279091A (en) 2021-01-31
JP2021525531A (ja) 2021-09-27
US20250215437A1 (en) 2025-07-03
US12203074B2 (en) 2025-01-21
US20210207147A1 (en) 2021-07-08
AU2019276645A1 (en) 2020-11-26
JP7563694B2 (ja) 2024-10-08
EP3802836A4 (en) 2022-10-19
EP3802836A1 (en) 2021-04-14
CN118480544A (zh) 2024-08-13
CN112204145A (zh) 2021-01-08
AU2019276645B2 (en) 2025-06-26
CN112204145B (zh) 2024-03-26
CA3102095A1 (en) 2019-12-05

Similar Documents

Publication Publication Date Title
US20250215437A1 (en) Compositions and methods for treatment of dominant retinitis pigmentosa
US11969478B2 (en) Optimized RPE65 promoter and coding sequences
ES2826384T3 (es) Terapia génica para trastornos oculares
US20210324387A1 (en) Aav vectors for treatment of dominant retinitis pigmentosa
EP2872183A1 (en) Aav-mediated gene therapy for rpgr x-linked retinal degeneration
US20240218394A1 (en) Gene therapy for ocular disorders
WO2020180928A1 (en) Enhanced human opsin promoter for rod specific expression
US20220033826A1 (en) Adeno-associated viral vectors for the treatment of best disease
JP2021520231A (ja) シュタルガルト病の処置のための組成物及び方法
HK40088240A (en) Aav vectors for treatment of dominant retinitis pigmentosa
JP2026067864A (ja) ベスト病の処置のためのアデノ随伴ウイルスベクター
CA3254646A1 (en) COMPOSITIONS AND METHODS OF TREATMENT OF HEARING IMPAIRMENT NOT ASSOCIATED WITH AGE IN A HUMAN SUBJECT
HK40002351B (en) Aav vectors for treatment of dominant retinitis pigmentosa
HK40002351A (en) Aav vectors for treatment of dominant retinitis pigmentosa

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19812143

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019276645

Country of ref document: AU

Date of ref document: 20190603

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3102095

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 279091

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2020567085

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019812143

Country of ref document: EP

Effective date: 20210111