WO2019186276A2 - Antibody-based methods of detecting and treating alzheimer's disease - Google Patents

Antibody-based methods of detecting and treating alzheimer's disease Download PDF

Info

Publication number
WO2019186276A2
WO2019186276A2 PCT/IB2019/000358 IB2019000358W WO2019186276A2 WO 2019186276 A2 WO2019186276 A2 WO 2019186276A2 IB 2019000358 W IB2019000358 W IB 2019000358W WO 2019186276 A2 WO2019186276 A2 WO 2019186276A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
antibody
chain variable
Prior art date
Application number
PCT/IB2019/000358
Other languages
English (en)
French (fr)
Other versions
WO2019186276A8 (en
WO2019186276A3 (en
Inventor
Jozef Hanes
Eva Kontsekova
Andrej KOVAC
Norbert ZILKA
Original Assignee
Axon Neuroscience Se
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to SG11202008098TA priority Critical patent/SG11202008098TA/en
Priority to BR112020018868-9A priority patent/BR112020018868A2/pt
Priority to CN201980029711.2A priority patent/CN112236452A/zh
Priority to MX2020009991A priority patent/MX2020009991A/es
Application filed by Axon Neuroscience Se filed Critical Axon Neuroscience Se
Priority to CA3095443A priority patent/CA3095443A1/en
Priority to AU2019244481A priority patent/AU2019244481A1/en
Priority to US15/733,660 priority patent/US20210139568A1/en
Priority to EP19732436.1A priority patent/EP3774887A2/en
Priority to JP2020551506A priority patent/JP2021520777A/ja
Priority to KR1020207030584A priority patent/KR20200144551A/ko
Priority to RU2020135052A priority patent/RU2020135052A/ru
Publication of WO2019186276A2 publication Critical patent/WO2019186276A2/en
Publication of WO2019186276A3 publication Critical patent/WO2019186276A3/en
Priority to IL277577A priority patent/IL277577A/en
Publication of WO2019186276A8 publication Critical patent/WO2019186276A8/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]

Definitions

  • AD Alzheimer’s disease
  • the disease leads to deficits in cognitive function and declines in memory, learning, language, and in the ability to perform intentional and purposeful movements.
  • AD is also accompanied by concomitant behavioral, emotional, interpersonal, and social deterioration. These cognitive and behavioral deficits render living difficult (Burns et al., Alzheimer’s disease, The Lancet, vol. 360, Jul. 13, 2002). Late-stage AD patients are often unable to speak, comprehend language, and handle their own basic personal care, eventually requiring full-time care and supervision, and are often dependent on family members and nursing homes.
  • AD Alzheimer senile dementia
  • the total number of persons with AD is predicted to increase at least threefold between 2000 and 2050, rendering AD a world-wide public health problem (Sloane et al., The Public Health Impact of Alzheimer’s Disease, 2000-2050: Potential Implication of Treatment Advances, Annu. Rev. Public Health, 23:213-31 , 2002).
  • Clinical detection, management, and treatment of AD remains largely inadequate. There is still an unmet need for effective methods to detect and treat AD.
  • AD has histologically been characterized pathologically by analyzing brain sections to identify the presence of extraneuronal plaques and intracellular and extracellular neurofibrillary tangles in the brain. Plaques are composed mainly of b amyloid (Ab), whereas tangles comprise pathological forms of tau, such as tau conformers and their aggregates. The relationship between plaques and tangles and the disease process remains unclear, although studies suggest a link between amyloid and tau pathogenesis (Hardy et al., Genetic dissection of Alzheimer’s disease and related dementias: amyloid and its relationship to tau, Nature
  • Alzheimer’s Disease Mouse Model Science, 316:750, 2007; Shipton et al., Tau Protein Is Required for Amyloid b-lnduced Impairment of Hippocampal Long-Term Potentiation, J. Neuroscience, 31 (5) :1688-1692, 201 1 ).
  • a central role for Ab in AD pathology was initially proposed in a hypothesis called the“Ab cascade,” wherein Ab deposition is followed by tau phosphorylation and tangle formation, and then neuronal death (Hardy and Allsop, Amyloid deposition as the central event in the aetiology of Alzheimer’s disease, TiPS, vol 12, 1991 ; Hardy and Selkoe, The
  • AD Alzheimer's disease
  • passive immunotherapies such as BAN2401 , ADUCANUMAB, GANTENERUMAB and CRENEZUMAB for Ab removal
  • active vaccine such as CAD106, Lu AF20513, ABvac 40, for Ab therapy or ACI-35 and AADvad to target disease modified tau.
  • Alzheimer’s Disease and Other Tauopathies Current Drug Targets, 5:495-502,
  • microtubule stabilizing drugs Zhang et al., Microtubule-binding drugs offset tau sequestration by stabilizing microtubules and reversing fast axonal transport deficits in a tauopathy model, PNAS, 102(1 ): 227- 231 , 2005
  • drugs that facilitate the proteolytic degradation of misfolded tau proteins Dikey et al., Development of a High Throughput Drug Screening Assay for the Detection of Changes in Tau Levels-Proof of Concept with HSP90 inhibitors, Current Alzheimer Research, 2:231 -238, 2005, Dickey et al., Pharmacologic reductions of total tau levels; implications for the role of microtubule dynamics in regulating tau expression, Molecular Neurodegeneration, 1 :6, 2006
  • immunosuppresive drugs Zilka et al., Chaperon-like Antibodies Targeting Misfolded Tau Protein: New Vistas in the Immunotherapy of
  • CSF cerebrospinal fluid
  • blood Several CSF and blood biomarkers, for example, have been extensively studied without adequate improvements in detection accuracy. These include biomarkers of
  • Alzheimer’s disease a systematic review and meta-analysis, Lancet Neurol., 7:673- 84, 2016).
  • CSF Ab1 -42 (Ab1 -42), also expressed as Ab1 -42 : Ab1 -40 ratio, t-tau, and p-tau Thr181 & Thr231 proteins
  • Cavedo et al., The Road Ahead to Cure Alzheimer’s Disease Development of Biological Markers and Neuroimaging Methods for Prevention Trials Across all Stages and Target Populations, J. Prev. Alzheimer’s Dis., 3:181 -202, 2014).
  • accurate detection of early stage AD and methods to distinguish AD from other tauopathies or other causes of dementia in patients remains a challenge, particularly for CSF based assays.
  • CSF biomarkers do not seem to reflect disease progression in some patients over time.
  • One possibility is that brain derived proteins are diluted in the CSF compartment (deLeon et al., Longitudinal cerebrospinal fluid tau load increases in mild cognitive
  • INNOTEST hTAU INNOTEST phospho-Tau (recognizing phospho-Threonine 181 ) and INNOTEST Ab42. Specificity and sensitivity of those assays, however, are generally not sufficient to predict Alzheimer’s disease, especially in its preclinical stages (Wennstrom et al., The Inflammatory Marker YKL-40 Is Elevated in
  • tau PET tracers for positron emission tomography
  • aryquinoline derivatives THK51 17 and THK5351 the pyrido-indole derivative AV-1451 (also known as T807 and Flortaucipir), and the phenyl/pyridinyl- butadienyl benzothiazole/ benzothiazolium derivative PBB3 ( Saint-Aubert et al., Tau PET imaging: present and future directions, Mol. Neurodegener., 12:19, 2017).
  • tau PET tracers displayed off target binding, mostly recognizing enzyme MAO B or neuromelanin (Barrio et al., The Irony of PET Tau Probe Specificity, J. Nucl. Med., 59(1 ):1 15-1 16, 2018; Lemoine et al., Comparative binding properties of the tau PET tracers THK51 17, THK5351 , PBB3, and T807 in postmortem Alzheimer brains, Alzheimers Res. Ther., 9(1 ) :96, 2017; Ng et al., Monoamine oxidase B inhibitor, selegiline, reduces 18 F-THK5351 uptake in the human brain, Alzheimers Res.
  • CSF tau biomarkers are primarily useful as disease state biomarker
  • tau PET imaging may also be useful in monitoring AD progression, such as the transition from prodromal stage to dementia (Mattsson et al., Comparing 18F- AV-1451 with CSF t-tau and p-tau for diagnosis of Alzheimer disease, Neurology, 5:e388-e395, 2018).
  • a non-invasive CSF-based assay with improved accuracy and specificity for AD would be beneficial.
  • radiotracers is to overcome nonspecific binding (Barrio et al., The Irony of PET Tau Probe Specificity, J. Nucl. Med., 59:1 15-1 16, 2018; Lemoine et al. Comparative binding properties of the tau PET tracers THK51 17, THK5351 , PBB3, and T807 in postmortem Alzheimer brains, Alzheimers Res. Then, 9(1 ):96 , 2017; Ng et al., Monoamine oxidase B inhibitor, selegiline, reduces 18 F-THK5351 uptake in the human brain, Alzheimers Res. Then, 9(1 ):25. 2017).
  • tau ligands have differential binding affinity to the various tau pathological entities (Choi et al., Development of tau PET Imaging Ligands and their Utility in Preclinical and Clinical Studies, 52(1 ):24-30, 2018).
  • Another challenge is to improve the binding potency to various tau pathological lesions in order to utilize them for diagnostics of multiple human tauopathies.
  • antibodies, compositions, kits, and methods that provide for improved detection, monitoring, prevention, and/or treatment of Alzheimer’s disease and other tauopathies.
  • the present disclosure provides an antibody or antigen binding fragment thereof capable of binding tau.
  • the antibody or antigen binding fragment thereof can bind a phosphorylated epitope in tau.
  • tau species with that phosphorylated epitope is present in a sample (e.g., blood or CSF) from a patient with AD in a greater concentration than in a patient with another tauopathy or in a healthy subject.
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the heavy chain variable region comprises an amino acids sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO 8.
  • an antibody or antigen binding fragment thereof disclosed herein can bind to an epitope on tau protein 2N4R (SEQ ID NO: 9), wherein the epitope is phosphorylated.
  • the epitope may comprise one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10).
  • the epitope comprises one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the epitope comprises at least one phosphorylated residue.
  • the epitope comprises more than one phosphorylated residue.
  • the phosphorylated residue(s) may comprise a phospho- threonine at position 217 of tau protein 2N4R (SEQ ID NO: 9).
  • the epitope also comprises a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • the antibody or antigen binding fragment thereof may bind to an epitope comprising or consisting of SRTPSLPpTPPTR (SEQ ID NO: 12).
  • an antibody or antigen binding fragment thereof disclosed herein can bind to an epitope on tau comprising one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10).
  • the epitope comprises one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the epitope comprises at least one phosphorylated residue, wherein the at least one phosphorylated residue may be a phospho-threonine at position 217 of tau protein 2N4R (SEQ ID NO: 9).
  • the epitope also comprises a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • the antibody or antigen binding fragment thereof can bind to an epitope comprising or consisting of
  • SRTPSLPpTPPTR (SEQ ID NO: 12).
  • an antibody or antigen binding fragment thereof disclosed herein can bind to an epitope on tau comprising one or more of residues
  • the antibody or antigen binding fragment thereof may can bind to an epitope comprising one or more of residues 163-172 of tau protein 2N4R (SEQ ID NO: 14).
  • the epitope may comprise KGQANATRIP (sequence of SEQ ID NO: 14).
  • the antibody is DC2E7 or an antigen binding fragment thereof, wherein DC2E7 is an antibody produced by a hybridoma deposited under American Type Culture
  • an antibody or antigen binding fragment disclosed herein is conjugated to a second agent.
  • the agent is at least one detectable label or at least one therapeutic agent for AD or another tauopathy.
  • the agent is a radiolabel.
  • the method comprises administering to the subject an effective amount of at least one antibody according to any one of previously disclosed embodiments.
  • the method comprises detecting AD using one or more of the disclosed antibodies or antigen binding fragments before administering or recommending administration of a suitable AD treatment.
  • the method comprises administering an AD treatment to a patient who has been diagnosed as having AD using an antibody or antigen binding fragment disclosed herein.
  • a method of detecting a tauopathy in a subject comprises: obtaining a biological sample from the subject; contacting the sample from the subject with an effective amount of a molecule that is capable of forming a complex with tau (e.g., using at least one antibody or antigen binding fragment disclosed herein that is capable of binding tau to form a tau-antibody complex);
  • the molecule that forms a tau-molecule complex is a first antibody that can bind tau to form a tau-antibody complex, and wherein the presence of the tau- antibody complex is detected using a second anti-tau antibody or antigen binding fragment, which can bind a different epitope on tau than the first antibody.
  • the first or second antibody or antigen binding fragment is linked (e.g., covalently or non-covalently coated on) to a solid surface or particle.
  • the first or second antibody is conjugated to a detectable label.
  • the disclosed method may comprise a classic ELISA, digital ELISA assay, or other ELISA assay formats, e.g., using any one or more of the antibodies or fragments disclosed herein that bind to phosphorylated tau, and may detect the presence and/or amount of phosphorylated tau in the sample, wherein an increased level of phosphorylated tau in the sample indicates the subject has Alzheimer’s disease rather than another tauopathy.
  • the biological sample is cerebrospinal fluid.
  • the biological sample is serum and/or plasma.
  • a method of distinguishing Alzheimer’s disease from another tauopathy or another cause of dementia in a subject comprises: obtaining a cerebrospinal fluid or blood sample from a subject, contacting the sample with an anti-tau antibody or antigen binding fragment thereof disclosed herein, and detecting the presence and/or amount of phosphorylated tau complexed with the antibody or antigen binding fragment in the same sample, wherein the presence and/or an elevated level of phosphorylated tau in the sample relative to the level in a sample from a healthy control subject or wherein an elevated level of phosphorylated tau above a threshold indicates the subject has Alzheimer’s disease rather than another tauopathy or an alternative cause (i.e., another form of) dementia or another neurodegenerative disorder.
  • the anti-tau antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6 that is capable of binding to phosphorylated tau to form a phosphorylated tau-antibody complex.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO:8.
  • a method of detecting Alzheimer’s disease (AD) or mild cognitive impairment (MCI) in a subject comprises: contacting a biological sample from the subject with an effective amount of a molecule that is capable of forming a complex with tau (e.g., using at least one antibody or antigen binding fragment disclosed herein that is capable of binding tau to form a tau-antibody complex); detecting the presence and/or amount of the tau-antibody complex; and comparing the presence/amount of tau bound to the antibody in the sample to the amount in a control sample or a threshold, wherein the presence and/or an increased amount of tau complexed with the antibody relative to the control sample or threshold indicates AD or MCI in the subject.
  • AD Alzheimer’s disease
  • MCI mild cognitive impairment
  • MCI is a precursor of AD in a patient.
  • the method distinguishes MCI and/or AD from other neurological diseases.
  • the other neurological diseases are selected from Parkinson’s disease, Multiple sclerosis, amyotrophic lateral sclerosis, and/or frontotemporal dementia.
  • the biological sample comprises cerebrospinal fluid (CSF). In some embodiments, the biological sample comprises blood. In some embodiments, the biological sample comprises plasma and/or serum fractions. In some embodiments, the threshold is about 9.3 pg/ml of tau or about 5.3 pg/ml of tau. In some
  • the threshold is between about 100-600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • a method of detecting Alzheimer’s disease (AD) or mild cognitive impairment (MCI) in a subject comprises: obtaining a biological sample; detecting the presence and/or amount of tau protein 2N4R phosphorylated at least at position threonine 217 in the biological sample; and comparing the presence/amount of tau protein 2N4R phosphorylated at threonine 217 to the amount in a control sample or a threshold, wherein the presence and/or an increased amount of tau protein 2N4R phosphorylated at threonine 217 relative to the control sample or threshold indicates AD or MCI in the subject.
  • the MCI is a precursor of AD in a patient.
  • the method distinguishes MCI and/or AD from other neurological diseases.
  • the other neurological disease is selected from Parkinson’s disease, Multiple sclerosis, amyotrophic lateral sclerosis, and/or frontotemporal dementia.
  • the biological sample comprises cerebrospinal fluid (CSF).
  • the biological sample comprises blood.
  • the biological sample comprises plasma and/or serum fractions.
  • the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is about 9.3 pg/ml of tau or about 5.3 pg/ml of tau. In some embodiments, the threshold is between about 100-600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • a method of distinguishing Alzheimer’s disease and/or mild cognitive impairment from Parkinson’s disease, multiple sclerosis, amyotrophic lateral sclerosis, and/or frontotemporal dementia in a subject comprises: contacting a biological sample from the subject with an effective amount of a molecule that is capable of forming a complex with tau (e.g., using at least one antibody or antigen binding fragment disclosed herein that is capable of binding tau to form a tau-antibody complex); and detecting the presence and/or amount of tau complexed with the antibody or antigen binding fragment in the same sample; and comparing the presence/amount of tau bound to the antibody in the sample to the amount in a control sample or a threshold, wherein the presense and/or an increased amount of tau complexed with the antibody relative to the control sample or threshold indicates Alzheimer’s disease and/or mild cognitive impairment (MCI) in the subject.
  • MCI mild cognitive impairment
  • the biological sample comprises cerebrospinal fluid (CSF). In some embodiments, the biological sample comprises blood. In some embodiments, the biological sample comprises plasma and/or serum fractions. In some embodiments, the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is between about 100-600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • CSF cerebrospinal fluid
  • the biological sample comprises blood.
  • the biological sample comprises plasma and/or serum fractions.
  • the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is between about 100-600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • a method of distinguishing Alzheimer’s disease and/or mild cognitive impairment from Parkinson’s disease, multiple sclerosis, amyotrophic lateral sclerosis, and/or frontotemporal dementia in a subject comprises: obtaining a biological sample from the subject; detecting the presence and/or amount of tau protein 2N4R phosphorylated at least at position threonine 217 in the biological sample; comparing the presence/amount of tau protein 2N4R
  • the biological sample comprises cerebrospinal fluid (CSF).
  • CSF cerebrospinal fluid
  • the biological sample comprises blood.
  • the biological sample comprises plasma and/or serum fractions.
  • the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is about 9.3 pg/ml of tau or about 5.3 pg/ml. In some embodiments, the threshold is between about 100-600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • a method of predicting the likelihood that a patient with mild cognitive impairment will develop Alzheimer’s disease comprises:
  • the biological sample comprises cerebrospinal fluid (CSF).
  • the biological sample comprises blood.
  • the biological sample comprises plasma and/or serum fractions.
  • the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is between about 100-600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • a method of predicting the likelihood that a patient with mild cognitive impairment will develop Alzheimer’s disease comprises: obtaining a biological sample from the subject; detecting the presence and/or amount of tau protein 2N4R phosphorylated at least at position threonine 217 in the biological sample; comparing the presence/amount of tau protein 2N4R phosphorylated at threonine 217 to the amount in a control sample or a threshold, wherein the presence and/or an increased amount of tau protein 2N4R phoshphorylated at threonine 217 relative to the control sample or threshold indicates an increased likelihood that the patient will develop Alzheimer’s disease.
  • the biological sample comprises cerebrospinal fluid (CSF).
  • the biological sample comprises blood. In some embodiments, the biological sample comprises plasma and/or serum fractions. In some embodiments, the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is between about 100- 600 pg/ml. In some embodiments, the threshold is about 300 pg/ml.
  • FIG. 1 Isotype determination for monoclonal antibody DC2E2 using ELISA.
  • FIGs. 2A-2D Epitope mapping of antibody DC2E2 using tau deletion mutants and tau peptides in ELISA.
  • FIG. 2A Schematic illustration of tau deletion mutants and peptides used to evaluate the DC2E2 binding site on tau protein.
  • FIG. 2B Immunoreactivity of DC2E2 to human six isoforms by ELISA.
  • FIG. 2C Determination of DC2E2 binding site using tau deletion mutants by ELISA.
  • FIG. 2D Determination of DC2E2 binding site using tau derived peptides by competitive ELISA.
  • Fig. 3 Immunoreactivity of DC2E2 to different tau proteins.
  • Lane 1 sarcosyl- insoluble tau isolated from human Alzheimer ' s disease brain tissue;
  • lane 2 tau151 - 391 ;
  • lane 3 phosphorylated tau151 -391 ;
  • lane 4 tau 2N4R;
  • lane 5 phosphorylated tau 2N4R.
  • Fig. 5A-D The nucleotide and amino-acid sequences of the variable regions in antibody DC2E2.
  • Fig. 5A shows the nucleotide sequence encoding the light chain variable region.
  • Fig. 5B shows the amino acid sequence of the light chain variable region, with the CDR sequences shown in bold and underlined.
  • Fig. 5C shows the nucleotide sequence encoding the heavy chain variable region.
  • Fig. 5D shows the amino acid sequence of the heavy chain variable region, with CDR sequences in bold and underlined.
  • Complementarity determining regions were identified according to the IMGT numbering system.
  • Fig. 6A-D The nucleotide and amino-acid sequences of the variable regions in antibody DC2E7.
  • Fig. 6A shows the nucleotide sequence encoding the light chain variable region.
  • Fig. 6B shows the amino acid sequence of the light chain variable region, with CDR sequences in bold and underlined.
  • Fig. 6C shows the nucleotide sequence encoding the heavy chain variable region.
  • Fig. 6D shows the amino acid sequence of the heavy chain variable region, with CDR sequences in bold and underlined.
  • Complementarity determining regions were identified according to the IMGT numbering system.
  • Lane 1 tau 2N4R; lane 2: 2N4R in vitro phosphorylated; lane 3: fetal tau; lane 4: sarcosyl- insoluble tau isolated from human Alzheimer ' s disease brain tissue.
  • DC25 a pan tau monoclonal antibody recognizing all forms of tau proteins, was used as control.
  • FIG. 8 Schematic illustration of tau deletion mutants used for evaluating the DC2E7 binding site on tau protein.
  • FIG. 10 Schematic illustration of potential phosphorylation sites on tau in region 188-227.
  • Fig. 1 1 Determination of DC2E7 binding site on tau protein by immunobloting using tau point mutants.
  • Mab DC25 was used as a control to measure the extent of phosphorylation of point mutations.
  • Fig. 13 Binding of antibodies DC2E7 and DC2E2 in Alzheimer’s disease (hippocampus CA1 ), FTD - Pick’s disease (dentate gyrus, hippocampus), CBD (nucleus caudatus) and PSP (putamen/nucleus caudatus) brain sections.
  • Monoclonal antibody AT8 was used as a control. Tool bar 100pm.
  • Fig. 14 Binding of antibodies DC2E7 and DC2E2 in Braak stage 1 , Braak stage 3, and Braak stage 6 brain sections. Tool bar 10Opm.
  • Fig. 15 Binding of antibodies DC2E7 and DC2E2 in brain sections from Alzheimer’s disease (hippocampus CA1 ), Pick’s bodies in FTD - Pick’s disease (dentate gyrus, hippocampus), and coiled bodies and astrocytic pathology in CBD (nucleus caudatus). Tool bar 20pm.
  • FIG. 17A-B Spike recovery experiment using three human CSF from healthy individuals.
  • FIG. 17A Estimated concentrations of spiked DC2E7 calibrator in human CSF.
  • Fig. 17B Recovery in % of spiked DC2E7 calibrator in human CSF.
  • Fig. 20 DC2E7 binding to insoluble tau species in AD and other human tauopathies.
  • Fig. 21 A comparison of CSF samples from AD and FTD subjects using pT217 tau and pT181 tau assays.
  • Fig. 22 A comparison of CSF samples from AD and control subjects using pT217 tau and pT181 tau assays.
  • FIG. 23A-B A comparison of CSF samples from control, MCI, and AD subjects using pT217 tau assays (Fig. 23A). A comparison of CSF samples from control, AD, PD, MS, ALS, and FTD subjects using pT217 tau assays (Fig. 23B).
  • Fig. 24 Absorbance of isolated scFV antibody fragments derived from DC2E7.
  • Fig. 25A-D Alignment of amino acid sequences of scFV antibody fragments derived from DC2E7.
  • Fig. 25A shows scFV antibody light chain variable domains compared to the DC2E7 sequence.
  • Fig. 25B shows scFV antibody heavy chain variable domains compared to the DC2E7 sequence.
  • Fig. 25C shows the variable light chain domains of the scFV antibody fragments which exhibited higher affinity as compared to DC2E7.
  • Fig. 25D shows the variable heavy chain domains of the scFV antibody fragments which exhibited higher affinity as compared to DC2E7. Residues identical to the sequence of DC2E7 are represented by dots. CDRs were identified according to the IMGT numbering system.
  • Fig. 26 Comparison of the affinity of the DC2E7 and DC149 antibodies for tau derived peptide 2E7pep.
  • Fig. 27A-B Alignment of amino acid sequences of DC2E7 and DC149.
  • Fig. 27A shows the DC149 variable light chain domain in comparison to the DC2E7 light chian sequence.
  • Fig. 27B shows the DC149 variable heavy chain domain in comparison to the DC2E7 heavy chain sequence. Residues identical to the sequence of DC2E7 are represented by dots. CDRs were identified according to the IMGT numbering system.
  • Fig. 28A-B Alignment of amino acid sequences of DC2E7 and DC807.
  • Fig. 28A shows the DC807 variable light chain domain in comparison to the DC2E7 light chain sequence.
  • Fig. 28B shows the DC807 variable heavy chain domain in comparison to the DC2E7 heavy chain sequence. Residues identical to the sequence of DC2E7 are represented by dots. CDRs were identified according to the IMGT numbering system.
  • Fig. 29 The distribution of pT217 tau as measured by a pT217 tau digital ELISA assay in samples from Alzheimer’s disease, other tauopathies, and control individuals using a phosphorylated tau calibrator (left panel) and 2E7 peptide calibrator (2E7pep) (right panel).
  • affinity refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen).
  • the affinity of a molecule X for its partner Y can generally be represented by the equilibrium dissociation constant (KD) (or its inverse equilibrium association constant, KA) .
  • KD equilibrium dissociation constant
  • KA inverse equilibrium association constant
  • Affinity can be measured by common methods known in the art, including those described herein. See, for example, Pope M.E., Soste M.V., Eyford B.A., Anderson N.L., Pearson T.W., (2009) J. Immunol. Methods. 341 (1 -2):86-96 and methods described herein.
  • amino acid refers to naturally occurring, modified, and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O- phosphoserine.
  • Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an alpha carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that function in a manner similar to a naturally occurring amino acid.
  • Suitable amino acids include, without limitation, both D- and L-isomers of the 20 common naturally occurring amino acids found in peptides as well as the naturally occurring and unnaturally occurring amino acids prepared by organic synthesis or other metabolic routes.
  • unnaturally occurring amino acids include, but are not limited to, N- acetylglucosaminyl-L-serine, N-acetylglucosaminyl-L-threonine, and O- phosphotyrosine.
  • Modified amino acids include, but are not limited to,
  • amino acid also includes naturally occurring amino acids that are metabolites in certain organisms but are not encoded by the genetic code for incorporation into proteins. Such amino acids include, but are not limited to, ornithine, D-ornithine, and D-arginine.
  • antibody refers to an immunoglobulin, whether genetically engineered, natural, or wholly or partially synthetically or recombinantly produced.
  • Intact antibodies typically comprise a heavy chain and a light chain, each comprised of a variable domain forming the binding pocket for an antigen and a constant domain that contributes to effector function.
  • the antibody by virtue of its chosen heavy chain, can be a member of any immunoglobulin class and subclass, including any of the human classes: IgG, IgM, IgA, IgD, and IgE, or a derivative or fragment thereof.
  • the light chain of the antibody may derive from any species, such as a human kappa (K) or lambda (l) light chain, determined based on the amino acid sequences of the constant domain.
  • the basic antibody structural unit typically comprises a tetramer.
  • the tetramer comprises two identical pairs of polypeptide chains, each pair having one“light” (about 25 kDa) and one“heavy” chain (about 50-70 kDa).
  • the amino-terminal portion of each chain includes a variable region of about 100 to 1 10 or more amino acids primarily responsible for antigen recognition.
  • the carboxy- terminal portion of each chain defines a constant region primarily responsible for effector function. Human light chains are classified as kappa and lambda light chains.
  • Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody’s isotype as IgM, IgD, IgA, and IgE, respectively.
  • the variable and constant regions are joined by a“J” region of about 12 or more amino acids, with the heavy chain also including a“D” region of about 10 or more amino acids. See generally, Fundamental Immunology Ch 7. (Paul, W., 2 nd ed. Raven Press, N.Y. (1989)) (incorporated by reference in its entirety for all purposes).
  • the variable regions of each light/heavy chain pair form the antibody binding site.
  • an intact antibody typically has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same.
  • the chains all exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDRs.
  • the CDRs from the two chains of each pair are aligned by the framework regions, enabling binding to a specific epitope.
  • both light and heavy chains comprise the domains FR1 , CDR1 , FR2,
  • CDR2, FR3, CDR3, and FR4 The assignment of amino acids to each domain may be done in accordance with the IMGT numbering system. Alternative definitions are also known to know of ordinary skill in the art. See, e.g., Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991 )), or Clothia & Lesk J. Mol. Biol. 196:901 -917 (1987); Clothia et al. Nature 342:878-883 (1989).
  • Antibody fragment or“antigen binding fragment” comprise a portion of a full length antibody, generally at least the antigen binding portion/domain or the variable region thereof.
  • the term antibody fragment is a subset of the term antibody discussed above. Examples of antibody fragments or antigen binding fragments include: Fab, Fab’, F(ab’)2, Fd, scFv, (scFv)2, scFv-Fc, Fv fragment, diabodies, single-chain antibody molecules, immunotoxins, and multi-specific antibodies formed from antibody fragments.
  • antibody fragments comprise single chain polypeptides having the characteristics of a VH chain binding pathological tau, namely being able to assemble together with a VL chain or of a VL chain binding to pathological tau, namely being able to assemble together with a VH chain to form a functional antigen binding pocket and thereby providing the property of binding to tau.
  • the terms also comprise fragments that per se are not able to provide effector functions (e.g., Antibody-dependent cell-mediate cytotoxicity (“ADCC”) or complement dependent cytotoxicity (“CDC”) but provide this function after being combined with the appropriate antibody constant domain(s).
  • ADCC Antibody-dependent cell-mediate cytotoxicity
  • CDC complement dependent cytotoxicity
  • An antibody or binding fragment thereof“capable of binding tau,” as used herein, refers to an antibody or binding fragment that preferentially binds to tau over other antigen targets.
  • the term is interchangable with an“anti-tau” antibody or an “antibody that binds tau.”
  • the antibody or binding fragment capable of binding to tau can do so with higher affinity for that antigen than others.
  • the antibody or binding fragment capable of binding tau can bind to that antigen with a KD of at least about 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 ,
  • chimeric antibodies refers to antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass (e.g., chimeric humanized, class-switched antibodies), while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit desired biological activity (U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81 :6851 -6855 (1984)).
  • the term“chimeric antibody” refers to a monoclonal antibody comprising a variable region from one source or species and at least a portion of a constant region derived from a different source or species, usually prepared by recombinant DNA techniques.
  • chimeric antibodies comprise a murine variable region and a human constant region.
  • Such murine/human chimeric antibodies may be produced by expressing immunoglobulin genes comprising DNA segments encoding murine immunoglobulin variable regions and DNA segments encoding human immunoglobulin constant regions.
  • Other forms of“chimeric antibodies” may be those in which the class or subclass has been modified or changed from that of the original antibody.
  • Such“chimeric” antibodies are also referred to as“class-switched antibodies.”
  • Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques now known in the art. See, e.g., Morrison, S. L, et a/., Proc. Natl. Acad Sci. USA 81 (1984) 6851 -6855; U.S. Pat. Nos. 5,202,238 and 5,204,244.
  • immunoglobulin/antibody/binding fragment under testing inhibits specific binding of a reference antibody to a common antigen, such as tau (e.g., tau SEQ ID No 12).
  • a common antigen such as tau (e.g., tau SEQ ID No 12).
  • Numerous types of competitive binding assays are known, for example: solid phase direct or indirect radioimmunoassay (RIA), solid phase direct or indirect enzyme immunoassay (EIA), sandwich competition assay (see Stahli et al., Methods in Enzymology 9:242 (1983)); solid phase direct biotin-avidin EIA (see Kirkland et al., J.
  • such an assay involves the use of purified antigen bound to a solid surface or cells bearing either of these, an unlabeled test immunoglobulin and a labeled reference immunoglobulin.
  • Competitive inhibition may be measured by determining the amount of label bound to the solid surface or cells in the presence of the test immunoglobulin.
  • the test immunoglobulin is present in excess. Usually, when a competing antibody is present in excess, it will inhibit specific binding of a reference antibody to a common antigen by at least 50-55%, 55-60%, 60-65%, 65-70%, 70-75% or more.
  • conjugated refers to a bond or chemical moiety formed from a chemical reaction between a functional group of a first molecule (e.g., an antibody) with a functional group of a second molecule (e.g., a detectable signor or therapeutic agent or drug).
  • bonds include, but are not limited to, covalent linkages and non-covalent linkages, while such chemical moieties include, but are not limited to, esters, carbonates, imines phosphate esters, hydrazones, acetals, orthoesters, peptide linkages, and oligonucleotide linkages.
  • AD Alzheimer's disease
  • Prevention encompasses prophylactic administration to a subject at risk for AD.
  • Teen in the general population is at risk for AD. Some individuals have an increased risk for AD. Some individuals have an increased, genetic risk for AD.
  • Delaying progression and preventing the progression can eliminate or reduce the risk or delay the onset of disease. Delay of AD onset or progression can be measured by comparing to standard disease progression timelines in similar populations or individuals. See Ostrowitzki et al., Alzherimers Res Ther., 9(1 ):95, 2017. Specific illustrative and exemplary embodiments for delaying progression are described below.
  • epitope on tau is the site on tau where an immunoglobulin or antibody (or antigen binding fragment thereof) can specifically bind.
  • Specific binding refers, in some embodiments, to binding that is measurably different from a non-specific interaction. Specific binding can be measured, for example, by determining binding of a molecule compared to binding of a control molecule, which generally is a molecule of similar structure that does not have binding activity, or by competition assay with a control molecule that shares similar binding affinity but is unlabeled.
  • binding of the labeled target to a probe is competitively inhibited by excess unlabeled target.
  • the term can be exhibited, for example, by a molecule having a Kd for the target of at least about 10 -4 M, alternatively at least about 10 -5 M, alternatively at least about 10 -6 M, alternatively at least about 10 -7 M, alternatively at least about 10 -8 M, alternatively at least about
  • the term“specific binding” refers to binding where a molecule binds to a particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or epitope.
  • An epitope can be formed from either contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein.
  • An epitope may include additional stretches of amino acids around a core region bound by an antibody, e.g., 1 , 2, 3, 4, 5, 10, 15, 20, or more amino acids on the N and/or C terminus of a core epitope peptide.
  • Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents.
  • An epitope typically includes at least 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 amino acids, often in a unique spatial conformation.
  • Methods of determining spatial conformation of epitopes include, for example, alanine scanning, x-ray crystallography, and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, G. E. Morris, Ed.
  • A“conformational epitope” is an epitope to which the antibody or tau- binding fragment thereof binds in a conformational-specific manner.
  • the binding can depend on the epitope-carrying-protein’s secondary, tertiary, or quaternary structure.
  • the antibody binds in a structure specific manner, or a quaternary-structure-specific manner.
  • An epitope on tau is identified with reference to amino acid residues on tau protein 2N4R.
  • One of skill in the art could readily identify corresponding amino acid residues on other tau isoforms and fragments, e.g, via alignment programs such as BLAST®.
  • a reference to a particular amino acid residue on tau refers to tau protein 2N4R and should be understood to encompass the corresponding positions on other tau isoforms and fragments.
  • Fab fragments can be produced by papain digestion of antibodies, each with a single antigen-binding site, and a residual“Fc” fragment, whose name reflects its ability to crystallize readily (fragment crystalizable). Pepsin treatment yields an F(ab’) 2 fragment that has two antigen-binding sites and is still capable of cross- linking antigen.“Fv” is the variable region portion of the heavy chain that is included in the Fab fragment. Any of these fragments can also be produced recombinantly.
  • the Fc portion of an antibody is associated with the antibody’s effector functions, including antibody-dependent cellular cytotoxicity (ADCC) and complement- dependent cytotoxicity or phagocytosis. Alterations (e.g., mutations or glycosylation changes) in the Fc region of an antibody can be used to modulate any of its effector functions as well as increase its serum half-life and other pharmacokinetic properties.
  • ADCC antibody-dependent cellular cytotoxicity
  • phagocytosis complement-
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH1 ) of the heavy chain.
  • Fab’ fragments typically differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region.
  • Fab’-SH is the designation herein for Fab’ in which the cysteine residue(s) of the constant domains bear at least on free thiol group.
  • F(ab’) 2 antibody fragments originally were produced as pairs of Fab’ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • Fc includes the polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain.
  • Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, and the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains.
  • IgA and IgM Fc may include the J chain.
  • Fc comprises immunoglobulin domains C gamma 2 and C gamma 3 (Cgamma2 and Cgamma3) and the hinge between C gamma
  • the human IgG heavy chain Fc region is usually defined to comprise residues C226 or P230 to its carboxyl-terminus, wherein the numbering is according to the EU numbering system (Edelman G. M. et al., (1969J Proc. Natl. Acad. Sci. USA, 63(1 ); 78-85).
  • the C-terminal lysine (residue 447 according to the EU numbering system) of the Fc region may be removed, for example, during production or purification of the antibody, or by recombinantly engineering the nucleic acid encoding a heavy chain of the antibody.
  • a composition of intact antibodies may comprise antibody populations with all K447 residues removed, antibody populations with no K447 residues removed, and antibody populations having a mixture of antibodies with and without the K447 residue.
  • Fc may refer to this region in isolation or this region in the context of an Fc polypeptide, for example an antibody.
  • the Fc may be a native sequence Fc or a variant Fc. Replacements of amino acid residues in the Fc portion to alter antibody effector function are known in the art (see, e.g., Winter et al., U.S. Pat. Nos. 5,648,260 and 5,624,821 ).
  • Fc is a single chain polypeptide extending from the N-terminal hinge region to the native C-terminus of the Fc region of a human lgG1 antibody.
  • Another useful Fc polypeptide is the Fc mutein described in U.S. Pat. No. 5,457,035 and in Baum et al., 1994, EMBO J. 13:3992-4001 .
  • the amino acid sequence of this mutein is identical to that of the native Fc sequence presented in WO 93/10151 , except that amino acid 19 has been changed from Leu to Ala, amino acid 20 has been changed from Leu to Glu, and amino acid 22 has been changed from Gly to Ala.
  • the mutein may exhibit reduced affinity for Fc receptors.
  • Fv refers to the minimum antibody fragment which contains a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer.
  • variable domain or half of an Fv comprising only three hypervariable regions specific for an antigen
  • a single variable domain or half of an Fv comprising only three hypervariable regions specific for an antigen
  • a humanized antibody that comprises a heavy or light chain variable“framework region” from a particular human germline immunoglobulin sequence may contain amino acid differences as compared to the heavy or light chain variable framework region of the particular germline sequence, due to, for example, naturally-occurring somatic mutations or intentional introduction of site- directed mutation.
  • a selected humanized antibody can be at least 90% identical in amino acid sequence of the heavy or light chain variable framework region to an amino acid sequence encoded by the heavy or light chain variable framework region of a human germline immunoglobulin gene and contains amino acid residues that identify the humanized antibody as being derived from the human when compared to the germline immunoglobulin amino acid sequences of other species (e.g., murine germline sequences).
  • a humanized antibody may share at least 90%, 95%, 96%, 97%, 98%, 99% or greater amino acid sequence identity with the heavy or light chain variable framework region encoded by the germline immunoglobulin gene.
  • the heavy or light chain variable framework region of a humanized antibody derived from a particular human germline sequence will display no more than 1 1 amino acid, preferably no more than 5, or even more preferably no more than 4, 3, 2, or 1 differences from the amino acid sequence of the heavy or light chain variable framework region encoded by the human germline immunoglobulin gene.
  • “Framework Region” or“FR” residues are those variable domain residues other than the hypervariable region residues as herein defined. They bracket the hypervariable regions in the varialble domain.
  • the FR residues can be identified according to a standard numbering system, e.g., the Kabat, Chothia, or modified Chotia numbering schemes. In the IMGT unique numbering system, the conserved amino acids always have the same position, for instance cysteine 23 (1 st -CYS), tryptophan 41 (CONSERVED-TRP), hydrophobic amino acid 89, cysteine 104 (2 nd - CYS), phenylalanine or tryptophan 1 18 (J-PHE or J-TRP).
  • the IMGT unique numbering provides a standardized delimitation of the framework regions (FR1 -IMGT : positions 1 to 26, FR2-IMGT : 39- 55, FR3-IMGT : 66-104 and FR4-IMGT : 1 18 to 128) and of the complementarity determining regions: CDR1 -IMGT: 27 to 38, CDR2-IMGT: 56 to 65 and CDR3-IMGT: 105 to 1 17.
  • the IMGT unique numbering can be used in 2D graphical representation of the framework regions (FR1 -IMGT : positions 1 to 26, FR2-IMGT : 39- 55, FR3-IMGT : 66-104 and FR4-IMGT : 1 18 to 128) and of the complementarity determining regions: CDR1 -IMGT: 27 to 38, CDR2-IMGT: 56 to 65 and CDR3-IMGT: 105 to 1 17.
  • the IMGT unique numbering can be used in 2D graphical representation of the framework regions (FR1
  • IMGT Colliers de Peries See, e.g., Ruiz, M. and Lefranc, M. P., Immunogenetics, 53, 857-883 (2002); Kaas, Q. and Lefranc, M. P., Current Bioinformatics, 2, 21 -30 (2007). It may also used for representing 3D structures. See, e.g., IMGT/3Dstructure-DB Kaas, Q., Ruiz, M. and Lefranc, M. P., T cell receptor and MHC structural data. Nucl. Acids. Res., 32, D208-D210 (2004).
  • the term“hinge” or“hinge region” or“antibody hinge region” herein includes the flexible polypeptide comprising the amino acids between the first and second constant domains of an antibody or tau-binding fragment thereof.
  • The“hinge region” as referred to herein may be a sequence of 6-62 amino acids in length, only present in IgA, IgD, and IgG, which encompasses the cysteine residues that bridge the two heavy chains.
  • the term“human antibody,” as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences and may be, e.g., isolated from a human or produced recombinantly.
  • the constant regions of the antibody can be, for example, the constant regions of a human lgG1 type antibody. Such regions can be allotypic and are described by, e.g., Johnson, G., and Wu, T. T., Nucleic Acids Res. 28 (2000) 214-218 and the databases referenced therein.
  • the term“humanized antibody” refers to antibodies in which the framework regions (FR) and/or the complementarity determining regions (CDR) have been modified to comprise amino acid residues of an immunoglobulin from a human as compared to that of the parent immunoglobulin (e.g., parent mouse immunoglobulin residues).
  • a murine CDR is grafted into the framework region of a human antibody to prepare the“humanized antibody.”
  • human frameworks are“grafted” or spliced into mouse antibodies, preserving the CDRs of the mouse antibody and replacing its frameworks with frameworks of human origin. Grafting and splicing can be done by various recombinant DNA technologies, including PCR and mutagenesis.
  • humanized antibodies are more human-like while retaining their original antigen-binding properties. Presta, L.G. Engineering of therapeutic antibodies to minimize immunogenicity and optimize function. Advanced Drug Delivery Reviews, Volume 58, Issues 5-6: 640-656 (2006).
  • the sequence of the variable domain of a rodent antibody is screened against a library of known human variable-domain sequences or a library of human germline sequences. The human sequence that is closest to that of the rodent may then be accepted as the human framework region for the humanized antibody (Sims et al., J. Immunol. 1993; 151 :2296 et seq.; Chothia et al, Chothia and Lesk, J. Mol. Biol.
  • humanization involves using a particular framework region derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., PNAS USA, 1992; 89:4285 et seq.; Presta et al., J Immunol 1993; 151 :2623 et seq.).
  • Other methods designed to reduce the immunogenicity of the antibody molecule in a human patient include veneered antibodies (see, e.g., U.S. Pat. No. 6,797,492 and U.S.
  • CDRs of the humanized antibodies described herein correspond to the CDR sequences of the mouse monoclonal DC2E7 antibody, namely SEQ ID Nos. 1 -6.
  • hypervariable region when used herein refers to the amino residues of an antibody that contribute most directly to antigen-binding.
  • the term is synonymous with the term“complementarity determining region” (or“CDR”).
  • CDR complementarity determining region
  • the hypervariable region generally comprises amino acids in three stretches on each of the heavy and light chain variable domains (e.g., residues 27-32 (LCDR1 ), 49-51 (LCDR2), and 88-96 (LCDR3) in the light chain variable domain and 26-33 (HCDR1 ), 51 -58 (HCDR2), and 97-102 (HCDR3) in the heavy chain variable domain.
  • insoluble tau refers to aggregates of tau (such as neurofibrillary tangles, neuropil threads, Pick’s bodies, coiled bodies etc.), which may be identified, e.g., by its characteristic pattern in the brain or in solution.
  • tau aggregates can be separated by centrifugation of homogenized brain samples and evaluated by, e.g., Western blot or ELISA assays. See, e.g., Lasagna-Reeves et al., FASEB J. 26:1946-59 (2012).
  • Tau aggregates may be composed of tau monomers, tau dimers, trimers, or oligomers, such as granular tau oligomers (GTO) and various types of filaments, including Paired Helical Filaments (PHF) and Straight Filaments (SF), among others.
  • GTO granular tau oligomers
  • PHF Paired Helical Filaments
  • SF Straight Filaments
  • isolated nucleic acid means a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, which by virtue of its origin either (1 ) is not associated with all or a portion of a polynucleotide in which the“isolated nucleic acid” is found in nature, (2) is operably linked to a
  • polynucleotide which is not liked to in nature, or (3) does not occur in nature as part of a larger sequence.
  • Linked refers to attachment of a moiety to a peptide, antibody, compound, or solid particle.
  • the term embraces instances where a moiety is coupled, or complexed, or covalently or non-covalently attached to a peptide, antibody, compound, or solid particle.
  • an antibody or antigen binding fragment disclosed herein can be covalently or non-covalently coated on a bead or other sold particle.
  • the moiety can be chemically crosslinked or expressed or synthesized as a fusion with the peptide or antibody.
  • a“molecule that is capable of forming a tau-molecule complex” is any agent that preferentially can bind to a tau species to form a complex.
  • the term encompasses antibodies, e.g., the anti-tau antibodies disclosed herein, as well as antigen receptors, Fc-conjugated receptors, receptor fragments, complement factors, and any other suitable binding moieties capable of forming a complex with tau.
  • nucleic acid as used herein, is intended to include DNA molecules and RNA molecules.
  • a nucleic acid molecule may be single-stranded our double stranded.
  • “Pathological tau” includes pathological tau conformers and structures and encompasses all of the following: disease modified tau (e.g., hyperphosphorylated tau, truncated tau, etc.), misordered tau, misdisordered tau, misdisordered soluble tau, insoluble tau, tau oligomers and filaments, extracellular and intracellular tau aggregates such as neurofibrillary tangles, neuropil threads, neuritic plaques, ghost tangles and axonal spheroids, Pick ' s bodies, coiled bodies, tuft-shape astrocytes, astrocytic plaques, or any other form of tau associated with AD or another tauopathy.
  • disease modified tau e.g., hyperphosphorylated tau, truncated tau, etc.
  • misordered tau misdisordered tau
  • misdisordered soluble tau insoluble tau
  • tau oligomers and filaments extracellular and intracellular tau aggregates such as
  • sample or“biological sample” as used herein refers to any portion of tissue or bodily fluid (e.g., blood, CSF, etc.) obtained from a subject for testing purposes.
  • the sample may be directly isolated from the subject or further processed prior to testing (e.g., by dilution, fixation, denaturation, division, separation, centrifugation, immune complex dissociation, and the like). Portions of the sample used for diagnostic or monitoring purpose are also encompassed by the terms.
  • the sample may also be further processed during or after testing (e.g., by
  • control sample refers to a sample obtained from a healthy patient or a patient with another diagnosed tauopathy or a patient with a known level of a tau species in a biologic fluid, e.g., CSF.
  • tau i.e., tau protein species
  • a subject e.g., in brain tissue or samples such as CSF or blood. Details on these types of tau are known and have been described, e.g., in W02004/007547 A2 and U.S. 9,518,101 , which are incorporated herein by reference in their entirety.
  • the term“tau,” when used without further isoform specification e.g., tau 2N4R), encompasses all forms of tau as well as tau fragments unless otherwise specified.
  • pharmacologically compatible for in vivo use in animals or humans and preferably means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • phosphorylated tau refers to any tau isoform comprising one or more phosphorylated amino acids.
  • the longest form of adult human brain tau has 80 serine or threonine residues and 5 tyrosine residues; therefore, almost 80% of the molecule has the potential to be phosphorylated.
  • Goedert, M. et al Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer’s disease. Neuron 3, 519-526 (1989).
  • the term phosphorylated tau also refers to any combination of phosphorylated tau amino acids. Tau plays a key role in regulating microtubule dynamics, axonal transport and neurite outgrowth.
  • tau may be modulated by site-specific phosphorylation and alteration of normal phosphorylation events (e.g., hyperphosphorylation, abnormal phosphorylation) may contribute to neurodegenerative diseases, such as AD. Johnson GV et al., Tau phosphorylation in neuronal cell function and dysfunction. J. Cell Sci. 2004 Nov 15;1 17(Pt 24): 5721 -9.
  • phosphorylated tau refers to a tau protein having any combination of one or more phosphorylated residues between amino acids 188 and 227 (as numbered in tau protein 2N4R or the equivalent residues in another tau fragment or isoform). In another embodiment, phosphorylated tau refers to tau phosphorylated at least at threonine 217 (as numbered in tau protein 2N4R or the equivalent residues in another tau fragment or isoform). In some embodiments, the tau protein is phosphorylated as in the phosphorylated tau proteins detected in the Examples.
  • Physiological tau refers to a native, unfolded tau protein found in the brain of health individuals, which can be of varying length. Such tau proteins are typically highly soluble and generally show less tendency for aggregation. See Wang et al., Tau in physiology and pathology, Nature Reviews, 17:22-35, 2016.
  • recombinant host cell (or simply“host cell”), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer to not only the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term“host cell” as used herein.
  • Single-chain Fv or“scFv” antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding.
  • treatment is defined as the application or administration of a therapeutic agent to a subject, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, one or more symptoms of the disease, or the predisposition toward the disease.
  • compositions of the disclosure either alone or in combination with another therapeutic agent cure, heal, alleviate, relive, alter, remedy, ameliorate, improve or affect at least one symptom of Alzheimer’s Disease or another tauopathy being treated, as compared to that symptom in the absence of treatment, the result should be considered a treatment of the underlying disorder regardless of whether all the symptoms of the disorder are cured, healed, alleviated, relieved, altered, remedied, ameliorated, improved or affected or not.
  • Treatment may be achieved using an“effective amount” of a therapeutic agent, which shall be understood to embrace partial and complete treatment, e.g., partial or complete curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, or affecting the disease, one or more symptoms of the disease, or the predisposition toward the disease.
  • An“effective amount” of may be determined empirically.
  • a “therapeutically effective amount” is a concentration or which is effective for achieving a stated therapeutic effect.
  • Tauopathy refers to a disease associated with the formation of pathological tau. Tauopathy encompasses all neurological diseases that are accompanied by the appearance of abnormal forms of microtubule associated protein tau in the brains of patients. The term includes, but is not limited to, the following diseases: Alzheimer’s disease, Gerstmann-Straussler-Scheinker disease, British dementia, Danish dementia, Pick’s disease, Progressive supranuclear palsy, Corticobasal
  • Frontotemporal dementia e.g., FTDP-17
  • Parkinsonism linked to chromosome 17 chronic traumatic encephalopathy and nodding disease. See, e.g., Goedert M, Clavaguera F and Tolnay M. The propagation of prion-like protein inclusions in neurodegenerative diseases. Trends Neurol. Sci.
  • a subject with Frontotemporal dementia may have Nonfluent/Agrammatic Primary Progressive Aphasia (nfPPA), Semantic Variant Primary Progressive Aphasia (svPPA), Behavioral Variant Frontotemporal Dementia (bvFTD), or Amyotrophic Lateral Sclerosis/Frontotemporal Dementia (ALS/FTD).
  • nfPPA Nonfluent/Agrammatic Primary Progressive Aphasia
  • svPPA Semantic Variant Primary Progressive Aphasia
  • bvFTD Behavioral Variant Frontotemporal Dementia
  • ALS/FTD Amyotrophic Lateral Sclerosis/Front
  • one or more of those abnormal forms of tau is recognized by one of the antibodies or binding fragments described herein in at least one assay.
  • the assay is IHC.
  • the assay is ELISA.
  • the term“another tauopathy” encompasses all neurological diseases (e.g., tau-based causes of dementia) other than AD that are accompanied by the appearance of pathologic tau, e.g., any of the other taupathies listed above. In contrast, dementia may also arise from non-tau based etiologies, and these would fall outside of the term tauopathy.
  • variable domain refers to the fact that certain portions of an immunoglobulin differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is often not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FRs).
  • the variable domains of native heavy and light chains each comprise four FRs, which often adopt a beta-sheet configuration, connected by three hypervariable regions, which often form loops connecting, and in some cases forming part of, the beta-sheet structure.
  • hypervariable regions (HVR) in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat, et al., Sequences of Proteins of Immunological Interest, 5 th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991 )).
  • The“constant domains” of an antibody in contrast, are not typically involved directly in binding an antibody to an antigen, but contribute to antibody dependent cellular cytotoxicity (ADCC).
  • vector is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • a“plasmid” refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
  • a viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • vectors can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are
  • expression vectors are referred to herein as“recombinant expression vectors” (or simply,“expression vectors”).
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • “plasmid” and“vector” may be used interchangeably as the plasmid is most commonly used form of vector.
  • the invention is intended to include other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • “about” can mean a range of up to and including 20%, 10%, 5%, or 1% of a given value.
  • the term can mean up to and including an order of magnitude, up to and including 5-fold, and up to and including 2-fold, of a value.
  • all ranges described herein include the endpoints as well as all points in between.
  • the term“or” will be understood to mean“and/or” unless the context clearly indicates otherwise. All references cited herein are incorporated by reference in their entirety. To the extent anything in an incorporated reference contradicts or is inconsistent with material provided herein, the present disclosure shall control.
  • the antibodies are capable of binding to a phosphorylated tau.
  • the antibodies are capable of binding to phosphorylated tau in a biological sample (e.g., CSF or blood), making them useful for non-invasively distinguishing AD from other tauopathies.
  • the antibodies can be conjugated to second agents (e.g., agents other than antibodies or antigen binding fragments disclosed herein, such as radiotracers or therapeutic agents).
  • one or more of the antibodies or antigen binding fragments disclosed herein are conjugated to each other.
  • the antibodies and/or conjugated antibodies cross the blood-brain barrier to bind to tau in the brain, making them useful for in vivo detection or treatment of AD and other tauopathies in the brain.
  • antibodies and binding fragments disclosed herein comprise one or more of the CDR and/or variable domain sequences disclosed in the table, and/or bind to one or more portions of tau protein 2N4R disclosed in the table.
  • antibodies or antigen binding fragments thereof capable of binding tau disclosed herein comprise one or more of the amino acid sequences disclosed in Table 1 above. In some embodiments, antibodies disclosed herein comprise variants of one or more sequences disclosed in Table 1 while retaining the ability to bind tau, e.g., tau phosphorylated at position 217.
  • an antibody or antigen binding fragment thereof capable of binding tau comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , or SEQ ID NO: 1 with a substitution at one or more of position 5 and 6, HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, or SEQ ID NO: 2 with a substitution at one or more of position 1 , 4, 5, 6, and 8, HCDR3 comprises the amino acid sequence of SEQ ID NO: 3, and/or wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 4 with a substitution at position 2, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, or SEQ ID NO: 5 with
  • a substitution at a particular position may be determined by counting from left to right (amino to carboxy terminal) in an amino acid sequence, e.g., a sequence listed in Table 1 beginning at the amino terminal end of the peptide sequence (or the left end in the table).
  • the substitution at position 5 in HCDR1 is glycine
  • the substitution at position 6 in HCDR1 is glycine
  • the substitution at position 1 in HCDR2 is valine
  • the substitution at position 4 in HCDR2 is alanine
  • the substitution at position 5 in HCDR2 is glycine
  • the substitution at position 6 in HCDR2 is serine
  • the substitution at position 8 in HCDR2 is valine.
  • the substitution at position 2 in LCDR1 is asparagine.
  • the substitution at position 3 in LCDR2 is glycine.
  • the substitution at position 4 of LCDR3 is arginine
  • the substitution at position 6 in LCDR3 is threonine.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 with a substitution at position 5
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2 with a substitution at 8 position 8
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4 with a substitution at position 2
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • substitution at position 5 in HCDR1 is glycine
  • substitution at position 8 in HCDR2 is valine
  • substitution at position 2 in LCDR1 is asparagine.
  • the antibody or antigen binding fragment that comprises variant sequences of those disclosed in Table 1 comprises any of the antibody CDRs (e.g., all six CDRs) and/or full heavy and/or light chain variable domain sequences (e.g., paired sets of heavy and light chain variable domain sequences of a particular antibody clone) selected from those shown in Figures 24- 27B.
  • the antibody CDRs e.g., all six CDRs
  • full heavy and/or light chain variable domain sequences e.g., paired sets of heavy and light chain variable domain sequences of a particular antibody clone
  • an antibody or antigen binding fragment thereof capable of binding tau comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3).
  • the CDRs and/or variable domain sequences are selected from those listed in Table 1 .
  • the HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • an antibody or antigen binding fragment thereof capable of binding tau wherein the the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or SEQ ID NO: 7 with a substitution at one or more of position 1 , 2, 3, 9, 12, 19, 30, 31 , 35, 37, 42, 43, 48, 49, 51 , 54, 55, 56, 58, 62, 63, 64, 65, 66, 68, 69, 70, 73, 76, 77, 78, 79, 80, 83, 84, 88, 94, 96, 107, 108, and 1 12, and/or the light chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 8 with a substitution at one or more of position 3, 7, 1 1 , 14, 17, 19, 20, 21 , 24, 25, 28, 39, 42, 49, 52, 56, 69, 71 ,
  • the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 2, 3, 9, 12, 19, 30, 31 , 35, 37, 42, 43, 48, 49, 51 , 54, 55, 56, 58, 62, 63, 64, 65, 66, 68, 69, 70, 73, 76, 77, 78, 79, 80, 83, 84, 88, 94, 96, 107, 108, and 1 12, wherein the substitution in the heavy chain variable region at position 1 is glycine, at position 2 is alanine, at position 3 is arginine, at position 9 is arginine, at position 12 is alanine, at position 19 is arginine, at position 30 is glycine, at position 31 is glycine, at position 35 is arginine, at position 37 is alanine, at position 42 is glycine, at position 43 is methionine, at position 48
  • the light chain variable region comprises the amino acid sequence of SEQ ID NO: 8 with a substitution at one or more of position 3, 7,
  • the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 3,
  • the light chain variable region comprises the amino acid sequence of SEQ ID SEQ ID NO: 8 with a substitution at one or more of position 7, 1 1 , 20, 28, 39, and 69.
  • the substitution in the heavy chain variable region at position 2 is alanine and/or the substitution at position 35 is arginine.
  • the substitution in the heavy chain variable region at position 49 is threonine and/or at position 79 methionine, and/or the substitution in the light chain variable region at position 19 is alanine.
  • the substitution in the heavy chain variable region at position 43 is methionine, at position 65 is glutamic acid, and/or at position 80 is serine, and/or the substitution in the light chain variable region at position 56 is proline and at position 94 is threonine.
  • the substitution in the heavy chain variable region at position 12 is alanine
  • at position 64 is glutamic acid
  • at position 78 is alanine
  • the substitution in the light chain variable region at position 21 is valine.
  • the substitution in the heavy chain variable region at position 107 is alanine, and/or the substitution in the light chain variable region at position 42 is aspartic acid.
  • the substitution in the heavy chain variable region at position 19 is arginine, at position 51 is valine, at position 66 is aspartic acid, and at position 84 is alanine, and/or the substitution in the light chain variable region at position 99 is serine.
  • the substitution in the heavy chain variable region at position 31 is glycine and/or at position 80 is serine.
  • the substitution in the heavy chain variable region at position 73 is asparagine, and/or the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 37 is alanine, and/or the substitution in the light chain variable region at position 42 is serine.
  • the substitution in the heavy chain variable region at position 80 is leucine, and/or the substitution in the light chain variable region at position 1 1 is leucine and at position 105 is glycine.
  • the substitution in the heavy chain variable region at position 54 is alanine and/or at position 56 is serine.
  • the substitution in the heavy chain variable region at position 37 is alanine
  • at position 68 is leucine
  • at position 83 is threonine
  • at position 99 is cysteine
  • the substation in the light chain variable region at position 25 is threonine
  • at position 49 is proline
  • at position 52 is glycine.
  • the substitution at position in the heavy chain variable region at position 19 is arginine, at position 42 is glycine, and/or at position 1 12 is proline.
  • the substitution in heavy chain variable region at position 80 is leucine
  • the substitution in the light chain variable region at position 3 is arginine and/or at position 17 is valine.
  • the substitution in the heavy chain variable region at position 19 is arginine, at position 37 is alanine, at position 55 is glycine, at position 70 is threonine, the substitution in the light chain variable region at position 1 1 is leucine and/or at position 42 is serine.
  • the substitution in the heavy chain variable region at position 64 is alanine
  • the substitution at position 69 is alanine
  • the substitution in the light chain variable region at position 42 is serine.
  • the substitution in the heavy chain variable region at position 9 is arginine and/or at position 62 is glycine, and/or the substitution in the light chain variable region at position 1 1 is serine and/or at position 14 is proline.
  • the substitution in the heavy chain variable region at position 37 is alanine, and/or the substitution in the light chain variable region at position 75 is valine.
  • the substitution at position in the heavy chain variable region at position 56 is serine, at position 88 is proline, and/or at position 96 is glycine, and/or the substitution in the light chain variable region at position 1 1 is leucine, at position 24 is glutamic acid, at position 42 is aspartic acid, at position 71 is histidine, at position 92 is arginine, and/or at position 106 is valine.
  • the substitution in the heavy chain variable region at position 80 is histidine and/or at position 108 is proline.
  • the antibody or antigen binding fragment thereof capable of binding tau comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 3, 30, 37, 48, 58, 63, 68, 76, 77, and 80, and a light chain variable region comprises the amino acid sequence of SEQ ID SEQ ID NO: 8 with a substitution at one or more of position 7, 1 1 , 20, 28, 39, and 69.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 30 is glycine, at position 37 is alanine, at position 48 is isoleucine, at position 58 is valine, at position 63 is alanine, at position 68 is leucine, at position 76 is glutamic acid, at position 77 is serine, and/or at position 80 is serine, and the substitution in the light chain variable region at position 7 is proline, at position 1 1 is selected from leucine and serine, at position 20 is alanine, at position 28 is asparagine, at position 39 is isoleucine, and/or at position 69 is glycine.
  • the substitution in the heavy chain variable region at position 68 is leucine, and/or the substitution in the light chain variable region at position 39 is isoleucine.
  • the substitution in the heavy chain variable region at position 48 is isoleucine.
  • the substitution in the heavy chain variable region at position 30 is glycine and/or at position 58 is valine, and the substitution in the light chain variable region at position 7 is proline and/or at position 69 is glycine.
  • the substitution in the light chain variable region at position 1 1 is serine.
  • the substitution in the heavy chain variable region at position 77 is serine, and/or the substitution in the light chain variable region at position 1 1 is leucine, at position 20 is alanine, and/or at position 28 is asparagine.
  • the substitution in the heavy chain variable region at position 37 is alanine, at position 63 is alanine, and/or position 80 is serine, and/or the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 76 is glutamic acid, and/or at position 77 is serine.
  • the substitution in the light chain variable region at position 1 1 is leucine.
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • an antibody or antigen binding fragment thereof capable of binding tau comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 23, HCDR2 comprises the amino acid sequence of SEQ ID NO: 24, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 25; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 26, LCDR2 comprises the amino acid sequence of SEQ ID NO: 27, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 28.
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 29 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 30.
  • an antibody or antigen binding fragment thereof capable of binding tau comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , or SEQ ID NO: 1 with a substitution at one or more of position 5 and 6, HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, or SEQ ID NO: 2 with a substitution at one or more of position 1 , 4, 5, 6, and 8, HCDR3 comprises the amino acid sequence of SEQ ID NO: 3, LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, or SEQ ID NO: 4 with a substitution at position 2, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, or SEQ ID NO: 5 with a substitution at
  • the substitution at position 5 in HCDR1 is glycine
  • the substitution at position 6 in HCDR1 is glycine
  • the substitution at position 1 in HCDR2 is valine
  • the substitution at position 4 in HCDR2 is alanine
  • the substitution at position 5 in HCDR2 is glycine
  • HCDR2 is serine
  • the substitution at position 8 in HCDR2 is valine
  • the substitution at position 2 in LCDR1 is asparagine
  • the substitution at position 3 in LCDR2 is glycine
  • the substitution at position 4 of LCDR3 is arginine
  • the substitution at position 6 in LCDR3 is threonine.
  • an antibody or antigen binding fragment thereof capable of binding tau wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 with a substitution at position 5, HCDR2 comprises the amino acid sequence of SEQ ID NO: 2 with a substitution at position 8, HCDR3 comprises the amino acid sequence of SEQ ID NO: 3, LCDR1 comprises the amino acid sequence of SEQ ID NO: 4 with a substitution at position 2, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and/or LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • an antibody or antigen binding fragment thereof capable of binding tau wherein the substitution at position 5 in HCDR1 is glycine, the substitution at position 8 in HCDR2 is valine, and/or the substitution at position 2 in LCDR1 is asparagine.
  • the antibody or antigen binding fragment thereof capable of binding tau comprises an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 41 ;
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO 34
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprise the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprise the amino acid sequence of SEQ ID NO 6;
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 32, HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6; or an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 35, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6; or an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 36
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 33
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 37
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 33
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 37
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6
  • an HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 39
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • an antibody or antigen binding fragment thereof capable of binding tau comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 43 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 44; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 45 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 46; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 47 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 48; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 49 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 50; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 51 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 52; or
  • the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 53 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 54; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 55 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 56; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 57 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 58; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 59 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 60; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 61 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 62; or
  • the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 63 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 64; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 65 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 66; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 67 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 68; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 69 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 70; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 71 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 72; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 73 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 74; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 75 and the light chain variable
  • antibody or antigen binding fragments that can compete for binding with an antibody or antigen binding fragment thereof defined by sequence, as disclosed in this paragraph.
  • an antibody or antigen binding fragment thereof disclosed herein can bind to the same epitope on tau protein 2N4R (SEQ ID NO: 9) as that of an antibody or antigen binding fragment thereof defined by sequence, as disclosed in this paragraph.
  • an antibody or antigen binding fragment thereof that is disclosed herein may bind to an epitope on tau comprising one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10).
  • the epitope comprises one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • an antibody or antigen binding fragment thereof that is disclosed herein may bind to an epitope on tau comprising residues 188-227 of tau protein 2N4R (SEQ ID NO: 10).
  • the epitope comprises residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the epitope may contain at least one, or more than one, phosphorylated residue, which may include a phospho- threonine at position 217 of tau protein 2N4R (SEQ ID NO: 9).
  • the epitope also comprises a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • the epitope comprises or consists of SRTPSLPpTPPTR (sequence of SEQ ID NO: 12).
  • the epitope comprises or consists of a region comprising more than one phosphorylated residue, e.g., SRpTPSLPpTPPTR (sequence of SEQ ID NO:
  • the epitope is determined by any method known to the skilled artisan. In some embodiments, alanine scanning or deletion/mutagenesis studies are used to determine the epitope. In some embodiments, mass spectrometry is used to determine the epitope. In certain embodiments, the epitope is determined by a crystal structure of the antibody-tau complex, where the epitope is defined as any contact residue on tau within 5 angstroms of the antibody binding pocket. In some embodiments, the antibody or antigen binding fragment comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 7 and a light chain variable region amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 29 and a light chain variable region amino acid sequence of SEQ ID NO: 30.
  • the antibody or antigen binding fragment comprises a heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 3, 30, 37, 48, 58, 63, 68, 76, 77, and 80, and/or light chain variable region comprises the amino acid sequence of SEQ ID SEQ ID NO: 8 with a substitution at one or more of position 7, 1 1 , 20, 28, 39, and 69.
  • the substitution in the heavy chain variable region at position 68 is leucine, and the substitution in the light chain variable region at position 39 is isoleucine.
  • the substitution in the heavy chain variable region at position 48 is isoleucine.
  • the substitution in the heavy chain variable region at position 30 is glycine and at position 58 is valine, and the substitution in the light chain variable region at position 7 is proline and at position 69 is glycine.
  • the substitution in the light chain variable region at position 1 1 is serine.
  • the substitution in the heavy chain variable region at position 77 is serine, and the substitution in the light chain variable region at position 1 1 is leucine, at position 20 is alanine, and at position 28 is asparagine.
  • the substitution in the heavy chain variable region at position 37 is alanine, at position 63 is alanine, and position 80 is serine, and the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 76 is glutamic acid, and at position 77 is serine.
  • the substitution in the light chain variable region at position 1 1 is leucine.
  • antibodies that can compete for binding to tau protein 2N4R (SEQ ID NO: 9) with an antibody comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 29 and a light chain variable region amino acid sequence of SEQ ID NO: 30.
  • the antibody or antigen binding fragment comprises a heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 3, 30, 37, 48, 58, 63, 68, 76, 77, and 80, and/or light chain variable region comprises the amino acid sequence of SEQ ID SEQ ID NO: 8 with a substitution at one or more of position 7, 1 1 , 20, 28, 39, and 69.
  • the substitution in the heavy chain variable region at position 68 is leucine
  • the substitution in the light chain variable region at position 39 is isoleucine.
  • the substitution in the heavy chain variable region at position 48 is isoleucine.
  • the substitution in the heavy chain variable region at position 30 is glycine and at position 58 is valine, and the substitution in the light chain variable region at position 7 is proline and at position 69 is glycine.
  • the substitution in the light chain variable region at position 1 1 is serine.
  • the substitution in the heavy chain variable region at position 77 is serine, and the substitution in the light chain variable region at position 1 1 is leucine, at position 20 is alanine, and at position 28 is asparagine.
  • the substitution in the heavy chain variable region at position 37 is alanine
  • at position 63 is alanine
  • position 80 is serine
  • the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 76 is glutamic acid, and at position 77 is serine. In various embodiments, the substitution in the light chain variable region at position 1 1 is leucine.
  • competition is measured by flow cytometry or fluorescence microscopy, ELISA, HTRF and/or SPR.
  • competition ELISA is used to measure competitive binding.
  • a BIACORE assay is used.
  • the antibody or antigen binding fragment with which the disclosed antibody competes comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 7 and a light chain variable region amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment with which the disclosed antibody competes comprises a heavy chain variable region amino acid sequence of SEQ ID NO: 29 and a light chain variable region amino acid sequence of SEQ ID NO: 30.
  • the antibody or antigen binding fragment with which the disclosed antibody competes comprises a heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 3,
  • the antibody or antibody fragment with which the disclosed antibody competes comprises a substitution in the heavy chain variable region at position 68 is leucine, and the substitution in the light chain variable region at position 39 is isoleucine.
  • the substitution in the heavy chain variable region at position 48 is isoleucine.
  • the substitution in the heavy chain variable region at position 30 is glycine and at position 58 is valine, and the substitution in the light chain variable region at position 7 is proline and at position 69 is glycine.
  • the substitution in the light chain variable region at position 1 1 is serine.
  • the substitution in the heavy chain variable region at position 77 is serine, and the substitution in the light chain variable region at position 1 1 is leucine, at position 20 is alanine, and at position 28 is asparagine.
  • the substitution in the heavy chain variable region at position 37 is alanine
  • at position 63 is alanine
  • position 80 is serine
  • the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 76 is glutamic acid, and at position 77 is serine. In various embodiments, the substitution in the light chain variable region at position 1 1 is leucine.
  • the antibody or antigen binding fragment can bind to the same one or more amino acids on tau protein 2N4R (SEQ ID NO: 9) as an antibody comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment with which the disclosed antibody competes can bind to an epitope on tau comprising one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10).
  • the epitope comprises one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the epitope comprises at least one phosphorylated residue.
  • the at least one phosphorylated residue comprises a phospho-threonine at position 217 of tau protein 2N4R (SEQ ID NO: 9), and optionally also comprise a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • the epitope comprises or consists of SRTPSLPpTPPTR (sequence of SEQ ID NO: 12).
  • the epitope comprises or consists of SRpTPSLPpTPPTR (sequence of SEQ ID NO: 31 ).
  • an antibody or antigen binding fragment thereof that can bind to a region or fragment of tau protein 2N4R comprising or consisting of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10), wherein the region or fragment is phosphorylated.
  • the region or fragment comprises or consists of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the region or fragment is phosphorylated at a position corresponding to residue 217 of tau protein 2N4R, and optionally also at one or more of positions corresponding to serine 210, threonine 212, serine 214, and threonine 220 of tau protein 2N4R (SEQ ID NO: 9).
  • the region or fragment of tau protein 2N4R comprises or consists of SRTPSLPpTPPTR (sequence of SEQ ID NO. 12).
  • the epitope comprises or consists of SRpTPSLPpTPPTR (sequence of SEQ ID NO: 31 ).
  • an antibody or antigen binding fragment disclosed herein can bind a phosphorylated epitope on tau, e.g., as measured by flow cytometry or fluorescence microscopy, ELISA, HTRF and/or SPR.
  • a phosphorylated epitope on tau e.g., as measured by flow cytometry or fluorescence microscopy, ELISA, HTRF and/or SPR.
  • ELISA as used to measure or check for binding to phosphorylated and dephosphorylated tau.
  • a BIACORE assay is used.
  • an antibody or antigen binding fragment thereof that can bind to an epitope on tau comprising one or more of residues 151 -188 of tau protein 2N4R (SEQ ID NO: 13).
  • the epitope on tau comprises one or more of residues 163-172 of tau protein 2N4R (SEQ ID NO: 14).
  • an antibody or antigen binding fragment thereof that can bind to an epitope on tau comprising residues 151 -188 of tau protein 2N4R (SEQ ID NO: 13).
  • the epitope on tau comprises residues 163-172 of tau protein 2N4R (SEQ ID NO: 14).
  • the epitope comprises or consist of KGQANATRIP (sequence of SEQ ID NO. 14).
  • one or more of the residues on the epitope are phosphorylated, e.g., a phosphorylated threonine at position 169 of tau protein 2N4R.
  • an antibody or antigen binding fragment thereof that can bind to a portion or fragment of tau comprising residues
  • the antibody or antigen binding fragment thereof that can bind to a portion or fragment of tau comprising residues 163-172 of tau protein 2N4R (SEQ ID NO: 14).
  • the epitope of an antibody disclosed herein is determined by any method known to the skilled artisan. In some embodiments, alanine scanning or deletion/mutagenesis studies are used to determine the epitope. In some embodiments, mass spectrometry is used to determine the epitope. In certain embodiments, the epitope is determined by a crystal structure of the antibody-tau complex, where the epitope is defined as any contact residue on tau within 5 angstroms of the antibody binding pocket.
  • an antibody or antigen binding fragment thereof capable of binding tau comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 15, HCDR2 comprises the amino acid sequence of SEQ ID NO: 16, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 17; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 18, LCDR2 comprises the amino acid sequence of SEQ ID NO: 19, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 15
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 16
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 17
  • LCDR1 comprises the
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 21 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 22.
  • an antibody or antigen binding fragments thereof can compete for binding to one or more amino acids on tau protein 2N4R (SEQ ID NO: 9) with the previously described antibody or antigen binding fragment thereof.
  • an antibody or antigen binding fragment thereof can bind the same epitope on tau protein 2N4R (SEQ ID NO: 9) bound by the antibody or antigen binding fragments previously disclosed in this paragraph.
  • an antibody or antigen binding fragment thereof can bind the fragment or region of tau protein 2N4R (SEQ ID NO: 9) bound by the antibody or antigen binding fragments previously disclosed in this paragraph.
  • any of the antibodies or antigen binding fragments described herein can comprise a heavy chain constant region and a light chain constant region.
  • the heavy chain constant region may be an IgG, IgM, IgA, IgD, and IgE isotype, or a derivative or fragment thereof that retains at least one effector function of the intact heavy chain.
  • the heavy chain constant region may be a human IgG isotype.
  • the heavy chain constant region may be a human lgG1 or human lgG4 isotypes.
  • the heavy chain constant region may be a human lgG1 isotype.
  • the light chain constant region may be a human kappa light chain or lambda light chain or a derivative or fragment thereof that retains at least one effector function of the intact light chain.
  • the light chain constant region may be a human kappa light chain.
  • any of the disclosed antibodies or antigen binding fragments may be a rodent antibody or antigen binding fragment thereof, a chimeric antibody or an antigen binding fragment thereof, a CDR-grafted antibody or an antigen binding fragment thereof, or a humanized antibody or an antigen binding fragment thereof.
  • any of the disclosed antibodies or antigen binding fragments comprises human or human-derived heavy and light chain variable regions, including human frameworks or human frameworks with one or more backmutations. See, e.g., the backmutation strategies outlined in U.S. Patent No. 7,566,771 , the disclosure of which is incorporated herein by reference.
  • any of the disclosed antibodies or antigen binding fragments may be a Fab, Fab’, F(ab’)2, Fd, scFv, (scFv)2, scFv-Fc, or Fv fragment.
  • antibody DC2E7 or a functional antigen binding fragment thereof is disclosed, wherein DC2E7 is an antibody produced by a hybridoma deposited under American Type Culture Collection Patent Deposit No. PTA-124992. In various embodiments, antibody DC2E2 or a functional antigen binding fragment thereof is disclosed, wherein DC2E2 is an antibody produced by a hybridoma deposited under American Type Culture Collection Patent Deposit No. PTA-124991 . Also disclosed are antibodies and antigen binding fragments that can bind to the same epitope on tau protein 2N4R (SEQ ID NO: 9) or can compete for binding to tau protein 2N4R (SEQ ID NO: 9) with either antibody DC2E7 or antibody DC2E2.
  • any of the disclosed antibodies or antigen binding fragments thereof may be conjugated to a second agent.
  • the second agent may be, e.g., at least one detectable agent, including but not limited to, an enzyme, a radioisotope, a fluorophore, a nuclear magnetic resonance marker, or a heavy metal.
  • the at least one detectable label is a radioisotope.
  • the antibody or antigen binding fragment conjugated to a detectable label comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment conjugated to a detectable label comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises amino acid sequence of SEQ ID NO: 23, HCDR2 comprises the amino acid sequence of SEQ ID NO: 24, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 25; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 26, LCDR2 comprises the amino acid sequence of SEQ ID NO: 27, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 28.
  • HCDR1 comprises amino acid sequence of SEQ ID NO: 23
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 24
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 25
  • LCDR1 comprises the
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 29 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 30.
  • the antibody or antigen binding fragment thereof conjugated to a detectable label comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3),
  • the antibody or antigen binding fragment conjugated to a detectable label comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 43 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 44; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 45 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 46; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 47
  • the antibody or antigen binding fragment conjugated to a detectable label may compete for binding or bind the same epitope as this antibody defined by sequence.
  • detectable labels include, but are not limited to, enzymes, radioisotopes and radionuclides, colloidal metals, fluorescent compounds, chemiluminescent compounds, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), and chemi/electrochemi/bioluminescent compounds.
  • a secondary reporter e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags
  • chemi/electrochemi/bioluminescent compounds chemi/electrochemi/bioluminescent compounds.
  • the enzymes include, but are not limited to, peroxidase (e.g., horse radish peroxidase), luciferase, alkaline phosphatase, b-galactosidase, glucose oxidase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, or glucose-6 phosphate dehydrogenase.
  • the label may be biotin, digoxin-genin, or 5-bromo-desoxyuridine.
  • Fluorescent labels can be also combined with the antibodies and antigen binding fragments thereof, including rhodamine, lanthanide phosphors, fluorescein and its derivatives, fluorochromes, rhodamine and its derivatives, green fluorescent protein (GFP), red fluorescent protein (RFP), dansyl, umbelliferone, and others.
  • conjugates may be prepared by methods known to a person skilled in the art. They can be bound with labels directly; via a spacer group or linkage group such as polyaldehyde, glutaraldehyde, ethylenediaminetetraacetic acid (EDTA) or diethylenetriaminepentaacetic acid (DPTA); or in the presence of other binding agents such as those routinely known in the art.
  • Other detectable labels may include radioactive labels such as iodine-123, iodine-125, iodine-126, iodine-133, iodine-131 , bromine-77, technetium-99m, indium- 1 13m, gallium-67, gallium-68, ruthenium-95, ruthenium-97, ruthenium-103, ruthenium-106, mercury-203, scandium-47, tellurium-121 m, tellurium-128, thulium- 165, thulium-167, thulium-168, fluorine-18, yttrium-99, and zirconium-89.
  • radioactive labels such as iodine-123, iodine-125, iodine-126, iodine-133, iodine-131 , bromine-77, technetium-99m, indium- 1 13m, gallium-67, gallium-68, ruthen
  • radioisotypes either directly or indirectly, e.g., via a chelating agent such as EDTA or DTPA, can be used.
  • a chelating agent such as EDTA or DTPA
  • any of the disclosed antibodies or antigen binding fragments can be conjugated to a second agent, where the second agent may be at least one therapeutic agent for Alzheimer’s disease or another tauopathy.
  • the antibody or antigen binding fragment conjugated to a therapeutic agent for Alzheimer’s disease comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment comprises any one or more (e.g., all six CDRs and/or a heavy and/or light chain variable domain) sequence selected fro those shown in Table 1 .
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 43 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 44; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 45 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 46; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 47 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 48; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 49 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 50; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 51 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 52; or the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 53 and the light chain variable region comprises the amino acid sequence of SEQ ID NO: 54; or the heavy chain variable variable region comprises the
  • the antibody or antigen binding fragment comprse is SEQ ID NOS: 29 and 30.
  • the antibody or antigen binding fragment conjugated to a therapeutic agent may compete for binding or bind the same epitope as this antibody defined by sequence.
  • the therapeutic agent may a passive immunotherapy against amyloid beta or tau, or an inhibitor of acetylcholinestarase.
  • the therapeutic agent may be selected from one or more of:, CAD106, Gantenerumab, Crenezumab, IVIG, AADvad , ACI-35, NIC5-15, CHF-5074, MK- 8931 , AZD 3293, LY33 14814, Elenbecestat, Tideglusib, Intranasal Humulin R, Intransal glulisine, SB742457 with donepezil, Azeliragon, Nivaldipine.
  • the therapeutic agent may be selected from:, Aducanumab, ALZT-OP1 a + ALZT-OP1 b, Aripiprazole, AVP-786, AZD3293 (LY3314814), Brexprprazole (OPC-34712), CAD106, CNP520, Elenbecestat, Insulin (humulin), Lumateperone, JNJ-5486191 1 , Methylphenidate, MK-4305 (suvorexant), Nabilone, Nilvadipine, Pioglitazone, RVT- 101 (intepirdine), Sodium Oligo-mannurarate (GV-971 ), TRx0237, TTp488
  • the anti-tau therapy comprises a small molecule or peptide vaccine therapy, or an anti-tau antibody therapy. See U.S. Patent No. 9,518,101 , which is incorporated by reference in its entirety.
  • an immunoconjugate having the formula (A)-(L)-(C), wherein: (A) is an antibody or antigen binding fragment thereof disclosed herein; (L) is an optional linker; and (C) is a second agent (e.g., a detectable label or a therapeutic agent for treating AD or another tauopathy); wherein the linker (L) joins (A) to (C).
  • (C) is a therapeutic agent, an imaging agent, a detectable agent, or a diagnostic agent.
  • these conjugates are referred to herein as antibody-drug-conjugates (ADCs).
  • Optional linker (L), as used herein, may be present or absent.
  • (L) is a molecule that is used to join the (A) to (C).
  • the linker is capable of forming covalent bonds to both the antibody and to the second agent.
  • Suitable linkers are well known to those of skill in the art and include, but are not limited to, straight or branched-chain carbon linkers, heterocyclic carbon linkers, or peptide linkers. Where the antibody and second agent are polypeptides, the linkers may be joined to the constituent amino acids through their side groups (e.g., through a disulfide linkage to cysteine).
  • the linkers may be joined to the alpha carbon amino and carboxyl groups of the terminal amino acids.
  • immunoconjugates may comprise linkages which are cleavable in the vicinity of the target site. Cleavage of the linker to release the second agent from the antibody may be prompted by enzymatic activity or conditions to which the immunoconjugate is subjected either inside the target cell or in the vicinity of the target site.
  • the linker unit is not cleavable and the drug is not released or is released, for example, by antibody degradation.
  • a number of different reactions are available for covalent attachment of drugs and/or linkers to antibodies or antigen binding fragments thereof. This is often accomplished by reaction of the amino acid residues of the antibody molecule, including the amine groups of lysine, the free carboxylic acid groups of glutamic and aspartic acid, the sulfhydryl groups of cysteine and various moieties of the aromatic amino acids.
  • One of the most commonly used non-specific methods of covalent attachment is the carbodiimide reaction to link a carboxy (or amino) group of a compound to amino (or carboxy) groups of the antibody.
  • bifunctional agents such as dialdehydes or imidoesters have been used to link the amino group of a compound to amino groups of an antibody molecule.
  • Schiff base reaction also available for attachment of drugs to antibodies is the Schiff base reaction. This method involves the periodate oxidation of a drug that contains glycol or hydroxyl groups, thus forming an aldehyde which is then reacted with the binding agent. Attachment occurs via formation of a Schiff base with amino groups of the binding agent.
  • Isothiocyanates can also be used as coupling agents for covalently attaching drugs to binding agents.
  • the linker is cleavable by a cleaving agent that is present in the intracellular environment (e.g., within a lysosome or endosome or caveolea).
  • the linker can be, e.g., a peptidyl linker that is cleaved by an intracellular peptidase or protease enzyme, including, but not limited to, a lysosomal or endosomal protease. See, e.g., Dubowchik and Walker, 1999, Pharm. Therapeutics 83:67-123.
  • Other examples of such linkers are described, e.g., in U.S. Pat. No. 6,214,345.
  • the cleavable linker is pH-sensitive, i.e., sensitive to hydrolysis at certain pH values.
  • the pH sensitive linker is hydrolysable under acidic conditions.
  • an acid-labile linker that is hydrolysable in the lysosome e.g., a hydrozone, semicarbazone, thiosemicarbazone, cis-aconitic aminde, orthoester, acetal, ketal, or the like
  • an acid-labile linker that is hydrolysable in the lysosome (e.g., a hydrozone, semicarbazone, thiosemicarbazone, cis-aconitic aminde, orthoester, acetal, ketal, or the like) can be used.
  • the linker is cleavable under reducing conditions (e.g., a disulfide linker).
  • disulfide linkers are known in the art, including, for example, those that can be formed using SATA (N-succinimidyl-S-acetylthioacetate), SPDP (N succinimidyl-3-(2-pyridyldithio)propionate), SPDB (N-succinimidyl-3-(2- pyridyldith io) butyrate) and SMPT (N-succinimidyl-oxycarbonyl-alpha-methyl-alpha(2 pyridyl-dithio)toluene)-, SPDB and SMPT.
  • SATA N-succinimidyl-S-acetylthioacetate
  • SPDP N succinimidyl-3-(2-pyridyldithio)propionate
  • SPDB N-succinimidyl-3-(2- pyridyldith io) butyrate
  • SMPT N-
  • the linker is a malonate linker (Johnson et al., 1995, Anticancer Res. 15:1387-93), a maleimidobenzoyl linker (Lau et al., 1995, Bioorg-Med-Chem. 3(10): 1299-1304), or a 3’-N-amide analog (Laur et al., 1995, Bioorg-Med-Chem. 3(10): 1305-12).
  • the linker unit is not cleavable and the drug is released by antibody degradation. (See U.S. Publication No. 2005/0238649).
  • the linker is not substantially sensitive to the extracellular environment.
  • "not substantially sensitive to the extracellular environment" in the context of a linker means that no more than about 20%, about 15%, about 10%, about 5%, about 3%, or no more than 1 % of the linkers, in a sample of antibody-drug conjugate compound, are cleaved when the antibody-drug conjugate compound presents in an extracellular environment (e.g., in plasma).
  • Whether a linker is not substantially sensitive to the extracellular environment can be determined, for example, by incubating with plasma the antibody-drug conjugate compound for a predetermined time period (e.g., 2, 4, 8, 16, or 24 hours) and quantifying the amount of free drug present in the plasma.
  • a predetermined time period e.g. 2, 4, 8, 16, or 24 hours
  • (L) can also comprise a spacer group or a linkage group such as polyaldehyde, glutaraldehyde, ethylenediaminetetraacetic acid (EDTA) or diethylenetriaminepentaacetic acid (DPTA).
  • a spacer group or a linkage group such as polyaldehyde, glutaraldehyde, ethylenediaminetetraacetic acid (EDTA) or diethylenetriaminepentaacetic acid (DPTA).
  • more than one second agent may be attached, either directly or by a linker, to an antibody or antigen binding fragment disclosed herein.
  • the ratio of second agent to antibody can range on average from about 1 :1 to about 1 :8. See U.S. Pat No. 7,498,298.
  • drug/antibody ratio of an ADC may be controlled in different ways. See
  • isolated nucleic acid(s) encoding at least one variable region of an immunoglobulin chain of any of the antibodies or antigen binding fragments described herein.
  • an isolated nucleic acid(s) encodes the antibody or antigen binding fragment of any one of the previously described antibodies or antigen binding fragments.
  • Other embodiments provide an isolated vector comprising the nucleic acids.
  • Another embodiment includes an isolated host cell comprising any of the nucleic acids or vectors.
  • the polynucleotides or nucleic acids encoding the antibodies or antigen binding fragments described herein can be, e.g., DNA, cDNA, RNA or synthetically produced DNA or RNA or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination.
  • the polynucleotide is part of a vector.
  • Such vectors can comprise further genes such as marker genes and/or control elements, allowing for the selection and/or expression of the vector in a suitable host cell and under suitable conditions.
  • the polynucleotide is operatively linked to one or more expression control sequences, allowing expression in prokaryotic or eukaryotic cells.
  • Expression of the polynucleotide may comprise transcription of the polynucleotide into translatable mRNA.
  • Regulatory elements ensuring expression in eukaryotic cells for example mammalian cells, are known to those skilled in the art. They usually comprise regulatory sequences ensuring initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional regulatory elements can include transcriptional as well as translational enhancers, and/or naturally associated or heterologous promoter regions.
  • polynucleotides encoding at least the CDRs and/or variable domain of the light and/or heavy chain can encode the variable domains of both immunoglobulin chains or only one.
  • the polynucleotides can be under the control of the same promoter or can be separately controlled for expression.
  • Possible regulatory elements permitting expression in prokaryotic host cells comprise, e.g., the PL, lac, trp or tac promoter in E.
  • coli and examples for regulatory elements permitting expression in eukaryotic host cells are the AOXI of GAL1 promoter in yeast or the CMV-, SV40-, RSV-promoter, CMV-enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells.
  • Beside elements that are responsible for the initiation of transcription can also comprise transcription termination signals, such as the SV40-poly-A site or the tk-poly-A site, downstream of the polynucleotide.
  • leader sequences capable of directing the polypeptide to a cellular compartment or secreting it into the medium can be added to the coding sequence of the polynucleotides and are known in the art.
  • the leader sequence(s) may be assembled in appropriate phase with translation, initiation and termination sequences, and optionally, a leader sequence capable of directing secretion of translated protein, or a portion thereof, into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including a C- or N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • suitable expression vectors include, without limitation, the Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8, pRc/CMV, PcDNAI , PcDNA3 (Invitrogen), and pSPORU (GIBCO BRL).
  • the expression control sequences can be eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic hosts can also be used.
  • the vector Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of nucleotide sequences, and, as desired, the collection and purification of the immunoglobulin light chains, heavy chains, light/heavy dimers or intact antibodies, binding fragments or other immunoglobulin forms can follow. See, e.g., Beychok, Cells of Immunoglobulin Synthesis, Academic Press, N.Y., (1979).
  • vectors particularly plasmids, cosmids, viruses, and bacteriophages can be used that comprise a polynucleotide encoding a variable domain of an immunoglobulin chain of an antibody of the present disclosure
  • the vector is an expression vector and/or gene transfer or targeting vector.
  • Expression vectors derived from viruses such as retrovirus, vaccina virus, adeno-associated virus, herpes virus, or bovine papilloma virus, can be used for delivery of the polynucleotides or vector of the present disclosure into targeted cell populations. Any methods that are known to those skilled in the art can be used to construct recombinant viral vectors. Alternatively, the polynucleotides and vectors provided by the invention can be reconstituted into liposomes for deliver to target cells.
  • the vector(s) containing the polynucleotides of the present disclosure can be transferred into a host cell by known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation can be used for other cellular hosts.
  • a host cell is transformed with a polynucleotide or vector described herein.
  • the host cell can be a prokaryotic or eukaryotic cell.
  • the poly nucleotide or vector that is present in the host cell can either be integrated into the genome of the host cell or it can be maintained extrachromosomally.
  • the host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell.
  • Preferred fungal cells are, for example, those of the genus Saccharomyces, such as S. cerevisiae.
  • the antibodies or antigen binging fragments thereof encoded by the polynucleotide can be glycosylated. Certain antibodies or antigen binding fragments thereof consistent with the present disclosure can also include an initial methionine amino acid residue.
  • a polynucleotide disclosed herein can be used to transform or transfect the host using any of the techniques commonly known to those of ordinary skill in the art. Furthermore, methods for preparing fused, operably linked genes and expressing them in, e.g., mammalian cells and bacteria are well-known in the art. In general, expression vectors containing promoter sequences which facilitate the efficient transcription of the inserted polynucleotide are use in connection with a host.
  • the expression vector typically contains an origin of replication, a promoter, and a terminator, as well as specific genes which are capable of providing phenotypic selection of the transformed cells.
  • Suitable source cells for DNA sequences and host cells for immunoglobulin expression and secretion can be obtained from a number of sources, such as the American Type Culture Collection (“Catalogue of Cell Lines and Hybridomas,” Fifth edition (1985) Manassas, Va., U.S.A., and other available version, incorporated herein by reference).
  • transgenic animals for example mammals, comprising cells of the invention can be used for large scale production of the antibodies or antigen binding fragments disclosed herein.
  • a hybridoma producing antibody DC2E7 is disclosed.
  • the hybridoma has been deposited at the American Type Culture Collection at Patent Deposit No. PTA-124992.
  • a hybridoma producing antibody DC2E2 is disclosed.
  • the hybridoma has been deposited at the American Type Culture Collection at Patent Deposit No. PTA-124991 .
  • an antibody or antigen binding fragment thereof described herein may be co-formulated and/or co-administered with one or more additional compounds that are also useful in the detection, prevention, and/or treatment of AD or another tauopathy.
  • an antibody or antigen binding fragment thereof described herein is formulated for use in an assay to detect phosphorylated tau in a biologic sample from a human subject (e.g., CSF or blood).
  • the antibody or antigen binding fragment thereof is conjugated to a detectable label, e.g., an enzyme, a radioisotope, a fluorophore, a nuclear magnetic resonance marker, or a heavy metal.
  • a detectable label e.g., an enzyme, a radioisotope, a fluorophore, a nuclear magnetic resonance marker, or a heavy metal.
  • two or more (e.g., 3, 4, 5, etc.) antibodies or antigen binding fragments described herein are formulated suitable for use in the assay.
  • the antibodies or antigen binding fragments comprise antibody clones DC2E7 or DC2E2 and/or antibodies or fragments comprising the CDRs or variable domains from those clones, alone or conjugated to suitable detectable labels.
  • the formulations further comprise additional elements and reagents (e.g., solid supports or particles such as magnetic beads) suitable for use in diagnostic assays such as the classic and digital ELISA assays described below.
  • the antibodies and antigen binding fragments described herein are prepared for use in methods of detecting phosphorylated tau in a biologic sample.
  • the antibodies can be prepared and formulated as discussed in Example 3 below.
  • the antibodies or antigen binding fragments e.g., DC2E7, DC149, DC807, and/or DC2E2 or antigen binding fragments or variants thereof, may be purified from serum-free hybridoma
  • the buffered antibody solution can be concentrated, e.g., by ultrafiltration.
  • DC2E7 or an antigen binding fragment when used as the capture antibody in the digital ELISA, may be prepared in a suitable buffer solution.
  • DC2E7 or an antigen binding fragment is immobilized on a solid support (e.g., a solid surface or ELISA capture bead).
  • a solid support e.g., a solid surface or ELISA capture bead.
  • DC2E7 or an antigen binding fragment is joined to a solid surface, e.g., as described according to Example 10 below.
  • DC2E7 may be coupled to a bead, e.g, a magnetic bead (Quanterix).
  • DC2E7 is coupled to the bead at a concentration of about 0.1 -5.0 mg/mL (e.g., about 1 .0 mg/mL).
  • DC2E2 or an antigen binding fragment is used as a detector antibody and may be conjugated to a detectable label.
  • the antibody or antigen binding fragment may be biotinylated for detection purposes, e.g., by exposure to 1 - 200 fold (e.g., about 120 fold) excess of biotin relative to the antibody concentration.
  • an antibody or antigen binding fragment thereof described herein may be co-formulated and/or co-administered with a detectable label.
  • the detectable label is an enzyme, a radioisotope, a fluorophore, a nuclear magnetic resonance marker, or a heavy metal.
  • the detectable label is in association (e.g., covalent or non-covalent) association with the antibody or antigen binding fragment.
  • Suitable additives and formulation conditions for antibody administration may be used, e.g., those known in the art for formulating antibodies for parenteral administration (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular), or intravenous, intramuscular or subcutaneous injection.
  • an antibody or antigen binding fragment thereof is formulated in combination with additional compounds that are also useful in the prevention and/or treatment of AD or another tauopathy.
  • additional compounds that are also useful in the prevention and/or treatment of AD or another tauopathy.
  • additional compounds that are also useful in the prevention and/or treatment of AD or another tauopathy.
  • these include, without limitation, compounds that are useful in active and passive immunotherapies for AD, such as beta-amyloid peptides (e.g., N-terminal amyloid beta peptides) and tau peptides which might or might not be conjugated to other compounds, such as mutated diphtheria toxin, KLH or other carriers.
  • antibodies against beta-amyloid such as bapineuzumab, solaneuzumab, gantenerumab, crenezumab, ponezumab, and IVIG immunoglobulin, other immunization therapies targeting Abeta oligomers, other tau antibodies, compounds preventing the hyperphosphorylation of tau, and other active and passive immunization therapies targeting tau aggregates.
  • beta-amyloid such as bapineuzumab, solaneuzumab, gantenerumab, crenezumab, ponezumab, and IVIG immunoglobulin
  • other immunization therapies targeting Abeta oligomers such as bapineuzumab, solaneuzumab, gantenerumab, crenezumab, ponezumab, and IVIG immunoglobulin
  • other immunization therapies targeting Abeta oligomers such as bapineuzumab, solaneuzumab, gantenerumab
  • an antibody or antigen binding fragment thereof described herein can be used in combination with at least one combination agent chosen from
  • acetylcholinesterase inhibitors e.g., donepezil, rivastigmine, galantamine, tacrine, nutritive supplements
  • N-Methyl-D-aspartate (NMDA) receptor antagonists e.g., memantine
  • inhibitors of DNA repair e.g., pirenzepine or a metabolite thereof
  • transition metal chelators e.g., growth factors, hormones, non-steroidal anti-inflammatory drugs (NSAID), antioxidants, lipid lowering agents, selective phosphodiesterase inhibitors, inhibitors of tau aggregation, inhibitors of protein kinases, inhibitors of anti- mitochondrial dysfunction drugs, neurotrophins, inhibitors of heat shock proteins, inhibitors of Lipoprotein-associated phospholipase A2, and any pharmaceutically acceptable salts thereof.
  • a disclosed antibody and/or tau- binding fragment thereof is combined with a cholinesterase inhibitor (ChEI) and/or memantine.
  • the combination agent is selected from the group consisting of an anti-apoptotic compound, a metal chelator, an inhibitor of DNA repair, 3-amino-1 -propanesulfonic acid (3APS), 1 ,3-propanedisulfonate (1 ,3PDS), a secretase activator, a beta-secretase inhibitor, a gamma-secretase inhibitor, a beta- amyloid peptide, a beta-amyloid antibody, a neurotransmitter, a beta-sheet breaker, an anti-inflammatory molecule, and a cholinesterase inhibitor.
  • the cholinesterase inhibitor is, rivastigmine, donepezil, galantamine, or a nutritive supplement.
  • the additional agent is selected from BACE inhibitors; muscarinic antagonists; cholinesterase inhibitors; gamma secretase inhibitors; gamma secretase modulators; HMG-CoA reductase inhibitors;
  • nonsteroidal anti-inflammatory agents N-methyl-D-aspartate receptor antagonists; anti-amyloid antibodies; vitamin E; nicotinic acetylcholine receptor agonists; CB1 receptor inverse agonists or CB1 receptor antagonists; an antibiotic; growth hormone secretagogues; histamine H3 antagonists; AMPA agonists; PDE4 inhibitors; GABAA inverse agonists; inhibitors of amyloid aggregation; glycogen synthase kinase beta inhibitors; promotors of alpha secretase activity; PDE-10 inhibitors and cholesterol absorption inhibitors.
  • alkanolsulfuric acids pages 39-51 ), cholinesterase inhibitors (pages 51 -56), NMDA receptor antagonists (pages 56-58), estrogens (pages 58-59), non-steroidal anti inflammatory drugs (pages 60-61 ), antioxidants (pages 61 -62), peroxisome proliferators-activated receptor (PPAR) agonists (pages 63-67), cholesterol-lowering agents (pages 68-75); amyloid inhibitors (pages 75-77), amyloid formation inhibitors (pages 77-78), metal chelators (pages 78-79), antipsychotics and anti-depressants (pages 80-82), nutritional supplements (pages 83- 89) and compounds increasing the availability of biologically active substances in the brain (see pages 89-93) and prodrugs (pages 93 and 94).
  • Other compounds that may be used in combinations include those described in Cummings et al., Alzheimer’s disease drug development pipeline: 2017, Alzheimer’s
  • compositions comprising an antibody or an antigen binding fragment thereof, as described herein, and another component, such as a carrier.
  • compositions/formulations comprising a humanized antibody or antigen binding fragment thereof, as described herein, and a carrier, e.g., a carrier suitable for diagnostic or therapeutic uses.
  • formulations and compositions of the antibodies used in accordance with the present disclosure are prepared for storage and/or
  • an antibody or antigen binding fragment thereof having the desired degree of purity by mixing an antibody or antigen binding fragment thereof having the desired degree of purity with optional carriers, e.g., pharmaceutically acceptable carriers, diluents, excipients or stabilizers (Remington’s Pharmaceutical Sciences 21 st edition, Mohr, M. Ed. (2006)), in the form of lyophilized formulations or aqueous solutions.
  • optional carriers e.g., pharmaceutically acceptable carriers, diluents, excipients or stabilizers (Remington’s Pharmaceutical Sciences 21 st edition, Mohr, M. Ed. (2006)
  • acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbezyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride, phenol, butyl or benyl alcholol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine,
  • the antibodies and antigen binding fragments thereof can be incorporated into pharmaceutical compositions suitable for administration to a subject.
  • the pharmaceutical composition comprises an antibody or antigen binding fragment thereof as disclosed herein and a
  • “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Additional examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In many cases, the composition will include isotonic agents, for example, sugars,
  • polyalcohols such as mannitol, sorbitol, or sodium chloride.
  • Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the antibody or antigen binding fragments thereof.
  • compositions described herein, comprising the disclosed antibodies or antigen binding fragments may be in a variety of forms. These include, for example, liquid, semi-liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
  • liquid solutions e.g., injectable and infusible solutions
  • dispersions or suspensions e.g., tablets, pills, powders, liposomes and suppositories.
  • compositions may also comprise buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide) and/or preservatives.
  • buffers e.g., neutral buffered saline or phosphate buffered saline
  • carbohydrates e.g., glucose, mannose, sucrose or dextrans
  • mannitol proteins
  • proteins polypeptides or amino acids
  • proteins e.glycine
  • antioxidants e.g., g., chelating agents such as EDTA or glutathione
  • adjuvants e.g., aluminum hydroxide
  • preservatives e.g., aluminum hydroxide
  • administration generally contain from about 0.1 milligram to about 500 milligrams of antibody or antigen binding fragment thereof per unit or container.
  • the active ingredient will ordinarily be present in an amount of about 0.5-99.999% by weight based on total weight of the composition.
  • the preferred dosage form depends on the intended use and/or mode of administration.
  • the antibodies or antigen binding fragments disclosed herein can traverse the blood-brain barrier or are formulated to traverse the blood- brain barrier.
  • Certain neurodegenerative diseases including AD and related tauopathies, are associated with an increase in permeability of the blood-brain barrier, such that the antibody or antigen binding fragment thereof can be readily introduced into the brain.
  • AD and related tauopathies are associated with an increase in permeability of the blood-brain barrier, such that the antibody or antigen binding fragment thereof can be readily introduced into the brain.
  • Methods for circumventing the blood-brain barrier include, but are not limited to, direct injection into the brain (see, e.g., Papanastassiou et al., Gene Therapy 9: 398-406 (2002)) and implanting a delivery device in the brain (see, e.g., Gill et al., Nature Med. 9: 589-595 (2003): and Gliadel Wafers, T.M., Guildford Pharmaceutical).
  • Methods of creating openings in the barrier include, but are not limited to, ultrasound (see, e.g., U.S. Patent Publication No. 2002/0038086), osmotic pressure (e.g., by administration of hypertonic mannitol (Neuwelt, E. A., Implication of the Blood-Brain Barrier and its Manipulation, Vols 1 & 2, Plenum Press, N.Y.
  • Lipid-based methods of transporting the antibody or antigen binding fragment thereof across the blood-brain barrier include, but are not limited to, encapsulating the antibody or antigen binding fragment thereof in liposomes that are coupled to active fragments thereof that bind to receptors on the vascular endosomes.
  • a composition can comprise any one or more antibodies or antigen binding fragments described herein and a carrier and/or diluent.
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO:
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen binding fragment comprises any one or more (e.g., all six CDRs and/or a heavy and/or light chain variable domain) sequence selected fro those shown in Table 1 .
  • the antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the antibody or antigen binding fragment comprseis SEQ ID NOS: 29 and 30.
  • the composition is suitable for use in a diagnostic assay, e.g., classic or digital ELISA.
  • the composition is a pharmaceutical composition and comprises a pharmaceutically-acceptable carrier.
  • a composition comprises any two antibodies or antigen binding fragments as previously described.
  • a composition comprises at least one further antibody or antigen binding fragment, and/or at least one additional agent.
  • one antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6; and the other antibody or anti
  • HCDR1 , HCDR2, and HCDR3 complementarity determining regions
  • the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3)
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 15
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 16
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 17
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 18
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 19
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • the first antibody or antigen binding fragment comprises any one or more (e.g., all six CDRs and/or a heavy and/or light chain variable domain) sequence selected fro those shown in Table 1 .
  • the antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the antibody or antigen binding fragment comprse is SEQ ID NOS: 29 and 30.
  • the second antibody or antigen binding fragment comprises any one or more (e.g., all six CDRs and/or a heavy and/or light chain variable domain) sequence selected fro those shown in Table 1.
  • the antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the antibody or antigen binding fragment comprseis SEQ ID NOS: 29 and 30.
  • the composition is suitable for use in a diagnostic assay, e.g., classic or digital ELISA.
  • the composition is a pharmaceutical composition and comprises a pharmaceutically-acceptable carrier. The pharmaceutical composition may further comprise at least one additional therapeutic agent for treating Alzheimer’s disease or another tauopathy.
  • the antibodies and compositions described herein can be used for various methods of treatment and prevention of AD and other tauopathies.
  • the antibodies and compositions can be used to detect patients suitable for anti-tau based treatments, to inform treatment selection, or to monitor the progress of treatment over time.
  • the antibodies and compositions disclosed herein can be used as direct treatments or preventions for AD and other tauopathies by administering one or more antibodies or compositions to a patient in need thereof.
  • compositions disclosed herein may be administered to a patient susceptible to, or otherwise at risk of, Alzheimer’s disease or another tauopathy.
  • the antibody or pharmaceutical composition is administered in an amount sufficient to eliminate or reduce the risk, lessen the severity, or delay the outset of the disease, including biochemical, histologic and/or behavioral symptoms of the disease, its complications and intermediate pathological phenotypes presenting during development of the disease.
  • compositions are administered to a patient suspected of, diagnosed with, and/or already suffering from such a disease in an amount sufficient to cure, or at least partially reduce, arrest, or reverse the symptoms of the disease (biochemical, histologic, and/or behavioral), including its complications and intermediate pathological phenotypes in development of the disease.
  • treating Alzheimer's disease refers to decreasing or preventing behavioral, functional, and cognitive deterioration over time.
  • behavioral, functional, and cognitive aspects of Alzheimer's Disease can be evaluated by any one or more of a series of standardized tests known to persons of ordinary skill in the art including, but not limited to, neuropsychological testing, the Mini-Mental State Exam, Mini-cog exam, Neuropsychiatric Inventory, Blessed Roth Dementia Rating Scale, Spanish and English Neuropsychological Assessment Scales (SENAS), Psychiatric Behavioral Assessment, Functional Assessment, Clock Drawing Test, Boston Naming Test.
  • patients may be diagnosed or monitored for treatment efficacy using any of the detection methods disclosed herein involving one or more of the disclosed antibodies or antigen binding fragments thereof.
  • the antibodies and pharmaceutical compositions disclosed herein may be administered to treat AD or another tauopathy in a patient.
  • the efficacy of an Alzheimer's disease treatment is
  • Alzheimer's Disease Assessment Scale-cognitive subscale ADAS-cog
  • CDR-sb Clinical Dementia Rating Sum of Boxes
  • ADCS-ADL Alzheimer’s Disease Cooperative Study Activities of Daily Living Scale
  • NPI Neuropsychiatric inventory
  • PDS Progressive Deterioration Scale
  • IADL Amsterdam Instrumental Activities of Daily Living
  • CDR Clinical Dementia Rating Scale
  • DAD Disability Assessment for Dementia Scale
  • MMSE Mini-Mental State Evaluation
  • the treatment results in a reduction in the rate of deterioration in ADAS-cog scores. In other embodiments, the treatment results in a median reduction in the rate of deterioration of ADAS-cog scores of two to five points.
  • a method of delaying the progression of Alzheimer’s disease comprising administering one or more of the disclosed antibodies, e.g., antibody DC2E7 or an antibody or antigen binding fragment that binds the same epitope as, or comprises the CDRs or variable domains from, antibody DC2E7.
  • “delaying” progression of AD means to defer, hinder, slow, retard, stabilize, and/or postpone development of the disease. This delay can be for a varying length of time, depending on the history of the disease and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease.
  • a method that“delays” progression of AD or another tauopathy is a method that reduces the probability of disease
  • AD or another tauopathy may be delayed by days, months, or years.
  • the method may delay progression of AD or another tauopathy by one or more weeks, months, or years.
  • Patients, subjects, or individuals include mammals, such as human, bovine, equine, canine, feline, porcine, and ovine animals.
  • the subject may be a human, and may or may not be afflicted with disease or presently show symptoms.
  • AD virtually anyone is at risk of suffering from AD if he or she lives long enough. Therefore, the present methods may be administered prophylactically to the general population without the need for any assessment of the risk of the subject patient.
  • the subject is assessed for AD using a detection method disclosed herein.
  • the patient herein is optionally subjected to a diagnostic test prior to therapy, which may include the diagnostic methods disclosed herein.
  • the disclosed methods are useful for individuals who have a known genetic risk of AD.
  • individuals include those having relatives who have experienced this disease and those whose risk is determined by analysis of genetic or biochemical markers.
  • Genetic markers of risk towards AD include mutations in the APP gene, particularly mutations at position 717 and positions 670 and 671 referred to as the Hardy and Swedish mutations, respectively. See Hardy (1997) Trends Neurosci. 20:154-9).
  • Other markers of risk are mutations in the presenilin genes,
  • PS1 PS2, and ApoE4 family history of AD, hypercholesterolemia or atherosclerosis.
  • Individuals presently suffering from AD may also be identified from behavioral characteristics.
  • treatment can begin at any age (e.g., 10, 20, 30). In some patients, it may not be necessary to begin treatment and/or monitoring until a patient reaches an older age, e.g., 40, 50, 60, or 70, or later, or any time period in between. Treatment may entail multiple dosages over a period of time. Treatment can be monitored in various ways, including by using the AD detection methods disclosed herein.
  • An improved score in one or more tests is an indication of decrease in severity of AD in that subject.
  • a method of treating, delaying progression, or preventing the progression of Alzheimer’s disease of another tauopathy in a subject comprising administering to the subject an effective amount of at least one antibody or antigen binding fragment described herein.
  • This method may result in reducing motor impairment, improving motor function, reducing cognitive impairment, improving cognitive function, or a combination thereof.
  • the use of any antibody described herein may be used in treating, delaying progression, or preventing Alzheimer’s disease by administering the antibody or antigen binding fragment to a subject in need thereof.
  • the disclosure herein focuses, in part, on the discovery of certain epitope residues on tau, particularly those containing one or more phosphorylated resiudes on tau, that can be detected in certain biological samples (e.g., blood or CSF) and used to identify and distinguish AD, other tauopathies, and other forms of dementia.
  • the useful epitope residues may comprise one or more of residues
  • the epitope comprises one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ). In certain embodiments, the epitope comprises at least one phosphorylated residue, e.g., phospho-threonine at position 217 of tau protein 2N4R (SEQ ID NO: 9), and optionally also comprises a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • phosphorylated residue e.g., phospho-threonine at position 217 of tau protein 2N4R (SEQ ID NO: 9)
  • the epitope comprises or consists of SRTPSLPpTPPTR (sequence of SEQ ID NO: 12) or that stretch of amino acid residues with one or more additional phophorylated positions in it.
  • the epitope comprises or consists of SRpTPSLPpTPPTR (sequence of SEQ ID NO: 31 ).
  • the level of these phosphorylated epitopes can be used to distinguish AD, other tauopathies, and other forms of dementia in certain samples is particularly unexpected given the fact that the phosphorylated epitopes can often be detected in the brain across different tauopathies.
  • the disclosure provided herein also focuses, in part, on antibodies (e.g., any antibodies comprising one or more sequences shown in Table 1 , e.g., all six CDRs and/or a heavy and/or light chain variable domain selected from those shown in Table 1 ) that are capable of binding to these particular phosphorylated tau epitopes in certain types of biological samples (e.g., CSF or blood) and are particularly useful for identifying and distinguishing AD, other tauopathies, and other forms of dementia based on the level of binding in the samples.
  • antibodies e.g., any antibodies comprising one or more sequences shown in Table 1 , e.g., all six CDRs and/or a heavy and/or light chain variable domain selected from those shown in Table 1
  • antibodies e.g., any antibodies comprising one or more sequences shown in Table 1 , e.g., all six CDRs and/or a heavy and/or light chain variable domain selected from those shown in Table 1
  • antibodies e.g.,
  • the disclosure is based in part on the surprising finding that the amount of phosphorylated tau species bound by the disclosed antibodies in these samples can be used to distinguish AD from other tauopathies and from subjects with other forms of dementia, and thereby diagnose, monitor, and/or guide treatment decisions for AD or for another tauopathy or for another cause of dementia based on the results of the assay.
  • FTD frontotemporal dementia
  • CBD corticobasal disease
  • PPP progressive supranuclear palsy
  • tau species are present in certain types of samples (e.g., blood and/or CSF) from both healthy subjects and those with dementia.
  • samples e.g., blood and/or CSF
  • antibodies that can bind to particular tau species in these samples such that they can provide diagnostic power (e.g., antibodies that bind to tau species only present in samples from subject with AD and/or other tauopathies or present in samples from those subjects at elevated and/or distinct levels) have not previously been identified.
  • an antibody or antigen binding fragment disclosed herein provides an improvement over the art because of its ability to bind a phosphorylated epitope on tau that is present in certain types of samples (e.g., blood or CSF) from a patient with AD at a greater level than in a comparable sample from a patient with another tauopathy, other neurologic disease, or in a healthy subject. This difference can be used, in some embodiments, to detect whether a subject presenting with dementia has AD, another tauopathy, or another cause of dementia, and/or to monitor the course of AD treatment.
  • samples e.g., blood or CSF
  • distinct thresholds or fold differences in the amount of tau bound by the antibody can be detected and correlated with AD, another tauopathy, or another cause of dementia in a subject.
  • this difference can be used to detect whether a subject presenting with dementia has AD or another tauopathy.
  • this difference can be used to detect whether a subject presenting with dementia has AD or some other cause of dementia.
  • this difference can be used to distinguish whether a subject presenting with dementia has AD or another tauopathy.
  • this difference can be used to distinguish whether a subject presenting with dementia has AD or some other cause of dementia.
  • a method of detecting a tauopathy in a subject comprising: obtaining a biological sample from the subject; contacting the sample from the subject with an effective amount of a molecule that is capable of forming a tau-molecule complex (e.g., at least one receptor, antibody, or antigen binding fragment disclosed hererin that is capable of binding tau to form a tau- antibody complex); detecting the presence and/or amount of the tau-molecule complex using an antibody or antigen binding fragment disclosed herein; wherein the presence and/or amount of tau-molecule complex indicates a tauopathy in the subject.
  • a molecule that is capable of forming a tau-molecule complex e.g., at least one receptor, antibody, or antigen binding fragment disclosed hererin that is capable of binding tau to form a tau- antibody complex
  • detecting the presence and/or amount of the tau-molecule complex using an antibody or antigen binding fragment disclosed herein; wherein the presence and/or amount of tau-molecule complex indicates a tauopathy in the subject.
  • a method of detecting a tauopathy in a subject comprises: contacting a biological sample from the subject with an effective amount of at least one antibody or antigen binding fragment disclosed herein that is capable of binding tau to form a tau-antibody complex, wherein the presence and/or amount of tau-antibody complex indicates a tauopathy in the subject.
  • detection is by an immunomagnetic reduction bio-assay, e.g., using a bioassay device from MagQu Co. Ltd.
  • the tau detected in the sample is a phosphorylated tau.
  • the at least one antibody or antigen binding fragment can bind an epitope on tau comprising one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO:10).
  • the at least one antibody or antigen binding fragment can bind an epitope on tau comprising one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO:1 1 ).
  • the antibody or antigen binding fragments used in the methods comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen binding fragment used in the methods comprise a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain
  • HCDR1 , HCDR2, and HCDR3 complementarity determining regions
  • the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3)
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 with a substitution at position 2
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2 with a substitution at one or more of position 2 and 12
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4 with a substitution at position
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the substitution at position 2 in HCDR1 is glycine
  • the substitution at position 2 in HCDR2 is isoleucine
  • the substitution at position 12 in HCDR2 is valine
  • the substitution at position 2 in LCDR1 is asparagine.
  • the antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the antibody or antigen binding fragment used in the methods comprise a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment used in the disclosed methods may, in various embodiments, comprise DC2E7 or an antigen binding fragment thereof or any of the variants disclosed herein that are capable of binding to tau.
  • the antigen or antigen binding fragment further comprises a detectable label.
  • the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or SEQ ID NO: 7 with a substitution at one or more of position 1 , 2, 3, 9, 12, 19, 30, 31 , 35, 37, 42, 43, 48, 49, 51 , 54, 55, 56, 58, 62, 63, 64, 65, 66, 68, 69, 70, 73, 76, 77, 78, 79, 80, 83, 84, 88, 94, 96, 107, 108, and 1 12, and/or the light chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 8 with a substitution at one or more of position 3, 7, 1 1 , 14, 17, 19, 20, 21 , 24, 25, 28, 39, 42, 49, 52, 56, 69, 71 , 75, 92, 94, 99, 105, and 106.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 2 is alanine, at position 3 is arginine, at position 9 is arginine, at position 12 is alanine, at position 19 is arginine, at position 30 is glycine, at position 31 is glycine, at position 35 is arginine, at position 37 is alanine, at position 42 is glycine, at position 43 is methionine, at position 48 is isoleucine, at position 49 is threonine, at position 51 is valine, at position 54 alanine, at position 55 is glycine, at position 56 is serine, at position 58 is valine, at position 62 is glycine, at position 63 is alanine, at position 64 is selected from alanine and glutamic acid, at position 65 is glutamic acid, at position 66 is aspartic acid, at position 68 is leucine, at position 69 is alanine, at position 62 is
  • the substitution in the heavy chain variable region at position 68 is leucine, and the substitution in the light chain variable region at position 39 is isoleucine.
  • the substitution in the heavy chain variable region at position 48 is isoleucine.
  • the substitution in the heavy chain variable region at position 30 is glycine and at position 58 is valine, and the substitution in the light chain variable region at position 7 is proline and at position 69 is glycine.
  • the substitution in the light chain variable region at position 1 1 is serine.
  • the substitution in the heavy chain variable region at position 77 is serine, and the substitution in the light chain variable region at position 1 1 is leucine, at position 20 is alanine, and at position 28 is asparagine.
  • the substitution in the heavy chain variable region at position 37 is alanine, at position 63 is alanine, and position 80 is serine, and the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 76 is glutamic acid, and at position 77 is serine.
  • the substitution in the light chain variable region at position 1 1 is leucine.
  • the antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the method comprises contacting a biological sample from a subject (e.g., blood or CSF) with at least one capture antibody and at least one detection antibody. In some embodiments, more than one capture antibody and/or more than one detection antibody is used. In some embodiments, the capture and detection antibodies are the same (e.g., when detecting tau oligomers in a sample). In some embodiments, a first antibody or antigen binding fragment (e.g., a detection antibody) capable of forming a tau-antibody complex, and wherein the presence of the tau-antibody complex is detecting using a second anti-tau antibody or antigen binding fragment (e.g., a detection antibody) disclosed herein. In some embodiments, the second antibody or antigen binding fragment binds a different epitope on tau than the first antibody.
  • a first antibody or antigen binding fragment e.g., a detection antibody
  • a second anti-tau antibody or antigen binding fragment e.g., a detection antibody
  • the first antibody or antigen binding fragment can bind an epitope on tau comprising one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10) or one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the epitope may comprise at least one phosphorylated residue at position 217 of tau protein 2N4R (SEQ ID NO: 9) and optionally also may comprise a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • the epitope on tau comprises or consists of SRTPSLPpTPPTR (SEQ ID NO: 12). In certain embodiments, the epitope on tau comprises or consists of SRpTPSLPpTPPTR (SEQ ID NO 31 ).
  • the first antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of
  • the first antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the first antibody or antigen binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the first antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 23, HCDR2 comprises the amino acid sequence of SEQ ID NO: 24, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 25; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 26, LCDR2 comprises the amino acid sequence of SEQ ID NO: 27, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 28.
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 29 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 30.
  • the second antibody or antigen binding fragment may bind to an epitope on tau comprising one or more of residues 151 -188 of tau protein 2N4R (SEQ ID NO: 13).
  • the epitope comprises one or more of residues 163-172 of tau protein 2N4R (SEQ ID NO: 14).
  • one or more of the residues on the epitope are phosphorylated, e.g., a phosphorylated threonine at position 169 of tau protein 2N4R.
  • the second antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 15, HCDR2 comprises the amino acid sequence of SEQ ID NO: 16, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 17; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 18, LCDR2 comprises the amino acid sequence of SEQ ID NO: 19, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 15
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 16
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 17
  • LCDR1 comprises the amino acid sequence of S
  • the second antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 21 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 22.
  • the second antibody or antigen binding fragment comprises antibody DC2E2 or an antigen binding fragment thereof.
  • first and second antibodies are reversed, and/or more than one first and second antibody are used (which may be the same or different antibodies).
  • the first antibody or antigen binding fragment may bind to an epitope on tau comprising one or more of residues 151 -188 of tau protein 2N4R (SEQ ID NO: 13).
  • the epitope comprises one or more of residues 163-172 of tau protein 2N4R (SEQ ID NO: 14).
  • one or more of the residues on the epitope are phosphorylated, e.g., a phosphorylated threonine at position 169 of tau protein 2N4R.
  • the first antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the first antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 15, HCDR2 comprises the amino acid sequence of SEQ ID NO: 16, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 17; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 18, LCDR2 comprises the amino acid sequence of SEQ ID NO: 19, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 15
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 16
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 17
  • LCDR1 comprises the amino acid sequence of S
  • the first antibody or antigen binding fragment comprises a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 21 and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 22.
  • the first antibody or antigen binding fragment comprises antibody DC2E2 or an antigen binding fragment thereof.
  • the second antibody or antigen binding fragment can bind an epitope on tau comprising one or more of residues 188-227 of tau protein 2N4R (SEQ ID NO: 10) or one or more of residues 210-221 of tau protein 2N4R (SEQ ID NO: 1 1 ).
  • the epitope bound by the second antibody or antigen binding fragment may comprise at least one phosphorylated residue at position 217 of tau protein 2N4R (SEQ ID NO: 9).
  • the epitope also comprises a phosphorylated serine at position 210, threonine at position 212, serine at position 214, or threonine at position 220 of tau protein 2N4R, or any combination thereof.
  • the second antibody may bind an epitope on tau comprising SRTPSLPpTPPTR (SEQ ID NO: 12).
  • the second antibody or antigen binding fragment comprises any of the sequences shown in table 1 , e.g., a set of six CDRs and/or paired heavy and light chain variable domain sequences listed in Table 1 .
  • the second antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the second antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the second antibody or antigen binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the first or second antibody or antigen binding fragment is linked and/or coated onto a solid surface or particle.
  • the solid surface may be the surface of a microtiter plate.
  • a microtiter plate or multiwell plate typically has, e.g., 6, 12, 24, 48, 96, 384, or 1536 or more sample wells arranged in a 2:3 rectangular matrix. Each well typically holds somewhere between tens of nanoliters to several milliliters of liquid. If a solid particle is used in place of or in addition to a solid surface, it may be a bead.
  • the particle may be a magnetic bead.
  • the bead may be a plastic or synthetic polymer bed comprising: polyethylene, polypropylene, polystyrene, polyamide, polyurethane, phenolic polymer, nitrocellulose, naturally derived polymer, latex rubber, polysaccharide, polypeptide, composite material, ceramic, silica or silica-based material, carbon, metal or metal compound, gold, silver, steel, aluminum, copper, inorganic glass, or silica material, or a combination thereof.
  • the bead may have a spherical, disk, ring, or cube-like shape.
  • the first and/or second antibody is conjugated to a detectable label.
  • the label may comprise an enzyme, a radioisotope, biotin, a nuclear magnetic resonance marker, a heavy metal, or a combination thereof.
  • the method may further comprise detecting a signal from the detectable label. In one embodiment, detecting the label is achieved by detection of a fluorescent signal or the intensity of that signal from a labeled antibody following binding to tau.
  • the detectable label is biotin and it is detected by contacting the sample with streptavidin conjugated to an enzyme, preferably horse radish peroxidase, alkaline phosphatase, or b-galactosidase.
  • the tau detection methods disclosed herein comprises a classic/conventional ELISA assay (i.e., analog readout systems).
  • the methods may comprise a digital ELISA (i.e., digital readout systems which enable concentrations to be determined digitally rather than by measurement of the total analog signal down to a single immunocomplex, although, at some concentrations, these methods can also be used to read analog signals).
  • a digital ELISA i.e., digital readout systems which enable concentrations to be determined digitally rather than by measurement of the total analog signal down to a single immunocomplex, although, at some concentrations, these methods can also be used to read analog signals.
  • a single-molecule array (simoa) may be used, which is a digital ELISA in which, after the formation of a sandwich complex on magnetic microbeads, the beads are transferred, in substrate solution, to an array of micro wells, e.g., femtoliter-sized micro wells. In some embodiments, these wells accommodate only one bead each.
  • an oil film is then applied to seal the wells to a small volume, e.g., confining the reaction volume to 50 fL. In some embodiments, this small volume allows for a readable signal to be detected even if only one sandwich complex is present on the bead.
  • the enzyme b-galactosidase and the substrate resorufin ⁇ -D- galactopyranoside may be used and the wells having a detectable signal are counted as are all the wells containing a bead.
  • the ratio between these counts can provide an average enzyme output per bead (AEB).
  • AEB average enzyme output per bead
  • Poisson statistics may be used to show that either a bead has only one or less complex on its surface.
  • the AEB signal gets higher, increasing the probability of more than one complex per bead, a transition to light intensity calculations may be used, which allows for a usable AEB even at signals >0.1 .
  • the algorithm for the transition may be implemented using software for a Simoa instrument, e.g., software which samples and calibrates, e.g., from a 96-well microtiter plate or separate vials.
  • SMC single-molecule counting
  • a single-molecule counting (SMC) platform may be used, e.g., one in which antibodies with and without fluorescent labels form sandwich complexes with tau, either on beads or plates, the complexes are then broken up and the molecules of fluorescently labeled (e.g., Alexa Fluor) detection antibody are drawn into a capillary tube and counted as they pass a laser beam that excites the fluorophore.
  • a digital event can be counted if the fluorescence reaches above a background threshold.
  • detection is by single-molecule counting, e.g., using a single-molecule counting device from Merck Millipore (developed by Singulex).
  • Another high sensitive immunoassay that may be used involves attaching magnetic nanoparticles to an antibody disclosed herein, and detecting an alteration in the oscillation of the nanoparticles in an alternating magnetic field in a concentration-dependent manner after binding to the analyte, e.g., detecting immunomagnetic reduction (IMR).
  • detection is by an immunomagnetic reduction bio-assay, e.g., using bio-assay from MagQu Co. Ltd.
  • a sample may be diluted prior to being contacted with an antibody or antigen binding fragment thereof.
  • circulating antigens can be masked by naturally existing antibodies against those antigens that also circulate in the blood.
  • the HIV protein p24 is a well-known example.
  • naturally existing tau/anti-tau antibody complexes have been reported in the literature. Wu J, Li L. Autoantibodies in Alzheimer’s disease: potential biomarkers, pathogenic roles, and therapeutic implications. Journal of Biomedical Research. 2016;30(5):361 -372. The presence of those complexes may interfere with the detection assays disclosed herein.
  • the sample may be subjected to immune complex dissociation (ICD) (e.g., dissociating naturally existing tau-antibody/tau-molecule complex in the sample such that tau is no longer bound to the naturally existing antibody/molecule and is thus free to be detected by the methods of the disclosure) prior to being contacted with an antibody or antigen binding fragment of the disclosure.
  • ICD immune complex dissociation
  • immune complex dissociation is achieved by applying heat and/or acid to the sample or any other known method of achieving ICD.
  • the biological sample can comprise cerebrospinal fluid (CSF).
  • CSF can be obtained from a patient, e.g., by a lumbar puncture performed in a medical setting.
  • the biological sample can comprise blood plasma and/or or serum.
  • the methods disclosed herein detect the presence and/or amount of a phosphorylated tau in a sample, which is compared to the amount of phosphorylated tau in the sample to the level in a control sample from a healthy individual, and wherein an increase in the level of phosphorylated tau in the sample over the control indicates a tauopathy.
  • the detected tauopathy is Alzheimer’s disease.
  • an increase in the level of phosphorylated tau in a sample from a subject over a sample from a healthy control and/or a patient with a known non-AD tauopathy sample indicates the subject has Alzheimer’s disease rather than another tauopathy or another cause of dementia.
  • a 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, or more fold increase in the level of tau detected by an antibody or antigen binding fragment (or any fold increase in between) in a sample from a subject with dementia as compared to the level in a control sample from a healthy subject may indicate the presence of AD or another tauopathy.
  • the fold increase is between about 1 -100 fold, or about 2-3 fold. In some embodiments, the fold increase is between about 1 -50, 1 -25, 1 -10, or 1 -5 fold.
  • a level of bound tau in a sample from a subject with dementia greater than a threshold e.g., 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 1 .5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 9.3 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 pg/ml, or any value in between) observed in a control sample from a healthy subject may indicate the presence of AD or another tauopathy.
  • a threshold e.g., 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 1 .5, 2, 2.5, 3, 4, 5, 6, 7, 8,
  • the threshold is about 9.3 pg/ml of tau. In some embodiments, the threshold is any value between 0.93 and 93 pg/ml of tau. In some embodiments, the threshold is about 5.37 pg/ml. In some embodiments, the threshold is about 305 pg/ml. In some
  • the threshold is about 100-600 pg/ml. In some embodiments, a 0.1 ,
  • the fold increase is between about 1 - 100 fold, or about 1 -50 fold, or about 1 -25 fold, or about 1 -5 fold, or about 2-3 fold.
  • a level of bound tau in a sample from a subject with dementia greater than a threshold e.g., 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 1 .5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 9.3, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45,
  • a threshold e.g., 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 , 1 .5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 9.3, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45,
  • the level of tau detected by antibody binding is quantified using routine methods, e.g., by measuring fluorescence intensity, by Western blot, mass spectrometry, classic ELISA, digital ELISA, or other methods known to the skilled artisan.
  • the threshold is about 0.1 -10 pg/ml when the detection assay is calibrated using a phosphorylated tau protein, i.e., a full-length tau protein comprising one or more phosphorylated positions. In some embodiments, the threshold is about 100-600 pg/ml when the detection assay is calibrated using a 2E7 synthetic peptide (2E7pep) with the following sequence:
  • a biological sample from the subject comprising: obtaining a biological sample from the subject; contacting the sample from the subject with an effective amount of a molecule that is capable of forming a tau-molecule complex (e.g., at least one receptor, or antibody, or antigen binding fragment disclosed hererin that is capable of binding tau to form a tau-antibody complex); detecting the presence and/or amount of the tau-molecule complex using an antibody or antigen binding fragment disclosed herein; wherein the presence and/or an elevated level of phosphorylated tau bound to the molecule in the sample relative to the level in a sample from a healthy control subject and/or relative to the level in a sample from a subject with a known tauopathy other than AD (e.g., FTD, CBD, or PSP) indicates the subject has Alzheimer’s disease rather than another tauopathy or an alternative cause of dementia.
  • a tau-molecule complex e.g., at least one receptor, or antibody, or antigen binding fragment disclosed hererin that is capable of binding tau to form a tau-antibody complex
  • the subject with Frontotemporal dementia may have Nonfluent/Agrammatic Primary Progressive Aphasia (nfPPA), Semantic Variant Primary Progressive Aphasia (svPPA), Behavioral Variant Frontotemporal Dementia (bvFTD), or Amyotrophic Lateral Sclerosis/Frontotemporal Dementia (ALS/FTD).
  • nfPPA Nonfluent/Agrammatic Primary Progressive Aphasia
  • svPPA Semantic Variant Primary Progressive Aphasia
  • bvFTD Behavioral Variant Frontotemporal Dementia
  • ALS/FTD Amyotrophic Lateral Sclerosis/Frontotemporal Dementia
  • a method for distinguishing Alzheimer’s disease from another tauopathy or another cause of dementia in a subject comprising: obtaining a cerebrospinal fluid or blood sample from a subject;
  • the method uses an antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 ,
  • HCDR2, and HCDR3 wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6, wherein the antibody or antigen binding fragment is capable of binding to phosphorylated tau to form a phosphorylated tau-antibody complex; and detecting the presence and/or amount of phosphorylated tau complexed with the antibody or antigen binding fragment in the sample, wherein the presence and/or an elevated level of
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the antibody-tau complex is detected with a second antibody or antigen binding fragment thereof capable of binding tau.
  • the second antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 15, HCDR2 comprises the amino acid sequence of SEQ ID NO: 16, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 17; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 18, LCDR2 comprises the amino acid sequence of SEQ ID NO: 19, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • the second antibody or antigen binding fragment comprises a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 21 and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 22.
  • second antibody or antigen binding fragment comprises antibody DC2E2 or an antigen binding fragment thereof.
  • the detection and capture antibodies are reversed.
  • a method of treatment comprising administering a therapeutic agent for Alzheimer’s disease to a subject suffering from Alzheimer’s disease, wherein the subject has been identified as having Alzheimer’s disease according to any of the preceding methods.
  • Treatment may comprise administering an antibody, therapeutic peptide, or small molecule that treats AD, e.g., any of the treatments mentioned herein.
  • therapeutic agents may include one or more of the antibodies or therapeutic peptides disclosed in U.S. Patent No. 9,518,101 and/or WO 2016/079597, which are hereby
  • the therapeutic agent may be antibody DC2E7 or an antigen binding fragment thereof and/or DC2E2, or an antigen binding fragment thereof.
  • the therapeutic agent may be an antibody or an antigen binding fragment thereof that binds to the same epitope as DC2E7 and/or DC2E2.
  • detectable labels e.g., radiolabels
  • a subject can be administered (e.g., intravenously) to a subject to detect the pattern of phosphorylated tau in the brain and thereby diagnose AD or another tauopathy.
  • a method of detecting Alzheimer’s disease or another tauopathy in a human subject comprising administering to the subject the antibody or antigen binding fragment disclosed herein conjugated to a detectable label such as a radioisotope and detecting a signal from the radioisotope or other detectable label in the brain of the patient, wherein the detection of a signal indicates the subject has Alzheimer’s disease or another tauopathy.
  • a detectable label such as a radioisotope
  • the brain distribution of tau species bound by the disclosed antibodies and antigen binding fragments conjugated to detectable labels may be used to deteremine whether a subject has AD or another tauopathy.
  • antibody binding may differ in AD (where the tau species may be more prominent in hippocampus CA1 ) as compared to other tauopathies such as FTD - Pick’s disease (where the tau species may be more prominent in dentate gyrus, and, to some extent, hippocampus), CBD (where the tau species may be more prominent in nucleus caudatus) and PSP (where the tau species may be more prominent in putamen/nucleus caudatus).
  • AD where the tau species may be more prominent in hippocampus CA1
  • other tauopathies such as FTD - Pick’s disease (where the tau species may be more prominent in dentate gyrus, and, to some extent, hippocampus)
  • CBD where the tau species may be more prominent in nucleus caudatus
  • PSP where the tau species may be more prominent in putamen/nucleus caudatus
  • a subject is administered an antibody and antigen binding fragment conjugated to a detectable label (e.g., via intravenous administration) and then their brain is imaged (e.g., via PET) to generate a map of tau bound by the labeled antibody and antigen binding fragment in the brain.
  • the map may be analyzed against known maps for AD and other tauopathies to determine whether the patient has AD or another tauopathy.
  • the detection is done by positron emission
  • the distribution of the signal in the brain may indicate whether the subject has Alzheimer’s disease or another tauopathy. See Murray et al.,
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the antibody or binding fragment comprises an antibody or antigen binding fragment that competes for binding or binds the same epitope as antibody DC2E7 or an antigen binding fragment thereof.
  • an antibody or antigen binding fragment thereof conjugated to a radioisotope may be administered to a subject as described herein.
  • the radiosignal may be detected in the brain by positron emission tomography.
  • Three dimensional images of the antibody conjugate concentration within the body may then be constructed by computer analysis.
  • the concentrations of signal throughout the brain can be used to correlate with distinct patterns associated with AD or other tauopathies, or to determine whether a patient presenting with dementia has or does not have AD, another tauopathy, or another cause of their dementia. These signal patterns may be interpreted by one skilled in the art to determine if a subject has AD or another tauopathy. See Murray et al., Clinicopathologic assessment and imaging of tauopathies in neurodegenerative dementias,
  • a human subject presenting with symptoms of dementia is first subjected to any one or more of the methods of detecting
  • a sample e.g., CSF or blood
  • a human subject presenting with symptoms of dementia and analyzed according to the methods described above, and/or the human subject is
  • a human subject who has been determined to have Alzheimer’s disease or another tauopathy may be administered a
  • the pharmaceutical composition that treats AD or another tauopathy.
  • the pharmaceutical composition comprises an antibody or antigen binding fragment disclosed herein.
  • the pharmaceutical composition comprises one or more of the antibodies or therapeutic peptides disclosed in U.S. Patent No.
  • a method of determining the stage of Alzheimer’s disease in a human subject comprising: obtaining a cerebrospinal fluid or blood sample from the subject, contacting the sample with an effective amount of a molecule that is capable of forming a tau-molecule complex (e.g., at least one receptor, antibody, or antigen binding fragment disclosed hererin that is capable of binding tau to form a tau-antibody complex); detecting the amount of the tau- molecule complex using an antibody or antigen binding fragment disclosed herein; and comparing the amount of tau complexed with the molecule to the amount in a sample of known AD stage or a threshold, thereby identifying the stage of a tau-molecule complex (e.g., at least one receptor, antibody, or antigen binding fragment disclosed hererin that is capable of binding tau to form a tau-antibody complex); detecting the amount of the tau- molecule complex using an antibody or antigen binding fragment disclosed herein; and comparing the amount of tau complexed with the molecule to the amount in a sample of known AD stage or a
  • Alzheimer’s disease a higher amount of tau in the sample indicates a more advanced stage of AD.
  • levels and/or thresholds are evaluated as described above.
  • an advanced stage is determined by comparison to the amount of phosphorylated tau detected in a sample of known AD stage, e.g., Braak Stages l-VI. Braak et al., "Neuropathological stageing of Alzheimer-related changes" A a
  • a method of determining the stage of Alzheimer’s disease in a human subject comprising: obtaining a cerebrospinal fluid or blood sample from the subject, contacting the sample with an antibody or antigen binding fragment disclosed herein, wherein the antibody or antigen binding fragment is capable of binding to phosphorylated tau to form a phosphorylated tau-antibody complex, detecting the amount of phosphorylated tau complexed with the antibody or antigen binding fragment in the sample, and comparing the amount of tau complexed with the antibody to the amount in a sample of known AD stage or a threshold, thereby identifying the stage of Alzheimer’s disease.
  • a higher amount of tau in the sample indicates a more advanced stage of AD.
  • levels and/or thresholds are evaluated as described above.
  • an advanced stage is determined by comparison to the amount of phosphorylated tau detected in a sample of known AD stage, e.g., Braak Stages I- VI. Braak et al., "Neuropathological stageing of A!zheimer-reiated changes". Acta Neuropathologica, 82(4): 239-59 (1991 ).
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the level of tau determined in the sample is compared to the level in a sample from a patient of known AD stage and/or to a control sample from a healthy individual to determine whether the test subject has an elevated amount of tau in their sample.
  • a method of determining the effectiveness of an anti- tau therapy for Alzheimer’s disease comprising: obtaining a
  • an elevated level of phosphorylated tau in the sample relative to the level in a sample from a healthy control subject or a threshold indicates the subject is more likely to respond to an anti-tau therapy for Alzheimer’s disease.
  • an elevated level over a threshold or a fold increase in tau is determined as described above.
  • the anti-tau antibody or antigen binding fragment used in determining the effectiveness of an anti-tau therapy for Alzheimer’s disease comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • an anti-tau therapy is administered to a subject identified as being more likely to respond to the therapy.
  • the anti- tau therapy comprises administering an antibody that binds to tau and promotes its clearance from the brain or inhibit the spreading of tau pathology.
  • the antibody or antigen binding fragment comprises comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the anti-tau therapy comprises any of those disclosed herein, and/or any disclosed in U.S. Patent No. 9,518,101 and WO 2016/079597.
  • the anti-tau therapy comprises a small molecule or peptide vaccine therapy or antibody therapy. See U.S. Patent No. 9,518,101 and WO 2016/079597, which are incorporated by reference in their entirety.
  • a method of monitoring the effectiveness of an anti- tau therapy for Alzheimer’s disease comprising: (a) obtaining
  • the anti-tau antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the method further comprises administering the anti-tau therapy again to a subject who has a lower level of phosphorylated tau a the sample obtained after treatment as compared to the level in the sample obtained before treatment.
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the anti-tau therapy comprises a small molecule or peptide vaccine or antibody therapy. See WO 2016/079597 and U.S. Patent No.
  • the anti-tau therapy comprises administering an antibody that binds to tau and promotes its clearance from the brain.
  • the anti-tau therapy comprises administering an anti-tau antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • a number of additional measures may be used to determine, confirm, and/or monitor AD status, e.g., by behavioral assessment, for use in confirming an AD diagnosis or to evaluate the effects of treatment and/or disease progression.
  • the measures include mean change in Alzheimer's Disease Activity Scale-Cognitive subscale 13 (ADAS-Cog 13) scores and Mean change in
  • ADCS-ADL Alzheimer's Disease Cooperative Study-Activities of Daily Living
  • Other measures may include change in MRI volumetry, change in Clinical Dementia Rating (CDR-SB/CDR-GS), change in neuropsychiatric behavior:
  • neuropsychiatric inventory NPI
  • domain scores neuropsychiatric inventory
  • MMSE total score MMSE total score.
  • the measures can include any of the following: time to the occurrence of death, institutionalization, loss of ability to perform activities of daily living, time to severe dementia, ADCS-ADL, ADAS-cog score, MMSE scores, cognitive performance, plasma CSF biomarkers, ADAS-total score, Quality of life assessed by Quality of Life Alzheimer's disease scale, behavioral test scores, and the US FDA's Clinical Dementia Rating-sum of boxes.
  • a method of detecting Alzheimer’s diseases or another tauopathy in a human subject comprises administering to a subject an antibody or antigen bringing fragment disclosed herein that has been conjugated to a radioisotope and detecting a signal in the brain of the patient, wherein the detected signal pattern in the brain indicates whether the subject has Alzheimer’s disease or another tauopathy. Detection of the signal may be done by positron emission topography. The distribution of the signal in the brain may be used to indicate whether the subject has Alzheimer’s disease or another tauopathy.
  • the administered antibody or antigen binding fragment conjugated to a radioisotope comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen binding fragment comprises a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 7 and a light chain variable region comprising an amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen binding fragment comprises DC2E7 or an antigen binding fragment thereof.
  • the antibodies and antigen binding fragments disclosed herein for therapeutic or diagnostic uses can be administered by any suitable administration route, e.g, parenteral, topical, intradermal, intravenous, oral, subcutaneous, intraperitoneal, intranasal or intramuscular routes.
  • a typical route of administration may be subcutaneous although others may be equally effective.
  • Another typical route may be intramuscular injection. This type of injection is typically performed in the arm or leg muscles.
  • Intravenous injections as well as intraperitoneal injections, intra-arterial, intracranial, or intradermal injections may also be used.
  • the antibodies or antigen binding fragments disclosed herein may be administered as injectable dosages of a solution or suspension of the substance in a physiologically acceptable carrier and/or diluent, e.g., a sterile liquid such as water, oil, saline, glycerol, or ethanol.
  • a physiologically acceptable carrier and/or diluent e.g., a sterile liquid such as water, oil, saline, glycerol, or ethanol.
  • the antibodies or antigen binding fragments disclosed herein may also be administered by drilling a small hole in the skull for administration, which may allow crossing of the blood brain barrier.
  • kits are disclosed herein, comprising one or more of the antibodies or antigen binding fragments described herein.
  • the kit comprises an antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO:
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8.
  • the antibody or binding fragment comprises antibody DC2E7 or an antigen binding fragment thereof.
  • the kit comprises an antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain
  • the antibody or antigen binding fragment comprises a light chain variable domain and a heavy chain variable domain and a light chain variable domain selected from those in Table 1 , e.g., paired heavy and light chain variable domain sequences selected from those in Table 1 .
  • the kit comprises an antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain
  • HCDR1 complementarity determining regions
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2 with a substitution at one or more of position 2 and 12
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4 with a substitution at position 2
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6.
  • the substitution at position 2 in HCDR1 is glycine
  • the substitution at position 2 in HCDR2 is isoleucine
  • substitution at position 1 comprises the amino acid sequence of SEQ ID NO: 1 with a substitution at position 2
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2 with a substitution at one or more of position 2 and 12
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4 with a substitution at position 2
  • the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 7 with a substitution at one or more of position 1 , 3, 30, 37, 48, 58, 63, 68, 76, 77, and 80
  • the light chain variable region comprises the amino acid sequence of SEQ ID SEQ ID NO: 8 with a substitution at one or more of position 7, 1 1 , 20, 28, 39, and 69.
  • the substitution in the heavy chain variable region at position 68 is leucine
  • the substitution in the light chain variable region at position 39 is isoleucine.
  • the substitution in the heavy chain variable region at position 48 is isoleucine.
  • the substitution in the heavy chain variable region at position 30 is glycine and at position 58 is valine, and the substitution in the light chain variable region at position 7 is proline and at position 69 is glycine.
  • the substitution in the light chain variable region at position 1 1 is serine.
  • the substitution in the heavy chain variable region at position 77 is serine, and the substitution in the light chain variable region at position 1 1 is leucine, at position 20 is alanine, and at position 28 is asparagine.
  • the substitution in the heavy chain variable region at position 37 is alanine, at position 63 is alanine, and position 80 is serine, and the substitution in the light chain variable region at position 1 1 is leucine.
  • the substitution in the heavy chain variable region at position 1 is glycine, at position 3 is arginine, at position 76 is glutamic acid, and at position 77 is serine.
  • the substitution in the light chain variable region at position 1 1 is leucine.
  • a kit comprises two or more antibody or antigen binding fragments. In certain embodiments, a kit comprises:
  • an antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 ,
  • HCDR2, and HCDR3 and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 1 , HCDR2 comprises the amino acid sequence of SEQ ID NO: 2, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 3; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 4, LCDR2 comprises the amino acid sequence of SEQ ID NO: 5, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 6; and b.
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 1
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 2
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 3
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 4
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 5
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 6; and
  • HCDR1 comprises three heavy chain complementarity determining regions
  • LCDR1 , LCDR2, and LCDR3 comprises three light chain complementarity determining regions
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 15
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 16
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 17
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 18
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 19
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • the kit comprises two or more antibodies or antigen binding fragments, wherein an antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8, and the other antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 21 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 22.
  • an antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 7 and the light chain variable region comprises an amino acid sequence of SEQ ID NO: 8
  • the other antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region
  • the heavy chain variable region comprises an amino acid sequence of SEQ ID NO: 21 and the light chain variable region comprises an amino acid sequence of SEQ
  • the kit comprises antibody or DC2E7 or an antigen binding fragment thereof and/or antibody or DC2E2 or an antigen binding fragment thereof.
  • a kit comprises two or more antibody or antigen binding fragments. In certain embodiments, a kit comprises:
  • an antibody or antigen binding fragment comprising any of the sequences shown in table 1 , e.g., a set of six CDRs and or paired heavy and light chain variable domain sequences listed in Table 1 ; b. another antibody or antigen binding fragment comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 15, HCDR2 comprises the amino acid sequence of SEQ ID NO: 16, and HCDR3 comprises the amino acid sequence of SEQ ID NO: 17; and wherein LCDR1 comprises the amino acid sequence of SEQ ID NO: 18, LCDR2 comprises the amino acid sequence of SEQ ID NO: 19, and LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • HCDR1 comprises the amino acid sequence
  • a kit comprises two or more antibody or antigen binding fragments. In certain embodiments, a kit comprises:
  • an antibody or antigen binding fragment comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises three heavy chain complementarity determining regions (HCDR1 , HCDR2, and HCDR3), and the light chain variable region comprises three light chain complementarity determining regions (LCDR1 , LCDR2, and LCDR3), wherein HCDR1 comprises the amino acid sequence of SEQ ID NO: 23, HCDR2 comprises the amino acid sequence of SEQ ID NO: 24, and HCDR3 comprises the amino acid sequence of SEQ ID NO:
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 26
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 27
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 28;
  • HCDR1 comprises three heavy chain complementarity determining regions
  • LCDR1 , LCDR2, and LCDR3 comprises three light chain complementarity determining regions
  • HCDR1 comprises the amino acid sequence of SEQ ID NO: 15
  • HCDR2 comprises the amino acid sequence of SEQ ID NO: 16
  • HCDR3 comprises the amino acid sequence of SEQ ID NO: 17
  • LCDR1 comprises the amino acid sequence of SEQ ID NO: 18
  • LCDR2 comprises the amino acid sequence of SEQ ID NO: 19
  • LCDR3 comprises the amino acid sequence of SEQ ID NO: 20.
  • any of the preceding kits may further comprise instructions for using the one or more antibodies or antigen binding fragments to detect phosphorylated tau in a sample from a subject according to the methods disclosed herein and thereby detect Alzheimer’s disease in the subject.
  • the instructions may call for the sample to be cerebrospinal fluid or blood.
  • the kits may further comprise additional components for use with a classic ELISA or a digital ELISA.
  • IPTG isopropyl- -D-1 - thiogalactopyranoside
  • PPES 1 ,4-piperazinediethanesulfonic acid pH 6.9, 50 mM sodium chloride (NaCI),
  • EDTA ethylenediaminetetraacetic acid
  • DTT dithiothreitol
  • PMSF phenylmethylsulfonyl fluoride
  • glycerol 5% (v/v) glycerol
  • Bound tau proteins were eluted by a gradient (0-30% within 15 ml) of Buffer B (lysis buffer supplemented with 1 M NaCI). Individual 1 ml_ fractions were collected and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE). To remove nucleic acids, which copurify with positively charged tau proteins, the fractions containing tau protein were pooled and purified by a second cation- exchange chromatography step, using a 5-ml HiTrap SP HP column (GE Healthcare, Uppsala, Sweden) with a less steep gradient of Buffer B (0-30% in 45 ml).
  • bacterial pellets were resuspended in 10 ml of histidine lysis buffer (20mM histidine, pH 6.0, 50mM NaCI, 1 mM EDTA, 5mM DTT, 0.1 mM PMSF, and 5% (v/v) glycerol).
  • Bacterial cell walls were broken by sonication on ice by using Sonopuls HD 2200, tip TT-13 (Bandelin, Germany) set to 50% duty cycle, 50 W power output, 6 times for 30 s with 30 s pauses.
  • the lysates were clarified by centrifugation (21 ,000xg for 15 min at 4°C).
  • Bacterial lysates were precipitated by 1 % streptomycin sulfate (Medexport, Russia), incubated on ice for 5 min, clarified by centrifugation (21 ,000xg for 15 min at 4°C), and filtered through a 0.45 pm membrane filter. The filtered streptomycin precipitated lysates were loaded at 3 ml/min flow rate onto a 5ml HiTrap
  • the buffer was exchanged to phosphate-buffered saline (PBS, 8.09 mM disodium phosphate (Na2HP04), 1 .47 mM potassium dihydrogen phosphate (KH2P04), 136.89 mM NaCI, 2.7 mM potassium chloride (KCI)) saturated with argon, using a 5 ml_ HiTrap Desalting column (GE Healthcare).
  • PBS phosphate-buffered saline
  • Na2HP04 disodium phosphate
  • KH2P04 1 .47 mM potassium dihydrogen phosphate
  • KCI potassium chloride
  • Protein quantitation of purified samples was done using bicinchoninic acid (BCA) quantitation kits (Pierce, USA), with bovine serum albumin (BSA) as a standard. Tau proteins were aliquoted into working aliquots, snap-frozen in liquid nitrogen, and stored at -70°C.
  • mice Six-week-old Balb/c mice were primed subcutaneously with 50 pg of recombinant tau1 -242- (prepared as described in Example 1 ) in complete Freund’s adjuvant (SIGMA) and boosted three times at four-week intervals with 50 pg of the same antigen in incomplete Freund’s adjuvant. Three days before the fusion, mice were injected intravenously with 50 pg of the same antigen in PBS. Spleen cells from immunized mice were fused with NS/0 myeloma cells according to the method of Kontsekova et al., The effect of postfusion cell density on establishment of hybridomas, Folia Biol. 34, 18-22 (1988).
  • Splenocytes were mixed with NS/0 myeloma cells (ratio 5:1 ) and fused for 1 minute in 1 ml of 50% polyethylene glycol (PEG) 1550 (Serva) in serum free Dulbecco ' s modified Eagle ' s medium (DMEM) supplemented with 10% dimethyl sulphoxide.
  • PEG polyethylene glycol
  • DMEM serum free Dulbecco ' s modified Eagle ' s medium
  • the fused cells were resuspended in DMEM containing 20% horse serum, L-glutamine (2 mM), hypoxanthine (0.1 mM), aminopterin (0.04 mM), thymidine (0.016 mM), and gentamycin (40 U/ml), at a density of 2.5 x 10 5 spleen cells per well on 96-well plates.
  • Bound monoclonal antibodies were detected with sheep anti-mouse immunoglobulin (Ig) conjugated with horse radish peroxidase (HRP, DAKO).
  • the reaction was developed with TMB one (Kem-En-Tec Diagnostics) as a peroxidase substrate and stopped with 50 mI of 2 M H2SC .
  • Absorbance at 450 nm was measured using a Powerwave HT (Bio-Tek). Readouts with an absorbance value of at least twice the value of the negative controls (PBS) were considered positive.
  • the monoclonal antibody DC2E2 (produced by the mouse hybridoma cell line deposited with the American Type Culture Collection, with the ATCC Patent Deposit Designation PTA-124991 .) was identified among the positive hybridoma cultures so produced and selected. DC2E2 was further characterized as described below.
  • the antibody isotype was determined to be murine lgG1 by ELISA (Fig. 1 ) using a mouse Ig isotyping kit (ISO-2, SIGMA).
  • the plates were blocked with PBS-Tween20 (0.1 % v/v) to reduce nonspecific binding and were incubated with 50 mI/well of DC2E2 hybridoma culture supernatant, for 1 hr at 37°C. Bound monoclonal antibody was detected with sheep anti-mouse Ig HRP-conjugated (DAKO). The reaction was developed with TMB one solution (Kem-En-Tec Diagnostics) as a peroxidase substrate and stopped with 50 mI of 2M H2S0 4 . Absorbance was measured at 450 nm using a Powerwave HT (Bio-Tek). Readouts with an absorbance value of at least twice the value of the negative controls (PBS) were considered positive.
  • PBS powerwave HT
  • DC2E2 recognized the following human tau proteins: six human tau isoforms (Fig. 2B), tau 1 -242, tau 31 -441 , tau 99-441 , tau 1 -226, tau151 -391 , tau 127-441 , but failed to recognize the deletion mutants tau 1 -136, tau 221 -441 and tau 2N4R(A134-168) (Fig. 2C). Together, these findings suggest that DC2E2 recognizes binding sites or epitopes on tau, located in the proline reach region of tau between amino acids 151 - 188.
  • DC2E2 monoclonal antibody was purified from serum-free hybridoma supernatant on a Protein G affinity column, as follows. The hybridoma supernatant was adjusted to pH 7.5, the solution was precleared by centrifugation, filtered through a 0.45 pm membrane filter, and loaded onto a 5 ml Protein G Sepharose column. DC2E2 mAb was eluted from the column with 0.1 M Glycine-HCI, pH 2.7. Eluted fractions were immediately neutralized with 1 M Tris-HCI pH 9.0.
  • peptides (tau 141 -170, 161 -190, 181 -210, 171 -200) were synthesized by EZBiolabs with purity higher than 90%.
  • ELISA plates (Nunc Medisorp, Thermo Scientific, Denmark) were coated overnight at 4°C with 50 pl/well of 0.4 pg/ml of recombinant purified tau 1 -242 in PBS. The plates were washed 4 times with PBS/Tween 20 (0.1% v/v), and blocked with PBS/Tween 20 for 2 h at 25°C. Peptides were separately dissolved in PBS at a final concentration of 5 mM.
  • Serial dilutions (2,5-fold) of the peptides in PBS/Tween 20 were prepared in polypropylene plates with conical well bottom (Greiner, #651201 ) (concentration range 200 mM, 32 mM, 12,8 pM, 5,1 pM, 2 pM, 0,8 pM, and 0,3 pM). 60 pi of each dilution were added per well.
  • Purified DC2E2 was diluted to a concentration of 0.6 pg/ml in PBS/Tween 20 and 60 pi of this diluted antibody was mixed with each serial dilution of peptides resulting in 120 pi mixtures with 0.36 ng of antibody/60pl containing each respective test peptide at a concentration of 200 pM, 32 pM, 12,8 pM, 5,1 pM, 2 pM, 0,8 pM, and 0,3 pM.
  • the antibody/peptide mixtures were incubated for 1 hr at 25°C on a rotating platform set to 250 rpm. Fifty microliters (50 pi) of antibody/peptide mixtures were transferred from the polypropylene plates into tau1 -242-coated and PBS/Tween 20-blocked plates (in duplicates) and incubated for
  • LC/MALDI mass spectrometry approach was used with the aim to define the epitope more precisely. Sequence of binding site was identified by binding of proteolytically digested tau proteins to DC2E2 monoclonal antibody immobilized on magnetic beads and subsequent identification of eluted peptides by LC/MALDI mass spectrometry.
  • Tau proteins tau 2N4R and tau151 -391 ) were digested with the mixture of trypsin, Glu-C, chymotrypsin at 37°C overnight or formic acid for 2 hours at 108 °C. Binding reaction was performed in 1 % CHAPS in PBS for 2 hours.
  • Non bound peptides were removed by three washes with 1 % CHAPS in PBS. Bound peptides were eluted by three washes with formic acid and lyophilized. Peptides were separated by UHPLC (Dionex, Ultimate 3000 nano-LC system), fractions were mixed with HCCA matrix solution, and dispensed onto MTP Anchor Chip 384 MALDI sample plate (Bruker Daltonics). The fractionated samples were analyzed with a MALDI TOF/TOF (Ultraflextreme, Bruker Daltonics) instrument operated in the positive ion mode. The collected MS and MS/MS spectra were searched against database of tau proteins using Mascot search engine (Matrix Science).
  • tau is hyperphosphorylated. Therefore, for detail characterization of binding properties of DC2E2, hyperphosphorylated PHF-tau and in vitro phosphorylated tau were examined.
  • polyacrylamide gel electrophoresis PNAS, 87:5827-31 , 1990.
  • frozen human AD brain tissue frontal cortex, samples of Braak stage VI obtained from the Netherlands brain bank
  • cold extraction buffer (10 mM Tris pH 7.4, 0.8 M NaCI, 1 mM EGTA, and 10% sucrose)
  • homogenate was centrifuged for 20 min at 20,000xg.
  • supernatant was supplemented with N-lauroylsarcosine (SIGMA) to a final concentration of 1% and incubated for 1 h at room temperature, while shaking.
  • SIGMA N-lauroylsarcosine
  • kinase extract was used for in vitro phosphorylation of tau 2N4R and tau151 -391 .
  • Adult rat brain ( 1 g/2 , 5 ml) was homogenized in kinase buffer (10 mM TRIS- HCI, pH 7,4; 5mM EGTA, 2mM DTT; 1 mM PMSF; 2mM MgC , leupeptin (20 pg/ml), pepstatin (20 pg/ml), aprotinin (20 pg/ml)) and after centrifugation at 100,000 x g for 30 min at 4°C the supernatant (kinase extract) was used for the phosphorylation of tau.
  • kinase buffer 10 mM TRIS- HCI, pH 7,4; 5mM EGTA, 2mM DTT; 1 mM PMSF; 2mM MgC , leupeptin (20 pg/ml), pepstatin (20 pg/m
  • the phosphorylation reaction was carried out at 37°C in 10 mM TRIS-HCI, pH 7,4; 5mM EGTA, 2mM DTT; 1 mM PMSF; leupeptin (20pg/ml); pepstatin (20pg/ml); aprotinin (20pg/ml); 2mM ATP; 2mM MgC and 10pM okadaic acid.
  • the brain kinase extract (5pl) was added to 50 pi tau solution (1 pM) and reaction was incubated at 37°C for 24h.
  • PVDF polyvinylidene fluoride
  • PBS phosphate-buffered-saline
  • the blots were developed with SuperSignal West Pico Chemiluminescent Substrate (Pierce, U.S.A), and the protein signals detected using a LAS3000 imaging system (FUJI Photo Film Co., Japan).
  • the chemiluminescence signal intensities were quantified using AIDA (Advanced Image Data Analyzer, Raytest, Straubenhardt, Germany) software.
  • DC2E2 recognized both forms of tau proteins, in vivo phosphorylated tau 2N4R, 151 -391 and wild type (unphoshorylated) forms of tau 2N4R and tau151 -391 (Fig. 3).
  • DC2E2 recognized the A68 triplet, a characteristic feature of pathological tau (PHF-tau) in AD neurofibrillary
  • DC2E2 can recognize and bind different type of tau proteins, pathological tau isolated from AD brain, physiological tau (2N4R), truncated tau151 -391 and its phosphorylated forms. Thus, DC2E2 recognized epitopes independent of epitope phosphorylation. Disclosed binding properties of DC2E2 suggest the possibility of using the antibody as diagnostic tool for AD.
  • nucleotide and amino acid sequences of the light and heavy chain variable regions of DC2E2 (Fig. 5).
  • the nucleotide sequence of DC2E2 variable regions (Fig. 5A and 5C) was determined by DNA sequencing of cDNA synthesized using total RNA extracted from the mouse hybridoma cell line DC2E2 (ATCC), which expresses the DC2E2 monoclonal antibody. Total RNA was extracted using RNeasy Mini Kit (Qiagen, Germany). Synthesis of the first strand cDNA was carried out using the“High capacity cDNA reverse transcription” kit according to the manufacturer’s protocol (Applied Biosystems, USA).
  • composition of the reagents for the 2x reverse transcription master-mix was as follows (quantities per 20 pi- reaction): 2 pL of 10x RT buffer; 0.8 pL of 25x dNTP Mix (100 mM); 2 pi of 10x RT Random Primers (50 pM); 1 pL of MultiScribeTM Reverse Transcriptase (50 U/pL);
  • RNA sample 1 pg/10 pL
  • cDNA was synthesized under the following conditions: 10 min at 25°C, 120 min at 37°C, 5 min at 85°C, and final cooling to 4°C.
  • the genes encoding the variable regions of the light and heavy chains were apmplified by polymerase chain reaction (PCR) using Phusion® High-Fidelity DNA Polymerase (Thermo Fisher Scientific, USA).
  • PCR polymerase chain reaction
  • Phusion® High-Fidelity DNA Polymerase Thermo Fisher Scientific, USA.
  • the forward primers M13-L6 5’-
  • signal sequence forward primers has the advantage of amplifying the whole V-gene of both light and heavy antibody chains, without bias introduced when the beginning of the variable region is being used for primer design.
  • the reverse primers for the light and heavy chains were derived from kappa and lgG1 chains constant regions, respectively.
  • ImMunoGeneTics numbering system (see, e.g., Lefranc M.P. The IMGT unique numbering for immunoglobulins, T-cell receptors, and Ig-like domains. The Immunologist, 7, 132-1 36, 1999 (1999)).
  • mice Six-week-old Balb/c mice were primed subcutaneously with approximately 20- 30 pg of insoluble tau protein isolated from human Alzheimer ' s brain tissue in complete Freund ' s adjuvant (SIGMA) and boosted five times at four-week intervals with 20-30 pg of the same antigen in incomplete Freund ' s adjuvant. Three days before the fusion, mice were injected intravenously with 20-30 pg of the same antigen in PBS. Spleen cells from immunized mice were fused with NS/0 myeloma cells according to the method of Kontsekova et al., The effect of postfusion cell density on establishment of hybridomas, Folia Biol. 34, 18-22 (1988).
  • Splenocytes were mixed with NS/0 myeloma cells (ratio 5:1 ) and fused for 1 minute in 1 ml of 50% polyethylene glycol (PEG) 1550 (Serva) in serum free Dulbecco ' s modified Eagle ' s medium (DMEM) supplemented with 10% dimethyl sulphoxide.
  • PEG polyethylene glycol
  • DMEM serum free Dulbecco ' s modified Eagle ' s medium
  • the fused cells were resuspended in DMEM containing 20% horse serum, L-glutamine (2 mM), hypoxanthine (0.1 mM), aminopterin (0.04 mM), thymidine (0.016 mM), and gentamycin (40 U/ml), at a density of 2.5 x 10 5 spleen cells per well on 96-well plates.
  • Bound monoclonal antibodies were detected with sheep anti-mouse immunoglobulin (Ig) conjugated with horse radish peroxidase (HRP, DAKO).
  • the reaction was developed with TMB one (Kem-En-Tec Diagnostics) as a peroxidase substrate and stopped with 50 mI of 2 M H2SC .
  • Absorbance at 450 nm was measured using a Powerwave HT (Bio-Tek). Readouts with an absorbance value of at least twice the value of the negative controls (PBS) were considered positive.
  • the monoclonal antibody DC2E7 (produced by the mouse hybridoma cell line deposited with the American Type Culture Collection, with the ATCC Patent Deposit Designation PTA-124992) was identified among the positive hybridoma cultures. DC2E7 was further characterized as described below.
  • the antibody isotype was determined to be murine lgG2a by ELISA (Fig. 4) using a mouse Ig isotyping kit (ISO-2, SIGMA).
  • nucleotide and amino acid sequences of the light and heavy chain variable regions of DC2E7 (Fig. 6).
  • the nucleotide sequence of DC2E7 variable regions (Figs. 6A and 6C) was determined by DNA sequencing of cDNA synthesized using total RNA extracted from the mouse hybridoma cell line DC2E7 (ATCC), which expresses the DC2E7 monoclonal antibody. Total RNA was extracted using RNeasy Mini Kit (Qiagen, Germany). Synthesis of the first strand cDNA was carried out using the“High capacity cDNA reverse transcription” kit according to the manufacturer’s protocol (Applied Biosystems, USA).
  • composition of the reagents for the 2x reverse transcription master-mix was as follows (quantities per 20 pi- reaction): 2 pL of 10x RT buffer; 0.8 pL of 25x dNTP Mix (100 mM); 2 pi of 10x RT Random Primers (50 pM); 1 pL of MultiScribeTM Reverse Transcriptase (50 U/pL);
  • RNA sample 1 pg/10 pL
  • cDNA was synthesized under the following conditions: 10 min at 25°C, 120 min at 37°C, 5 min at 85°C, and final cooling to 4°C.
  • Amplification of the genes encoding the variable regions of the light and heavy chains was done by polymerase chain reaction (PCR) using Phusion® High-Fidelity DNA Polymerase (Thermo Fisher Scientific, USA).
  • the forward primers (M13-L12 5’-
  • TGTAAAACGACGGCCAGTATGAAGTTTCCTTCTCAACTTCTGCTC-3’ and M13- H5 5’-TGTAAAACGACGGCCAGTATGGACTCCAGGCTCAAMAGTTTTCCTT-3’ were selected after screening a library of mouse immunoglobulin signal sequence forward primers.
  • the usage of signal sequence forward primers has the advantage to amplify the whole V-gene of both light and heavy antibody chains, without biases introduced when the beginning of variable region is being used for primer design.
  • the reverse primers for the light and heavy chains (M13-KC 5’- CAGGAAACAGCTATGACCACTGGATGGTGGGAAGATGG-3’ and M13-CG2a 5’- CAGGAAACAGCTATGACCCAGTGGATAGACCGATGGGGC -3’ were derived from kappa and lgG2a chains constant regions, respectively.
  • CDRs Complementarity determining regions
  • FR framework regions
  • ImMunoGeneTics numbering system (see, e.g., Lefranc M.P. The IMGT unique numbering for immunoglobulins, T-cell receptors, and Ig-like domains. The Immunologist 7, 132-1 36, 1999 (1999)).
  • Monoclonal Antibody DC2E7 Is Specific For Phosphorylated Forms Of Tau Protein
  • Recombinant full length tau 2N4R, phosphorylated 2N4R, PHF-tau and fetal tau were used for further characterization of binding activity of monoclonal antibody DC2E7 by immunoblotting.
  • Recombinant human tau isoform 2N4R was prepared as described in Example 1 .
  • PHF- tau was prepared as described in Example 4.
  • Fetal rat tau extraction and purification was done essentially as described in Ivanovova et al., High-yield purification of fetal tau preserving its structure and phosphorylation, J. Immunol. Methods, 339:17-22, 2008, using 1 % perchloric acid.
  • Brain tissue obtained from 1 -7 day old rat pups was homogenized in ice-cold 1 % perchloric acid (1 .5 g tissue per 5 ml of perchloric acid, Applichem) and allowed to stand on ice for 20 min.
  • the homogenate was spun at 15,000xg for 20 min, and the clear supernatant was concentrated and simultaneously the buffer was changed to washing buffer (20 mM Tris, pH 7.4, 150 mM NaCI, 0.1 % Tween 20) using an Amicon Ultra Centrifugal Filter device (Millipore).
  • the filtered extract were loaded at a flow rate of 0.2 ml/min onto a Poly-Prep column C10/10 (GE Healthcare) packed with Sepharose carrying immobilized pan-tau mAb DC25. Unbound proteins were washed off with 10-15 ml washing buffer until the absorbance of the eluting fractions (at 280 nm) became stable.
  • Fetal tau, bound to mAb DC25 was eluted with 0.1 M glycine, pH 2.6. Eluted 0.5 ml fractions were immediately neutralized with 50 pi of 1 M Tris-HCI, pH 9, and assayed by SDS-PAGE. Fractions containing fetal tau were concentrated using Amicon Ultra Centrifugal Filter devices (Millipore) with simultaneous buffer exchange to PBS. Fetal tau purified by affinity chromatography was precipitated according to Chen et al., (2005) by addition of four volumes of ice cold acetone containing 10% trichloroacetic acid. The mixture was incubated at - 20°C for 2 hours and centrifuged at 15,000xg for 20 min at 2°C.
  • DC2E7 is capable of distinguishing phosphorylated tau derived from Alzheimer ' s disease brain tissue (PHF-tau) from physiological tau (2N4R).
  • Ser199Ala; Ser202Ala; Thr217Ala) into human 2N4R tau protein was done using QuickChange site directed mutagenesis kit (Agilent Technologies, USA, CA) according the manufacturer ' s instructions.
  • 5-50 pg of plasmid containing coding sequence for wild-type 2N4R tau protein and 125 ng of each primer were used in one 50 pi reaction. Cycling parameters were as follows: 95 °C for 30 seconds, then PCR continued with cycle which was repeated 16 times: denaturation 95 °C for 30 seconds, annealing 55 °C for 60 seconds, elongation 68 °C for 6 min. The whole reaction was digested with Dpnl, which is specific for methylated DNA, to eliminate parental plasmid.
  • Plasmids with desired mutations were used for production of recombinant proteins as described in Example 1 .
  • mapping experiments suggested the presence of phospho-threonine 217 within the epitope of DC2E7.
  • synthetic peptides of different lengths carrying different phospho-sites were analyzed in competitive ELISA.
  • Peptides tau 210-224/pT212/pT217, 210-222/pT212/pT217, 210-221 /pT212/pT217, 210- 220/pT212/pT217, 210-219/pT212/pT217, 210-218/pT212/pT217, tau 201 - 230/pT212, tau 193-222/pS208, 193-222/pS214, tau 193-
  • Serial dilutions (2.5x) of peptides in PBS/Tween 20 were prepared in polypropylene microtiter plates with conical well bottom (Greiner) within the concentration range of 200 mM; 80 mM; 32 mM; 12.8 pM; 5.12 mM; 2.048 pM; 0.8192 mM; 0.32768 pM).
  • the monoclonal antibody DC2E7 was diluted to a concentration of 0.6 pg/ml in PBS and 60 pi of this diluted antibody was added into each well to serial dilution of peptides resulting in 120 mI/well of mixture.
  • the antibody/peptide mixtures were incubated for 1 hr at 25°C on a rotating platform set to 230 rpm. 50 mI/well of antibody/peptide mixtures were transferred from polypropylene plates into PHF-tau coated and PBS/Tween 20 blocked ELISA plates (in duplicates) and incubated for
  • DC2E7 binds a phosphoepitope on human phosphorylated tau of 12 amino acids which comprise the residues 210- SRTPSLPTPPTR-221 , where at least the threonine 217 is phosphorylated.
  • DC2E7 and DC2E2 do not recognize tau pathology in normal brain fulfilling criteria for Braak stage 1 , in prodromal stage (Braak stage 3) both antibodies identified in the hippocampus neurofibrillary pathology, in the full blown AD antibodies visualized extensive tau pathology in the form of neurofibrillary tangles, neuropil threads and neuritic plaques (Fig. 14). By using higher magnification, it was demonstrated that the antibodies bound neurofibrillary tangles in AD, Pick’s bodies in FTD and glial tau pathology in PSP and CBD (Fig. 15).
  • In vitro phosphorylation reaction (see Example 4) was dialyzed against PBS at 4°C (3 x 100- fold excess). All purification steps were performed at 4°C.
  • DC2E7 column was washed with 3 x 5 ml of WBNP0.1 buffer (50 mM Tris pH 7.4, 150 mM NaCI and 0.1 % NP40).
  • In vitro phosphorylation reaction was diluted 4-fold with ice cold WBNP1 buffer (50 mM Tris pH 7.4, 150 mM NaCI and 1 % NP40) and filtered through 0.2 pm filter. Sample was applied onto DC2E7 column.
  • DC2E7 ELISA was set up in high sensitive format, digital ELISA, using Simoa- HD1 analyzer (Quanterix). Reagents for digital ELISA were prepared according to the Quanterix Homebrew Assay Development Guide with following details. DC2E7 antibody was used as a capture antibody and DC2E2 antibody was used as a detector antibody. DC2E7 was coupled to magnetic beads (Quanterix) at
  • Detector antibody was prepared by biotinylation of DC2E2, whereby 120 - fold excess of Biotin, EZ-LinkTM NHS-PEG 4 -Biotin (Thermo Scientific, #21329) over antibody concentration was used.
  • DC2E7 calibrator was diluted in calibrator diluent (20 mM sodium phosphate pH 7.4, 137 mM NaCI, 2.7 mM KCI, 2 % BSA and 0.01 % casein) in serial two-fold dilutions starting from 100 pg/mL, following by 50, 25, 12.5, 6.25, 3.13, 1 .56 and 0 pg/ml.
  • Diluted calibrators and samples were pipetted into 96 well plate, inserted in Simoa HD1 analyzer and also capture antibody DC2E7 beads diluted in bead diluent, detector DC2E2 diluted in detector diluent to 1 .2 pg/ml, SBG diluted in SBG diluent to 200 pM and substrate RGP were inserted in analyzer (all buffers, SBG and RGP were obtained from Quanterix).
  • Assay was programmed in Simoa 1 .5 software and analysis was performed. After analysis evaluation was done by Graphpad Prism and/or by software included in Simoa 1 .5 software. An example of a calibration curve is shown on Fig. 16. An example of a spike recovery experiment is shown on Fig. 17.
  • DC2E7 Recognizes Insoluble Tau Species In Alzheimer’s Disease And Human
  • Insoluble tau complexes were isolated from human AD brain (Braak stage V, frontal cortex, Amsterdam Brain bank), corticobasal degeneration (London brain bank, frontal cortex) and FTD (Amsterdam Brain bank) as described in Example 4. Extracted insoluble tau proteins were analyzed in immunoblotting using DC2E7 as described in Example 4.
  • the assay was compared to an INNOTEST Phospho-Tau(181 P) assay.
  • the assay was also slightly better at distinguishing AD patients from healthy subjects (> 3.855 pg/ml, AUC 0.96, 95% Cl, 0.89-0.99, 95% sensitivity, 89.7% specificity) than the p-tau 181 assay (> 52 pg/ml, AUC 0.93, 95% Cl, 0.85-0.97, 92% sensitivity, 87.5% specificity) (Fig. 22). Comparing the high correlation between pT217 and pT181 assays in the AD group (P ⁇ 0.0001 ,
  • pT217 Tau Digital ELISA Assay Distinguished AD Patients From FTD And Healthy Subjects With High Sensitivity And Specificty Using Different Calibrators
  • the pT217 tau digital ELISA assay can distinguish between subjects with mild cognitive impairment (MCI) and healthy subjects.
  • MCI mild cognitive impairment
  • CSF cerebrospinal fluid
  • Fig. 23A Three subjects with MCI later developed AD.
  • the pT217 tau assay was used to test CSF samples from subjects with other neurological disorders including multiple sclerosis (MS), Parkinson’s disease (PD), amotrophic lateral sclerosis (ALS), and frontotemporal dementia (FTD), where tau pathology may be present (Fig. 23B).
  • MS multiple sclerosis
  • PD Parkinson’s disease
  • ALS amotrophic lateral sclerosis
  • FTD frontotemporal dementia
  • Fig. 23B frontotemporal dementia
  • the pT217 tau digital ELISA assay distinguishes between AD and the other neurological disorders (cut-off 9.3 pg/ml, specificity, 94%, sensitivity 100%).
  • the pT217 tau digital ELISA assay can distinguish AD patients from FTD patients and healthy subjects with similar sensitivity and specificity regardless of the chosen calibrator. Distribution of pT217 tau in CSF samples from AD patients, FTD patients and healthy subjects using either in vitro phosphorylated tau protein or synthetic peptide showed similar sensitivity and specificity.
  • the assay exhibited 94.1 % sensitivity and 91 .7 % specificity (>5.37 pg/ml).
  • the assay exhibited 93.9 % sensitivity and 90.0 % specificity (>305 pg/ml) (Fig. 29). 2E7pep possessed the following amino acid sequence:
  • the first underlined sequence represents an epitope of the DC2E2 antibody
  • the second underlined sequence represents an epitope of the DC2E7 antibody (first 3 amino acids and last amino acids are derived from tau protein, while the sequence
  • the affinity of the DC2E7 antibody was optimized by ribosome display and phage display technologies.
  • cDNA encoding an scFv format of antibody DC2E7 was generated by amplification and cloning from a DC2E7 hybridoma cell line.
  • the gene for the scFv DC2E7 was then mutated by error-prone PCR and a library of mutated scFv DC2E7 fragments was affinity selected against 2E7pep by ribosome display (Hanes et al., 1998) and phage display technologies (Harrison at al., 1996)
  • immunoassays were performed in 96 well microtiter plates coated with 100 mI/well of 0.01 pg/ml of 2E7pep in PBS at 4°C overnight. Plates were washed 4x and blocked in PBS-T for 30 min at room temperature. Binding was performed with 100 mI of 10x diluted bacterial lysate in PBS-T, containing anti-myc antibody diluted 10,000 x, on a shaking platform for 1 hour at RT. The wells were washed four times with PBS-T and competition with a 2E7pep at a concentration of 10 pg/ml per lysate was performed for 2 hours at RT on a shaking platform.
  • scFv K+ represents unmutated DC217. All scFv showing signal above the line corresponding to scFv K+ are expected to have higher affinity (labeled with an asterisk), as compared to the original DC217 scFv.
  • Antibody DC149 was generated in a similar manner to what was described in Example 2, with the following difference: Mice were immunized with a double phosphorylated peptide at positions Thr212 and Thr217, i.e.,
  • CSRpTPSLPpTPPTREPK (210-224 of 2N4R tau) conjugated via the first cysteine to KLH. Screening was performed by ELISA as described in Example 2, whereby DC149 was identified by specific binding to peptide comprising
  • SRTPSLPpTPPTREPK i.e., the same peptide mono-phosphorylated at Thr217 that DC2E7 bound
  • DC807 by specific binding to the double-phosphorylated peptide.
  • the DC149 and DC807 antibodies did not bind to an unphosphorylated peptide or to unphosphorylated tau protein, while DC807 also did not bind to mono- phosphorylated peptides.
  • DC2E7, and DC149 an DC807 were analyzed in a classical ELISA assay using a similar setup to what was described in example 10, whereby 2E7pep calibrator was used. All three antibodies bound to tau peptide phosphorylated at least on Thr217 with very similar affinities (Fig. 26).
  • Amino acid sequences for antibodies DC217, DC149 and DC807 were determined by cloning and by mass spectrometry. Alignment of the heavy and light chain sequences in DC2E7 and DC149 are shown in Fig. 27A-B. Alignments of the heavy and light chain sequences in DC2E7 and DC807 are shown in Fig. 28A-B. Residues identical to the sequence of DC2E7 are represented by dots.
  • CDRs Complementarity-determining regions
  • the protocol for pT217 detection and quantitation discussed previously was applied to SIMOA using an HD-1 Analyzer.
  • the protocol was found suitable for the measurement of pT217 in human CSF samples.
  • the assay s sensitivity, linearity, parallelism, and recovery were analyzed. Standard curves were measured by spiking 2E7 pep calibrator peptide into CSF samples and into PBS. DC2E7 was used as the capture antibody and DC2E2 was used as the detection antibody. The observed limit of detection was 184.4 pg/mL.
  • Intra-assay ⁇ 15% for values within the linear range of the standard curve
  • Inter-assay ⁇ 15% for values within the linear range of the standard curve
  • Intra-plate assay ( ⁇ 15% for values within the linear range of the standard curve). Parallelism and recovery were determined to be ⁇ 15%.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Psychiatry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Hospice & Palliative Care (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/IB2019/000358 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating alzheimer's disease WO2019186276A2 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
AU2019244481A AU2019244481A1 (en) 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating Alzheimer's disease
CN201980029711.2A CN112236452A (zh) 2018-03-28 2019-03-27 检测和治疗阿尔茨海默氏病的基于抗体的方法
MX2020009991A MX2020009991A (es) 2018-03-28 2019-03-27 Metodos basados en anticuerpos para detectar y tratar la enfermedad de alzheimer.
EP19732436.1A EP3774887A2 (en) 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating alzheimer's disease
CA3095443A CA3095443A1 (en) 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating alzheimer's disease
BR112020018868-9A BR112020018868A2 (pt) 2018-03-28 2019-03-27 métodos baseados em anticorpo para detectar e tratar doença de alzheimer
US15/733,660 US20210139568A1 (en) 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating alzheimer's disease
SG11202008098TA SG11202008098TA (en) 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating alzheimer's disease
JP2020551506A JP2021520777A (ja) 2018-03-28 2019-03-27 アルツハイマー病を検出および処置するための抗体に基づく方法
KR1020207030584A KR20200144551A (ko) 2018-03-28 2019-03-27 알츠하이머병을 검출하고 치료하는 항체-기반 방법
RU2020135052A RU2020135052A (ru) 2018-03-28 2019-03-27 Способы выявления и лечения болезни альцгеймера на основе антител
IL277577A IL277577A (en) 2018-03-28 2020-09-24 Antibody-based methods for the detection and treatment of Alzheimer's disease

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201862649208P 2018-03-28 2018-03-28
US62/649,208 2018-03-28
US201862664662P 2018-04-30 2018-04-30
US62/664,662 2018-04-30
US201862703299P 2018-07-25 2018-07-25
US62/703,299 2018-07-25

Publications (3)

Publication Number Publication Date
WO2019186276A2 true WO2019186276A2 (en) 2019-10-03
WO2019186276A3 WO2019186276A3 (en) 2020-02-27
WO2019186276A8 WO2019186276A8 (en) 2020-10-15

Family

ID=66999856

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2019/000358 WO2019186276A2 (en) 2018-03-28 2019-03-27 Antibody-based methods of detecting and treating alzheimer's disease

Country Status (12)

Country Link
EP (1) EP3774887A2 (ru)
JP (1) JP2021520777A (ru)
KR (1) KR20200144551A (ru)
CN (1) CN112236452A (ru)
AU (1) AU2019244481A1 (ru)
BR (1) BR112020018868A2 (ru)
CA (1) CA3095443A1 (ru)
IL (1) IL277577A (ru)
MX (1) MX2020009991A (ru)
RU (1) RU2020135052A (ru)
SG (1) SG11202008098TA (ru)
WO (1) WO2019186276A2 (ru)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021048619A2 (en) 2019-09-09 2021-03-18 Axon Neuroscience Se Biomarkers and treatments of alzheimer's disease and mild cognitive impairment
WO2022132923A1 (en) * 2020-12-16 2022-06-23 Voyager Therapeutics, Inc. Tau binding compounds
WO2022176959A1 (en) * 2021-02-19 2022-08-25 Eisai R&D Management Co., Ltd. Anti-pt217 tau antibody
US11492393B2 (en) 2016-05-02 2022-11-08 Prothena Biosciences Limited Tau immunotherapy
US11584791B2 (en) 2016-05-02 2023-02-21 Prothena Biosciences Limited Antibodies recognizing tau
US11643457B2 (en) 2013-03-13 2023-05-09 Prothena Biosciences Limited Tau immunotherapy
US11926659B2 (en) 2019-03-03 2024-03-12 Prothena Biosciences Limited Antibodies recognizing tau
US11958896B2 (en) 2017-05-02 2024-04-16 Prothena Biosciences Limited Antibodies recognizing tau
WO2024040212A3 (en) * 2022-08-19 2024-04-25 Staidson Biopharma Inc. Antibodies specifically recognizing programmed cell death 1 ligand 1 and uses thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117003863A (zh) * 2022-04-28 2023-11-07 厦门大学 针对p-tau 217的抗体及其用途
CN114778856B (zh) * 2022-05-30 2023-03-17 苏州宇测生物科技有限公司 磷酸化tau蛋白检测试剂盒
CN117624351A (zh) * 2023-11-24 2024-03-01 无锡傲锐东源生物科技有限公司 一种抗人磷酸化tau181兔单克隆抗体及其应用

Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4880935A (en) 1986-07-11 1989-11-14 Icrf (Patents) Limited Heterobifunctional linking agents derived from N-succinimido-dithio-alpha methyl-methylene-benzoates
US5112596A (en) 1990-04-23 1992-05-12 Alkermes, Inc. Method for increasing blood-brain barrier permeability by administering a bradykinin agonist of blood-brain barrier permeability
US5122368A (en) 1988-02-11 1992-06-16 Bristol-Myers Squibb Company Anthracycline conjugates having a novel linker and methods for their production
US5202238A (en) 1987-10-27 1993-04-13 Oncogen Production of chimeric antibodies by homologous recombination
US5204244A (en) 1987-10-27 1993-04-20 Oncogen Production of chimeric antibodies by homologous recombination
WO1993010151A1 (en) 1991-11-22 1993-05-27 Immunex Corporation Receptor for oncostatin m and leukemia inhibitory factor
US5268164A (en) 1990-04-23 1993-12-07 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5457035A (en) 1993-07-23 1995-10-10 Immunex Corporation Cytokine which is a ligand for OX40
WO1997004801A1 (en) 1995-07-27 1997-02-13 Genentech, Inc. Stabile isotonic lyophilized protein formulation
US5622929A (en) 1992-01-23 1997-04-22 Bristol-Myers Squibb Company Thioether conjugates
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
US5712120A (en) 1994-06-30 1998-01-27 Centro De Immunologia Molecular Method for obtaining modified immunoglobulins with reduced immunogenicity of murine antibody variable domains, compositions containing them
US5824805A (en) 1995-12-22 1998-10-20 King; Dalton Branched hydrazone linkers
US6214345B1 (en) 1993-05-14 2001-04-10 Bristol-Myers Squibb Co. Lysosomal enzyme-cleavable antitumor drug conjugates
US20020025313A1 (en) 1992-07-27 2002-02-28 Micklus Michael J. Targeting of liposomes to the blood-brain barrier
US20020034765A1 (en) 1991-05-17 2002-03-21 Merck & Co., Inc. Method for reducing the immunogenicity of antibody variable domains
US20020038086A1 (en) 2000-07-27 2002-03-28 Hynynen Kullervo H. Blood-brain barrier opening
US20030083299A1 (en) 2000-11-04 2003-05-01 Ferguson Ian A. Non-invasive delivery of polypeptides through the blood-brain barrier
US20030153043A1 (en) 1997-05-21 2003-08-14 Biovation Limited Method for the production of non-immunogenic proteins
WO2004007547A2 (en) 2002-07-12 2004-01-22 Axon Neuroscience Forschungs- Und Entwicklungs Gmbh Truncated tau proteins
US20040131692A1 (en) 2001-05-05 2004-07-08 Joerg Kreuter Nanoparticles made of protein with coupled apolipoprotein e for penetration of the blood-brain barrier and methods for the production thereof
WO2004058258A1 (en) 2002-12-24 2004-07-15 Neurochem (International) Limited Therapeutic formulations for the treatment of beta-amyloid related diseases
US20040204354A1 (en) 2002-12-03 2004-10-14 Thomas Nelson Artificial low-density lipoprotein carriers for transport of substances across the blood-brain barrier
US20050238649A1 (en) 2003-11-06 2005-10-27 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
WO2006034488A2 (en) 2004-09-23 2006-03-30 Genentech, Inc. Cysteine engineered antibodies and conjugates
US20080050383A1 (en) 2006-03-29 2008-02-28 New York University Immunotherapy for clearing pathological tau conformers
US7566771B1 (en) 1989-12-21 2009-07-28 Celltech R&D Limited Humanised antibodies
WO2016079597A1 (en) 2014-11-19 2016-05-26 Axon Neuroscience Se Humanized tau antibodies in alzheimer's disease
US9518101B2 (en) 2011-09-19 2016-12-13 Axon Neuroscience Se Protein-based therapy and diagnosis of tau-mediated pathology in alzheimer's disease

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU5508798A (en) * 1996-11-19 1998-06-10 Trustees Of The University Of Pennsylvania, The Diagnostic and therapeutic reagents for alzheimer's disease
WO2008140639A2 (en) * 2007-02-08 2008-11-20 Oligomerix, Inc. Biomarkers and assays for alzheimer's disease
US8093018B2 (en) * 2008-05-20 2012-01-10 Otsuka Pharmaceutical Co., Ltd. Antibody identifying an antigen-bound antibody and an antigen-unbound antibody, and method for preparing the same
DK2462162T3 (en) * 2009-08-06 2017-01-16 Immunas Pharma Inc Antibodies that specifically bind to A-beta oligomers and their use
EP3578567A1 (en) * 2011-12-20 2019-12-11 Janssen Biotech, Inc. Anti-phf-tau antibodies and their uses
US8853505B2 (en) * 2012-02-27 2014-10-07 Syngenta Participations Ag Variety corn line AA2205
US8980270B2 (en) * 2013-01-18 2015-03-17 Ipierian, Inc. Methods of treating a tauopathy
WO2017133673A1 (zh) * 2016-02-05 2017-08-10 江苏恒瑞医药股份有限公司 凝血酶抗体、其抗原结合片段及医药用途

Patent Citations (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4880935A (en) 1986-07-11 1989-11-14 Icrf (Patents) Limited Heterobifunctional linking agents derived from N-succinimido-dithio-alpha methyl-methylene-benzoates
US5648260A (en) 1987-03-18 1997-07-15 Scotgen Biopharmaceuticals Incorporated DNA encoding antibodies with altered effector functions
US5624821A (en) 1987-03-18 1997-04-29 Scotgen Biopharmaceuticals Incorporated Antibodies with altered effector functions
US5202238A (en) 1987-10-27 1993-04-13 Oncogen Production of chimeric antibodies by homologous recombination
US5204244A (en) 1987-10-27 1993-04-20 Oncogen Production of chimeric antibodies by homologous recombination
US5122368A (en) 1988-02-11 1992-06-16 Bristol-Myers Squibb Company Anthracycline conjugates having a novel linker and methods for their production
US7566771B1 (en) 1989-12-21 2009-07-28 Celltech R&D Limited Humanised antibodies
US5268164A (en) 1990-04-23 1993-12-07 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5506206A (en) 1990-04-23 1996-04-09 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US5112596A (en) 1990-04-23 1992-05-12 Alkermes, Inc. Method for increasing blood-brain barrier permeability by administering a bradykinin agonist of blood-brain barrier permeability
US5686416A (en) 1991-04-23 1997-11-11 Alkermes, Inc. Increasing blood-brain barrier permeability with permeabilizer peptides
US20040253645A1 (en) 1991-05-17 2004-12-16 Daugherty Bruce L. Method for reducing the immunogenicity of antibody variable domains
US6797492B2 (en) 1991-05-17 2004-09-28 Merck & Co., Inc. Method for reducing the immunogenicity of antibody variable domains
US20020034765A1 (en) 1991-05-17 2002-03-21 Merck & Co., Inc. Method for reducing the immunogenicity of antibody variable domains
WO1993010151A1 (en) 1991-11-22 1993-05-27 Immunex Corporation Receptor for oncostatin m and leukemia inhibitory factor
US5622929A (en) 1992-01-23 1997-04-22 Bristol-Myers Squibb Company Thioether conjugates
US20020025313A1 (en) 1992-07-27 2002-02-28 Micklus Michael J. Targeting of liposomes to the blood-brain barrier
US6214345B1 (en) 1993-05-14 2001-04-10 Bristol-Myers Squibb Co. Lysosomal enzyme-cleavable antitumor drug conjugates
US5457035A (en) 1993-07-23 1995-10-10 Immunex Corporation Cytokine which is a ligand for OX40
US5712120A (en) 1994-06-30 1998-01-27 Centro De Immunologia Molecular Method for obtaining modified immunoglobulins with reduced immunogenicity of murine antibody variable domains, compositions containing them
WO1997004801A1 (en) 1995-07-27 1997-02-13 Genentech, Inc. Stabile isotonic lyophilized protein formulation
US5824805A (en) 1995-12-22 1998-10-20 King; Dalton Branched hydrazone linkers
US20030153043A1 (en) 1997-05-21 2003-08-14 Biovation Limited Method for the production of non-immunogenic proteins
US20020038086A1 (en) 2000-07-27 2002-03-28 Hynynen Kullervo H. Blood-brain barrier opening
US20030083299A1 (en) 2000-11-04 2003-05-01 Ferguson Ian A. Non-invasive delivery of polypeptides through the blood-brain barrier
US20040131692A1 (en) 2001-05-05 2004-07-08 Joerg Kreuter Nanoparticles made of protein with coupled apolipoprotein e for penetration of the blood-brain barrier and methods for the production thereof
WO2004007547A2 (en) 2002-07-12 2004-01-22 Axon Neuroscience Forschungs- Und Entwicklungs Gmbh Truncated tau proteins
US20040204354A1 (en) 2002-12-03 2004-10-14 Thomas Nelson Artificial low-density lipoprotein carriers for transport of substances across the blood-brain barrier
WO2004058258A1 (en) 2002-12-24 2004-07-15 Neurochem (International) Limited Therapeutic formulations for the treatment of beta-amyloid related diseases
US20050238649A1 (en) 2003-11-06 2005-10-27 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
US7498298B2 (en) 2003-11-06 2009-03-03 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
WO2006034488A2 (en) 2004-09-23 2006-03-30 Genentech, Inc. Cysteine engineered antibodies and conjugates
US20080050383A1 (en) 2006-03-29 2008-02-28 New York University Immunotherapy for clearing pathological tau conformers
US9518101B2 (en) 2011-09-19 2016-12-13 Axon Neuroscience Se Protein-based therapy and diagnosis of tau-mediated pathology in alzheimer's disease
WO2016079597A1 (en) 2014-11-19 2016-05-26 Axon Neuroscience Se Humanized tau antibodies in alzheimer's disease

Non-Patent Citations (137)

* Cited by examiner, † Cited by third party
Title
"Catalogue of Cell Lines and Hybridomas", 1985
"Remington's Pharmaceutical Sciences", 2006
ANDERSSON ET AL.: "CSF biomarker levels in early and late onset Alzheimer's disease", NEUROBIOL AGING, vol. 30, 2008, pages 1895 - 1901, XP026692382, DOI: doi:10.1016/j.neurobiolaging.2008.02.007
ANDREASEN ET AL., ARCH. NEUROL., vol. 56, 1999, pages 673 - 680
ANDREASEN ET AL.: "Cerebrospinal fluid levels of total-tau, phospho-tau and A beta 42 predicts development of Alzheimer's disease in patients with mild cognitive impairment", ACTA NEUROL. SCAND. SUPPL., vol. 179, 2003, pages 47 - 51, XP002284308, DOI: doi:10.1034/j.1600-0404.107.s179.9.x
ARAI ET AL., JAGS, vol. 45, 1997, pages 1228 - 31
ASUNI ET AL.: "Immunotherapy Targeting Pathological Tau Conformers In a Tangle Mouse Model Reduces Brain Pathology with Associated Functional Improvements", THE JOURNAL OF NEUROSCIENCE, vol. 27, no. 34, 2007, pages 9115 - 9129, XP002606710, DOI: doi:10.1523/JNEUROSCI.2361-07.2007
BARRIO ET AL.: "The Irony of PET Tau Probe Specificity", J. NUCL. MED., vol. 59, no. 1, 2018, pages 115 - 116
BAUM ET AL., EMBO J., vol. 13, 1994, pages 3992 - 4001
BEJANIN ET AL.: "Tau pathology and neurodegeneration contribute to cognitive impairment in Alzheimer's disease", BRAIN, vol. 140, no. 12, 2017, pages 3286 - 3300
BEYCHOK: "Cells of Immunoglobulin Synthesis", 1979, ACADEMIC PRESS
BLENNOW: "CSF markers for incipient Alzheimer's disease", LANCET NEUROL., vol. 2, 2005, pages 605 - 613, XP004811238, DOI: doi:10.1016/S1474-4422(03)00530-1
BLENNOWHAMPEL: "CSF markers for incipient Alzheimer's disease", LANCET NEUROL., vol. 2, 2003, pages 605 - 613, XP004811238, DOI: doi:10.1016/S1474-4422(03)00530-1
BLOMBERG ET AL., NEUROSCI. LETT., vol. 214, 1996, pages 163 - 166
BOUWMAN ET AL.: "Longtitudinal changes of CSF biomarkers in memory clinic patients", NEUROLOGY, vol. 69, 2007, pages 1006 - 1011
BRAAK ET AL.: "Neuropathological stageing of Alzheimer-related changes", ACTA NEUROPATHOBGICA, vol. 82, no. 4, 1991, pages 239 - 59
BRAAK ET AL.: "Neuropathological stageirig of Alzheimer-related changes", ACTA NEUROPATHOBGICA, vol. 82, no. 4, 1991, pages 239 - 59
BRAAKBRAAK: "Neuropathological stageing of Alzheimer-related changes", ACTA NEUROPATHOL, vol. 82, 1991, pages 239 - 59
BURNS ET AL., ALZHEIMER'S DISEASE, THE LANCET, vol. 360, 13 July 2002 (2002-07-13)
CARTER ET AL., PNAS USA, vol. 89, 1992, pages 4285
CAVEDO ET AL.: "The Road Ahead to Cure Alzheimer's Disease: Development of Biological Markers and Neuroimaging Methods for Prevention Trials Across all Stages and Target Populations", J. PREV. ALZHEIMER'S DIS., vol. 3, 2014, pages 181 - 202
CHEUNG ET AL., VIROLOGY, vol. 176, 1990, pages 546
CHOI ET AL., DEVELOPMENT OF TAU PET IMAGING LIGANDS AND THEIR UTILITY IN PRECLINICAL AND CLINICAL STUDIES, vol. 52, no. 1, 2018, pages 24 - 30
CHOTHIALESK, J. MOL. BIOL., vol. 196, 1987, pages 196901 - 917
CITRON ET AL.: "Alzheimer's disease: strategies for disease modification", NATURE REVIEWS, vol. 9, 2010, pages 397
CLOTHIA ET AL., NATURE, vol. 342, 1989, pages 878 - 883
COWAN, C.M.MUDHER, A.: "Are tau aggregates toxic or protective in tauopathies?", FRONTIERS IN NEUROLOGY, vol. 4, 2013, pages 114
CSOKOVA ET AL.: "Rapid purification of truncated tau proteins: model approach to purification of functionally active fragments of disordered proteins, implication for neurodegenerative diseases", PROTEIN EXPRESSION AND PURIFICATION, vol. 35, 2004, pages 366 - 372, XP004506575, DOI: doi:10.1016/j.pep.2004.01.012
CUMMINGS ET AL.: "Alzheimer's disease drug development pipeline: 2017", ALZHEIMER'S & DEMENTIA, vol. 3, 2017, pages 367 - 384
CUMMINGS ET AL.: "Alzheimer's disease drug development pipeline: 2017", ALZHEIMER'S & DEMENTIA: TRANSLATIONAL RESEARCH & CLINICAL INTERVENTIONS, vol. 3, 2017, pages 367 - 384
DELEON ET AL., NEUROBIOL. AGING, vol. 27, 2006, pages 394 - 401
DELEON ET AL.: "Longitudinal cerebrospinal fluid tau load increases in mild cognitive impairment", NEUROSCI LETT., vol. 333, 2004, pages 183 - 186
DICKEY ET AL.: "Development of a High Throughput Drug Screening Assay for the Detection of Changes in Tau Levels-Proof of Concept with HSP90 inhibitors", CURRENT ALZHEIMER RESEARCH, vol. 2, 2005, pages 231 - 238, XP008121926, DOI: doi:10.2174/1567205053585927
DICKEYPETRUCELLI: "Pharmacologic reductions of total tau levels; implications for the role of microtubule dynamics in regulating tau expression", MOLECULAR NEURODEGENERATION, vol. 1, 2006, pages 6
D'SOUZA, I.SCHELLENBERG, G.D.: "Regulation of tau isoform expression and dementia", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1739, 2005, pages 104 - 115, XP025329094, DOI: doi:10.1016/j.bbadis.2004.08.009
DUBOWCHIKWALKER, PHARM. THERAPEUTICS, vol. 83, 1999, pages 67 - 123
EDELMAN G. M. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 63, no. 1, 1969, pages 78 - 85
FORMICHI ET AL.: "Cerebrospinal fluid tau, A beta, and phosphorylated tau protein for the diagnosis of Alzheimer's disease", J. CELL PHYSIOL., vol. 208, 2006, pages 39 - 46, XP002593166, DOI: doi:10.1002/JCP.20602
GILL ET AL., NATURE MED., vol. 9, 2003, pages 589 - 595
GODYN ET AL., PHARMACOLOGICAL REPORTS, vol. 68, 2016, pages 127 - 138
GOEDERT, M. ET AL.: "Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease", NEURON, vol. 3, 1989, pages 519 - 526, XP027463480, DOI: doi:10.1016/0896-6273(89)90210-9
GREENBERGDAVIES: "A preparation of Alzheimer paired helical filaments that diplays distinct tau proteins by polyacrylamide gel electrophoresis", PNAS, vol. 87, 1990, pages 5827 - 31
GREENBERGDAVIES: "A preparation of Alzheimer's paried helical filaments that displays distint tau proteins by polyacrylamide gel electrophoresis", PNAS, vol. 87, 1990, pages 5827 - 31
HAMPEL ET AL., ANN NEUROL., vol. 49, 2001, pages 545 - 546
HAMPEL ET AL.: "Perspective on future role of biological markers in clinical therapy trials of Alzheimer's disease: a long-range point of view beyond 2020", BIOCHEM. PHARMACOL., vol. 88, no. 4, 2014, pages 426 - 46
HANES ET AL.: "Ribosome display efficiently selects and evolves high-affinity antibodies in vitro from immune libraries", PNAS, vol. 95, 1998, pages 14130 - 14135, XP002165663, DOI: doi:10.1073/pnas.95.24.14130
HARDY ET AL.: "Genetic dissection of Alzheimer's disease and related dementias: amyloid and its relationship to tau", NATURE NEUROSCIENCE, vol. 1, no. 5, 1998, XP002258588, DOI: doi:10.1038/1565
HARDY, TRENDS NEUROSCI., vol. 20, 1997, pages 154 - 9
HARDYALLSOP: "Amyloid deposition as the central event in the aetiology of Alzheimer's disease", TIPS, vol. 12, 1991, XP023860717, DOI: doi:10.1016/0165-6147(91)90609-V
HARDYSELKOE: "The Amyloid Hypothesis of Alzheimer's Disease: Progress and Problems on the Road to Therapeutics", SCIENCE, vol. 297, 2002, XP055310378, DOI: doi:10.1126/science.1072994
HARRISON ET AL., SCREENING OF PHAGE ANTIBODY LIBRARIES, vol. 26783-109, 1996, pages 83 - 109
HOGLUND ET AL., DEMENT. GERIATR. COGN. DISORD., vol. 19, 2005, pages 256 - 265
HU ET AL.: "Levels of nonphosphorylated and phosphorylated tau in cerebrospinal fluid Alzheimer's disease patients: an ultrasensitive bienzyme-substrate-recycle enzyme-linked immunosorbent assay", AM. J. PATHOL., vol. 160, 2002, pages 1269 - 1278
HULSTAERT ET AL.: "Improved discrimination of AD patients using beta-amyloid(1-42) and tau levels in CSF", NEUROLOGY, vol. 52, 1999, pages 1555 - 1562, XP009023746
HUSE WDSASTRY SIVERSON SAKANG ASALTING-MEES MBURTON DRBENKOVIV SJLERNER RA: "Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda", SCIENCE, vol. 246, 1989, pages 1275 - 1281, XP000083689, DOI: doi:10.1126/science.2531466
IQBAL ET AL., SUBGROUPS OF ALZHEIMER'S DISEASE BASED ON CEREBROSPINAL FLUID MOLECULAR MARKERS, vol. 58, 2005, pages 748 - 757
IQBALGRUNDKE-IQBAL: "Inhibition of Neurofibrillary Degeneration: A Promising Approach to Alzheimer's Disease and Other Tauopathies", CURRENT DRUG TARGETS, vol. 5, 2004, pages 495 - 502
IQBALGRUNDKE-LQBAL: "Developing pharmacological therapies for Alzheimer disease", CELL. MOL. LIFE SCI., vol. 64, 2007, pages 2234 - 2244, XP019536893, DOI: doi:10.1007/s00018-007-7221-9
IVANOVOVA ET AL.: "High-yield purification of fetal tau preserving its structure and phosphorylation", J. IMMUNOL. METHODS, vol. 339, 2008, pages 17 - 22, XP025504738, DOI: doi:10.1016/j.jim.2008.07.014
JOHNSON ET AL., ANTICANCER RES., vol. 15, 1995, pages 1387 - 93
JOHNSON GV ET AL.: "Tau phosphorylation in neuronal cell function and dysfunction", J. CELL SCI., vol. 117, 15 November 2004 (2004-11-15), pages 5721 - 9, XP055306280, DOI: doi:10.1242/jcs.01558
JOHNSON, G.WU, T. T., NUCLEIC ACIDS RES., vol. 28, 2000, pages 214 - 218
KAAS, Q.LEFRANC, M. P., CURRENT BIOINFORMATICS, vol. 2, 2007, pages 21 - 30
KAAS, Q.RUIZ, M.LEFRANC, M. P.: "T cell receptor and MHC structural data", NUCL. ACIDS. RES., vol. 32, 2004, pages D208 - D210
KABAT, E. A.WU, T. T.PERRY, H. M.GOTTESMANN, K. S.FOELLER, C.: "Sequences of Proteins of Immunological Interest", vol. I, 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES, pages: 151,464
KANAI ET AL., ANN. NEUROL., vol. 44, pages 17 - 26
KANAI ET AL., NEUROSCI. LETT., vol. 267, 1999, pages 65 - 68
KIRKLAND ET AL., J. IMMUNOL, vol. 137, 1986, pages 3614
KONTSEKOVA ET AL.: "One-step method for establishing 8-azaguanine-resistant hybridomas suitable for preparation of triomas", J. IMMUNOL. METHODS, vol. 145, 1991, pages 247 - 250, XP023975161, DOI: doi:10.1016/0022-1759(91)90333-B
KONTSEKOVA ET AL.: "The effect of postfusion cell density on establishment of hybridomas", FOLIA BIOL., vol. 34, 1988, pages 18 - 22
KRAJCIOVA ET AL.: "Preserving free thios of intrinsically disordered tau protein without use of a reducing agent", ANALYTICAL BIOCHEMISTRY, vol. 383, 2008, pages 343 - 345, XP025585809, DOI: doi:10.1016/j.ab.2008.09.022
LARBIG ET AL.: "Screening for Inhibitors of Tau Protein Aggregation into Alzheimer Paired Helical Filaments: A Ligand Based Approach Results in Successful Scaffold Hopping", CURRENT ALZHEIMER RESEARCH, vol. 4, 2007, pages 315 - 323, XP008123572, DOI: doi:10.2174/156720507781077250
LASAGNA-REEVES ET AL., FASEB J., vol. 26, 2012, pages 1946 - 59
LAUR ET AL., BIOORG-MED-CHEM., vol. 3, no. 10, 1995, pages 1305 - 1304
LEFRANC M. P., IMMUNOLOGY TODAY, vol. 18, 1997, pages 509
LEFRANC M. P.: "The IMGT unique numbering for immunoglobulins, T-cell receptors, and Ig-like domains", THE IMMUNOLOGIST, vol. 7, no. 132-1 36, 1999, pages 1999 - 136
LEFRANC, M. P.POMMIE, C.RUIZ, M.GUIDICELLI, V.FOULQUIER, E.TRUONG, L.THOUVENIN-CONTET, V.LEFRANC, DEV. COMP. IMMUNOL., vol. 27, 2003, pages 55 - 77
LEMOINE ET AL.: "Comparative binding properties of the tau PET tracers THK5117, THK5351, PBB3, and T807 in postmortem Alzheimer brains", ALZHEIMERS RES. THER., vol. 9, no. 1, 2017, pages 96
MATTSSON ET AL., J. ALZHEIMERS DIS., vol. 30, no. 4, 2012, pages 767 - 778
MATTSSON ET AL.: "AV-1451 and CSF T-tau and P-tau as biomarkers in Alzheimer's disease", EMBO MOL. MED., vol. 9, 2017, pages 1212 - 1223
MATTSSON ET AL.: "Comparing 18F-AV-1451 with CSF t-tau and p-tau for diagnosis of Alzheimer disease", NEUROLOGY, vol. 5, 2018, pages e388 - e395
MOLDENHAUER ET AL., SCAND. J. IMMUNOL., vol. 32, 1990, pages 77
MOLLENHAUER ET AL., J. NEURAL. TRANSM., vol. 112, 2005, pages 933 - 948
MOREL ET AL., MOL. IMMUNOL., vol. 25, no. 1, 1988, pages 7
MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855
MORRISON, S. L. ET AL., PROC. NATL. ACAD SCI. USA, vol. 81, 1984, pages 6851 - 6855
MURRAY ET AL.: "Clinicopathologic assessment and imaging of tauopathies in neurodegenerative dementias", ALZHEIMER'S RESEARCH & THERAPY, vol. 6, no. 1, 2014, pages 1, XP021193614, DOI: doi:10.1186/alzrt231
MURRAY ET AL.: "Neuropathologically defined subtypes of Alzheimer's disease with distinct clinical characteristics: a retrospective study", LANCET NEUROL., vol. 9, 2011, pages 785 - 96, XP055183487, DOI: doi:10.1016/S1474-4422(11)70156-9
NECULA ET AL.: "Cyanine Dye N744 Inhibits Tau Fibrillization by Blocking Filament Extension: Implications for the Treatment of Tauopathic Neurodegenerative Diseases", BIOCHEMISTRY, vol. 44, 2005, pages 10227 - 10237, XP055087111, DOI: doi:10.1021/bi050387o
NELSON ET AL.: "Correlation of Alzheimer disease neuropathologic changes with cognitive status: a review of the literature", J. NEUROPATHOL. EXP. NEUROL., vol. 71, 2012, pages 362 - 81
NEUBERGER, M.S. ET AL., NATURE, vol. 314, 1985, pages 268 - 270
NEUWELT, E. A.: "Implication of the Blood-Brain Barrier and its Manipulation", vol. 1, 2, 1989, PLENUM PRESS
NEVILLE ET AL., BIOL. CHEM., vol. 264, 1989, pages 14653 - 14661
NG ET AL.: "Monoamine oxidase B inhibitor, selegiline, reduces F-THK5351 uptake in the human brain", ALZHEIMERS RES. THER., vol. 9, no. 1, 2017, pages 25
NISHIMURA ET AL., METHODS FIND. EXP. CLIN. PHARMACOL., vol. 20, 1998, pages 227 - 235
NOBLE ET AL.: "Inhibition of glycogen synthase kinase-3 by lithium correlates with reduced tauopathy and degeneration in vivo", PNAS, vol. 102, no. 19, 2005, pages 6990 - 6995
ODDO ET AL.: "Aβ Immunotherapy Leads to Clearance of Early, but Not Late, Hyperphosphorylated Tau Aggregates via the Proteasome", NEURON, vol. 43, 2004, pages 321 - 332
OLSSON ET AL.: "CSF and blood biomarkers for the diagnosis of Alzheimer's disease: a systematic review and meta-analysis", LANCET NEUROL., vol. 7, 2016, pages 673 - 84, XP029531930, DOI: doi:10.1016/S1474-4422(16)00070-3
OSSENKOPPELE ET AL.: "Tau PET patterns mirror clinical and neuroanatomical variability in Alzheimer's disease", BRAIN, vol. 139, 2016, pages 1551 - 67
OSTROWITZKI ET AL., ALZHERIMERS RES THER., vol. 9, no. 1, 2017, pages 95
PAPANASTASSIOU ET AL., GENE THERAPY, vol. 9, 2002, pages 398 - 406
PICKHARDT ET AL.: "Screening for Inhibitors of Tau Polymerization", CURRENT ALZHEIMER RESEARCH, vol. 2, 2005, pages 219 - 226, XP009117693, DOI: doi:10.2174/1567205053585891
PLUCKTHUN: "The Pharmacology of Monoclonal Antibodies", vol. 113, 1994, SPRINGER-VERLAG, pages: 269 - 315
POPE M.E.SOSTE M.V.EYFORD B.A.ANDERSON N.L.PEARSON T.W., J. IMMUNOL. METHODS, vol. 341, no. 1-2, 2009, pages 86 - 96
PRESTA ET AL., J IMMUNOL, vol. 151, 1993, pages 2623
PRESTA, L.G.: "Engineering of therapeutic antibodies to minimize immunogenicity and optimize function", ADVANCED DRUG DELIVERY REVIEWS, vol. 58, no. 5-6, 2006, pages 640 - 656, XP024892146, DOI: doi:10.1016/j.addr.2006.01.026
RIECHMANN, L. ET AL., NATURE, vol. 332, 1988, pages 323 - 327
RISSIN, D.M. ET AL.: "Single-molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations", NAT. BIOTECHNOL., vol. 28, no. 6, 2010, pages 555 - 559
ROBERSON ET AL.: "Reducing Endogenous Tau Ameliorates Amyloid β-induced Deficits in an Alzheimer's Disease Mouse Model", SCIENCE, vol. 316, 2007, pages 750
RUIZ, M.LEFRANC, M. P., IMMUNOGENETICS, vol. 53, 2002, pages 857 - 883
SAINT-AUBERT ET AL.: "Tau PET imaging: present and future directions", MOL. NEURODEGENER., vol. 12, 2017, pages 19
SAMBROOKRUSSELL, MOLECULAR CLONING: A LABORATORY MANUAL, 2001
SASTRY LALTING-MESS MHUSE WDSHORT JMSORGE JAHAY BNJANDA KDBENKOVIV SJLERNER RA: "Cloning of the immunological repertoire for generation of monoclonal catalytic antibodies: construction of a heavy chain variable region-specific cDNA library", PROC NATL ACAD SCI USA, vol. 86, 1989, pages 5728 - 5732, XP008026026, DOI: doi:10.1073/pnas.86.15.5728
SCHNEIDERMANDELKOW ET AL.: "Tau-Based Treatment Strategies in Neurodegenerative Diseases", NEUROTHERAPEUTICS, vol. 5, 2008, pages 443 - 457
SCHNEIDERMANDELKOW: "Tau-Based Treatment Strategies in Neurodegenerative Disease", NEUROTHERAPEUTICS, vol. 5, 2008, pages 443 - 457
SEABROOK ET AL.: "Beyond Amyloid the Next Generation of Alzheimer's Disease Therapeutics", MOLECULAR INTERVENTION, vol. 7, no. 5, 2007
SHIPTON ET AL.: "Tau Protein Is Required for Amyloid β-induced Impairment of Hippocampal Long-Term Potentiation", J. NEUROSCIENCE, vol. 31, no. 5, 2011, pages 1688 - 1692
SIMS ET AL., J. IMMUNOL., vol. 151, 1993, pages 2296
SLOANE ET AL.: "The Public Health Impact of Alzheimer's Disease, 2000-2050: Potential Implication of Treatment Advances", ANNU. REV. PUBLIC HEALTH, vol. 23, 2002, pages 213 - 31
STAHLI ET AL., METHODS IN ENZYMOLOGY, vol. 9, 1983, pages 242
SUNDERLAND ET AL., BIOL. PSYCHIATRY, vol. 46, 1999, pages 750 - 755
TABIRA, T.: "Immunization Therapy for Alzheimer disease: A Comprehensive Review of Active Immunization Strategies", TOHOKUJ. EXP. MED., vol. 220, 2010, pages 95 - 106, XP002599098, DOI: doi:10.1620/tjem.220.95
TANIGUCHI ET AL.: "Inhibition of Heparin-induced Tau Filament Formation by Phenothiazines, Polyphenols, and Porphyrins", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 280, no. 9, 2005, pages 7614 - 7623, XP003014102, DOI: doi:10.1074/jbc.M408714200
TAPIOLA ET AL., NEUROSCI. LETT., vol. 280, 2000, pages 119 - 122
THORPE ET AL., CANCER RES., vol. 47, 1987, pages 5924 - 5931
TOLEDO ET AL., ACTA NEUROPATHOL., vol. 125, no. 5, 2013, pages 659 - 70
WALSHSELKOE: "Deciphering the Molecular Basis of Memory Failure in Alzheimer's Disease", NEURON, vol. 44, 2004, pages 181 - 193
WANG ET AL.: "Analysis of Cerebrospinal Fluid and [11 C]PIB PET Biomarkers for Alzheimer's Disease with Updated Protocols", JAD, vol. 52, no. 4, 2016, pages 1403 - 13
WANG ET AL.: "Tau in physiology and pathology", NATURE REVIEWS, vol. 17, 2016, pages 22 - 35
WAWRZYNCZAK ET AL.: "Immunoconjugates: Antibody Conjugates in Radiolmagery and Therapy of Cancer", 1987, OXFORD U. PRESS
WENNSTROM ET AL.: "The Inflammatory Marker YKL-40 Is Elevated in Cerebrospinal Fluid from Patients with Alzheimer's but Not Parkinson's Disease or Dementia with Lewy Bodies", PLOSONE, vol. 10, no. 8, 2015, pages e0135458
WISCHIK ET AL.: "Selective inhibition of Alzheimer's disease-like tau aggregation by phenothiazines", PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 11213 - 11218, XP002067057, DOI: doi:10.1073/pnas.93.20.11213
WU JLI L: "Autoantibodies in Alzheimer's disease: potential biomarkers, pathogenic roles, and therapeutic implications", JOURNAL OF BIOMEDICAL RESEARCH, vol. 30, no. 5, 2016, pages 361 - 372
ZETTERBERG ET AL., ALZHEIMERS RES. THER., vol. 5, no. 2, 2007, pages 9
ZHANG ET AL.: "Microtubule-binding drugs offset tau sequestration by stabilizing microtubules and reversing fast axonal transport deficits in a tauopathy model", PNAS, vol. 102, no. 1, 2005, pages 227 - 231, XP002539191, DOI: doi:10.1073/PNAS.0406361102
ZILKA ET AL.: "Chaperone-like Antibodies Targeting Misfolded Tau Protein: New Vistas in the Immunotherapy of Neurodegenerative Foldopathies", JOURNAL OF ALZHEIMER'S DISEASE, vol. 15, 2008, pages 169 - 177
ZILKA ET AL.: "Chaperon-like Antibodies Targeting Misfolded Tau Protein: New Vistas in the Immunotherapy of Neurodegenerative Foldopathies", JOURNAL OF ALZHEIMER'S DISEASE, vol. 15, 2008, pages 169 - 177

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11643457B2 (en) 2013-03-13 2023-05-09 Prothena Biosciences Limited Tau immunotherapy
US11492393B2 (en) 2016-05-02 2022-11-08 Prothena Biosciences Limited Tau immunotherapy
US11584791B2 (en) 2016-05-02 2023-02-21 Prothena Biosciences Limited Antibodies recognizing tau
US11958896B2 (en) 2017-05-02 2024-04-16 Prothena Biosciences Limited Antibodies recognizing tau
US11926659B2 (en) 2019-03-03 2024-03-12 Prothena Biosciences Limited Antibodies recognizing tau
WO2021048619A2 (en) 2019-09-09 2021-03-18 Axon Neuroscience Se Biomarkers and treatments of alzheimer's disease and mild cognitive impairment
WO2022132923A1 (en) * 2020-12-16 2022-06-23 Voyager Therapeutics, Inc. Tau binding compounds
WO2022176959A1 (en) * 2021-02-19 2022-08-25 Eisai R&D Management Co., Ltd. Anti-pt217 tau antibody
WO2024040212A3 (en) * 2022-08-19 2024-04-25 Staidson Biopharma Inc. Antibodies specifically recognizing programmed cell death 1 ligand 1 and uses thereof

Also Published As

Publication number Publication date
CA3095443A1 (en) 2019-10-03
MX2020009991A (es) 2020-10-14
WO2019186276A8 (en) 2020-10-15
KR20200144551A (ko) 2020-12-29
BR112020018868A2 (pt) 2021-01-26
CN112236452A (zh) 2021-01-15
AU2019244481A1 (en) 2020-10-01
IL277577A (en) 2020-11-30
SG11202008098TA (en) 2020-10-29
EP3774887A2 (en) 2021-02-17
RU2020135052A (ru) 2022-04-29
WO2019186276A3 (en) 2020-02-27
JP2021520777A (ja) 2021-08-26

Similar Documents

Publication Publication Date Title
AU2019244481A1 (en) Antibody-based methods of detecting and treating Alzheimer's disease
US11319363B2 (en) Humanized tau antibodies in Alzheimer's disease
CN108034005B (zh) 识别Tau的磷酸化特异抗体
US20200369754A1 (en) Binding molecules that specifically bind to tau
US20210122810A1 (en) Binding molecules that specifically bind to tau
US20230151083A1 (en) Anti-phf-tau antibodies and uses thereof
CN113891746A (zh) 焦谷氨酸淀粉样蛋白-β的抗体及其用途
US20210139568A1 (en) Antibody-based methods of detecting and treating alzheimer's disease
US20240150451A1 (en) Anti-tau antibodies and uses thereof
EP3334453A2 (en) Antibody-based molecules specific for the truncated asp421 epitope of tau and their uses in the diagnosis and treatment of tauopathy
US20230365665A1 (en) ANTIBODY COMPOSITIONS TARGETING NON-PHOSPHORYLATED a-SYNUCLEIN AGGREGATES
WO2022060236A1 (en) ANTIBODY COMPOSITIONS TARGETING NON-PHOSPHORYLATED α-SYNUCLEIN AGGREGATES
WO2022079297A1 (en) Antibodies binding to alpha-synuclein for therapy and diagnosis
EA039569B1 (ru) Антитела, специфичные к гиперфосфорилированному тау-белку, и способы их применения

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2020551506

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3095443

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019244481

Country of ref document: AU

Date of ref document: 20190327

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020018868

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2019732436

Country of ref document: EP

Effective date: 20201028

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19732436

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112020018868

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200916