WO2019178410A1 - Micro-rna and obesity - Google Patents

Micro-rna and obesity Download PDF

Info

Publication number
WO2019178410A1
WO2019178410A1 PCT/US2019/022350 US2019022350W WO2019178410A1 WO 2019178410 A1 WO2019178410 A1 WO 2019178410A1 US 2019022350 W US2019022350 W US 2019022350W WO 2019178410 A1 WO2019178410 A1 WO 2019178410A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
inhibitor
disclosure
oligonucleotide
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/022350
Other languages
English (en)
French (fr)
Inventor
Pier Paulo PANDOLFI
Riccardo PANELLA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beth Israel Deaconess Medical Center Inc
Original Assignee
Beth Israel Deaconess Medical Center Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beth Israel Deaconess Medical Center Inc filed Critical Beth Israel Deaconess Medical Center Inc
Priority to JP2020549635A priority Critical patent/JP2021518841A/ja
Priority to KR1020207029243A priority patent/KR20200132920A/ko
Priority to EP19768285.9A priority patent/EP3765610A4/en
Priority to RU2020132725A priority patent/RU2020132725A/ru
Priority to CN201980032204.4A priority patent/CN112119159B/zh
Priority to SG11202008921YA priority patent/SG11202008921YA/en
Priority to CA3093844A priority patent/CA3093844A1/en
Priority to BR112020018752-6A priority patent/BR112020018752A2/pt
Priority to AU2019234916A priority patent/AU2019234916B2/en
Priority to US16/979,777 priority patent/US11753639B2/en
Publication of WO2019178410A1 publication Critical patent/WO2019178410A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity

Definitions

  • the disclosure relates to the treatment and prevention of metabolic disorders by administering agents that modulate the activity or expression of microRNAs.
  • MicroRNAs are nucleic acid molecules that regulate the expression of target genes.
  • MiRNAs are typically short (typically 18-24 nucleotides) and act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, and/or by inhibiting translation, when their sequences contain mismatches.
  • Functional analyses of miRNAs have revealed that these small non-coding RNAs contribute to different physiological and metabolic processes, including regulating genes associated with metabolic disorders. Metabolic disorders are characterized by one or more abnormalities in metabolic function in the body. Metabolic disorders are also characterized by obesity and weight gain, a deficiency in insulin production, or a deficiency in sensitivity to insulin.
  • Metabolic disorders are related to defects the body’s use of blood glucose, resulting in abnormally high levels of blood glucose. Metabolic disorders affect millions of people worldwide, and can be life-threatening disorders. With the incidence of obesity on the rise in the United States, there is a critical need to develop more effective therapies to reduce the health risks and alleviate the symptoms associated with obesity, overeating, excessive bodyweight gain or excessive accumulation of fat. As such, there is a need for method and compositions to treat, prevent, or delay the onset of metabolic disorders.
  • the present disclosure provides new methods for the treatment or prevention of metabolic disorders by administering agents that modulate the activity or expression of microRNAs, for example by inhibiting microRNA expression and/or activity.
  • agents that modulate the activity or expression of microRNAs for example by inhibiting microRNA expression and/or activity.
  • Such inhibition can be mediated by sequence specific chemically modified oligonucleotides, including for example, locked nucleic acid (LNA).
  • LNA locked nucleic acid
  • Inhibitors based on LNA technology, among others, when directed at the metabolic gene regulating miRNAs disclosed herein provide for an effective method of treating or preventing metabolic disorders.
  • the present disclosure provides a method for treating or preventing a metabolic disorder, comprising administering an effective amount of an inhibitor of miR-22 to a subject in need thereof.
  • the expression and/or activity of miR-22 is reduced in the subject following administration of the inhibitor.
  • the inhibitor of miR-22 is an oligonucleotide-based inhibitor.
  • the oligonucleotide-based inhibitor comprises a sequence that is at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% complementary to a mature sequence of miR-22.
  • the oligonucleotide-based inhibitor comprises deoxynucleotides or ribonucleotides.
  • the oligonucleotide-based inhibitor is single stranded. In some embodiments, wherein the oligonucleotide-based inhibitor is double stranded.
  • the oligonucleotide-based inhibitor comprises one or more chemically modified nucleotides.
  • the chemically modified nucleotides are locked nucleotides (LNAs).
  • the oligonucleotide-based inhibitor comprises about 25, about 20, about 15, about 10, about 9, about 8, about 7, about 6, or about 5 or fewer nucleotides. In some embodiments, the oligonucleotide-based inhibitor is conjugated to one or more N- acetylgalactosamine (GalNAc) moieties.
  • GalNAc N- acetylgalactosamine
  • the oligonucleotide-based inhibitor is an antisense oligonucleotide inhibitor. In some embodiments, the oligonucleotide-based inhibitor is a small interfering RNA (siRNA). In some embodiments, the oligonucleotide-based inhibitor is an aptamer.
  • siRNA small interfering RNA
  • the inhibitor of miR-22 is a peptide-based or protein-based inhibitor.
  • the protein-based inhibitor in an antibody or an antigen-binding portion thereof.
  • the inhibitor of miR-22 is a small molecule-based inhibitor.
  • the metabolic disorder is obesity.
  • the subject is suffering from Prader-Willi Syndrome.
  • the subject is suffering from hypercholesterolemia.
  • the subject harbors a fat mass and obesity-associated protein (FTO) variant and/or shows an upregulation of FTO expression and/or activity.
  • FTO fat mass and obesity-associated protein
  • the subject is obese and has a body mass index of greater than about 30. In some embodiments, the subject is overweight and has a body mass index of about 25-29.9.
  • the method induces weight loss. In some embodiments, the method induces a total weight loss of about 1%, about 5%, about 10%, about 15%, about 20%, or about 25% or more in the subject. In some embodiments, the method prevents weight gain.
  • the method reduces or prevents the growth of adipose tissue. In some embodiments, the method impairs adipocyte differentiation.
  • the metabolic disorder is a fatty liver disease.
  • the fatty liver disease is selected from non-alcoholic fatty acid liver disease (NAFLD) or non alcoholic steatohepatitis (NASH).
  • NAFLD non-alcoholic fatty acid liver disease
  • NASH non alcoholic steatohepatitis
  • the method reduces or prevents liver steatosis.
  • the method reduces or prevents liver fibrosis.
  • the method reduces the activity and/or expression of FTO, ALKB Homologous 5 (ALKBH5), CCAAT/enhancer binding protein alpha (CEBPa), peroxisome proliferator activated receptor gamma (PPARy), and/or ATP citrate lyase (ACLY).
  • the method increases the activity and/or expression of phosphatase and tensin homolog (PTEN) and/or tet methylcytosine dioxygenase 2 (TET2).
  • the method alters the activity and/or expression of PPARy co- activator-a (PGCl-a), Specific Protein 1 (SP1), Fibroblast Grow Factor 21 (FGF-21), ETncoupled protein 1 (ETCP1), DNA Damage Included Transcript 4 (DDIT-4, REDD1), tumor protein p63 (TP63), fibroblast growth factor 1 (FGF1), and/or Methyltransferase like 3 (METTL3).
  • PPCl-a PPARy co- activator-a
  • SP1 Specific Protein 1
  • FGF-21 Fibroblast Grow Factor 21
  • ETncoupled protein 1 ETncoupled protein 1
  • DDIT-4, REDD1 DNA Damage Included Transcript 4
  • TP63 tumor protein p63
  • FGF1 fibroblast growth factor 1
  • MEMETTL3 Methyltransferase like 3
  • Figure 1A-C are schematics showing the regulation profile of miR-22.
  • Figure 1A is a schematic showing the position of miR-22 in in 3rd exon in non-coding transcript MGC14376.
  • Figure 1B shows PTEN targeting miRNAs and
  • Figure 1C shows that miR-22 directly targets PTEN and TET to promote tumorigenesis and metastasis.
  • Figures 2A-D show that miR-22 overexpression affects weight of mice.
  • Figure 2A is a picture showing the feeding regimen of Wild Type (WT) and Transgenic (Tg) mice.
  • Figure 2B is an immunohistochemical staining of WT liver and miR-22 Tg mice liver.
  • Figure 2C is a graph showing the average weight of WT versus miR-22 Tg mice and
  • Figure 2D is a bar graph showing the average weight of WT and miR-22 T mice colony.
  • Figure 3A-C are a pair of bar graphs and a line graph showing that miR-22 null mice fail to gain weight on High Fat Diet (HFD).
  • Figure 3 A shows the percentage of body mass increase the entire colony after 2 weeks on the HFD and
  • Figure 3B shows the percentage of body mass increase the entire colony after 4 weeks on the HFD.
  • Figure 3C shows the change in grams of KO vs WT from week 1 to 8 from the start of HFD.
  • Figure 4A-F are a series of bar graphs showing that miR-22 null mice fail to gain weight on HFD.
  • Figure 4A shows the percentage of body mass increase in female mice after 2 weeks on the HFD.
  • Figure 4B shows the percentage of body mass increase in female mice after 4 weeks on the HFD.
  • Figure 4C shows the percentage of body mass increase in female mice after 8 weeks on the HFD.
  • Figure 4D shows the change in grams in KO vs WT mice after 2 weeks.
  • Figure 4E shows the change in grams in KO vs WT mice after 4 weeks.
  • Figure 4F shows the change in grams in KO vs WT mice after 8 weeks.
  • Figure 5A-D are a series of graphs showing that miR-22 null mice show a different metabolism compared with WT when fed with HFD.
  • Figure 5A shows percentage of fat and lean mass (Figure 5B), (% of total body mass) of miR-22 KO and WT mice pre (day 0) and post 8 weeks on HFD.
  • miR-22 KO cohort has a statistically significant lower fat mass compared to WT after 8 weeks on HFD.
  • Lean mass in miR-22 KO cohort is not affected by HFD, contrary top WT cohort that increase the % of fat mass and decrease the % of lean mass after HFD.
  • Figures 5C and 5D show a series of parameters collected in metabolic cages.
  • Figure 6 is a bar graph showing no difference between WT and KO cohort in food consumption (HFD).
  • Figure 7A-B is a bar graph and Oil-Red-O stain showing that down regulation of miR-22 impairs Mouse Embryonic Fibroblast (MEF) ability to differentiate in adipocytes.
  • Figure 7A is a bar graph showing adipocyte differentiation in MEFs, indicating that miR-22-/- MEFs show 27% less adipocytes than WT.
  • Figure 7B is an Oil-Red-O stain showing MEF from WT, miR-22 +/ and miR-22 /_ , cultured in Adipo-differentiative media for 5 days.
  • Figure 8 shows the design of anti-miR-22 LNA.
  • Figure 9 is a pictorial showing the in vivo experimental planning and conditions for miR- 22-/- and WT mice on HFD following transfection of Vehicle (VCH), Scramble Control RNA (SCR) and Locked Nucleic Acid (LNA).
  • VH Vehicle
  • SCR Scramble Control RNA
  • LNA Locked Nucleic Acid
  • Figure 10 is a bar graph showing that there is no difference between treated and non-treated mice in food consumption for (D) Vehicle, (9) SCR, ( ⁇ ) anti-miR-22.
  • Figure 11A-B are line graphs showing an in vivo pharmacological inhibition of miR-22 prevents mice from becoming obese.
  • Figure 11 A shows the final percentage body increase.
  • Figure 11B shows in vivo silencing of miR-22 in DIO mice.
  • Vehicle in green
  • SCR in red
  • anti-miR-22 in blue
  • Figure 12 is a western blot showing that anti-miR-22 therapy in-vivo is able to increase protein level of major miR-22 targets in the liver.
  • Figure 13A-B is a series of bar graphs (Figure 13A) and immunohistochemical staining (Figure 13B), showing that anti-miR-22 treatment doesn’t affect liver lipid composition but profoundly suppresses liver steatosis.
  • Figure 14A-B is a series of bar graphs showing relative mRNA level in the liver of mice treated with VHL, SCR LNA or LNA anti-miR-22.
  • Figure 14A shows mRNA expression of TET2 and PTEN.
  • Figure 14B shows mRNA expression of FTO, FTO and CEBPa.
  • Figure 15A-C is a series of bar graphs showing relative mRNA level in Brown adipose tissue (BAT) of mice treated with VHL, SCR LNA or LNA anti-miR-22.
  • Figure 15A shows mRNA expression of TET2 and PTEN.
  • Figure 15B shows mRNA expression of FTO, CEBPa and PPARg and
  • Figure 15C shows mRNA expression of UCP1 and CD36.
  • Figure 16A-C is a series of bar graphs showing relative mRNA levels in White adipose tissue (WAT) of mice treated with VHL, SCR LNA or LNA anti-miR-22.
  • Figure 16A are bar graphs showing TET2 and PTEN mRNA expression levels.
  • Figure 16B are bar graphs showing FTO, CEBPa and PPARg mRNA expression levels and
  • Figure 16C are bar graphs showing, UCP1 and CD36 expression levels.
  • Figure 17 is a pictorial of a curative approach showing miR-22 -/- and WT mice on a HFD treated with an anti-miR-22-LNA, SCR and a VHL and placed on a second HFD regimen.
  • Figure 18 is a line graph showing the results of the curative approach whereby there is a significant reduction in body weight in mice already obese and fed with a HFD. After 3 1 ⁇ 2 months of treatment, a significant reduction in body weight was observed in obese mice (average weight >40 g) and fed with HFD. Mice were sacrificed, tissue collected, RNA from livers used for RNAseq.
  • Figure 19A-C are three pictures showing that miR-22 pharmacological inhibition reverts Obese phenotype in mice.
  • Figure 19A shows fat pad from mice treated with VHL
  • Figure 19B shows Fat pad from mice treated with anti-miR-22
  • Figure 19C shows fat pad from mice treated with SCR.
  • Figure 20 is an RNA-seq plot showing the hierarchy cluster analysis from mice liver indicating that miR-22 pharmacological inhibition and genetic Knockout (KO) cluster together, indicating that the treatment is on target and that KO phenotype can be mimicked using LNA construct.
  • KO genetic Knockout
  • Figure 21 is an RNA-Seq plot showing the gene ontology analysis in mice liver indicating that top down regulated pathway in KO and LNA treated mice are lipid metabolism and biosynthesis related.
  • Figure 22 is a western blot showing that anti-miR-22 therapy in-vivo strongly down regulate ATP-citrate lysase (ACL). Anti-miR-22 therapy in vivo strongly downregulates ACL.
  • ACL ATP-citrate lysase
  • Figure 23 is an Oil-Red-O staining showing that Pharmacological inhibition of miR-22 is effective in impairing MEFs adipocytic differentiation.
  • Figure 24 is an Oil- Red O staining ( Figure 24A) and a bar graph ( Figure 24B) showing that anti-miR-22 treatment in Human Primary Mesenchymal cells cultured in Adipo differentiation media for 2 weeks with or without LNA anti-miR-22. Un- assisted uptake 500nM (LNAs added every 2 days).
  • Figure 24B the data in the right (red) bars in each bar graph is for the with LNA# 10-treated cells.
  • Figure 25 is a bar graph showing that pharmacological inhibition of miR-22 is effective in impairing MEFs adipocytic differentiation.
  • the order of data in the bar graphs, when reading from left to right corresponds with the legend (at the right of the graph) when reading from top to bottom.
  • FIG 26 Schematic representation of metabolic network that it is orchestrated by miR-22.
  • miR-22 can target multiple metabolic player (directly or indirectly) at the same time.
  • Figure 27A-B show that, Fat Mass and Obesity-Associated protein (FTO) expression is profoundly down-regulated during adipose induced differentiation in miR-22 deficient MEF but not in WT MEF.
  • Figure 27A is a representation of the FTO gene and
  • Figure 27B is a bar graph showing FTO mRNA expression level under steady state and differentiation media conditions.
  • the order of data in the bar graphs, reading from left to right, is WT (in black), miR- 22+/- (in grey), and miR-22-/- (in blue).
  • Figure 28A-D shows that miR-22 down regulation (genetic or pharmacological) increase level of RNA m6A.
  • Figure 28 A shows the chemical reaction.
  • Figure 28B, Figure 28C and Figure 28D are bar graphs showing the percentage and relative amount of m6A levels in mice on a HFD.
  • Figure 30 are a series of immunohistochemical images showing that miR-22 genetic depletion doesn’t affect liver function and that miR-22 KO mice do not show any liver related disease or dysfunction at old age.
  • Figure 31 are a series of immunohistochemical images showing that anti-miR-22 LNA treatment prevent liver steatosis in diet induced obese mice. Images are at lOx magnification.
  • Figure 32 are a series of immunohistochemical images showing the effects of miR-22 Overexpression and ETnderexpression on Liver Fibrosis.
  • Figure 33 A-C shows that miR-22 Overexpression Affects Liver Function feed with normal chow: Fatty Liver and Fibrosis in WT-mice (Figure 33A) and miR-22 Tg mice ( Figure 33B).
  • Figure 33C shows FSP-l positive cells in liver from mouse on a normal diet in WT and miR-22 Tg mice.
  • Figure 34A-C show that miR-22 Overexpression Affects Liver Function: Fatty Liver and Fibrosis in WT-mice ( Figure 34A) and miR-22 +/- mice ( Figure 34B).
  • Figure 34C shows FSP-l positive cells in liver from mouse on a HFD in WT and miR-22 +/- mice. DETAILED DESCRIPTION OF THE DISCLOSURE
  • the present disclosure is based on the discovery that miRNAs, including miR-22, can regulate targets that are linked to a variety of metabolic disorders, including Obesity, Prader-Willi Syndrome, Hypercholesterolemia, Fatty Liver Disease, Non -Fatty Acid Liver Disease (NAFLD) and/or Non-Alcoholic Steatohepatitis (NASH).
  • miRNAs including miR-22
  • targets that are linked to a variety of metabolic disorders, including Obesity, Prader-Willi Syndrome, Hypercholesterolemia, Fatty Liver Disease, Non -Fatty Acid Liver Disease (NAFLD) and/or Non-Alcoholic Steatohepatitis (NASH).
  • the present disclosure includes targeting miRNAs, including miR-22, with various inhibitors for the treatment and/or prevention of diseases the cause of which can be influenced by modulating the metabolism, for example, metabolic disorders, including Obesity, Prader-Willi Syndrome, Hypercholesterolemia, NAFLD and/or NASH.
  • metabolic disorders including Obesity, Prader-Willi Syndrome, Hypercholesterolemia, NAFLD and/or NASH.
  • MiR-22 directly targets phosphatase and tensin homolog (PTEN) and tet methylcytosine dioxygenase (TET) to promote tumorigenesis, metastasis and metabolic disorders. More than 60 PTEN-targeting miRNAs and no less than 30 new proto-oncogenic genetic loci are studied in human cancer. PTEN-targeting miRNAs are highly conserved evolutionarily among vertebrates and ubiquitously expressed in various tissues, (Lagos-Quintana et al, 2001, 2002; Neely et al, 2006). By targeting PTEN, miR-22 is remains metabolically relevant, as PTEN lowering or its elevation triggers a Warburg- or an anti -Warburg metabolic state respectively. In some embodiments, miR-22 targeting genes regulate metabolism and fatty acid oxidation or biogenesis.
  • the methods of the present disclosure provide a method for treating or preventing a metabolic disorder, comprising administering an effective amount of an inhibitor of miR-22 to a subject in need thereof.
  • LNA locked nucleic acid
  • the LNA inhibitors when directed at the metabolism gene-regulating miRNAs disclosed herein, provide for cost effective agents that can be delivered efficiently and possess sufficient bioavailability for the treatment and prevention of various metabolic disorders.
  • the present disclosure further provides uses of any methods or combinations described herein in the manufacture of a medicament for treating a disease.
  • diseases include, for example, metabolic disorders or a disease influenced by modulating the metabolism (e.g Fat related metabolism and synthesis pathway).
  • miRNAs including miR-22 regulate fat related metabolism and synthesis pathway targets and/or genes.
  • the fat related metabolism and synthesis genes include Fat mass and obesity-associated protein (FTO), CCAAT/enhancer binding protein alpha (CEBPa), peroxisome proliferator activated receptor gamma (PPARg), phosphatase and tensin homolog (PTEN), tet methylcytosine dioxygenase 2 (TET2), ATP citrate lyase (ACLY), bone morphogenetic protein 7 (BMP-7) and/or sirtuin 1 (SIRT-l).
  • FTO Fat mass and obesity-associated protein
  • CEBPa CCAAT/enhancer binding protein alpha
  • PPARg peroxisome proliferator activated receptor gamma
  • PTEN phosphatase and tensin homolog
  • TET2 tet methylcytosine dioxygenase 2
  • ACLY ATP citrate lyase
  • the fat related metabolism and synthesis genes include FTO.
  • the method reduces the activity and/or expression of fat mass and obesity- associated protein (FTO), CEBPa, and/or PPARy.
  • the method reduces the activity and/or expression of ALKB Homologous 5 (ALKBH5). In some embodiments, the method increases the activity and/or expression of PTEN and/or TET2.
  • the method alters the activity and/or expression of PPARy co- activator-a (PGCl-a), Specific Protein 1 (SP1), Fibroblast Grow Factor 21 (FGF-21), ETncoupled protein 1 (ETCP1), DNA Damage Included Transcript 4 (DDIT-4, REDD1), Methyltransf erase like 3 (METTL3), tumor protein p63 (TP63) and/or fibroblast growth factor 1 (FGF1).
  • PPCl-a PPARy co- activator-a
  • SP1 Specific Protein 1
  • FGF-21 Fibroblast Grow Factor 21
  • ETncoupled protein 1 ETncoupled protein 1
  • DDIT-4, REDD1 DNA Damage Included Transcript 4
  • REDD1 Methyltransf erase like 3
  • TP63 tumor protein p63
  • FGF1 fibroblast growth factor 1
  • the method alters the level of DNA or RNA methylation, or affects the m6A level at RNA level.
  • the present disclosure treats or prevents metabolic disorders (by way of non-limiting example, Obesity, Prader-Willi Syndrome, Hypercholesterolemia, Fatty Liver Disease, NAFLD and/or NASH) in a subject through the inhibition of a miRNA.
  • MiRNAs are short nucleic acid molecules that are able to regulate the expression of target genes. See review by Carrington et al, Science, Vol. 301(5631):336-338, 2003. MiRNAs are often between about 18 to 24 nucleotides in length. MiRNAs act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, and/or by inhibiting translation, when their sequences contain mismatches.
  • mature miRNAs are believed to be generated by pol II or pol III and arise from initial transcripts termed pri-miRNAs. These pri-miRNAs are frequently several thousand bases long and are therefore processed to make much shorter mature miRNAs. These pri-miRNAs may be multi cistronic and result from the transcription of several clustered sequences that organize what may develop into many miRNAs. The processing to yield miRNAs may be two-steps. First, pri-miRNAs may be processed in the nucleus by the RNase Drosha into about 70- to about lOO-nucleotide hairpin-shaped precursors (pre-miRNAs).
  • the hairpin pre-miRNAs may be further processed by the RNase Dicer to produce a double-stranded miRNA.
  • the mature miRNA strand may then be incorporated into the RNA-induced silencing complex (RISC), where it may associate with its target mRNAs by base-pair complementarity and lead to suppression of protein expression.
  • RISC RNA-induced silencing complex
  • the other strand of the miRNA duplex that is not preferentially selected for entry into a RISC silencing complex is known as the passenger strand or minor miRNA or star (*) strand. This strand may be degraded.
  • a miRNA may refer to pri- and/or pre- and/or mature and/or minor (star) strand and/or duplex version of miRNA.
  • miRNA genes may be located within introns of protein-coding genes or within introns or exons of noncoding transcriptional units.
  • the expression of intronic miRNAs may coincide with that of the hosting transcriptional units because they are typically oriented in the same direction and are coordinately expressed with the pre-mRNAs in which they reside.
  • miRNAs may bind to sequences within the 3' untranslated region (3'UTR) of target gene transcripts. In some embodiments, miRNAs may bind to sequences outside of the 3'UTR of target gene transcripts. In some embodiments, miRNAs may bind to both within and outside the 3'UTR of target gene transcripts.
  • nucleotide pairing between the second and seventh nucleotides of the miRNA (the miRNA seed sequence) and the corresponding sequence along the target 3'UTR (seed match) may occur for target recognition.
  • the binding between miRNA and target may comprise about a 5 nucleotide base pairing.
  • the binding between miRNA and target may comprise more than a 5 nucleotide base pairing.
  • the binding between an miRNA and the gene that it regulates may be mediated by the miRNA binding up to 2, up to 4, up to 6, up to 8, or up to 10 sites of the target nucleic acid.
  • MiRNAs of the present disclosure may regulate nucleic acids, including but not limited to metabolic-critical genes such as genes of a marker linked to a metabolic disorder etiology, by direct binding. This binding may be perfectly complementary to the target nucleic acid or contain mismatches. The effect of this binding may be to promote degradation and/or to inhibit translation of the target.
  • the present invention treats or prevents metabolic disorder in a subject through the inhibition of miRNAs, such as miR-22.
  • the nucleic acid encoding mir-22 comprises or consists of AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 1) .
  • the predicted miR-22 hairpin precursor is contained entirely within exon 2 of a noncoding transcript, C17orf91 , and the splicing pattern is generally conserved in human and mouse, despite the lack of protein-coding potential.
  • C17orf91 a noncoding transcript
  • splicing pattern is generally conserved in human and mouse, despite the lack of protein-coding potential.
  • Deletion of exon 2 of Cl7orf9l encompassing mir-22 in mouse models has revealed that miR-22 may play a role in cardiac hypertrophy and remodeling by targeting SIRT1 (NAD-dependent deacetylase sirtuin-l), HDAC4 (histone deacetylase 4), PURB (purine-rich element binding protein B) and PTEN.
  • SIRT1 NAD-dependent deacetylase sirtuin-l
  • HDAC4 histone deacetylase 4
  • PURB purine-rich element binding protein B
  • the present invention shows that miR-22 may function as an epigenetic modifier and EMT promoter independently of its ability to target Pten.
  • the present disclosure includes treatment or prevention of metabolic disorder in a subject through the prevention of an increase and/or causing of a decrease in fat mass and obesity- associated protein (FTO) variant and/or shows a downregulation of FTO expression and/or activity.
  • FTO is an enzyme that in humans is encoded by the FTO gene located on chromosome 16. As one homolog in the AlkB family proteins, it is the first mRNA demethylase that has been identified. Certain variants of the FTO gene are associated with obesity in humans.
  • the sequence of the inhibitor is conserved across species.
  • the sequence of the inhibitor is taken, in part, from the sequence of a human transcript.
  • the inhibitor is selected to reduce the expression and/or activity of the target miRNA, by way of non-limiting example, miR-22, in a subject.
  • an inhibitor of miRNA is an antisense oligonucleotide.
  • Antisense oligonucleotides can include ribonucleotides or deoxyribonucleotides or a combination thereof.
  • Antisense oligonucleotides may have at least one chemical modification (non-limiting examples are sugar or backbone modifications).
  • the chemical modification is one or more of a phosphorothioate, 2'- 0-Methyl, or 2'-0-Methoxyethyl, 2'-0-alkyl-RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'- fluoro-DNA unit (including, but not limited to, a DNA analogue with a substitution to a fluorine at the 2' position (2' F)), LNA unit, PNA unit, HNA unit, INA unit, and a 2' MOE RNA unit.
  • Suitable antisense oligonucleotides can be comprised of one or more conformationally constrained or bicyclic sugar nucleoside modifications (BSN) that confer enhanced thermal stability to complexes formed between the oligonucleotide containing BSN and their complementary miRNA target strand.
  • BSN bicyclic sugar nucleoside modifications
  • the antisense oligonucleotides contain at least one locked nucleic acid.
  • Locked nucleic acids (LNAs) contain a 2'-0, 4'-C-methylene ribonucleoside (structure A) wherein the ribose sugar moiety is in a locked conformation.
  • the antisense oligonucleotides contain at least one 2', 4'-C- bridged 2' deoxyribonucleoside (CDNA, structure B). See, e.g., U.S. Patent No. 6,403,566 and Wang etal, (1999) Bioorganic and Medicinal Chemistry Letters, Vol. 9: 1147-1150, both of which are herein incorporated by reference in their entireties.
  • the antisense oligonucleotides contain at least one modified nucleoside having the structure shown in structure C.
  • the antisense oligonucleotides targeting miRNAs that regulate fat related metabolism and synthesis pathway targets can contain combinations of BSN (LNA, CDNA, and the like) or other modified nucleotides, and ribonucleotides or deoxyribonucleotides.
  • the antisense oligonucleotides can comprise peptide nucleic acids (PNAs), which contain a peptide-based backbone rather than a sugar-phosphate backbone.
  • PNAs peptide nucleic acids
  • Other modified sugar or phosphodiester modifications to the antisense oligonucleotide are also contemplated.
  • other chemical modifications can include 2'-o-alkyl (e.g ., 2'-0- methyl, 2'-o-methoxyethyl), 2'-fluoro, and 4'-thio modifications, and backbone modifications, such as one or more phosphorothioate, morpholino, or phosphonocarboxylate linkages (see, e.g., U.S. Patent Nos. 6,693,187 and 7,067,641, which are herein incorporated by reference in their entireties).
  • antisense oligonucleotides targeting oncogenic miRNAs contain 2'-0-methyl sugar modifications on each base and are linked by phosphorothioate linkages.
  • Antisense oligonucleotides can comprise one or more affinity enhancing modifications, such as, but not limited to, LNAs, bicyclic nucleosides, phosphonoformates, 2' o-alkyl modifications, and the like.
  • suitable antisense oligonucleotides are 2'-0-methoxyethyl gapmers which contain 2'-0-methoxyethyl-modified ribonucleotides on both 5' and 3' ends with at least ten deoxyribonucleotides in the center.
  • gapmers are capable of triggering RNase H-dependent degradation mechanisms of RNA targets.
  • Other modifications of antisense oligonucleotides to enhance stability and improve efficacy such as those described in U.S. Patent No. 6,838,283, which is herein incorporated by reference in its entirety, are known in the art and are suitable for use in the methods of the invention.
  • the antisense oligonucleotide can be linked to a steroid, such as cholesterol moiety, a vitamin, a fatty acid, a carbohydrate or glycoside, a peptide, or other small molecule ligand at its 3' end.
  • antisense oligonucleotides useful for inhibiting the activity of miRNAs are about 5 to about 25 nucleotides in length, about 10 to about 30 nucleotides in length, or about 20 to about 25 nucleotides in length.
  • antisense oligonucleotides targeting oncogenic miRNAs are about 8 to about 18 nucleotides in length, in other embodiments about 12 to about 16 nucleotides in length, and in other embodiments about 7 to about 8 nucleotides in length.
  • any 7-mer or longer complementary to an oncogenic miRNA may be used, i.e., any anti-miR complementary to the 5' end of the miRNA and progressing across the full complementary sequence of the miRNA.
  • the antisense oligonucleotides targeting oncogenic miRNAs are about 5, or about 6, or about 7, or about 8, or about 9, or about 10, or about 11, or about 12, or about 13, or about 14, or about 15, or about 16, or about 17, or about 18, or about 19, or about 20, or about 21, or about 22, or about 23, or about 24, or about 25, or about 26, or about 27, or about 28, or about 29, or about 30 nucleotides in length.
  • Antisense oligonucleotides can comprise a sequence that is at least partially complementary to a mature or minor (i.e. star) oncogenic miRNA sequence, e.g., at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a mature or minor (i.e., star) oncogenic miRNA sequence.
  • the antisense oligonucleotide can be substantially complementary to a mature or minor oncogenic miRNA sequence, that is at least about 90%, 95%, 96%, 97%, 98%, or 99% complementary to a target polynucleotide sequence.
  • the antisense oligonucleotide comprises a sequence that is 100% complementary to a mature or minor oncogenic miRNA sequence.
  • substantially complementary refers to a sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target polynucleotide sequence (non- limiting examples are mature, minor, precursor miRNA, or pri-miRNA sequence of, for example, miR-22).
  • the antisense oligonucleotides are antagomirs.
  • Antagomirs are single-stranded, chemically-modified ribonucleotides that are at least partially complementary to miRNAs and therefore may silence them. See, e.g., Kriitzfeldt, et ah, Nature (2005) 438 (7068): 685-9.
  • Antagomirs may comprise one or more modified nucleotides, such as 2'-0-methyl-sugar modifications.
  • antagomirs comprise only modified nucleotides.
  • Antagomirs can also comprise one or more phosphorothioate linkages resulting in a partial or full phosphorothioate backbone.
  • the antagomir can be linked to a cholesterol or other moiety at its 3' end.
  • Antagomirs suitable for inhibiting can be about 15 to about 50 nucleotides in length, about 18 to about 30 nucleotides in length, and about 20 to about 25 nucleotides in length.
  • the antagomirs can be at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a mature or minor oncogenic miRNA sequence.
  • the antagomir may be substantially complementary to a mature or minor oncogenic miRNA sequence, that is at least about 95%, 96%, 97%, 98%, or 99% complementary to a target polynucleotide sequence. In other embodiments, the antagomirs are 100% complementary to a mature or minor oncogenic miRNA sequence.
  • Antisense oligonucleotides or antagomirs may comprise a sequence that is substantially complementary to a precursor miRNA sequence (pre-miRNA) or primary miRNA sequence (pri- miRNA) of an oncogenic miRNA.
  • the antisense oligonucleotide comprises a sequence that is located outside the 3 '-untranslated region of a target of that miRNA.
  • the antisense oligonucleotide comprises a sequence that is located inside the 3'- untranslated region of a target of that miRNA.
  • Any of the inhibitors or agonists of the oncogenic miRNAs described herein, including but not limited to miR-22, can be delivered to a target cell by delivering to the cell an expression vector encoding the miRNA inhibitors or agonists.
  • a vector is a composition of matter which can be used to deliver a nucleic acid of interest to the interior of a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term vector includes an autonomously replicating plasmid or a virus.
  • viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
  • An expression construct can be replicated in a living cell, or it can be made synthetically.
  • expression construct, expression vector, and vector are used interchangeably to demonstrate the application of the invention in a general, illustrative sense, and are not intended to limit the invention.
  • an expression vector for expressing an inhibitor of an oncogenic miRNA comprises a promoter operably linked to a polynucleotide encoding an antisense oligonucleotide.
  • the sequence of the expressed antisense oligonucleotide may be partially or perfectly complementary to a mature or minor sequence of an oncogenic miRNA.
  • the phrase operably linked or under transcriptional control as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.
  • a promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
  • Suitable promoters include, but are not limited to, RNA pol I, pol II, pol III, and viral promoters (e.g, human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, and the Rous sarcoma virus long terminal repeat).
  • CMV human cytomegalovirus
  • the promoter operably linked to a polynucleotide encoding a miRNA inhibitor or a polynucleotide encoding a metabolism gene regulating miRNA and/or miRNA targeting genes of markers linked to metabolic etiologies can be an inducible promoter.
  • Inducible promoters are known in the art and include, but are not limited to, the tetracycline promoter, the metallothionein IIA promoter, the heat shock promoter, the steroid/thyroid hormone/retinoic acid response elements, the adenovirus late promoter, and the inducible mouse mammary tumor virus LTR.
  • Methods of delivering expression constructs and nucleic acids to cells are known in the art and can include, by way of non-limiting example, calcium phosphate co-precipitation, electroporation, microinjection, DEAE-dextran, lipofection, transfection employing polyamine transfection reagents, cell sonication, gene bombardment using high velocity microprojectiles, and receptor-mediated transfection.
  • the present invention also includes scavenging or clearing inhibitors of oncogenic miRNAs following treatment.
  • Scavengers may include isolated nucleic acids that are complementary to miRNA inhibitors or vectors expressing the same. Therefore, they may bind to miRNA inhibitors or vectors expressing the same and, in doing so, prevent the binding between miRNA and target.
  • the present disclosure provides a method of treating or preventing a metabolic disorder in a subject in need thereof.
  • the present disclosure provides a method of treating or preventing metabolic disorder, including Obesity, Prader-Willi Syndrome, Hypercholesterolemia, Fatty Liver Disease, Non Alcoholic Fatty Liver Disease (NAFLD) and/or Non-Alcoholic Steatohepatitis (NASH) in a subject.
  • metabolic disorder including Obesity, Prader-Willi Syndrome, Hypercholesterolemia, Fatty Liver Disease, Non Alcoholic Fatty Liver Disease (NAFLD) and/or Non-Alcoholic Steatohepatitis (NASH) in a subject.
  • the term“metabolic disorder” as used in context of this invention refers to a disease or condition that is impacted by the presence, level or activity of brown adipose tissue, plasma glucose concentration, plasma insulin level and/or body fat content.
  • the metabolic disorder or condition also includes, but is not limited to, Metabolic Syndrome, impaired glucose tolerance, elevated plasma insulin concentrations and insulin resistance, dyslipidemia, hyperglycemia, hyperlipidemia, hypertension, lipodystrophy, cardiovascular disease, respiratory problems or conditions.
  • Metabolic disorders of particular interest are Obesity, Prader-Willi Syndrome, Hypercholesterolemia, Fatty Liver Disease, including Non-Fatty Acid Liver Disease (NAFLD) and/or Non-Alcoholic Steatohepatitis (NASH).
  • Obesity Prader-Willi Syndrome
  • Hypercholesterolemia Fatty Liver Disease, including Non-Fatty Acid Liver Disease (NAFLD) and/or Non-Alcoholic Steatohepatitis (NASH).
  • NAFLD Non-Fatty Acid Liver Disease
  • NASH Non-Alcoholic Steatohepatitis
  • the present disclosure relates to obesity.
  • Obesity is a chronic disease that is highly prevalent in modem society and is associated not only with a social stigma, but also with decreased life span and numerous medical problems, including diabetes mellitus, insulin resistance, hypertension, hypercholesterolemia, cholelithiasis, osteoarthritis, orthopedic injury, thromboembolic disease, cancer, and coronary heart disease.
  • Obesity can be calculated using the body mass index (BMI: body weight per height in meters squared).
  • obesity is defined as an otherwise healthy subject that has a BMI greater than or equal to 30 kg/m2, or a condition whereby a subject with at least one co-morbidity has a BMI greater than or equal to 27 kg/m2.
  • the subject is obese and has a body mass index of greater than about 30.
  • the subject is overweight and has a body mass index of about 25-29.9.
  • the method induces weight loss.
  • the method prevents weight gain.
  • the method prevents the growth of adipose tissue and impair adipocyte differentiation.
  • the present disclosure provides for methods of treatment comprising administering an inhibitor of miR-22 (and compounds related to miR-22) and/or uses of miR-22 (and compounds related to miR-22) in the treatment of, or manufacture of a medicament for, obesity and overweight, and related conditions.
  • the present disclosure provides a method for treating or preventing obesity, comprising administering an effective amount of miR-22 (and compounds related to inhibiting miR-22) to a patient in need thereof.
  • the present disclosure provides a method for weight management, comprising administering an effective amount of an inhibitor of miR-22 (and compounds related to inhibiting miR-22) to induce weight loss and/or to prevent weight gain in a patient in need thereof.
  • the present disclosure relates to a method for inducing weight loss or preventing weight gain (or treating or preventing obesity or inducing weight loss or preventing weight gain in a patient that does not substantially change caloric intake), comprising administering an effective amount of an inhibitor of miR-22 (and compounds related to miR-22) to a patient that: has undertaken or will undertake a surgery of the digestive system; is greater than about 80-100 pounds overweight; has a BMI of greater than about 35; or has a health problem related to obesity.
  • the surgery of the digestive system is one or more of those classified under ICD-9-CM: Operations on the Digestive System and therefore may include Operations on esophagus; Incision and excision of stomach; Other operations on stomach; Incision, excision, and anastomosis of intestine; Other operations on intestine; Operations on appendix; Operations on rectum, rectosigmoid and perirectal tissue; Operations on anus; Operations on liver; Operations on gallbladder and biliary tract; Operations on pancreas; Repair of hernia; and Other operations on abdominal region.
  • the surgery of the digestive system is one or more of a restrictive surgery and/or malabsorptive procedure, including, for example, vertical banded gastroplasty
  • VBG e.g., stomach stapling
  • gastric banding e.g, LAP -BAND or REALIZE
  • sleeve gastrectomy e.g, Roux-en-Y gastric bypass
  • a cosmetic surgery e.g, liposuction, such as, for example, suction-assisted liposuction (SAL); ultrasound-assisted liposuction (UAL); power-assisted liposuction (PAL); twin-cannula (assisted) liposuction (TCAL or TCL); external ultrasound-assisted liposuction (XUAL or EUAL); water- assisted liposuction (WAL); laser assisted liposuction; tumescent liposuction; and cryolipolysis).
  • suction-assisted liposuction SAL
  • ultrasound-assisted liposuction UAL
  • power-assisted liposuction PAL
  • the health problem related to obesity is selected from cardiovascular diseases (e.g ., high cholesterol, hypercholesterolemia, low HDL, high HDL, hypertension, coronary artery disease, heart failure), sleep apnea (including obstructive sleep apnea), osteoarthritis, thyroid problems, dementia, gout, asthma, gastroesophageal reflux disease, and chronic renal failure.
  • cardiovascular diseases e.g ., high cholesterol, hypercholesterolemia, low HDL, high HDL, hypertension, coronary artery disease, heart failure
  • sleep apnea including obstructive sleep apnea
  • osteoarthritis e.g., obstructive sleep apnea
  • thyroid problems dementia
  • dementia gout
  • asthma gastroesophageal reflux disease
  • chronic renal failure e.g., chronic renal failure.
  • the health problem related to obesity is heart disease, sleep apnea, or high cholesterol.
  • the present disclosure provides for uses and methods for inducing weight loss or preventing weight gain, comprising administering an effective amount of an inhibitor of miR-22 (and compounds related to inhibiting miR-22) to a patient in need thereof; wherein the patient does not substantially change caloric intake.
  • the caloric intake is high, relative to guidelines, such as the USD A tables.
  • the patient's caloric intake is 2000-10000 calories/day, or greater than about 2000 calories/day, or about 2200 calories/day, or about 2400 calories/day, or about 2600 calories/day, or about 2800 calories/day, or about 3000 calories/day, or about 3200 calories/day, or about 3400 calories/day, or about 3600 calories/day, or about 3800 calories/day, or about 4000 calories/day, or about 5000 calories/day, or about 6000 calories/day.
  • the patient has a high caloric intake and does not gain weight or even loses weight. Therefore, the present disclosure provides for an effect without life style changes that often reduce patient adherence (e.g., failed dieting).
  • the patient's caloric intake is not restricted by more than about 20%, or not by more than about 10%, or not by more than about 5% of the patient's caloric intake at the start of treatment.
  • a high proportion of the patient's caloric intake is“empty calories,” i.e. calories from solid fats and/or added sugars.
  • greater than about 15%, or 20%, or 25%, or 30%, or 35%, or 50% of the patient's caloric intake is empty calories. Even in these embodiments, a patient may not gain weight or even lose weight.
  • the patient of the present disclosure is overweight or obese.
  • the patient of the present disclosure suffers from central obesity.
  • the obesity of one of simple obesity (alimentary obesity; usually resulting from consumption of more calories than the body can utilize), secondary obesity (usually resulting from an underlying medical condition, such as, for example, Cushing's syndrome and polycystic ovary syndrome), and childhood obesity.
  • the obesity is classified as: Class I, which includes a BMI between 30 and 34.99; Class II, which includes BMIs of 35 to 39.99; and Class III, which includes a BMI of over 40.
  • the present disclosure provides for obesity of any of classes I, II, or III that is further classified as severe, morbid, and super obesity.
  • the patient is at risk of further weight gain, as assessed by, for example, daily caloric intake.
  • the weight management/weight loss/anti-obesity effects of an inhibitor of miR-22 can be assessed using various techniques and indices. In some embodiments, assessment before, during, and after treatment is undertaken. In some embodiments, body mass index (BMI), a measure of a person's weight taking into account height, may be used. In some embodiments, a patient described herein has a BMI that provides an “overweight” classification, i.e. 25-29.9, such as, for example, about 25, or about 25.5, or about 26, or about 26.5, or about 27, or about 27.5, or about 28, or about 28.5, or about 29, or about 29.5.
  • BMI body mass index
  • a patient described herein has a BMI that provides an“obese” classification, i.e. greater than 30, such as, for example, about 30, or about 31, or about 32, or about 33, or about 34, or about 35, or about 36, or about 37, or about 38, or about 39, or about 40, or about 50.
  • body volume index BVI
  • BVI uses 3D software to create a 31) image of a person so BVI can differentiate between people with the same BMI rating, but who have a different shape and different weight distribution.
  • BVI measures where a person's weight and the fat are located on the body, rather than total weight or total fat content and places emphasis on the weight carried around the abdomen, commonly known as central obesity.
  • whole-body air displacement plethysmography is used to assess the weight management/weight loss/anti-obesity effects of miR-22 (and compounds related to miR-22).
  • simple weighing is used in the present invention.
  • skinfold calipers or“pinch test,” bioelectrical impedance analysis, hydrostatic weighing, or dual energy X-ray absorptiometry (DEXA) may be used.
  • a patient of the present disclosure has a waist circumference exceeding about 35 inches, or about 36 inches, or about 37 inches, or about 38 inches, or about 39 inches, or about 40 inches, or about 41 inches, or about 42 inches, or about 43 inches, or about 44 inches, or about 45 inches, or about 46 inches, or about 47 inches, or about 48 inches, or about 50 inches, or about 55 inches, or about 60 inches.
  • the patient is male human with a waist circumference exceeding 40 inches.
  • the patient is a female human with a waist circumference exceeding 35 inches.
  • the methods of the disclosure may be used to treat humans having a body fat percentage above the recommended body fat percentage, i.e., at least in the“overweight” range, or at least in the“obese” range.
  • the body fat percentage will differ between women and men. Specifically, for women, the methods of the disclosure may be used to treat a female human having a body fat percentage of at least about 25%, above 25%, at least about 32%, or above 32%. For men, the methods of the disclosure may be used to treat a male human having a body fat percentage of at least about 14%, above 14%, at least about 18%, above 18%, at least about 25%, or above 25%.
  • Body fat percentage may be estimated using any method accepted in the art, including, for example, near infrared interactance, dual energy X-ray absorptiometry, body density measurement, bioelectrical impedance analysis, and the like.
  • the methods of the disclosure may be used to treat a patient who is a man that is greater than 100 pounds’ overweight and/or has waist circumference exceeding 40 inches.
  • the methods of the disclosure may be used to treat a patient who is a woman that is greater than 80 pounds’ overweight and/or waist circumference exceeding 35 inches.
  • the disclosure provides for an inhibitor of miR-22 (and compounds related to inhibiting miR-22) being used to treat and/or prevent certain disorders associated with being overweight.
  • miR-22 and compounds related to miR-22 find use in cardiovascular diseases (e.g high cholesterol, hypercholesterolemia, low HDL, high HDL, hypertension, coronary artery disease, heart failure), sleep apnea (including obstructive sleep apnea), osteoarthritis, thyroid problems, dementia, gout, asthma, gastroesophageal reflux disease, and chronic renal failure.
  • cardiovascular diseases e.g high cholesterol, hypercholesterolemia, low HDL, high HDL, hypertension, coronary artery disease, heart failure
  • sleep apnea including obstructive sleep apnea
  • osteoarthritis thyroid problems
  • dementia gout
  • asthma gastroesophageal reflux disease
  • chronic renal failure chronic renal failure.
  • the inhibitor of miR-22 (and compounds related to miR-22) administration and/or use prevents or reduces the growth of adipose tissue.
  • miR-22 (and compounds related to miR-22) effects one or more of white adipose tissue (WAT) and brown adipose tissue (BAT), including, for example, visceral adipose tissue (VAT), abdominal subcutaneous adipose tissue (ASAT), or ectopic fat.
  • WAT white adipose tissue
  • BAT brown adipose tissue
  • VAT visceral adipose tissue
  • ASAT abdominal subcutaneous adipose tissue
  • ectopic fat ectopic fat
  • Such an effect may be assessed by, for example, using any of the techniques described herein (e.g ., BMI, weight for-stature indexes, skinfold measures, electrical bioimpedance analysis, etc.), as well as various imaging techniques, including computed tomography (CT), magnetic-resonance imaging (MRI, including transverse body scans), dual energy X-ray absorptiometry (DXA).
  • CT computed tomography
  • MRI magnetic-resonance imaging
  • DXA dual energy X-ray absorptiometry
  • miR-22 (and compounds related to miR-22) may also be used in combination with dietary therapy, behavioral therapy, physical therapy, exercise, and weight loss surgery, or a combination of two or more such therapies.
  • the subject is on a calorie restricted diet.
  • the subject engages in or is to engage in a physical exercise or physical therapy regimen.
  • the subject has undergone, or will undergo, weight loss surgery.
  • an inhibitor of miR-22 (and compounds related to inhibiting miR-22) may be in combination with additional agents or may be administered to patient undergoing treatment with various agents.
  • the additional agents may include one or more of orlistat (e.g., ALLI, XENICAL), loracaserin (e.g, BELVIQ), phentermine-topiramate (e.g, QSYMIA), sibutramine (e.g, REDUCTIL or MERIDIA), rimonabant (ACOMPLIA), exenatide (e.g, BYETTA), pramlintide (e.g, SYMLIN) phentermine, benzphetamine, diethylpropion, phendimetrazine, bupropion, and metformin.
  • orlistat e.g., ALLI, XENICAL
  • loracaserin e.g, BELVIQ
  • phentermine-topiramate e.g, QSYMIA
  • sibutramine e.g, REDUCTIL or MERIDIA
  • rimonabant rimonabant
  • exenatide e
  • Agents that interfere with the body's ability to absorb specific nutrients in food are among the additional agents, e.g, orlistat (e.g, ALLI, XENICAL), glucomannan, and guar gum.
  • Agents that suppress apetite are also among the additional agents, e.g. catecholamines and their derivatives (such as phentermine and other amphetamine-based drugs), various antidepressants and mood stabilizers (e.g, bupropion and topiramate), anorectics (e.g, dexedrine, digoxin).
  • Agents that increase the body's metabolism are also among the additional agents.
  • additional agents may be selected from among appetite suppressants, neurotransmitter reuptake inhibitors, dopaminergic agonists, serotonergic agonists, modulators of GABAcrgic signaling, anticonvulsants, antidepressants, monoamine oxidase inhibitors, substance P (NK1) receptor antagonists, melanocortin receptor agonists and antagonists, lipase inhibitors, inhibitors of fat absorption, regulators of energy intake or metabolism, cannabinoid receptor modulators, agents for treating addiction, agents for treating metabolic syndrome, peroxisome proliferator-activated receptor (PPAR) modulators; dipeptidyl peptidase 4 (DPP-4) antagonists, agents for treating cardiovascular disease, agents for treating elevated triglyceride levels, agents for treating low HDL, agents for treating hypercholesterolemia, and agents for treating hypertension.
  • PPAR peroxisome proliferator-activated receptor
  • statins e.g ., lovastatin, atorvastatin, fluvastatin, rosuvastatin, simvastatin and pravastatin
  • omega-3 agents e.g., LOVAZA, EPANOVA, VASCEPA, esterified omega-3's in general, fish oils, krill oils, algal oils.
  • additional agents may be selected from among amphetamines, benzodiazepines, sulfonyl ureas, meglitinides, thiazolidinediones, biguanides, beta-blockers.
  • ACE inhibitors diuretics, nitrates, calcium channel blockers, phenlermine, sibutramine, lorcaserin, cetilistat, rimonabant, taranabant, topiramate, gabapentin, valproate, vigabatrin, bupropion, tiagabine, sertraline, fluoxetine, trazodone, zonisamide, methylphenidate, varenicline, naltrexone, diethylpropion, phendimetrazine, repaglinide, nateglinide, glimepiride, metformin, pioglitazone, rosiglilazone, and sitagliptin.
  • the method relates to Prader-Willi syndrome.
  • Prader-Willi syndrome is a complex genetic condition that affects many parts of the body. In infancy, the condition is characterized by weak muscle tone (hypotonia), feeding difficulties, poor growth, and delayed development. Beginning in childhood, affected individuals develop an insatiable appetite, which leads to chronic overeating (hyperphagia) and obesity.
  • the subject is suffering from Prader-Willi syndrome.
  • Prader-Willi syndrome particularly those with obesity, also develop type 2 diabetes mellitus.
  • the method of the disclosure relates to Fatty Liver Disease.
  • a substantial fraction of the population is affected by fatty liver disease, also known as nonalcoholic steatohepatitis (NASH).
  • NASH nonalcoholic steatohepatitis
  • Hepatic steatosis the presence of droplets of triglycerides with hepatocytes, predisposes the liver to chronic inflammation (detected in biopsy samples as infiltration of inflammatory leukocytes), which can lead to fibrosis and cirrhosis.
  • Fatty liver disease is generally detected by observation of elevated serum levels of liver-specific enzymes such as the transaminases ALT and AST, which serve as indices of hepatocyte injury, as well as by presentation of symptoms which include fatigue and pain in the region of the liver, though definitive diagnosis often requires a biopsy.
  • the anticipated benefit is a reduction in liver inflammation and fat content, resulting in attenuation, halting, or reversal of the progression of NASH toward fibrosis and cirrhosis.
  • the method reduces or prevents liver steatosis. In some embodiments, the method reduces or prevents liver fibrosis.
  • the method is a method of treating NASH by administering the inhibitor of miR-22 described herein.
  • the NASH patient can be a high risk NASH patient.
  • A“high risk NASH patient” refers to characterization by one or more of: NAS34; baseline fibrosis stage 2 or 3; or baseline fibrosis stage 1 with a comorbidity (type 2 diabetes, BMI330 kg/m2 or ALT360 U/L).
  • the inhibitor of miR-22 reduces one or more of steatosis, mixed acinar inflammation, and hepatocellular ballooning and/or pericellular fibrosis.
  • the inhibitor of miR-22 reduces one or more of steatosis.
  • the inhibitor of miR-22 treats mild, grade 1 NASH, or moderate, grade 2 NASH, or severe, grade 3 NASH, as described in Brunt, et al. Am. J. Gastroenterology, Vol. 94, No. 9 (1999), the entirety of which is incorporated by reference in its entirety:
  • hepatocytes (predominantly zone 3)
  • the inhibitor of miR-22 treats NASH of any of the following stages: Stage 0, No fibrosis; Stage 1, Zone 3 pericellular/sinusoidal fibrosis, focal or extensive; Stage 2, as in stage 1 plus portal fibrosis, focal or extensive; Stage 3, bridging fibrosis, focal or extensive; and Stage 4 cirrhosis (+/- residual pericellular fibrosis).
  • the inhibitor of miR-22 treats NASH of any activity score (NAS), as described in Kleiner, et al., Hepatology, 2005. 41(6): p. 1313-21, the entirety of which is incorporated by reference in its entirety:
  • NAS NASH of any activity score
  • the inhibitor of miR-22 reduces the NASH to less than 8, or less than 7, or less than 6, or less than 5, or less than 4, or less than 3, or less than 2, or less than 1.
  • the AP -based reduces the NAS to about 7, or to about 6, or less than 5, or less than 4, or to about 3, to about 2, or to about 1.
  • the inhibitor of miR-22 reduces steatosis by about 5%, or about 10%, or about 15%, or about 20%, or about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50%, or about 55%, or about 60%, or about 65%, or about 70%, or about 75%, or about 80%, or about 85%, or about 90%, or about 95%.
  • the inhibitor of miR-22 reduces lobular inflammation to less than 4 foci, or less than 3 foci, or less than 2 foci, or less than 1 focus.
  • the inhibitor of miR-22 reduces ballooning to a score of 0 or 1 per the scale above.
  • the inhibitor of miR-22 treats a subject at risk for NASH, such as a subject suffering from various acquired metabolic diseases, such as obesity, diabetes ( e.g ., type 2), hypertriglyceridemia, rapid weight loss, and malnutrition.
  • the inhibitor of miR-22 treats a subject at risk for NASH, such as a subject suffering from various genetic metabolic diseases, such as Wilson disease, tyrosinemia, and abetalipoproteinemia.
  • the inhibitor of miR-22 treats a subject at risk for NASH, such as a subject suffering from various other factors such as lipodystrophy and jejunoileal bypass.
  • the inhibitor of miR-22 treats a subject at risk for NASH, such as a subject undergoing treatment with one or more of amiodarone, chemotherapeutic agents (e.g., irinotecan), tamoxifen, steroids, estrogens, diethylstilbestrol, methotrexate, calcium channel blockers (e.g, nifedipine, verapamil, and diltiazem).
  • the present disclosure provides methods that reduce or prevent fibrosis.
  • Direct markers of fibrosis include procollagen type (I, III, IV), matrix metalloproteinases, cytokines, and chemokines.
  • the present invention provides methods that reduce or prevent enhancement of extracellular matrix synthesis, e.g, by activated stellate cells.
  • the present invention provides methods that modulate levels of TIMP-l .
  • the present disclosure provides methods that reduce or prevent serum levels of hyaluronic acid.
  • the effect of the inhibitor of miR-22 is monitored using tests that monitor one or more of combines hyaluronic acid, tissue inhibitor of a metalloproteinase- 1 (TIMP- 1), and alpha-2-macroglobulin (e.g FIBROSpect II).
  • the present invention provides methods that reduce or prevent cirrhosis.
  • the present disclosure provides methods that modulate one or more of platelet count, prothrombin time, albumin, total bilirubin, and serum aminotransferase.
  • the present invention provides methods that modulate serum fibrotic markers, such as hyaluronic acid (HA) and alpha-2-macroglobulin.
  • serum fibrotic markers such as hyaluronic acid (HA) and alpha-2-macroglobulin.
  • the method of the disclosure relates to hypercholesterolemia.
  • Hypercholesterolemia is a condition characterized by elevated serum cholesterol. Elevated serum cholesterol levels affect a substantial fraction of the population and are an important risk factor for atherosclerosis and myocardial infarction.
  • Cholesterol-lowering drugs such as HMG-CoA reductase inhibitors (statins) can be administered to hypercholesterolemia patients in addition to agents of the invention, optionally incorporated into the same pharmaceutical.
  • the hypocholesterolemia is on-familial hypercholesterolemia which is a condition characterized by elevated serum cholesterol that is not the result of a single gene mutation.
  • the hypercholesterolemia is polygenic hypercholesterolemia which is a condition characterized by elevated cholesterol that results from the influence of a variety of genetic factors. In certain embodiments, polygenic hypercholesterolemia may be exacerbated by dietary intake of lipids. In some embodiments, the hypercholesterolemia is Familial hypercholesterolemia (FH) which is an autosomal dominant metabolic disorder characterized by a mutation in the LDL- receptor (LDL-R) gene, markedly elevated LDL-C and premature onset of atherosclerosis.
  • FH Familial hypercholesterolemia
  • a diagnosis of familial hypercholesterolemia is made when an individual meets one or more of the following criteria: genetic testing confirming 2 mutated LDL-receptor genes; genetic testing confirming one mutated LDL-receptor gene; document history of untreated serum LDL- cholesterol greater than 500 mg/dL; tendinous and/or cutaneous xanthoma prior to age 10 years; or, both parents have documented elevated serum LDL-cholesterol prior to lipid-lowering therapy consistent with heterozygous familial hypercholesterolemia.
  • the hypercholesterolemia is Homozygous familial hypercholesterolemia or HoFH which is a condition characterized by a mutation in both maternal and paternal LDL-R genes.
  • the hypercholesterolemia is Heterozygous familial hypercholesterolemia or HeFH which is a condition characterized by a mutation in either the maternal or paternal LDL-R gene.
  • the wild type human FTO gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001080432.2; SEQ ID NO: 13).
  • the wild type human FTO gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_00l07390l . l; SEQ ID NO: 14).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_004364.4, transcript variant 1 ; SEQ ID NO: 15).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_004355.2, transcript variant 1; SEQ ID NO: 16).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001285829.1, transcript variant 2; SEQ ID NO: 17).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NM_001285829.1, transcript variant 2; SEQ ID NO: 18).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001287424.1, transcript variant 3; SEQ ID NO: 19).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NR_001274353.1, transcript variant 3; SEQ ID NO: 20).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001287435.1, transcript variant 4; SEQ ID NO: 21).
  • the wild type human CEBPa gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_00l274364.l, transcript variant 4; SEQ ID NO: 22).
  • the wild type human PPARg gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_138712.3, transcript variant 1; SEQ ID NO: 23).
  • the wild type human PPARg gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_619726.2, transcript variant 1; SEQ ID NO: 24).
  • the wild type human PPARg gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_0l5869.4, transcript variant 2; SEQ ID NO: 25).
  • the wild type human PPARg gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_056953.2, transcript variant 2; SEQ ID NO: 26).
  • the wild type human PPARg gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_138711.3, transcript variant 3; SEQ ID NO: 27).
  • the wild type human PPARg gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_6l9725.2, transcript variant 3 ; SEQ ID NO: 28).
  • the wild type human PPARg gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_005037.5, transcript variant 4; SEQ ID NO: 29).
  • the wild type human PPARg gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_005028.4, transcript variant 4; SEQ ID NO: 30).
  • the wild type human PTEN gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_0003 l4.6, transcript variant 1; SEQ ID NO: 31).
  • the wild type human PTEN gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_000305.3, transcript variant 1; SEQ ID NO: 32).
  • the wild type human PTEN gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001304717.2, transcript variant 1; SEQ ID NO: 33).
  • the wild type human PTEN gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NR_001291646.2, transcript variant 1; SEQ ID NO: 34).
  • the wild type human PTEN gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001304718.1, transcript variant 2; SEQ ID NO: 35).
  • the wild type human PTEN gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_001291647.1, transcript variant 2; SEQ ID NO: 36).
  • the wild type human TET2 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_00l 127208.2, transcript variant 1; SEQ ID NO: 37).
  • the wild type human TET2 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_00l 120680.1, transcript variant 1 ; SEQ ID NO: 38).
  • the wild type human TET2 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_0l7628.4, transcript variant 2; SEQ ID NO: 39).
  • the wild type human TET2 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_060098.3, transcript variant 2; SEQ ID NO: 40).
  • the wild type human BMP-7 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001719.2, transcript variant 1 ; SEQ ID NO: 41).
  • the wild type human BMP-7 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NR_001710.1, transcript variant 1; SEQ ID NO: 42).
  • the wild type human SIRT-l gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_0l2238.4, transcript variant 1; SEQ ID NO: 43).
  • the wild type human SIRT-l gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_036370.2, transcript variant 1 ; SEQ ID NO: 44).
  • the wild type human SIRT-l gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_00l 142498.1, transcript variant 2; SEQ ID NO: 45).
  • the wild type human SIRT-l gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_00l 135970.1, transcript variant 2; SEQ ID NO: 46).
  • the wild type human SIRT-l gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number: NM_001314049.1, transcript variant 3; SEQ ID NO: 47).
  • the wild type human SIRT-l gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number: NP_001300978.1, transcript variant 3; SEQ ID NO: 48).
  • the wild type human PGCl-a gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_001330751, transcript variant 1; SEQ ID NO: 49).
  • the wild type human PGCla gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NR_001317680: transcript variant 2; SEQ ID NO: 50).
  • the wild type human PGCl-a gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_013261, transcript variant 2; SEQ ID NO: 51).
  • the wild type human PGCla gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_037393: transcript variant 2; SEQ ID NO: 52).
  • the wild type human PGCl-a gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_00l330752. l, transcript variant 3; SEQ ID NO: 53).
  • the wild type human PGCla gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_00l317681.1, transcript variant 3; SEQ ID NO: 54).
  • the wild type human PGCl-a gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_00l330753. l, transcript variant 4; SEQ ID NO: 55).
  • the wild type human PGCla gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_00l317682, transcript variant 4; SEQ ID NO: 56).
  • the wild type human SP-l gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_l38473.2; SEQ ID NO: 57).
  • the wild type human SP-l gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_612482; SEQ ID NO: 58).
  • the wild type human FGF-21 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_0l9l 13.3; SEQ ID NO: 59).
  • the wild type human FGF-21 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP 061986.1; SEQ ID NO: 60).
  • the wild type human UCP1 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_02l833.4; SEQ ID NO: 61).
  • the wild type human UCP1 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_068605.l; SEQ ID NO: 62).
  • the wild type human DDIT-4 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_019058 3; SEQ ID NO: 63).
  • the wild type human DDIT-4 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_061931.1 ; SEQ ID NO: 64).
  • the wild type human METTL3 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_019852.4; SEQ ID NO: 65).
  • the wild type human METTL3 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_062826.2; SEQ ID NO: 66).
  • the wild type human FGFlgene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_000800.4; SEQ ID NO: 67).
  • the wild type human FGF1 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NP_00079l.l; SEQ ID NO: 68).
  • the wild type human TP63 gene of the disclosure consists of or comprises the nucleic acid sequence (Genbank Accession number NM_00l 114978.1; SEQ ID NO: 69).
  • the wild type human TP63 gene of the disclosure consists of or comprises the amino acid sequence (Genbank Accession number NR_001108450.1; SEQ ID NO: 70).
  • the term subject or patient refers to any vertebrate including, without limitation, humans and other primates (e.g ., chimpanzees and other apes and monkey species), farm animals (e.g., cattle, sheep, pigs, goats, and horses), domestic mammals (e.g, dogs and cats), laboratory animals (e.g, rodents such as mice, rats, and guinea pigs), and birds (e.g, domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like).
  • the subject is a mammal.
  • the subject is a human.
  • compositions or use of pharmaceutical composition, comprising an inhibitor of a miRNA, such as miR-22, and a pharmaceutically acceptable carrier.
  • pharmaceutical compositions may be prepared in a form appropriate for the intended application. Generally, this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
  • a pharmaceutical composition comprises an effective dose of a miRNA inhibitor, by way of non-limiting example, an antisense oligonucleotide directed to miR- 22, and a pharmaceutically acceptable carrier.
  • An effective dose is an amount sufficient to affect a beneficial or desired clinical result.
  • An effective dose of a miRNA inhibitor of the invention may be from about 1 mg/kg to about 100 mg/kg, about 2.5 mg/kg to about 50 mg/kg, or about 5 mg/kg to about 25 mg/kg.
  • doses may be determined with reference Physicians' Desk Reference, 66th Edition, PDR Network; 2012 Edition (December 27, 2011), the contents of which are incorporated by reference in its entirety.
  • a beneficial or desired treatment result may include, inter alia, a reduction a body mass index, weight loss or a marker that is associated with the presence of metabolic disorder as compared to what is observed without administration of the inhibitor.
  • a beneficial or desired treatment result may also include, inter alia, an increased or decreased presence of a marker or gene that is associated with a reduction of metabolic disorder as compared to what is observed without administration of the inhibitor.
  • the marker or gene is fat mass and obesity-associated protein (FTO), CEBPa, and/or PPARy, ALKBH5, and ACLY.
  • the marker or gene is fat mass and obesity-associated protein (FTO).
  • Colloidal dispersion systems such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes, may be used as delivery vehicles for the oligonucleotide inhibitors of oncogenic miRNA function, polynucleotides encoding Fat related metabolism and synthesis pathway targets miRNA agonists, or constructs expressing particular miRNA inhibitors or agonists.
  • adipose tissues e.g ., adipocytes
  • adipose tissues e.g ., adipocytes
  • a colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The preparation and use of such systems is well known in the art.
  • Aqueous compositions of the present invention comprise an effective amount of the delivery vehicle comprising the inhibitor polynucleotides (e.g., liposomes or other complexes or expression vectors) dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • the phrases pharmaceutically acceptable or pharmacologically acceptable refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
  • pharmaceutically acceptable carrier includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the vectors or polynucleotides of the compositions.
  • the active compositions of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route so long as the target tissue is available via that route. This includes oral, nasal, or buccal. Alternatively, administration may be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection, or by direct injection into adipose tissue.
  • the agents disclosed herein may also be administered by catheter systems. Such compositions would normally be administered as pharmaceutically acceptable compositions as described herein.
  • the active compounds may also be administered parenterally or intraperitoneally.
  • solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use or catheter delivery include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • these preparations are sterile and fluid to the extent that easy injectability exists.
  • Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • a coating such as lecithin
  • surfactants for example, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above.
  • the preferred methods of preparation include vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • solutions may be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.
  • parenteral administration in an aqueous solution for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic with, for example, sufficient saline or glucose.
  • aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure.
  • a single dose may be dissolved in 1 ml of isotonic NaC 1 solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion (see, e.g, Remington Pharmaceutical Sciences, 15th Edition, pages 1035-1038 and 1570-1580, the contents of which are hereby incorporated by reference).
  • Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by the FDA Office of Biologies standards.
  • the present disclosure includes a method of treating or preventing metabolic disorder in a subject in need thereof comprising administering to the subject: a first inhibitor of a first miRNA, wherein the miRNA is miR-22 and a second inhibitor of a second miRNA, wherein the miRNA is a regulator of a metabolism-related gene.
  • the second miRNA is a known miR inhibitor, including, by way of non-limiting example, those disclosed in International Patent Publication No. WO 2012/142313, the contents of which are hereby incorporated by reference in their entirety.
  • the first and second inhibitors may be administered in either order ( e.g ., first then second or second then first) or concurrently.
  • the present disclosure includes a method of treating or preventing metabolic disorder in a subject in need thereof comprising administering to the subject a first agent that is or comprises an inhibitor of miR-22 and a second agent that is or comprises at least one other metabolic disorder biologic, therapeutic or drug.
  • the first and second inhibitors may be administered in either order (e.g., first then second or second then first) or concurrently.
  • kits that can simplify the administration of any agent described herein, such as an inhibitor of an oncogenic miRNA, including antisense oligonucleotide directed to miR-22.
  • An exemplary kit of the invention comprises any composition described herein in unit dosage form.
  • the unit dosage form is a container, such as a pre-filled syringe, which can be sterile, containing any agent described herein and a pharmaceutically acceptable carrier, diluent, excipient, or vehicle.
  • the kit can further comprise a label or printed instructions instructing the use of any agent described herein.
  • the kit may also include a lid speculum, topical anesthetic, and a cleaning agent for the administration location.
  • the kit can further comprise one or more additional agent, such as a second inhibitor of an oncogenic miRNA, or a biologic, therapeutic, chemotherapeutic or drug described herein.
  • the kit comprises a container containing an effective amount of a composition of the invention and an effective amount of another composition, such those described herein.
  • miR-22 directly targets PTEN and TET to promote tumorigenesis, metastasis and other metabolic disorders. More than 60 PTEN-targeting miRNAs and no less than 30 new proto- oncogenic genetic loci were studied in human cancer. Highly conserved evolutionarily among vertebrates and ubiquitously expressed in various tissues, (Lagos-Quintana et al, 2001, 2002; Neely et al, 2006). By targeting PTEN, miR-22 is remains metabolically relevant, as PTEN lowering or its elevation triggers a Warburg- or an anti-Warburg metabolic state respectively.
  • Figure 2A-D shows that miR-22 overexpression affects weight of mice.
  • mice To assess whether, the effect on a mouse’s weight and fat accumulation is due to miR-22 overexpression and to evaluate the differential increase in mice weight during the time and differential consumption of food, 2 month old mice (start day), Wildtype (Wt) and miR-22 Transgenic (Tg) mice were placed on a High Fat (60%) Diet. Mice Weight was monitored 2 times/week and food usage monitored 1 time/week. ( see Figure 3A-C and Figure 4A-F). Transgenic miR-22 (Tg) mice developed an obese phenotype on a Non-Diet (ND) while miR-22 Knockout mice (KO) mice failed to gain weight on HFD.
  • Tg Transgenic miR-22 mice developed an obese phenotype on a Non-Diet (ND) while miR-22 Knockout mice (KO) mice failed to gain weight on HFD.
  • Mouse Embryonic Fibroblast (MEF) miR-22 deficient cells showed an impaired ability to differentiate in adipocytes. This phenotype is correlated with a differential gene expression for a panel of different genes that are involved in adipocyte differentiation and generally in fat metabolism. Father, results indicate that the effect of miR-22 on weight gain is Leptin (or Leptin like) independent ( see Figures 5A-D and Figure 6).
  • LNA anti-miR-22 are useful in both human and mouse. Host gene showed a 49% complementarity between human and mouse and LNA anti HG-miR-22 works predominately in human.
  • LNA was designed to cover the seed sequence, contain between 8 nt and 20 nt in length, have a length-specific fraction of LNAs allowed and as high a binding affinity to miR-22 as possible.
  • the sequence was validated in an assay by optimization of protocol for LNA assisted uptake (Lipo200 transfection), an adherent cell line, FAM labeled LNA was used and the biological effect validated by Identifying the most potent anti-miR-22 in adherent cell line assisted and un-assisted uptake (analysis of miR-22 level pre and post treatment and TET2 activity and protein level).
  • the oligonucleotides of SEQ ID NO: 11 and SEQ ID NO: 12, orientated 5’ to 3’, are scrambled sequences and do not hybridize to the miR-22 (SEQ ID NO: 1).
  • CRM0009 CtT ca ACtgGc AgC T (SEQ ID NO: 4)
  • CRM0010 CTTcaACtgGCAgCT (SEQ ID NO: 5)
  • CRM0011 T CtTC AaCtgGC AgC T (SEQ ID NO: 6)
  • CRM0012 T CtT caaCtGGC AgC T (SEQ ID NO: 7)
  • CRM0016 CGaAT AgTtaGT AgCG (SEQ ID NO: 11)
  • CRM0017 FAM labelled-CGaATAgTtaGTAgCG (SEQ ID NO: l2)
  • RNAs from Livers White adipose tissue (WAT) and Brown adipose tissue (BAT) were extracted from the mice treated with VHL, SCR LNA or LNA anti-miR-22 and mRNA expression of TET2, PTEN (Positive Control), FTO, CEBPa, PPARg which are involved in fat related metabolism and synthesis pathway and LTCP1 and CD36 (as Brown marker) were a determined, (see Figure 12).
  • Figure 19A-C is an RNA-seq plot showing the hierarchy cluster analysis from mice liver indicating that miR-22 pharmacological inhibition and genetic Knockout (KO) cluster together, indicating that the treatment is on target and that KO phenotype can be mimicked using LNA construct and an RNA-Seq plot showing the gene ontology analysis in mice liver indicating that top down regulated pathway in KO and LNA treated mice are lipid metabolism and biosynthesis related is depicted in Figure 20.
  • Anti-miR-22 therapy in vivo strongly downregulated ACL and pharmacological inhibition of miR-22 was shown to be effective in impairing MEFs adipocytic differentiation.
  • results indicate that anti-miR-22 therapy prevents mice from gaining weight when fed with HFD chow, reverses obese phenotype in obese mice fed with HFD chow, does not affect food consumption and efficiently target the liver and WAT in-vivo. Additionally, anti-miR-22 treatment affects the protein level of miR-22 target genes and does not affect any specific lipid class but is able to reduce the overall amount of total lipids in mice.
  • Example 3 miR-22 control obesity and Fat Mass and Obesity- Associated protein (FTP)
  • miR-22 directly targets PTEN and TET to promote tumorigenesis and metastasis.
  • PTEN as many other miR-22 targeting genes are involved in metabolism and fatty acid oxidation or biogenesis including for example SIRT-l, BMP-7, PPAR-alpha, PPAR-g, SP-l, PGCla, FGF-21, UCP1, Methyltransferase like 3 and DDIT4.
  • FTO expression was profoundly down-regulated during adipose induced differentiation in miR-22 deficient MEF but not in WT MEF ( Figure 26) and miR-22 down regulation (genetic or pharmacological) increased levels of RNA m6A (Figure 27A-B).
  • Mir-22 downregulation was shown to not affect liver function or show any liver related disease or dysfunction at old age ( Figures 28A-B, 29).
  • miR-22 in an onco-miR PTEN targeting, MEF transformation, EMT
  • miR-22 is 100% conserved in human and mouse
  • miR-22 OE leads to and obese phenotype in ND
  • LNA anti-miR-22 treatment prevent mice to become obese in a prevention setting
  • LNA anti-miR-22 treatment reverts obese phenotype in obese mice fed with HFD
  • miR-22 silencing doesn’t show any liver toxicity
  • miR-22 silencing prevent liver from steatosis and fibrosis
  • miR-22 can target multiple genes related to metabolism and lipid biogenesis at the same time.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2019/022350 2018-03-14 2019-03-14 Micro-rna and obesity Ceased WO2019178410A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
JP2020549635A JP2021518841A (ja) 2018-03-14 2019-03-14 マイクロrnaと肥満症
KR1020207029243A KR20200132920A (ko) 2018-03-14 2019-03-14 마이크로-rna 및 비만
EP19768285.9A EP3765610A4 (en) 2018-03-14 2019-03-14 MICRO-RNA AND OBESITY
RU2020132725A RU2020132725A (ru) 2018-03-14 2019-03-14 Микро-рнк и ожирение
CN201980032204.4A CN112119159B (zh) 2018-03-14 2019-03-14 micro-RNA和肥胖
SG11202008921YA SG11202008921YA (en) 2018-03-14 2019-03-14 Micro-rna and obesity
CA3093844A CA3093844A1 (en) 2018-03-14 2019-03-14 Micro-rna and obesity
BR112020018752-6A BR112020018752A2 (pt) 2018-03-14 2019-03-14 Micro-rna e obesidade
AU2019234916A AU2019234916B2 (en) 2018-03-14 2019-03-14 Micro-RNA and obesity
US16/979,777 US11753639B2 (en) 2018-03-14 2019-03-14 Micro-RNA and obesity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862642934P 2018-03-14 2018-03-14
US62/642,934 2018-03-14

Publications (1)

Publication Number Publication Date
WO2019178410A1 true WO2019178410A1 (en) 2019-09-19

Family

ID=67908026

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2019/022350 Ceased WO2019178410A1 (en) 2018-03-14 2019-03-14 Micro-rna and obesity
PCT/US2019/022351 Ceased WO2019178411A1 (en) 2018-03-14 2019-03-14 Inhibitors of micro-rna 22

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2019/022351 Ceased WO2019178411A1 (en) 2018-03-14 2019-03-14 Inhibitors of micro-rna 22

Country Status (12)

Country Link
US (2) US11753639B2 (cg-RX-API-DMAC7.html)
EP (2) EP3765610A4 (cg-RX-API-DMAC7.html)
JP (2) JP7318166B2 (cg-RX-API-DMAC7.html)
KR (2) KR20200131287A (cg-RX-API-DMAC7.html)
CN (2) CN112119159B (cg-RX-API-DMAC7.html)
AU (2) AU2019234917B2 (cg-RX-API-DMAC7.html)
BR (2) BR112020018705A2 (cg-RX-API-DMAC7.html)
CA (2) CA3093572A1 (cg-RX-API-DMAC7.html)
ES (1) ES3001019T3 (cg-RX-API-DMAC7.html)
RU (2) RU2020131372A (cg-RX-API-DMAC7.html)
SG (2) SG11202008925VA (cg-RX-API-DMAC7.html)
WO (2) WO2019178410A1 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110609142A (zh) * 2019-10-09 2019-12-24 广州医科大学附属第二医院 一种检测外周血fto蛋白与自身调控元件结合能力的方法与应用

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200131287A (ko) 2018-03-14 2020-11-23 베스 이스라엘 데코니스 메디칼 센터 마이크로-rna 22의 억제제
CN115029347B (zh) * 2022-05-11 2024-02-20 珠海中科先进技术研究院有限公司 识别和调控肝肾细胞纤维化的分子监测序列、重组质粒、抑制病毒
CN116082447A (zh) * 2022-09-09 2023-05-09 湖南大学 一种多肽及其制备方法
CN117304258B (zh) * 2022-09-09 2024-09-24 湖南大学 一种多肽的用途
EP4353823A1 (en) * 2022-10-12 2024-04-17 Resalis Therapeutics S.r.l. Inhibitors of micro-rna 22

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012080459A1 (en) * 2010-12-17 2012-06-21 Sanofi Mirnas in joint disease
US20140314833A1 (en) * 2004-11-12 2014-10-23 Mirna Therapeutics, Inc. Methods and compositions involving mirna and mirna inhibitor molecules
WO2017187426A1 (en) * 2016-04-29 2017-11-02 Aptamir Therapeutics, Inc. Inhibition of mir-22 mirna by apt-110

Family Cites Families (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5981505A (en) 1993-01-26 1999-11-09 The Trustees Of The University Of Pennsylvania Compositions and methods for delivery of genetic material
US5837533A (en) 1994-09-28 1998-11-17 American Home Products Corporation Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent
US5840710A (en) 1994-12-09 1998-11-24 Genzyme Corporation Cationic amphiphiles containing ester or ether-linked lipophilic groups for intracellular delivery of therapeutic molecules
US6217900B1 (en) 1997-04-30 2001-04-17 American Home Products Corporation Vesicular complexes and methods of making and using the same
CA2294988C (en) 1997-07-01 2015-11-24 Isis Pharmaceuticals Inc. Compositions and methods for the delivery of oligonucleotides via the alimentary canal
JP2002516256A (ja) 1998-05-26 2002-06-04 アイ・シー・エヌ・フアーマシユーテイカルズ・インコーポレイテツド 二環式糖成分を有する新規ヌクレオシド
US6838283B2 (en) 1998-09-29 2005-01-04 Isis Pharmaceuticals Inc. Antisense modulation of survivin expression
US6693187B1 (en) 2000-10-17 2004-02-17 Lievre Cornu Llc Phosphinoamidite carboxlates and analogs thereof in the synthesis of oligonucleotides having reduced internucleotide charge
CA2487274A1 (en) 2002-05-06 2003-11-13 Nucleonics Inc. Spermine chemically linked to lipids and cell-specific targeting molecules as a transfection agent
US20070213292A1 (en) * 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
KR101485071B1 (ko) * 2005-12-12 2015-01-26 더 유니버시티 오브 노쓰 캐롤라이나 엣 채플 힐 마이크로 rna를 이용한 근육 세포 증식 및 분화 조절방법과 근육 세포 치료방법 및 유전자 발현 억제방법그리고 마이크로 rna 분자의 발현용 벡터와 이를 이용한키트 및 미오사이트
AU2013254923A1 (en) * 2006-04-03 2013-11-28 Santaris Pharma A/S Pharmaceutical compositions comprising anti-miRNA antisense oligonucleotide
EP2007888A2 (en) 2006-04-03 2008-12-31 Santaris Pharma A/S Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
EP2623599B1 (en) * 2007-10-04 2019-01-02 Roche Innovation Center Copenhagen A/S Micromirs
EP2419537B1 (en) * 2009-04-13 2014-01-29 Somagenics, Inc. Methods and compositions for detection of small rnas
SG176716A1 (en) * 2009-06-08 2012-01-30 Miragen Therapeutics CHEMICAL MODIFICATION MOTIFS FOR miRNA INHIBITORS AND MIMETICS
CA2832899A1 (en) 2011-04-12 2012-10-18 Beth Israel Deaconess Medical Center, Inc. Micro-rna inhibitors and their uses in disease
JP6092655B2 (ja) * 2012-02-23 2017-03-08 善基 村上 テスト体液サンプルの分類方法
US9034839B2 (en) 2012-04-20 2015-05-19 Aptamir Therapeutics, Inc. miRNA modulators of thermogenesis
WO2013181613A1 (en) * 2012-05-31 2013-12-05 Research Development Foundation Mirna for the diagnosis and treatment of autoimmune and inflammatory disease
CN107236735B (zh) * 2012-06-21 2019-11-08 米拉根医疗股份有限公司 包含锁核酸基序的基于寡核苷酸的抑制剂
US9822358B2 (en) 2013-10-18 2017-11-21 Beth Israel Deaconess Medical Center Treatment of cancers with micro-RNA inhibitors
CA2935426C (en) * 2014-01-30 2023-07-25 F. Hoffmann-La Roche Ag Polyoligomer compound with biocleavable conjugates for reducing or inhibiting expression of a nucleic acid target
WO2016127002A1 (en) 2015-02-04 2016-08-11 Bristol-Myers Squibb Company Lna oligonucleotides with alternating flanks
WO2016149358A1 (en) * 2015-03-16 2016-09-22 Duncan Ross Method of treatment comprising membrane-enclosed vesicle
CN107432933A (zh) * 2017-07-13 2017-12-05 中南大学湘雅三医院 miR‑22作为靶位点在制备膀胱癌的化疗增敏治疗药物中的应用
WO2019053235A1 (en) * 2017-09-15 2019-03-21 Genfit NON-INVASIVE DIAGNOSIS OF NON ALCOHOLIC LIVER DISEASES, NON ALCOHOLIC STHEATHEPATITIS AND / OR HEPATIC FIBROSIS
KR20200131287A (ko) 2018-03-14 2020-11-23 베스 이스라엘 데코니스 메디칼 센터 마이크로-rna 22의 억제제
WO2019217907A1 (en) * 2018-05-11 2019-11-14 The Regents Of The University Of California Methods and compositions for the treatment of hepatic and metabolic diseases

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140314833A1 (en) * 2004-11-12 2014-10-23 Mirna Therapeutics, Inc. Methods and compositions involving mirna and mirna inhibitor molecules
WO2012080459A1 (en) * 2010-12-17 2012-06-21 Sanofi Mirnas in joint disease
WO2017187426A1 (en) * 2016-04-29 2017-11-02 Aptamir Therapeutics, Inc. Inhibition of mir-22 mirna by apt-110

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110609142A (zh) * 2019-10-09 2019-12-24 广州医科大学附属第二医院 一种检测外周血fto蛋白与自身调控元件结合能力的方法与应用

Also Published As

Publication number Publication date
US11499152B2 (en) 2022-11-15
CA3093572A1 (en) 2019-09-19
CN111918968A (zh) 2020-11-10
SG11202008925VA (en) 2020-10-29
JP2021518841A (ja) 2021-08-05
EP3765619A1 (en) 2021-01-20
AU2019234917B2 (en) 2025-06-26
AU2019234917A1 (en) 2020-10-01
CA3093844A1 (en) 2019-09-19
CN111918968B (zh) 2023-11-24
EP3765619B1 (en) 2024-10-09
AU2019234916B2 (en) 2025-06-26
AU2019234916A1 (en) 2020-10-15
EP3765610A4 (en) 2022-01-19
RU2020131372A (ru) 2022-04-14
JP7318166B2 (ja) 2023-08-01
CN112119159B (zh) 2025-04-29
EP3765610A1 (en) 2021-01-20
BR112020018752A2 (pt) 2021-01-05
EP3765619A4 (en) 2021-12-08
KR20200132920A (ko) 2020-11-25
RU2020132725A (ru) 2022-04-15
KR20200131287A (ko) 2020-11-23
JP2021518159A (ja) 2021-08-02
EP3765619C0 (en) 2024-10-09
US20210017520A1 (en) 2021-01-21
CN112119159A (zh) 2020-12-22
ES3001019T3 (es) 2025-03-04
SG11202008921YA (en) 2020-10-29
WO2019178411A1 (en) 2019-09-19
BR112020018705A2 (pt) 2021-01-05
US11753639B2 (en) 2023-09-12
US20210017521A1 (en) 2021-01-21

Similar Documents

Publication Publication Date Title
US11753639B2 (en) Micro-RNA and obesity
JP6370860B2 (ja) 被験体におけるsmn2スプライシングのモジュレーションのための組成物および方法
US8716258B2 (en) Regulation of metabolism by miR-378
US20230183696A1 (en) Compositions and Methods for Modulation of SMN2 Splicing in a Subject
JP7834686B2 (ja) アポリポタンパク質(a)発現の調節
US20220218682A1 (en) Compositions and methods for treating cancer
CN114072503A (zh) 载脂蛋白b拮抗剂
US20140255353A1 (en) Compositions, kits and methods for treating obesity, diabetes and hyperglycemia
US8846630B2 (en) Pharmaceutical composition for treating cancer
EP4678193A1 (en) Rnai formulation for prevention or treatment of obesity and combination therapy using same
WO2024112653A1 (en) Inhibitory nucleic acids and methods of use thereof
TW202539703A (zh) 治療多囊性腎病之方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19768285

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3093844

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020549635

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20207029243

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019234916

Country of ref document: AU

Date of ref document: 20190314

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019768285

Country of ref document: EP

Effective date: 20201014

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020018752

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112020018752

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200914

WWG Wipo information: grant in national office

Ref document number: 201980032204.4

Country of ref document: CN