WO2013181613A1 - Mirna for the diagnosis and treatment of autoimmune and inflammatory disease - Google Patents

Abstract

Provided are methods for treating an inflammatory lung disorder, such as emphysema. The methods may involve administering or inhibiting a microRNA (miRNA) in a human subject. Also provided are methods for identifying an inflammatory lung disease, or monitoring responses to a treatment of an inflammatory lung disease, in a subject based on alterations in the expression of specific miRNA. In some embodiments, an inhibitor of miRNA-22 may be used to treat a Th-17 mediated inflammatory disease, such as, e.g., emphysema or an autoimmune disease.

Description

DESCRIPTION

MIRNA FOR THE DIAGNOSIS AND TREATMENT OF AUTOIMMUNE AND

INFLAMMATORY DISEASE

BACKGROUND OF THE INVENTION

This application claims the benefit of United States Provisional Patent Application No. 61/653,892, filed May 31, 2012, the entirety of which is incorporated herein by reference.

This invention was made with government support under HL095382 awarded by the National Institutes of Health. The government has certain rights in the invention.

1. Field of the Invention

The present invention relates generally to the fields of molecular biology, immunology, and medicine. More particularly, it concerns particular miRNA and their application in the diagnosis and treatment of inflammatory and autoimmune diseases such as emphysema.

2. Description of Related Art

Tobacco smoking is a highly addictive and profoundly hazardous practice that promotes emphysema, an inflammatory disorder that is linked to interferon gamma (IFN-γ)- secreting CD4 T cells (Thl cells) and Thl7 cells that secrete IL-17A (Shan et ah, 2012; Grumeli et ah, 2004). Thl and Thl7 cells have been shown to be both reactive to and promote the destruction of the key structural protein of the lung, elastin, or other auto- antigens (Lee et ah, 2007; Alimohammadi et ah, 2009). Autoimmune inflammation and emphysema are observed in some, but not all, smokers and recent genetic and epidemiological studies further reveal strong differences in the susceptibility of individuals to the pro-inflammatory effects of tobacco smoke (Demeo et ah, 2006; Castaldi et ah, 2010; Hersh et ah, 201 1). At least in part, such differences in susceptibility may be linked to genes, with a few exceptions most are currently unknown, that could determine the ability of the adaptive immune system to respond to self-antigens, including those modified as a result of cigarette smoking (Wood et ah, 2011 ; Kong et ah, 2011 ; Thorgeirsson et ah, 2008; Pillai et al, 2009). Additionally, smoking-related changes in histone proteins, DNA methylation patterns, and expression patterns of regulatory transcripts are poorly understood, but potentially equally important epigenetic factors underlying disease expression (Mizuno et ah, 2011 ; Suzuki et al, 2010).

MicroRNAs (miRNAs) are ~21 nucleotide regulatory RNA transcripts that bind to 3 ' untranslated regions of mRNAs to effect post-transcriptional gene silencing (Esteller, 2011). Extensive studies verify that miRNAs are critically important regulators of gene expression in diverse disease states and that miRNA expression patterns contain diagnostically useful information (Andorfer et ah, 2011 ; Sayed and Abdellatif, 201 1). miRNA patterns have been correlated with the expression of asthma-like disease in mice and further demonstrated that inhibition of let-7 miRNAs is potentially therapeutically useful (Polikepahad et ah, 2010). A recent study showed differential expression of miRNA and mRNA expressed in smokers with and without obstruction, indicating that this inter-relation may play a role in chronic airway inflammation (Ezzie et ah, 2012). However it remains unclear as to how the epigenetic changes in miRNA in response to smoke in those susceptible to emphysema may regulates Thl and Thl7 adaptive immune responses.

Emphysema is a relentlessly progressive disorder that ultimately proves to be lethal in patients who do not succumb earlier, often to other smoking-related disorders such atherosclerosis and lung cancer. Current therapy for emphysema involves symptomatic management only and fails to prevent, halt, or reverse the lung destruction and physiological decline that are disease hallmarks. Clearly, there is a need for new therapeutic approaches for treating inflammatory lung diseases such as autoimmune inflammation and emphysema.

SUMMARY OF THE INVENTION

The present invention overcomes deficiencies in the prior art by providing new methods for treating inflammatory diseases, such as an inflammatory lung disease, an autoimmune disease, or emphysema. In some embodiments, the therapeutic method may involve inhibiting an miRNA, such as miR-22, or administering a pharmacologically effective amount of a miRNA, such as let-7a or mir-1266, to a subject. In some embodiments, differential expression of one or more miRNA may be used to diagnose a Thl 7 related disease, such as an autoimmune disease or emphysema. An aspect of the present invention relates to a method of treating or preventing exacerbation of an inflammatory lung disease in a subject, comprising administering to said subject a pharmaceutically effective amount of a composition comprising a nucleic acid comprising a let-7a, a mir-1266, or a nucleic acid which selectively binds or inhibits Mir-22 (also called mir-22, miRNA-22, or microRNA 22). The nucleic acid may be hsa-let-7a or hsa-mir-1266. In some embodiments, the nucleic acid administered to the subject selectively binds or inhibits Mir-22. The nucleic acid may be selected from the group consisting of a siRNA, an antisense oligonucleotide, a locked nucleic acid (LNA), an antisense RNA, and a plasmid expressing an antisense RNA. The inflammatory lung disease may be emphysema, chronic obstructive pulmonary disease, an interstitial lung disease, sarcoidosis, or an autoimmune disease such as, e.g., rheumatoid arthritis or scleroderma. The nucleic acid may comprise a phosphoramidate linkage, a phosphorothioate linkage, a phosphorodithioate linkage, or an O-methylphosphoroamidite linkage. The nucleic acid may comprise one or more nucleotide analogs. The subject may be a mammal, such as a human. The method may further comprise administering to the subject one or more secondary forms of therapy for the treatment or prevention of the inflammatory lung disease. The secondary form of therapy may be selected from the group consisting of a corticosteroid, a beta-2 adrenergic receptor agonist, a leukotrine modifier, an anti-immunoglobulin E (IgE) antibody, a mast cell stabilizing agent, a bronchodilator, an inhaled steroid, an antibiotic, pulmonary rehabilitation, supplemental oxygen, and surgery. The nucleic acid may be comprised in a vector. The vector may be a viral vector such as, e.g., an adenovirus, an adeno-associated virus, a lentivirus, or a herpes virus. The vector may comprise a lipid. The lipid may be comprised in a liposome. The pharmaceutically effective amount of said composition may be administered via an aerosol, topically, locally, intravenously, intraarterially, intraperitoneally, intramuscularly, by lavage, or by injection into the thoracic cavity.

Another aspect of the present invention relates to a pharmaceutical composition comprising an inhibitor of miRNA-22. The inhibitor may be a locked nucleic acid (LNA) or a modified nucleic acid. The inhibitor may comprise a phosphoramidate linkage, a phosphorothioate linkage, a phosphorodithioate linkage, or an O-methylphosphoroamidite linkage. The inhibitor may comprises one or more nucleotide analogs. In some embodiments, the pharmaceutical composition is formulated for inhalation or parenteral administration such as, e.g., intravenous injection.

Another aspect of the present invention relates to a method for identifying an inflammatory lung disease in a subject, comprising obtaining a biological sample from the subject, and detecting the level of one or more miRNAs in the biological sample; wherein the at least one of the one or more miRNAs comprises: (i) miR-223, miR-379, miR-376a, miR- 1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR- 381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, or (ii) miR-452; and wherein an increase in the level of a miRNA from group (i) or a decrease in the level of a miRNAs from group (ii) in the biological sample compared to a reference level indicates that the has or is at risk of having an inflammatory lung disease. The method may further comprise preparing a report of said detecting. In some embodiments, the subject is a human and the miRNA are human miRNA. The inflammatory lung disease may be emphysema, chronic obstructive pulmonary disease, an interstitial lung disease, or sarcoidosis. The detecting may comprise measuring the level of one or more of miR-1303, miR-376a, miR-132, or miR-452. The biological sample may comprise white blood cells, lung tissue, or plasma. Yet another aspect of the present invention relates to a biochip comprising an isolated nucleic acid comprising: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR- 559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR- 135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, or miR-452. The biochip may comprise a plurality of said nucleic acids. The biochip may comprise micro fludics.

Another aspect of the present invention relates to a kit comprising a sealed container comprising a set of primers specific for transcription or reverse transcription of a nucleic acid sequence, wherein said nucleic acid sequence comprises: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR- 132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337- 3p, miR-144:9.1, miR-452, or a nucleic acid from Table 1. The kit may further comprise instructions for use. Yet another aspect of the present invention relates to an isolated nucleic acid comprising a nucleic acid from Table 1 or a complement thereof. The nucleic acid may be comprised in a vector, such as a viral vector. The vector may comprise a promoter or enchancer. The nucleic acid may comprise a phosphoramidate linkage, a phosphorothioate linkage, a phosphorodithioate linkage, or an O-methylphosphoroamidite linkage. The nucleic acid may comprises one or more nucleotide analogs or a chemical modification. The nucleic acid is comprised in a pharmaceutically acceptable composition. Another aspect of the present invention relates to a method of screening for a modulator of an inflammatory lung response comprising: contacting a lung cell with a candidate substance; and measuring the expression level of one or more microRNAs (miRNAs) in the lung cell; wherein at least one of the one or more miRNAs comprises: miR- 223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR- 431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR- 302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, miR-452; wherein a decrease in the expression level in the lung cell of one or more of miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR- 623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, or miR-144:9.1 indicates that the modulator can inhibit an inflammatory lung response; and wherein an increase in the expression level in the lung cell of miR-452 indicates that the modulator can inhibit an inflammatory lung response. Yet another aspect of the present invention relates to a method for monitoring the effectiveness of an inhibitor of an inflammatory lung response comprising: administering an inhibitor of an inflammatory lung response to a subject, and measuring the expression level of one or more microRNAs (miRNAs) in a biological sample from the subject subsequent to said administering; wherein at least one of the one or more miRNAs comprises: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR- 619, miR-337-3p, miR-144:9.1, or miR-452; wherein an a decrease in the level of one or more of miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR- 142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR- 617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, or miR-144:9.1 relative to a reference level indicates that the inhibitor is providing a therapeutic benefit; and wherein an increase in the level of miR- 452 relative to a reference level indicates that the inhibitor is providing a therapeutic benefit.

Another aspect of the present invention relates to a method of identifying a subject to receive an inhibitor of an inflammatory lung response comprising measuring the expression level of one or more microR As (miR As) in a biological sample from the subject; wherein at least one of the one or more miRNAs comprises: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR- 132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337- 3p, miR-144:9.1, or miR-452; wherein an increase in the level of one or more of miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR- 619, miR-337-3p, or miR-144:9.1 relative to a reference level indicates that the subject may therapeutically benefit from said inhibitor; and wherein a decrease in the level of miR-452 indicates that the subject may therapeutically benefit from said inhibitor. The method may further comprises preparing a report of said measuring. In some embodiments, said measuring indicates that the subject may therapeutically benefit from said inhibitor, and wherein the method further comprises administering the inhibitor to the subject. The biological sample may comprise lung cells or lung tissue, white blood cells, or plasma. The subject may be a human. The measuring may be performed in a plurality of subjects. In some embodiments, the method further comprises a method of identifying a sub-population of patients to receive said inhibitor.

"Inflammatory lung disease" as used herein refers to any disease of the lung that is associated with presence of increased Thl and/or Thl7 responses in the lung of a subject. Non-limiting examples of inflammatory lung disease include emphysema, chronic obstructive pulmonary disease, sarcoidosis, adult respiratory distress syndrome, and interstitial lung disease associated with autoimmune diseases such as rheumatoid arthritis and scleroderma. In some embodiments the inflammatory lung disease is not chronic obstructive pulmonary disease. Inflammatory lung diseases can result in inflammation in non-lung tissues in a subject. In some embodiments, the inflammatory lung disease is an autoimmune disease. "Allergic lung disease" as used herein refers to any disease of the lung that is associated with presence of increased eosinophil and/or Th2 cell responses in the lung. Non- limiting examples of allergic lung disease include asthma, hay fever, hypersensitivity pneumonitis, eosinophilic pneumonia (acute or chronic), Churg-Strauss Syndrome, allergic bronchopulmonary mycosis, and tropical eosinophilic pneumonia. In specific embodiments, the allergic disease is asthma. "Asthma" is a common disorder in which chronic inflammation of the bronchial tubes (bronchi) makes them swell or construct, narrowing the airways. Asthma involves only the bronchial tubes and does not affect the air sacs (alveoli) or the parenchyma of the lung. Airway constriction in asthma is due to three major processes acting on the bronchi: inflammation, bronchospasm, and mucus over-production. Various factors may precipitate an asthma attack in a subject, including allergies, infections, strong odors, fumes, and so forth.

"Biological sample" as used herein may mean a sample of biological tissue or fluid that comprises nucleic acids. Such samples include, but are not limited to, tissue or fluid isolated from subjects. Biological samples may also include sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, blood (such as white blood cells), plasma, serum, sputum, stool, tears, mucus, hair, and skin. Biological samples also include explants and primary and/or transformed cell cultures derived from animal or patient tissues. A biological sample may be provided by removing a sample of cells from an animal, but can also be accomplished by using previously isolated cells (e.g., isolated by another person, at another time, and/or for another purpose), or by performing the methods described herein in vivo. Archival tissues, such as those having treatment or outcome history, may also be used. Tissue, such as lung tissue is specifically contemplated as a biological sample. Lung tissue may be obtained by any method known to those of ordinary skill in the art, such as via bronchoscopy or obtained at the time of thoracotomy.

As used herein, "obtaining a biological sample" or "obtaining a urine sample" refer to receiving a biological or urine sample, e.g., either directly or indirectly. For example, in some embodiments, the biological sample is directly obtained from a subject at or near the laboratory or location where the biological sample will be analyzed. In other embodiments, the biological sample may be drawn or taken by a third party and then transferred, e.g., to a separate entity or location for analysis. In other embodiments, the sample may be obtained and tested in the same location using a point-of care test. In these embodiments, said obtaining refers to receiving the sample, e.g., from the patient, from a laboratory, from a doctor's office, from the mail, courier, or post office, etc. In some further aspects, the method may further comprise reporting the determination to the subject, a health care payer, an attending clinician, a pharmacist, a pharmacy benefits manager, or any person that the determination may be of interest.

The nucleic acids and miRNAs set forth herein may optionally include one or more phosphoramidate linkages, phosphorothioate linkages, phosphorodithioate linkages, or O-methylphosphoroamidite linkages. The nucleic acid may optionally include one or more nucleotide analogs. Non-limiting examples are discussed in greater detail in the specification below.

It is specifically contemplated that any limitation discussed with respect to one embodiment of the invention may apply to any other embodiment of the invention. Furthermore, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or to utilize any composition of the invention.

The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternative are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."

Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device and/or method being employed to determine the value.

As used herein the specification, "a" or "an" may mean one or more, unless clearly indicated otherwise. As used herein in the claim(s), when used in conjunction with the word "comprising," the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

FIGS. 1A-D: Nucleotide modifications of small RNAs in human lungs. (FIG. 1A) Distribution of nucleotide modifications along the length of mature lung miRNAs comparing emphysematous with normal human lungs (analysis truncated at the 20^th nucleotide). (FIG. IB and FIG. 1C) Pie charts depicting the percentage of modified miRNAs at position 6 (FIG. IB) and position 13 (FIG. 1C) for emphysema and control human lungs as indicated. (FIG. ID) Editing of hsa-let-7a-l as detected by NGS in which the sixth nucleotide of the seed sequence, U, has been modified to G, C or A. * canonical mature sequence.

FIGS. 2A-C: miRNA expression profiling of emphysematous and normal human lungs. (FIG. 2A and FIG. 2B), Heat maps of miRNAs induced or repressed (A, p<0.0l ; B, p<0.05 and fold change >1.5) in emphysematous versus normal human lungs. (FIG. 2C) Validation of miRNA microarray findings by quantitative RT-PCR (qRT-PCR) for selected miRNAs. Bar graph data are presented as means ± S.E.M. (error bars), n>=4; * p < 0.05, ** p <0.01, as determined by the student T test.

FIGS. 3A-B: Gene expression in emphysematous and normal human lungs. (FIG. 3A) Heat map of 214 genes (mRNAs) induced or repressed (p<0A and fold change >1.5) in emphysematous versus normal human lungs. (FIG. 3B) Validation of expression patterns of randomly selected gene from microarray results and inflammation-related genes of potential relevance to emphysema as determined by qRT-PCR. Bar graph data are presented as means ± S.E. (error bars), n>=4; * p < 0.05, ** p <0.01, as determined by the student T test.

FIGS. 4A-F: Inverse expression of CD86 and hsa-let-7a suggests a functional association. (FIG. 4A) Mature let-7a sequence and its target sequence in the CD86 gene 3 '- UTR, which is conserved across mammalian genes (Targetscan 5.2). (FIG. 4B) Mature let-7a aligned with the human CD86 gene 3' -UTR target site. (FIG. 4C) qRT-PCR analyses of CD86 and hsa-let-7a using total RNA from whole lung. (FIG. 4D) Inverse correlation between CD86 and let-7a from human lung dendritic cell as indicated by linear regression analysis. (FIG. 4E) Specific suppression of CD86 expression by let-7a. HEK 293T cells were transfected with plasmids containing Firefly luciferase under the control of human CD86 3 '- UTR and simultaneously with plasmids expressing pre-let-7a and scrambled pre-miRs, as indicated. Gene expression was quantitated as Firefly relative light units after normalizing for transfection efficiency based on Renilla luciferase activity (Firefly/Renilla). (FIG. 4F) anti- let-7a LNA rescues human CD86 expression in HEK 293T cells. Data are presented as means ± S.E. (error bars). n>=3; * p < 0.05, ** p <0.01, *** p <0.001, as determined by the student T test.

FIGS. 5A-E: let-7a controls Thl and Thl7 responses. (FIG. 5A) Anti-let-7a LNA specifically enhances CD86 mRNA expression in human lung dendritic cells as assessed by q-RT PCR. (FIG. 5B and FIG. 5C), human lung dendritic cells were transfected with anti-let-7a or scrambled LNA or scrambled LNA and cultured overnight, followed by surface staining for CD86 by flow cytometry. Data indicate the percent of cells staining positive as determined relative to sham-stained cells (FIG. 5B) and cumulative (FIG. 5C) mean fluorescence intensity (MFI) of staining. (FIG. 5D) Human lung dendritic cells were transfected with anti-let-7a LNA or scrambled LNA and co-cultured with naive allogeneic CD4 T cells that were then activated and analyzed for expression of lineage markers and intracellular IL17A and IFN-γ production by flow cytometry. Quadrant numbers indicate the % of CD4 T cells expressing the indicated cytokines. (FIG. 5E), Supernatants from the co- culture experiments (FIG. 5D) were collected and analyzed for the concentration of IL-17A and IFNy. All data are representative of one of three experiments yielding similar results. * p < 0.05, ** p <0.01, as determined by the student T test.

FIGS. 6A-E: miR-1266 regulates Thl7 responses. (FIG. 6A) Mature miR-1266 sequence and its conserved target sequence in the IL17A gene 3 ' -UTR is conserved across mammalian genes (Targetscan 5.2). (FIG. 6B) Mature miR-1266 aligned with the human IL17A gene 3'-UTR target site. (FIG. 6C) Comparative analysis of miR-1266 expression in CD4 T cells from control and emphysema patients by qRT-PCR. (FIG. 6D) IL17A expression is suppressed by miR-1266. HEK 293T cells were transfected with plasmids containing Firefly luciferase under the control of human IL17A 3 '-UTR and simultaneously with plasmids expressing pre-miR-1266, as indicated. Gene expression was quantitated as Firefly relative light units after normalizing for transfection efficiency based on Renilla luciferase activity (Firefly/Renilla). (FIG. 6E) Anti-miR-1266 LNA increases IL17A mRNA in human T cells. Data are presented as means ± S.E. (error bars), n>=3. * p < 0.05, ** p <0.01, as determined by the student T test.

FIG. 7: Mir-22 is required for Thl7 responses in carbon black treated mice, a model of pulmonary emphysema. Mice were challenged intranasally weekly with carbon black (0.5 mg) for a total of 6 mg and then allowed to rest for 4 weeks, after which total lung leukocytes (left panel), inflammatory cells (macrophages: mac; eosinophils: Eos; neutrophils: Neut; lymphocytes: Lymph; middle panel), and IL-17A+ CD4 T cells (Thl7 cells) were enumerated from whole lung. **: P < 0.01 ; *: P < 0.05.

FIG. 8: Mir-22 is required for Thl7 responses and allergic lung disease.

FIGS. 9A-C: Characterization of small RNAs from human lungs. (FIG. 9A) frequency of NGSderived sequences as a function of nucleotide length. The 23-nt peak is typical for miRNAs. (FIG. 9B), Pie charts show percentage of sequenced transcripts from distinct lung RNA classes comparing emphysematous to control human lungs. (FIG. 9C) Total number of distinct known human miRNAs identified by NGS in emphysema and control human lungs and the percentage of let-7 group miRNAs from total miRNAs identified by NGS comparing emphysema and control lungs.

FIG. 10: Pie charts depicting the relative (percent) abundance of let-7 miRNAs from human control (top) and emphysematous lung (bottom).

FIG. 11: Attenuated lung inflammation was observed in miR-22-/- mice exposed to cigarette smoke, as compared to wild-type controls. FIG. 12: Less airway inflammation was observed in miR-22-/- mice exposed cigarette smoke, as compared to wild-type controls.

FIG. 13: MiR-22 knockdown (KD) in BMDC attenuated DC activation. Relative quantification (RQ) of the cytokine IL-6 ("il-6") and Cd86 are shown. RQ was determined by measuring mRNA levels of the cytokines. FIG. 14: MiR-22 Mediates BMDC-dependent T_H17 Activation by carbon black (CB) in vitro. Levels of the cytokine IL-17 are shown in cell either treated witn 1000 ng of CB or control cells cultured without CB.

FIG. 15: Overexpression of miR-22 resulted in increased activation of antigen presenting cells (APCs). Relative quantification (RQ) of the cytokines IL-Ιβ, IL-6, and IL- 23a are shown. RQ was determined by measuring mRNA levels of the cytokines.

FIG. 16: Overview of microarray studies to identify miR-22 target.

FIG. 17: HDAC Inhibitor Activated Naive RAW Cells. Relative quantification (RQ) of the cytokines IL-Ιβ, IL-6, IL-23a, and Cd86 are shown.

FIG. 18: Bone marrow derived dendritic cells (BMDC) were transfected with either miR-22 locked nucleic acid (LNA) or scramble control LNA, and relative quantification (RQ) of HDAC4 was measured with qRT-PCR (left) or Western blot (right).

FIG. 19: miR-22 augments TH17 by inhibiting HDAC4 in APCs.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

The present invention provides, in various aspects, methods for diagnosing and/or treating inflammatory disease. As shown in the below examples, select miRNAs such as mir- 1266 or let-7a miRNAs can be therapeutically administered to a subject to inhibit the T helper type 1 (Thl) and Thl7 responses that promote inflammation in diseases such as emphysema. In some embodiments, miR-22 may be inhibited to therapeutically treat an inflammatory lung disease in a subject. Without wishing to be bound by any theory, data presented in the below examples are consistent with miR-22 affecting cytokine production in antigen presenting cells (APC) via a mechanism involving histone deacetylase 4 (HDAC4). Altered miRNA profiles in healthy and diseased lung tissues are also provided and may be used to diagnose an inflammatory lung disease and/or monitor the response to a therapeutic in a subject having an inflammatory lung disease.

Tobacco smoking-related emphysema is an inflammatory disorder mediated in part by activation and recruitment of the antigen presenting cells (APCs) into the lungs that can induce T helper type 1 (Thl) and Thl 7 cells that mediate autoimmune inflammation. Cigarette smoke-regulated epigenetic pathways that govern such destructive lung responses remain largely unknown. As shown in the below examples, diverse genomic techniques were used to evaluate the lung short transcriptome and examine the function of non-coding RNAs in immune cells in the lungs of smokers with and without emphysema. Using next generation sequencing, novel miRNAs were identified, and the most abundant miRNAs in the lung, Let- 7 members, were found to exhibit nucleic acid editing that result in an abbreviated target repertoire. miRNA-mRNA expression profiling and correlation analyses revealed distinct transcript profiles linked to emphysema, and two miRNAs, hsa-let-7a (let-7a) and hsa-mir- 1266 (mir-1266), were expressed inversely to their target genes CD86 and IL-17A. Let-7a and mir-1266 regulate target genes in lung APCs and T cells respectively and are critical in differentiation into Thl and Thl 7 responses. Collectively, these findings establish that posttranslational control of Thl and Thl7 responses through miRNAs is an important regulatory feature of emphysema and support modulation of miRNA in smoke induced lung diseases. Immune defense against diverse microorganisms requires robust T helper cell type 17 (Thl7) responses and the cytokine IL-17A. Thl7 cells are further essential mediators of diverse autoimmune disorders such as multiple sclerosis and emphysema. Thus, the ontogeny of the Thl7 response is critical for understanding both beneficial and harmful immune responses. MicroRNAs (miR As) are critical epigenetic mediators of post- translational gene silencing, but the role of miRNAs in the Thl7 response has been previously unknown. As shown in the below examples, it was observed that miR-22 is a key regulator of the Thl7 response, and miR-22-/- mice were unable to develop inflammatory emphysema-like responses.

I. DEFINITIONS

"Subject" as used herein may mean fish, amphibians, reptiles, birds, and mammals, such as mice, rats, rabbits, goats, cats, dogs, cows, apes and humans. "Attached" or "immobilized" as used herein to refer to a nucleic acid probe and a solid support may mean that the binding between the probe and the solid support is sufficient to be stable under conditions of binding, washing, analysis, and removal. The binding may be covalent or non-covalent. Covalent bonds may be formed directly between the probe and the solid support or may be formed by a cross linker or by inclusion of a specific reactive group on either the solid support or the probe or both molecules. Non-covalent binding may be one or more of electrostatic, hydrophilic, and hydrophobic interactions. Included in non-covalent binding is the covalent attachment of a molecule, such as streptavidin, to the support and the non-covalent binding of a biotinylated probe to the streptavidin. Immobilization may also involve a combination of covalent and non-covalent interactions. "Complement" or "complementary" as used herein to refer to a nucleic acid may mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.

"Differential expression" may mean qualitative or quantitative differences in the temporal and/or cellular gene expression patterns within and among cells and tissue. Thus, a differentially expressed gene may qualitatively have its expression altered, including an activation or inactivation, in, e.g., normal versus disease tissue. Genes may be turned on or turned off in a particular state, relative to another state thus permitting comparison of two or more states. A qualitatively regulated gene may exhibit an expression pattern within a state or cell type which may be detectable by standard techniques. Some genes may be expressed in one state or cell type, but not in both. Alternatively, the difference in expression may be quantitative, e.g., in that expression is modulated, either up-regulated, resulting in an increased amount of transcript, or down-regulated, resulting in a decreased amount of transcript. The degree to which expression differs need only be large enough to quantify via standard characterization techniques such as expression arrays, quantitative reverse transcriptase PCR, northern analysis, and RNase protection. "Gene" used herein may be a natural (e.g., genomic) or synthetic gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non- translated sequences (e.g., introns, 5'- and 3 '-untranslated sequences). The coding region of a gene may be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA or antisense RNA. A gene may also be an mRNA or cDNA corresponding to the coding regions (e.g., exons and miRNA) optionally comprising 5'- or 3'-untranslated sequences linked thereto. A gene may also be an amplified nucleic acid molecule produced in vitro comprising all or a part of the coding region and/or 5'- or 3 '-untranslated sequences linked thereto.

"Identical" or "identity" as used herein in the context of two or more nucleic acids or polypeptide sequences, may mean that the sequences have a specified percentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

"Label" as used herein may mean a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include .sup.32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and other entities which can be made detectable. A label may be incorporated into nucleic acids and proteins at any position. "Nucleic acid" or "oligonucleotide" or "polynucleotide" used herein may mean at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions. Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. A nucleic acid will generally contain phosphodiester bonds, although nucleic acid analogs may be included that may have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphosphoroamidite linkages and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, which are incorporated by reference. Nucleic acids containing one or more non-naturally occurring or modified nucleotides are also included within one definition of nucleic acids. The modified nucleotide analog may be located for example at the 5'-end and/or the 3'-end of the nucleic acid molecule. Representative examples of nucleotide analogs may be selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5- bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g. N6-methyl adenosine are suitable. The 2'-OH-group may be replaced by a group selected from H, OR, R, halo, SH, SR, NH₂, NHR, NR₂ or CN, wherein R is Ci-C₆ alkyl, alkenyl or alkynyl and halo is F, CI, Br or I. Modified nucleotides also include nucleotides conjugated with cholesterol through, e.g., a hydroxyprolinol linkage as described in Krutzfeldt et al. (2005); Soutschek et al (2004); and U.S. Patent Publication No. 20050107325, which are incorporated herein by reference. Modified nucleotides and nucleic acids may also include locked nucleic acids (LNA), as described in U.S. Patent Publication No. 2002/0115080, U.S. Patent 6,268,490, and U.S. Patent 6,770,748, which are incorporated herein by reference. LNA nucleotides include a modified extra methylene "bridge" connecting the 2' oxygen and 4' carbon of the ribose ring. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form of DNA or RNA. LNA nucleotides can be mixed with DNA or RNA bases in the oligonucleotide whenever desired. Such oligomers are commercially available from companies including Exiqon (Vedbaek, Denmark). Additional modified nucleotides and nucleic acids are described in U.S. Patent Publication No. 20050182005, which is incorporated herein by reference. Modifications of the ribose- phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments, to enhance diffusion across cell membranes, or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs may be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.

In some embodiments, a LNA or other nucleic acid analog may be produced via methods involving use of an enzyme. Methods for producing LNA include the use of an enzyme or polymerase have been shown, e.g., in Pinheiro et al (2012). In some embodiments, a polymerase may be used in the synthesis of C5-ethynyl locked nucleic acids, LNA, cyclohexenyl nucleic acids (CeNA), anhydrohexital nucleic acids (HNA), or threofuranosyl nucleid acids (TNA) (see, e.g., Veedu et al, 2010; Pinheiro et al, 2012). Producing LNA via the use of an enzyme may significantly reduce the costs associated with the production of LNA. A nucleic acid may be used to therapeutically inhibit a Mir-22 miRNA. For example a nucleic acid comprising a sequence having at least 80%, 85%, 90%, 95%, or all of a sequence complementary to Mir-22 may be used to inhibit the function of a Mir-22 in vitro or in vivo. As shown in the below examples, the inhibition of Mir-22 is sufficient to substantially inhibit emphysema-like, allergic, autoimmune, or inflammatory lung responses in vivo.

For example, in certain embodiments a complementary nucleic acid, such as a modified nucleic acid or an LNA, may be used to bind or suppress the function of one or more Mir-22 miRNA. Full-length LNAs anti-complementary to Mir-22 may be used to inhibit the function of these Mir-22 in vivo or in vitro. In certain embodiments, a LNA may be administered to a subject, such as a mammal, mouse, rat, primate, or human subject, to inhibit the function of one or more miRNA. It is anticipated that the foregoing sequences do not need to be LNA; similar effect may be achieved using one or more of the foregoing sequences either alone or comprising one or more modification (e.g., to reduce in vivo degradation, improve pharmacokinetics, etc.).

In some embodiments, a modified nucleic acid that is not a LNA may be used to inhibit a miRNA, such as Mir-22. For example, an antisense nucleic acid comprising a 2'-4' conformationaly restricted nucleoside analogue may be used to inhibit a miRNA, such as Mir-22. Previous work involving short oligonucleotides with a 2'-4' conformationaly restricted nucleoside analogues has shown that these molecules can exhibit increased potency without increased toxicity in animals (Seth et ah, 2009). Alternately, a cyclohexenyl nucleic acid (CeNA), an anhydrohexital nucleic acid (UNA), or a threofuranosyl nucleid acid (TNA) may be used to target or inhibit a miRNA such as, e.g., Mir-22.

LNA (or 2'-4' BNA) can essentially be considered a 2'-OMe nucleoside (A, below) where the methyl group is constrained back to the 4'- position of the furanose ring system. The 2'-4' constraint enforces an N-type sugar pucker of the furanose ring, which may result in improved hybridization with complementary RNA. By use of a similar strategy, constraining the ethyl chain in the MOE residue back to the 4'-position of the furanose ring system can be used to make nucleosides E (R-constrained MOE or R-cMOE) and F (S- cMOE) below (Seth et ah, 2008). The methoxymethyl groups in cMOE nucleosides may mimic the steric and hydration attributes of MOE nucleosides and may, in some embodiments, improve the safety profile of antisense oligonucleoties containing these modifications. (Teplova et ah, 1999).

O, R = H, LNA D, R = H, LNA

E = CH₂OMe, (/?)-c OE F, R = CH₂OMe, (S)-cMOE

G = CH₃. ( ?)-cES H, R = CH₃, (S)-cEt

"Promoter" as used herein may mean a synthetic or naturally-derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of same. A promoter may also comprise distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. A promoter may be derived from sources including viral, bacterial, fungal, plants, insects, and animals. A promoter may regulate the expression of a gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter and the CMV IE promoter.

"Stringent hybridization conditions" used herein may mean conditions under which a first nucleic acid sequence will hybridize to a second nucleic acid sequence, such as in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions may be selected to be about 5- 10°C. lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength pH. The T_m may be the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T_m, 50% of the probes are occupied at equilibrium). Stringent conditions may be those in which the salt concentration is less than about 1.0 M sodium ion, such as about 0.01-1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 °C. for short probes (e.g., about 10-50 nucleotides) and at least about 60 °C. for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal may be at least 2 to 10 times background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5 x SSC, and 1% SDS, incubating at 42°C, or, 5 x SSC, 1% SDS, incubating at 65°C, with wash in 0.2xSSC, and 0.1% SDS at 65°C.

"Substantially complementary" used herein may mean that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, or that the two sequences hybridize under stringent hybridization conditions.

II. MICRORNAS (MIRNAS)

MicroR As (miR As) are short, non-coding RNAs that target and silence protein coding genes through 3'-UTR elements. Important roles for miRNAs in numerous biological processes have been established, but comprehensive analyses of miRNA function in complex diseases are lacking. MiRNAs are initially transcribed as primary miRNAs (pri- miRNAs) that are then cleaved by the nuclear RNAses Drosha and Pasha to yield precursor- miRNAs (pre-miRNAs). These precursors are further processed by the cytoplasmic RNAse III dicer to form short double stranded miR-miR* duplexes, one strand of which (miR) is then integrated into the RNA Induced Silencing Complex (RISC) that includes the enzymes dicer and Argonaute (Ago). The mature miRNAs (~17-24nt) direct RISC to specific target sites located within the 3 'UTR of target genes. Once bound to target sites, miRNAs represses translation through mRNA decay, translational inhibition and/or sequestration into processing bodies (P -bodies) (Eulalio et ah, 2008; Behm-Ansmant et ah, 2006; Chu and Rana, 2006). Recent estimates find that over 60% of protein coding genes carry 3 '-UTR miRNA target sites (Friedman et ah, 2009). In this regard, miRNAs act as key regulators of processes as diverse as early development (Reinhart et al, 2000), cell proliferation and cell death (Brennecke et al, 2003), apoptosis and fat metabolism (Xu et al, 2003), and cell differentiation (Chen, 2004; Dostie et al, 2003). In addition, studies of miRNA expression in chronic lymphocytic leukemia (Calin et al, 2008), colonic adenocarcinoma (Michael et al, 2003), Burkitt's lymphoma (Metzler et al, 2004), cardiac disease (Zhao et al, 2007) and viral infection (Pfeffer et al, 2004) suggest vital links between miRNA and numerous diseases. miRNAs thus far observed have been approximately 21-22 nucleotides in length and they arise from longer precursors, which are transcribed from non-protein-encoding genes. See review of Carrington et al (2003). The precursors form structures that fold back on each other in self-complementary regions; they are then processed by the nuclease Dicer in animals or DCL1 in plants. miRNA molecules interrupt translation through precise or imprecise base-pairing with their targets.

Certain embodiments of the present invention involve methods for diagnosing or treating an inflammatory disease in a subject that involves inhibiting the function or measuring expression, respectively, of one or more miRNA species in a sample from the subject. Altered expression of one or more of these miRNA in the lungs of a subject may indicate that the subject has an inflammatory disease affecting the lungs such as, e.g., an autoimmune disease or emphysema. Some aspects of the present invention relate to the identification of novel miRNAs shown below in Table 1. Altered expression of these miRNA were observed between emphysematous and control lungs in humans (Table 1).

Table 1. Putative novel miRNAs from human lungs identified by deep sequencing.

MM PI 1,

4 GTTGGAGGATGAAAGTACGG 141

CCL22

SERBP1,

5 TTTCTGTGTGGAATTTGAATATCTGAAA 404

IL17RD

6 TTCCTGGTGGTCTAGTGGTTAG 229 CXCR5

7 AGCTCTAGAAAGATTGTTGACC 124 CD103

SMAD4,

8 GATGCCTGGGAGTTGCGATCTG 89

IRS2

SMAD2,

9 CACCTGTATTCGAAAGTGATCGTGGGCTG 135

SMAD5

10 CGGCGGGAGCCCCGGGG 17 ADRBK1

SMAD4,

11 AAACCTAGAACTCCAAGCCTGTT 89

TRAF4

12 ATCGAGGCTAGAGTCACGCTTGG 4 EDF1

13 TGGGCTAAGGGAGATGATTGGGT 64 c-MAF

(Targetscan 5.2)

As shown in the below examples, certain miRNA were observed to be upregulated in the lung in response to an inflammatory or emphysema-like challenge, while other miRNA were observed to be downregulated in response to an inflammatory or or emphysema-like challenge. Twenty miRNAs were observed to be differentially expressed with a significance ofp<0.01 between emphysema and controls (FIG. 2A).

Using complementary genomic approaches to examine the epigenetic factors in cigarette smoke induced emphysema, human lung short RNAome with specific functions have been identified and are disclosed herein. These results provide insight into how miRNAs, one of the most abundant of lung short transcripts, may orchestrate the destructive immune events that are triggered by chronic exposure to smoke. Comparison of lung transcriptomes from ever-smokers with and without emphysema revealed highly consistent patterns of gene expression that extended to the miRNAs and other transcripts. Let-7 miRNAs were observed to be both the most abundant miRNA found and also the most likely to undergo editing in human lungs regardless of disease status. This analysis of human lung using Next Generation Sequencing (NGS) resulted in the discovery of several novel miRNAs. Using microarrays, a more quantitative assay, differential expression was observed for a select group of miRNAs.

To further determine the functional relevance of lung miRNAs, additional inverse correlation analyses against target genes of relevance to emphysema (CD86; IL-17A) and their putative regulatory miRNAs let-7a and mir-1266, respectively, were performed. Expression of both let-7a and mir-1266 was found to correlate inversely with the expression of the target genes CD86 and IL-17A in the lungs of smokers with emphysema. The function of let-7a was further confirmed using multiple in vitro assays that validated the association studies in the inverse correlation array data. Increased expression of CD86, a co-stimulatory molecule expressed on activated antigen presenting cells (Carreno and Collins, 2002; Caux et al, 1994; Masten et al, 1997), is an important step in the activation of CD4 T cells that are recognized as pathogenic effectors in emphysema (Grumelli et al, 2004; Shan et al, 2009; Cosio and Majo, 2002; Harrison et al, 2008; Hanaoka et al, 2010; Motz et al, 2010). Consistent with these findings and using similar approaches, it was also found that mir-1266 in CD4 T cells also regulates the expression of IL-17A, a cytokine that is predominantly expressed in Thl7 cells (Harrington et al, 2005; Park et al, 2005).

The emphysematous lung is characterized by the presence of parenchymal Thl and Thl 7 cells that mediate lung destruction by coordinating the expression of elastin- degrading matrix metalloproteinases (MMPs), in particular MMP12 (Grumelli et al, 2004; Lee et al, 2007). IL-17A plays a critical role in animal models of smoke induced emphysema (Shan et al, 2012; Shen et al, 2011 ; Melgerte? al, 2007; Chen et al, 201 1), and long-term pulmonary expression of this cytokine is harmful. Without wishing to be bound by any theory, the data provided herein supports the idea that the immune system has evolved a complex epigenetically modified regulatory network to limit the expression of IL-17A in the lung, and it is anticipated that these mechanisms may be operational in other inflammatory sites and tissues. In addition to T regulatory cells (Treg) which dampen Thl 7 responses overall (Lohr et al, 2006) and are in lower abundance in emphysematous lung (Lee et al, 2007), the data herein shows that miRNAs can play an important role in controlling Thl 7 responses both directly through the control of IL-17A (mir-1266) or indirectly by controlling lung APC maturation and CD86 expression specifically (let-7a). Furthermore, additional pro-inflammatory genes have been identified herein that may be linked to emphysema pathogenesis and which are susceptible to miRNA-dependent regulation (Table 2). Table 2. Conserved miRNAs for a selected number of genes implicated in Emphysema

Other TargetScan 5.2 conserved

Target ID FC P value

name miRNA

ALDH1A1 0.59 0.12 RALDH1 none

CCL2 6.18 0.06 MCP1 374a, 374b CCL20 3.18 0.47 590-5p, 21 CCL3 2.67 0.41 MlPla let-7(s), 98 CCR5 0.94 0.55 1323, 548o CCR6 1.23 0.60 607,518a-5p,527,450b-5p CD14 1.22 0.53 none CD1A 1.13 0.85 none CD80 1.11 0.77 146a, 146b-5p CD86 1.37 0.34 let-7(s), 98 CXCL10 1.29 0.88 503 CXCL9 1.12 0.95 none CXCR3 0.91 0.53 none ELA2 0.91 0.78 elastase none IFNG 0.96 0.94 607, 656 IL17A I.04 0.72 1266 IL1B 3.13 0.19 none IL6 II.4 0.09 none ITGAX 1.64 0.36 CDllc none MMP12 1.45 0.42 none MMP9 1.88 0.32 none PPARy 0.82 0.73 454, 130b, 301b, 301a, 130a

SERPI A1 1.53 0.22 alAT none

SPP1 1.80 0.33 osteopontin none

TNF 1.17 0.76 19a, 19b

TYROBP 1.36 0.53 DAP12

HCST 1.25 0.68 DAP10

CLEC5A 1.50 0.27 MDL-1 548f,e,a-3p, 584, 593

TREM1 1.26 0.33

TREM2 1.39 0.38

SIRPB1 1.00 1.00

CD200 1.30 0.43 26a,b, 1297

CD300LB 1.02 0.94 TREM5

SIGLEC14 n/a n/a

TRIM35 0.88 0.38 MAIR

Prior studies focusing on allergic lung disease marked by Th2 inflammation in the lungs in mice and studies by others have shown that let-7 miRNAs represent by far the most abundant lung miRNAs (Polikepahad et ah, 2010). Similarly, using human lung tissue, irrespective of the presence or absence of emphysema, it is shown herein that the same miRNA represents the most abundant group expressed in the lungs of humans, suggesting that the let-7 miRNA family may be unusually important in regulating lung and immune biology, a concept that is commensurate with the very large number of predicted targets (-800) of let-7 miRNAs. It was demonstrated previously in mice that let-7 miRNAs promoted allergic lung inflammation despite paradoxically acting to downregulate some molecules that promote the expression of asthma-like disease (Polikepahad et ah, 2010). Here, however, the inventor has shown in the context of cigarette smoking that largely the same miRNAs in part play a protective role by inhibiting Thl and Thl7 responses in concert with unrelated miRNAs such as mir-1266. Thus, the exceptionally abundant let-7 miRNA family of short transcripts possesses both pro- and anti-inflammatory properties that are strongly context dependent.

The data provided herein utilize diverse miRNA analytical techniques including deep sequencing, microarrays, and PCR, each having distinct sensitivities and providing differential insights into miRNA function. Although let-7a and mir-1266 appear to have similar importance to the regulation of Thl and Thl7 responses in emphysema, they are expressed at vastly different scales, with let-7 being one of the most abundant of all miRNA transcripts and mir-1266 being so rare it was detectable only with the most sensitive PCR technique. Expression of both let-7a and mir-1266 was downregulated in emphysema, a critical finding that was too subtle to be detected by microarray analysis alone. Thus, optimal analysis of miRNAs ex vivo can require a combination of analytical techniques.

III. METHODS FOR ANALYZING EXPRESSION OF MIRNA AND GENE EXPRESSION

Some embodiments of the methods of the present invention involve analysis of miRNA expression or gene expression. Methods for analyzing gene expression or expression of miRNA include, but are not limited to, methods based on hybridization analysis of polynucleotides, sequencing of polynucleotides, and analysis of protein expression such as proteomics-based methods. Commonly used methods for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker and Barnes, 1999), RNAse protection assays (Hod, 1992), and PCR-based methods, such as reverse transcription polymerase chain reaction (RT-PCR) (Weis et ah, 1992). In some embodiments, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).

A. PCR-Based Methods

[0068] Gene expression or miRNA expression can be analyzed using techniques that employ PCR. PCR is useful to amplify and detect transcripts from a sample. RT-PCR is a sensitive quantitative method that can be used to compare mRNA levels in different samples (e.g., endomyocardial biopsy samples) to examine gene expression signatures. To perform RT-PCR, mR A is isolated from a sample. For example, total RNA may be isolated from a sample of lung tissue. mRNA may also be extracted, for example, from frozen or archived paraffin-embedded and fixed tissue samples. Methods for mRNA extraction are known in the art. See, e.g., Ausubel et al. (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, 1987, and De Andres et al, 1995. Purification kits for RNA isolation from commercial manufacturers, such as Qiagen, can be used. Other commercially available RNA isolation kits include MasterPure™. Complete DNA and RNA Purification Kit (EPICENTRE.TM., Madison, Wis.), and, Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be also isolated using RNA Stat-60 (Tel-Test) or by cesium chloride density gradient centrifugation.

RNA is then reverse transcribed into cDNA. The cDNA is amplified in a PCR reaction. A variety of reverse transcriptases are known in the art. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.

For quantitative PCR, a third oligonucleotide, or probe, is used to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and typically is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative analysis.

RT-PCR can be performed using commercially available equipment, such as an ABI PRISM 7700.TM. Sequence Detection System (Perkin-Elmer-Applied Biosystems, Foster City, Calif, USA), or Lightcycler.RTM. (Roche Molecular Biochemicals, Mannheim, Germany). Samples can be analyzed using a real-time quantitative PCR device such as the ABI PRISM 7700.TM. Sequence Detection System.TM. A variation of the RT-PCR technique is real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe, such as a TaqMan.TM. probe. Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.

Gene expression may be examined using fixed, paraffin-embedded tissues as the RNA source or fresh tissue such as tissue obtained from a biopsy of pulmonary tissue. Examples of methods of examining expression in fixed, paraffin-embedded tissues, are described, for example, in Godfrey et al, 2000; and Specht et. al, 2001.

Another approach for gene expression analysis employs competitive PCR design and automated, high-throughput matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) MS detection and quantification of oligonucleotides. This method is described by Ding and Cantor, 2003. See also the MassARRAY-based gene expression profiling method, developed by Sequenom, Inc. (San Diego, Calif).

Additional PCR-based techniques for gene expression analysis include, e.g., differential display (Liang and Pardee, 1992); amplified fragment length polymorphism (iAFLP) (Kawamoto et al, 1999); BeadArray.TM. technology (Illumina, San Diego, Calif; Oliphant et al, 2002; Ferguson et al, 2000); BeadsArray for Detection of Gene Expression (BADGE), using the commercially available LuminexlOO LabMAP system and multiple color-coded microspheres (Luminex Corp., Austin, Tex.) in a rapid assay for gene expression (Yang et al, 2001); and high coverage expression profiling (HiCEP) analysis (Fukumura et al, 2003).

B. Microarrays

Other techniques for examining gene expression in a sample involve use of microarrays. Microarrays permit simultaneous analysis of a large number of gene expression products. Typically, polynucleotides of interest are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with nucleic acids (e.g., DNA or RNA) from cells or tissues of interest. The source of mRNA typically is total RNA. If the source of mRNA is lung tissue, mRNA can be extracted. In various embodiments of the microarray technique, probes to at least 10, 25, 50, 100, 200, 500, 1000, 1250, 1500, or 1600 polynucleotides are immobilized on an array substrate. The probes can include DNA, RNA, copolymer sequences of DNA and RNA, DNA and/or RNA analogues, or combinations thereof. In some embodiments, a microarray includes a support with an ordered array of binding (e.g., hybridization) sites for each individual polynucleotide of interest. The microarrays can be addressable arrays, such as positionally addressable arrays where each probe of the array is located at a known, predetermined position on the solid support such that the identity of each probe can be determined from its position in the array. Each probe on the microarray can be between about 10-50,000 nucleotides in length. The probes of the microarray can consist of nucleotide sequences of any length. An array can include positive control probes, such as probes known to be complementary and hybridizable to sequences in the test sample, and negative control probes such as probes known to not be complementary and hybridizable to sequences in the test sample. Methods for attaching nucleic acids to a surface are well-known in the art.

Methods for immobilizing nucleic acids on glass are described (Schena et al, 1995; DeRisi Shalon et al, 1996). Techniques are known for producing arrays with thousands of oligonucleotides at defined locations using photolithographic techniques are described by Fodor et al, 1991; Pease et al, 1994; Lockhart et al, 1996; U.S. Pat. Nos. 5,578,832; 5,556,752; and 5,510,270). Other methods for making microarrays have been described. See, e.g., Maskos and Southern, 1992. Any type of array may be used in the context of the present invention.

C. Serial Analysis of Gene Expression (SAGE)

Gene expression or miRNA expression in samples may also be determined by serial analysis of gene expression (SAGE), which is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript (see Velculescu et al, 1995; and Velculescu et al, 1997). Briefly, a short sequence tag (about 10-14 nucleotides) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of a population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag.

D. Protein Detection Methodologies

Immunohistochemical methods are also suitable for detecting the expression of the genes. Antibodies, most preferably monoclonal antibodies, specific for a gene product are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available.

Proteomic methods can allow examination of global changes in protein expression in a sample. Proteomic analysis may involve separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE), and identification of individual proteins recovered from the gel, such as by mass spectrometry or N-terminal sequencing, and analysis of the data using bioinformatics. Proteomics methods can be used alone or in combination with other methods for evaluating gene expression. In various aspects, the expression of certain genes in a sample is detected to provide clinical information, such as information regarding prognosis. Thus, gene expression assays include measures to correct for differences in RNA variability and quality. For example, an assay typically measures and incorporates the expression of certain normalizing genes, such known housekeeping genes. Alternatively, normalization can be based on the mean or median signal (Ct) of all of the assayed genes or a large subset thereof (global normalization approach). In some embodiments, a normalized test RNA (e.g., from a patient sample) is compared to the amount found in a sample from a patient with left ventricular dysfunction. The level of expression measured in a particular test sample can be determined to fall at some percentile within a range observed in reference sets. IV. KITS

The technology herein includes kits for evaluating miRNA or gene expression in samples. A "kit" refers to a combination of physical elements. For example, a kit may include, for example, one or more components such as probes, including without limitation specific primers, antibodies, a protein-capture agent, a reagent, an instruction sheet, and other elements useful to practice the technology described herein. These physical elements can be arranged in any way suitable for carrying out the invention.

Kits for analyzing RNA expression may include, for example, a set of oligonucleotide probes for detecting expression of a gene or a miRNA (e.g., from Table 1). The probes can be provided on a solid support, as in an array (e.g., a microarray), or in separate containers. The kits can include a set of oligonucleotide primers useful for amplifying a set of genes described herein, such as to perform PCR analysis. Kits can include further buffers, enzymes, labeling compounds, and the like. Any of the compositions described herein may be comprised in a kit. In a non-limiting example, an individual miRNA is included in a kit. The kit may further include water and hybridization buffer to facilitate hybridization of the two strands of the miRNAs. The kit may also include one or more transfection reagents to facilitate delivery of the miRNA to cells.

A kit for analyzing protein expression can include specific binding agents, such as immunological reagents (e.g., an antibody) for detecting protein expression of a gene of interest. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a single vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, such as a sterile aqueous solution. However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. The container means will generally include at least one vial, test tube, flask, bottle, syringe and/or other container means, into which the nucleic acid formulations are placed, preferably, suitably allocated. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent.

The kits of the present invention will also typically include a means for containing the vials in close confinement for commercial sale.

Such kits may also include components that preserve or maintain the miRNA or that protect against its degradation. Such components may be RNAse-free or protect against RNAses. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution. A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.

It is contemplated that such reagents are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.

V. VECTORS FOR CLONING, GENE TRANSFER AND EXPRESSION

Within certain embodiments expression vectors are employed to express a nucleic acid of interest, such as a miRNA that inhibits the expression of a particular gene. Expression requires that appropriate signals be provided in the vectors, and which include various regulatory elements, such as enhancers/promoters from both viral and mammalian sources that drive expression of the genes of interest in host cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide. A. Regulatory Elements

Throughout this application, the term "expression construct" is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest.

In certain embodiments, the nucleic acid encoding a gene product is under transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.

At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.

Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.

In other embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, rat insulin promoter and glyceraldehyde-3 -phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.

By employing a promoter with well-known properties, the level and pattern of expression of the protein of interest following transfection or transformation can be optimized. Further, selection of a promoter that is regulated in response to specific physiologic signals can permit inducible expression of the gene product. Tables 2 and 3 list several regulatory elements that may be employed, in the context of the present invention, to regulate the expression of the gene of interest. This list is not intended to be exhaustive of all the possible elements involved in the promotion of gene expression but, merely, to be exemplary thereof.

Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.

The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization. Below is a list of viral promoters, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the nucleic acid encoding a gene of interest in an expression construct (Table 3 and Table 4). Additionally, any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of the gene. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.

TABLE 3

Promoter and/or Enhancer

Promoter/Enhancer References

t-Globin Bodine et al, 1987; Perez-Stable et al, 1990 β-Globin TmAQl et al, 1987

c-fos Cohen et al, 1987

c-HA-ras Triesman, 1986; Deschamps et al, 1985

Insulin Edlund et al, 1985

Neural Cell Adhesion Molecule Hirsh et al, 1990

(NCAM)

(Xi-Antitrypain Latimer et al, 1990

H2B (TH2B) Histone Hwang et al, 1990

Mouse and/or Type I Collagen Ripe et al, 1989

Glucose-Regulated Proteins Chang ed/., 1989

(GRP94 and GRP78)

Rat Growth Hormone Larsen et al, 1986

Human Serum Amyloid A (SAA) Edbrooke ei a/., 1989

Troponin I (TN I) Yutzey et al, 1989

Platelet-Derived Growth Factor Pech ei a/., 1989

(PDGF)

Duchenne Muscular Dystrophy Klamut ei a/., 1990

SV40 Banerji et al, 1981 ; Moreau et al, 1981 ; Sleigh et al, 1985; Firak et al, 1986; Herr et al, 1986; Imbra et al, 1986; Kadesch et al, 1986; Wang et al, 1986; Ondek et al, 1987; Kuhl et al, 1987; Schaffner ei a/., 1988

Polyoma Swartzendruber et al, 1975; Vasseur et al, 1980;

Katinka et al, 1980, 1981 ; Tyndell et al, 1981 ; Dandolo et al, 1983; de Villiers et al, 1984; Hen et al, 1986; Satake et al, 1988; Campbell and/or Villarreal, 1988 TABLE 3

Promoter and/or Enhancer

Promoter/Enhancer References

Retroviruses Kriegler et al, 1982, 1983; Levinson et al, 1982;

Kriegler et al, 1983, 1984a, b, 1988; Bosze et al, 1986; Miksicek et al, 1986; Celander et al, 1987; Thiesen et al, 1988; Celander et al, 1988; Choi et al, 1988; Reisman a/., 1989

Papilloma Virus Campo et al, 1983; Lusky et al, 1983; Spandidos and/or Wilkie, 1983; Spalholz et al, 1985; Lusky et al, 1986; Cripe et al, 1987; Gloss et al, 1987; Hirochika et al, 1987; Stephens et al, 1987

Hepatitis B Virus Bulla et al, 1986; Jameel et al, 1986; Shaul et al,

1987; Spandau et al, 1988; Vannice et al, 1988

Human Immunodeficiency Virus Muesing et al, 1987; Hauber et al, 1988;

Jakobovits et al, 1988; Feng et al, 1988; Takebe et al, 1988; Rosen et al, 1988; Berkhout et al, 1989; Laspia et al, 1989; Sharp et al, 1989; Braddock ei a/., 1989

Cytomegalovirus (CMV) Weber et al, 1984; Boshart et al, 1985; Foecking et al, 1986

Gibbon Ape Leukemia Virus Holbrook e? al, 1987; Quinn et al, 1989

TABLE 4

Inducible Elements

Element Inducer References

MMTV (mouse mammary Glucocorticoids Huang et al, 1981; Lee et tumor virus) al, 1981; Majors et al,

1983; Chandler et al, 1983; Ponta et al, 1985; Sakai ei a/., 1988

β-Interferon poly(rI)x Tavernier et al, 1983

poly(rc)

Adenovirus 5 E2 E1A Imperiale et al, 1984

Collagenase Phorbol Ester (TPA) Angel et al, 1987a

Stromelysin Phorbol Ester (TPA) Angel a al, 1987b

SV40 Phorbol Ester (TPA) Angel a al, 1987b

Murine MX Gene Interferon, Newcastle Hug e? al, 1988

Disease Virus

GRP78 Gene A23187 Resendez et al, 1988 α-2-Macroglobulin IL-6 Kunz et al, 1989

Vimentin Serum Rittling et al, 1989

MHC Class I Gene Η-2κ±> Interferon Blanar ei a/., 1989

HSP70 E1A, SV40 Large T Taylor et al, 1989, 1990a,

Antigen 1990b

Proliferin Phorbol Ester-TPA Mordacq et al, 1989

Tumor Necrosis Factor PMA Hensel et al, 1989

Thyroid Stimulating Thyroid Hormone Chatterjee ei a/., 1989

Hormone a Gene

Of particular interest are muscle specific promoters, and more particularly, cardiac specific promoters. These include the myosin light chain-2 promoter (Franz et al, 1994; Kelly et al, 1995), the alpha actin promoter (Moss et al, 1996), the troponin 1 promoter (Bhavsar et al, 1996); the Na⁺/Ca²⁺ exchanger promoter (Barnes et al, 1997), the dystrophin promoter (Kimura et al, 1997), the alpha7 integrin promoter (Ziober and Kramer, 1996), the brain natriuretic peptide promoter (LaPointe et al, 1996) and the alpha B- crystallin/small heat shock protein promoter (Gopal-Srivastava, 1995), alpha myosin heavy chain promoter (Yamauchi-Takihara et ah, 1989) and the ANF promoter (LaPointe et ah, 1988).

Where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed such as human growth hormone and SV40 polyadenylation signals. Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.

B. Selectable Markers

In certain embodiments of the invention, the cells contain nucleic acid constructs of the present invention, a cell may be identified in vitro or in vivo by including a marker in the expression construct. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression construct. Usually the inclusion of a drug selection marker aids in cloning and in the selection of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be employed. Immunologic markers also can be employed. The selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable markers are well known to one of skill in the art.

C. Multigene Constructs and IRES

In certain embodiments of the invention, the use of internal ribosome binding sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picanovirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message. Any heterologous open reading frame can be linked to IRES elements. This includes genes for secreted proteins, multi-subunit proteins, encoded by independent genes, intracellular or membrane-bound proteins and selectable markers. In this way, expression of several proteins can be simultaneously engineered into a cell with a single construct and a single selectable marker. D. Delivery of Expression Vectors

There are a number of ways in which expression vectors may introduced into cells. In certain embodiments of the invention, the expression construct comprises a virus or engineered construct derived from a viral genome. One of the preferred methods for in vivo delivery involves the use of an adenovirus expression vector. "Adenovirus expression vector" is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to express an antisense polynucleotide that has been cloned therein. In this context, expression does not require that the gene product be synthesized.

The expression vector comprises a genetically engineered form of adenovirus. Knowledge of the genetic organization of adenovirus, a 36 kB, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kB (Grunhaus and Horwitz, 1992). In contrast to retrovirus, the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity. Also, adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification. Adenovirus can infect virtually all epithelial cells regardless of their cell cycle stage. So far, adenoviral infection appears to be linked only to mild disease such as acute respiratory disease in humans.

Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized genome, ease of manipulation, high titer, wide target cell range and high infectivity. Generation and propagation of the current adenovirus vectors, which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham et ah, 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the D3 or both regions (Graham and Prevec, 1991).

The adenovirus may be replication-defective or replication-competent. The adenovirus may be of any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.

Adenovirus is easy to grow and manipulate and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10⁹-10¹² plaque- forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells.

The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants. Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et ah, 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984), lentivirus, and herpesviruses may be employed.

With the recognition of defective hepatitis B viruses, new insight was gained into the structure-function relationship of different viral sequences. In vitro studies showed that the virus could retain the ability for helper-dependent packaging and reverse transcription despite the deletion of up to 80% of its genome (Horwich et al, 1990). In order to effect expression of sense or antisense gene constructs, the expression construct must be delivered into a cell. This delivery may be accomplished in vitro, as in laboratory procedures for transforming cells lines, or in vivo or ex vivo, as in the treatment of certain disease states. One mechanism for delivery is via viral infection where the expression construct is encapsidated in an infectious viral particle.

Several non-viral methods for the transfer of expression constructs into cultured mammalian cells also are contemplated by the present invention. These include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al, 1986; Potter et al, 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al, 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al, 1987), gene bombardment using high velocity microprojectiles (Yang et al, 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use.

Once the expression construct has been delivered into the cell the nucleic acid encoding the gene of interest may be positioned and expressed at different sites. In certain embodiments, the nucleic acid encoding the gene may be stably integrated into the genome of the cell. This integration may be in the cognate location and orientation via homologous recombination (gene replacement) or it may be integrated in a random, non-specific location (gene augmentation). In yet further embodiments, the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.

In yet another embodiment of the invention, the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularly applicable for transfer in vitro but it may be applied to in vivo use as well. Dubensky et al (1984) successfully injected polyomavirus DNA in the form of calcium phosphate precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of calcium phosphate-precipitated plasmids results in expression of the transfected genes. It is envisioned that DNA encoding a gene of interest may also be transferred in a similar manner in vivo and express the gene product.

In still another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

In a further embodiment of the invention, the expression construct may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self- rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated are lipofectamine-DNA complexes. Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful. Wong et al, (1980) demonstrated the feasibility of liposome- mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells. Nicolau et al, (1987) accomplished successful liposome-mediated gene transfer in rats after intravenous injection. Other expression constructs which can be employed to deliver a nucleic acid encoding a particular gene into cells are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993). In other embodiments, the delivery vehicle may comprise a ligand and a liposome. For example, Nicolau et al. (1987) employed lactosyl-ceramide, a galactose- terminal asialganglioside, incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes. Thus, it is feasible that a nucleic acid encoding a particular gene also may be specifically delivered into a cell type by any number of receptor- ligand systems with or without liposomes. For example, epidermal growth factor (EGF) may be used as the receptor for mediated delivery of a nucleic acid into cells that exhibit upregulation of EGF receptor. Mannose can be used to target the mannose receptor on liver cells. Also, antibodies to CD5 (CLL), CD22 (lymphoma), CD25 (T-cell leukemia) and MAA (melanoma) can similarly be used as targeting moieties.

In a particular example, the oligonucleotide may be administered in combination with a cationic lipid. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. The publication of WO/0071096, which is specifically incorporated by reference, describes different formulations, such as a DOTAP:cholesterol or cholesterol derivative formulation that can effectively be used for gene therapy.

In certain embodiments, gene transfer may more easily be performed under ex vivo conditions. Ex vivo gene therapy refers to the isolation of cells from an animal, the delivery of a nucleic acid into the cells in vitro, and then the return of the modified cells back into an animal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues.

VI. CLINICAL INFORMATION

A. Definitions

"Treatment" and "treating" as used herein refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition.

The term "therapeutic benefit" or "therapeutically effective" as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease.

"Prevention" and "preventing" are used according to their ordinary and plain meaning to mean "acting before" or such an act. In the context of a particular disease or health-related condition, those terms refer to administration or application of an agent, drug, or remedy to a subject or performance of a procedure or modality on a subject for the purpose of blocking the onset of a disease or health-related condition.

The term "compound" refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function. Compounds comprise both known and potential therapeutic compounds. A compound can be determined to be therapeutic by screening using the screening methods of the present invention. A "known therapeutic compound" refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment. In other words, a known therapeutic compound is not limited to a compound efficacious in the treatment of asthma.

A "sample" is any biological material obtained from an individual. For example, a "sample" may be a blood sample or a lung tissue sample.

B. Dosage

A pharmaceutically effective amount of a therapeutic agent as set forth herein is determined based on the intended goal, for example inhibition of cell death. The quantity to be administered, both according to number of treatments and dose, depends on the subject to be treated, the state of the subject, the protection desired, and the route of administration. Precise amounts of the therapeutic agent also depend on the judgment of the practitioner and are peculiar to each individual. For example, a dose of the therapeutic agent may be about 0.0001 milligrams to about 1.0 milligrams, or about 0.001 milligrams to about 0.1 milligrams, or about 0.1 milligrams to about 1.0 milligrams, or even about 10 milligrams per dose or so. Multiple doses can also be administered. In some embodiments, a dose is at least about 0.0001 milligrams. In further embodiments, a dose is at least about 0.001 milligrams. In still further embodiments, a dose is at least 0.01 milligrams. In still further embodiments, a dose is at least about 0.1 milligrams. In more particular embodiments, a dose may be at least 1.0 milligrams. In even more particular embodiments, a dose may be at least 10 milligrams. In further embodiments, a dose is at least 100 milligrams or higher.

In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above. Dosages of nucleic acid or LNA which may be used include, for example, about from 10-100 mg (LNA or nucleic acid)/g body weight, about 25- 75 mg (LNA or nucleic acid)/g body weight, about mg (LNA or nucleic acid)/g body weight, or any range derivable therein. A dosage of about 50 mg (LNA or nucleic acid)/g mouse body weight was observed to be effective to substantially inhibit allergic or inflammatory lung responses in mice in vivo.

The dose can be repeated as needed as determined by those of ordinary skill in the art. Thus, in some embodiments of the methods set forth herein, a single dose is contemplated. In other embodiments, two or more doses are contemplated. Where more than one dose is administered to a subject, the time interval between doses can be any time interval as determined by those of ordinary skill in the art. For example, the time interval between doses may be about 1 hour to about 2 hours, about 2 hours to about 6 hours, about 6 hours to about 10 hours, about 10 hours to about 24 hours, about 1 day to about 2 days, about 1 week to about 2 weeks, or longer, or any time interval derivable within any of these recited ranges.

In certain embodiments, it may be desirable to provide a continuous supply of a pharmaceutical composition to the patient. This could be accomplished by catheterization, followed by continuous administration of the therapeutic agent. The administration could be intra-operative or post-operative. VII. PHARMACEUTICAL COMPOSITIONS AND ROUTES FOR ADMINISTRATION TO PATIENTS

Some embodiments of the present invention involve administration of pharmaceutical compositions. For example, an inhibitor of miRNA-22 may be administered to a subject (e.g., a mammal, a primate, a mouse, a rat, or a human) to treat an inflammatory disease or an inflammatory lung disorder. The inflammatory disease mey be a Th-17 mediated inflammatory disease such as, e.g., emphysema, or an autoimmune disease, etc. The inhibitor of miRNA-22 may be, e.g., a modified nucleic acid or a LNA. Where clinical applications are contemplated, pharmaceutical compositions will be prepared in a form appropriate for the intended application. Generally, this will involve preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.

One will generally desire to employ appropriate salts and buffers in preparing compositions of therapeutic agents. Buffers also will be employed when recombinant cells are introduced into a patient. Aqueous compositions of the present invention comprise an effective amount of the therapeutic agent, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients of the present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions, provided they do not inactivate the therapeutic agents of the compositions.

The active compositions of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention may be via any common route so long as the target tissue is available via that route. Administration may be by any method known to those of ordinary skill in the art, such as intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal or intrathecal injection, or by direct injection into cardiac tissue. Other modes of administration include oral, buccal, and nasogastric administration. The active compounds may also be administered parenterally or intraperitoneally. Such compositions would normally be administered as pharmaceutically acceptable compositions, as described supra. In particular embodiments, the composition is administered to a subject using a drug delivery device. For example, the drug delivery device may be a catheter or syringe. In some embodiments, the composition is applied as a coating to a medical device, such as a stent.

By way of illustration, solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that easy injectability exists. Preparations should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial an antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount into a solvent along with any other ingredients (for example as enumerated above) as desired, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the desired other ingredients, e.g., as enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation include vacuum-drying and freeze- drying techniques which yield a powder of the active ingredient(s) plus any additional desired ingredient from a previously sterile-filtered solution thereof.

For oral administration the therapeutic agents of the present invention generally may be incorporated with excipients. Any excipient known to those of ordinary skill in the art is contemplated.

The compositions of the present invention generally may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids, or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and the like.

Upon formulation, solutions are preferably administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations may easily be administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution generally is suitably buffered and the liquid diluent first rendered isotonic for example with sufficient saline or glucose. Such aqueous solutions may be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as is known to those of skill in the art, particularly in light of the present disclosure. By way of illustration, a single dose may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.

VIII. COMBINED THERAPY

In another embodiment, it is envisioned to use an miRNA or an miRNA inhibitor as set forth herein in combination with other therapeutic modalities. Thus, in addition to the therapies described above, one may also provide to the patient more "standard" pharmaceutical cardiac therapies. Examples of other therapies include, without limitation, other pharmaceutical therapies of asthma or other allergic lung disease. The other therapeutic modality may be administered before, concurrently with, or following administration of the miRNA The therapy using miRNA may precede or follow administration of the other agent(s) by intervals ranging from minutes to weeks. In embodiments where the other agent and the miRNA are administered separately, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that each agent would still be able to exert an advantageously combined effect. In such instances, it is contemplated that one would typically administer the miRNA and the other therapeutic agent within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other, with a delay time of only about 12 hours being most preferred. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

It also is conceivable that more than one administration of an miRNA, or the other agent will be desired. In this regard, various combinations may be employed. By way of illustration, where the miRNA is "A" and the other agent is "B", the following permutations based on 3 and 4 total administrations are exemplary:

A/B/A B/A/B B/B/A A/A/B B/A/A A/B/B B/B/B/A B/B/A/B

A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A

A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B Other combinations are likewise contemplated. Non-limiting examples of pharmacological agents that may be used in the present invention include any pharmacological agent known to be of benefit in the treatment of asthma. Examples include inhaled corticosteroids, long-activing beta-2 agonists (such as salmetrol and formoterol), leukotriene modifiers such as montelukast, zafirlukast, and zileuton, cromolyn and nedocromil, theophylline, short-acting beta-2 agonists such as albuterol, ipratropium, and oral and intravenous corticosteroids. Further examples include immunotherapy and anti-IgE monoclonal antibodies, such as omalizumab.

IX. BIOCHIPS

A biochip is also provided. The biochip may comprise a solid substrate comprising an attached nucleic acid sequence that is capable of hybridizing to an miRNA sequence described herein. "Probe" as used herein may mean an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. A probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind. The probes may be capable of hybridizing to a target sequence under stringent hybridization conditions. The probes may be attached at spatially defined address on the substrate. More than one probe per target sequence may be used, with either overlapping probes or probes to different sections of a particular target sequence. The probes may be capable of hybridizing to target sequences associated with a single disorder. The biochip may comprise microflucdics (see, e.g., Lange, 2010). The probes may be attached to the biochip in a wide variety of ways, as will be appreciated by those in the art. The probes may either be synthesized first, with subsequent attachment to the biochip, or may be directly synthesized on the biochip. The solid substrate may be a material that may be modified to contain discrete individual sites appropriate for the attachment or association of the probes and is amenable to at least one detection method. Representative examples of substrates include glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonJ, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses and plastics. The substrates may allow optical detection without appreciably fluorescing.

The substrate may be planar, although other configurations of substrates may be used as well. For example, probes may be placed on the inside surface of a tube, for flow- through sample analysis to minimize sample volume. Similarly, the substrate may be flexible, such as a flexible foam, including closed cell foams made of particular plastics.

The biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two. For example, the biochip may be derivatized with a chemical functional group including, but not limited to, amino groups, carboxyl groups, oxo groups or thiol groups. Using these functional groups, the probes may be attached using functional groups on the probes either directly or indirectly using a linkers. The probes may be attached to the solid support by either the 5' terminus, 3' terminus, or via an internal nucleotide. The probe may also be attached to the solid support non-covalently. For example, biotinylated oligonucleotides can be made, which may bind to surfaces covalently coated with streptavidin, resulting in attachment. Alternatively, probes may be synthesized on the surface using techniques such as photopolymerization and photolithography

X. EXAMPLES

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1

Materials and Methods

Human Study Subjects— Non-atopic current or former smokers were serially entered the study (Table 5); all smoker subjects had significant (>20 pack-year) history of smoking in control and COPD/emphysema groups, respectively. COPD was diagnosed according to the criteria recommended by the NIH/WHO workshop summary, and emphysema was diagnosed based on the radiographic findings on chest CT scan (GOLD Executive Committee, 2008). Smoking one pack of cigarettes per day each year is defined as "one pack-year". Subjects were recruited from the chest or surgical clinics at Methodist and Michael E. DeBakey Houston VAMC hospitals. The patients had no history of allergy or asthma, had not received oral or systemic corticosteroids and were free of acute symptoms suggestive of upper or lower respiratory tract infection during the last six weeks. Studies were approved by the Institutional Review Board at Baylor College of Medicine, and informed consents were obtained from all patients.

Table 5. Demographics of study participants.

Characteristics Controls Emphysema P value

No. 15 32

Age (mean±SD) 68.5±9 64.9±7.7

Male No. 11 31

Smoking Status, No.

Current smoker 3(20%) 15(46.9%)

Former smoker 12(80%) 17(53.1%)

Never smoker 0 0

PPY (meaniSD) 44.3±28.2 73.8±36.5 0.01

Quitting yrs. (mean±SD) 19.7±13.0 2.7±4.6 0.0003

Lung Function

%FEV1 (meaniSD) 83.0±9.6 73.2±12.2 0.0074 FEV1/FVC (meaniSD) 77.2±6.3 64.1±8.7 <0.0001

SD, standard deviation; No., number; FEV1, forced expiratory volume in 1 second; %FEV1, FEV1 % predicted; FVC, Forced Vital Capacity; PPY, pack per year; yrs., years.

Human Immune Cell Preparation and Isolation— Human lung single cell suspensions were prepared as described (Grumelli et ah, 2004). Briefly, fresh lung tissue was cut into 0.1 cm pieces in Petri dishes and treated with 2mg/ml of collagenase D (Roche Pharmaceuticals) for 30 minutes in 37°C 5% CO2 incubator. Single cells were extracted by pressing digested lung tissue through 40 μιη cell strainer (BD Falcon) followed by red blood cell lysis using ACK lysis buffer (Sigma) for 3 minutes. To isolate lung antigen presenting cells (APCs), RBC-free whole lung cell suspensions were labeled with bead-conjugated anti- CD la (Miltenyi Biotec) and autoMACS was used to separate dendritic cells. PBMCs were isolated by Histopaque (Sigma) gradient centrifugation followed by red blood cell lysis. T cells were then isolated from PBMCs using anti-CD4 beads by autoMACS.

RNA Isolation— Cell pellets were treated with TRIZOL (Invitrogen) and total RNAs were extracted with chloroform (Sigma), precipitated in isopropanol (Sigma), and washed in 70% alcohol (Sigma). Alternatively, lung tissue was homogenized with PT 10-35 polytron homogenizer (Kinematica, Switzerland) and the lung total RNAs were purified with mirVana miRNA isolation kit (Ambion, Austin, TX) as described (Polikepahad et ah, 2010). The concentration of mRNA was measured using NanoDrop 2000 (Thermo Scientific).

Preparation of Short RNA Transcripts for Illumina Sequencing— Short RNA transcripts of 60 nucleotides in length were gel-purified after running 10μg of total RNA extracted from human lung on 15% TBE-urea polyacrylamide gels. A synthetic 26-residue adapter RNA oligonucleotide (5'-GUU CAG AGU UCU ACA GUC CGA CGA UC-3' (SEQ ID NO: 14)) was ligated to the 5'-end of the small RNAs. The ligated small RNA was gel purified to remove unligated free adapter. A synthetic 22-residue 3 '-adapter with inverted dideoxythymidine (idT) added at the 3 '-end (5'-p UCG UAU GCC GUC UUC UGC UUG idT-3' (SEQ ID NO: 15)) was ligated to the 5 '-ligated small RNA and gel-purified. The resultant RNA library was reverse transcribed and amplified by PCR for 15 cycles using adapter-specific primers. The PCR products were sequenced using Illumina (Solexa)-based next generation sequencing. Ten short RNA transcript libraries were prepared from 10 human lung total RNAs as above for deep sequencing. Small RNA Mapping and Classification & Novel miRNA Discovery — After filtering for the Illumina small RNA adapter sequences, the reads were mapped to the reference human genome using the Pash software package as described previously (Kalafus et ah, 2004; Coarfa and Milosavljevic, 2008). All small RNA sequences that failed to align with a known miRNA, Piwi-interacting RNA (piRNA), or short nucleolar RNA were passed through our miRNA discovery platform, as described previously (Polikepahad et ah, 2010).

Microarray Analysis of Human Lung Gene Expression, miRNA Profiling and Inverse correlation— Microarray analyses were performed using human lung total RNA by the Genomics and Proteomics Core Laboratory, Texas Children's Hospital, Baylor College of Medicine. An Illumina Human WG-6 V3.0 chip (48,804 transcripts, Illumina) was used for gene expression. The Illumina Human v3 miRNA Expression BeadChip Array (858 miRNAs) was used for miRNA profiling. The gene array data were quantile normalized after which significantly regulated genes and miRNAs were identified by comparing control with emphysema groups using t-test (log-transformed data) and fold change (ratio of averages of the two groups). Java TreeView (Saldanha, 2004) represented expression patterns as color maps, where gene and miRNA values were centered on the median expression of the naive group. Microarray data will be made available on the Gene Expression Omnibus (GSE35892).

Quantitative PCR— Quantitative PCR of miRNAs and mRNAs were performed by using Taqman miRNA assay and Taqman one-step real time reverse transcription (RT) gene expression assays, respectively (Applied Biosystems, Foster City, CA). PCR data were analyzed by using the AACt method of relative quantification using the ABI Perkin Elmer Prism 7500 Sequence Detection System (Applied Biosystems). RNU48 and 18s was used as endogenous control for miRNA and gene expression, respectively. Alternatively, quantitative PCR of hsa-miR-452 were performed by miScript PCR system (Qiagen).

In Vitro Validation— HEK293T cells were used for co-transfection of plasmids expressing miRNAs, 3'-UTR of target genes, and anti-miRNA or control/scrambled LNAs. Briefly, HEK293T cells that were cultured in 24-well plates were co-transfected with plasmids expressing CD86 -UTR (350 ng) or scrambled target 3'-UTR (350 ng), hsa-let-7a (350, 117, and 39 ng), scrambled miRNA (350 ng), human anti-let-7a LNA (52.5, 17.5, and 5.8 pmol) or scrambled LNA (52.5 pmol). In some co-transfection experiments (293T cells), plasmids expressing IL17A 3'-UTR (120 ng), hsa-miR-1266 (120 and 40 ng), anti-hsa-miR- 1266 LNA, or scrambled LNA (60 and/or 300 pmol) were used. Human lung APCs, and T cells, were transfected with 60 pmol and/or 300 pmol of anti-let-7a LNA or scrambled LNA. Lipofectamine 2000 (Invitrogen) was used as a transfection reagent according to the manufacturer's protocol. Firefly and Renilla luciferase light units were measured after 24 hours of co-transfection by using the Dual Luciferase Reporter Assay System (Promega, Madison, WI) with the help of a FLOU star OPTIMA microplate reader (Bmg Labtech, Cary, NC). The HI promoter was used to express pre-miRNAs, and the SV40 promoter was used to express target 3 '-UTRs. Human lung dendritic cells were transfected using human dendritic cell Nucleofection kit (Lonza) according to manufacturer's instructions. Human T cells from PBMCs were transfected using human T cell Nucleofection kit (Lonza) according to manufacturer's instructions. Human lung antigen presenting cells (APCs) transfected with LNAs were incubated overnight, or they were co-cultured with allogeneic human CD4 T cells from PBMCs (1 : 10) for functional experiments.

In vitro T cell coculture, cytokine measurement— CD4⁺ T cells from PBMCs were cultured in vitro (in triplicate) in the presence or absence of autologous or allogeneic, positively selected lung APCs (10: 1 ratio; CDla⁺). CD4⁺ T cells were cultured for 3 days in the presence of an antibody against CD3 (1 mg/ml). Cells were stimulated with phorbol 12- myristate 13 -acetate (10 ng/ml; Sigma) and ionomycin (200 ng/ml) supplemented with monensin (10 ng/ml; Sigma) for 3 hours. Cells were stained for surface markers with Pacific Blue-CD3 (BD Biosciences) and fixed with 1% paraformaldehyde, permeabilized with 0.5% saponin, and stained with APC-IFN-γ (BD Biosciences) and phycoerythrin (PE)-IL-17A (eBioscience ) antibodies for analysis of ICC production by flow cytometry. Flowcytometry were performed with BD LSRII (BD biosciences), and data were analyzed with Flowjo (Treestar). Human specific antibodies: APC-CD19 (SJ25C1), APC-CD3 (SK7), Pacific Blue- CD 3 (UCHT1), APC-IFN (B27), APC-CDla (HI149), FITC-CDla (HI149) were purchased from BD Pharmingen. PE-IL17A (eBio64DEC17) was purchased from eBioscience.

Statistical Analysis— For all statistical analyses, analysis of variance with post hoc Tukey tests or t-tests were used. Statistical significance was calculated with p value <0.05. Correlation between gene expression and FEV1% based emphysema quantification was determined by linear regression. All statistical analyses were performed with Prism software (Prism). For microarray data, variance stabilizing transform and quantile normalization were used; linear models were used to identify differentially expressed transcripts. Nominal / values were adjusted to yield false discovery rates using the empirical Bayes method. Significantly regulated genes and miRNAs were identified by comparing emphysematous with normal lungs using Student's t test (log-transformed data) and fold change (ratio of averages of the two groups).

EXAMPLE 2

Transcriptome-Wide Search Reveals MicroRNAs Regulating T Helper Cell Type 1 and 17

Responses in Human Emphysema

In this example, a combination of genomic techniques including next generation sequencing (NGS), and microarrays together with advanced computational analyses and in vitro validation studies were used to explore the lung short RNAome in human emphysema and further to determine the functional significance of select miRNAs. It is shown that extensive editing of the most abundant miRNAs in the lung and report that miRNAs, hsa-let-

7a (let-7a) and hsa-mir-1266 (mir-1266) regulate Thl and Thl7 adaptive immune responses in human emphysema, and these miRNA may be used as therapeutic targets to treat disease.

The human whole lung short RNAome contains diverse RNA species and novel miRNAs.

The inventor explored the human lung short RNAome (<60 nucleotide RNA fraction) from smokers with and without emphysema using next generation sequencing (NGS) technology (Illumina). The length distributions of short RNAs from the two cohorts showed similar enrichment for 23- and 25-nt RNAs, a size range that includes miRNAs (FIG. 9A). Indeed, although the most abundant short RNA species from whole lung were long interspersed elements (LINEs), which are derived from a type of DNA element containing highly repetitive sequences, miRNAs were also abundant, accounting for approximately a quarter of all short lung transcripts (FIG. 9B). Numerous additional RNA species were found from both control and emphysematous lung although, unlike miRNAs, the lack of fully curated databases precludes definitive assignment of such transcripts to discrete transcript classes (FIG. 9B). The fraction of all short transcripts representing fragments of obviously larger RNAs, including mRNAs of known genes, was relatively small, indicating overall excellent RNA quality. These findings were similar regardless of disease phenotype and are strongly reminiscent of findings from mouse lung using a similar analytical approach (Polikepahad et al, 2010). Thus, the lung short transcriptome contains diverse RNA species, the precise composition of which is under tight regulation.

Further analysis of lung miRNAs revealed that an average of -30% of the 858 known human miRNAs were present in significant abundance (> 10 copies each; Mirbase 14.0). NGS identified 244 distinct miRNAs in emphysematous and 247 miRNAs in non- emphysematous human lungs (FIG. 9C). Of these, let-7 family miRNAs were by far the dominant species, comprising >70% of total lung miRNA transcripts. Of the 10 known let-7 miRNAs, let- 7b, let-7a and let-7f were most abundant in lungs with and without emphysema. Using our previously described miRNA discovery platform (Gu et al, 2008), 13 putative novel miRNAs from emphysematous and control lungs (Table 1) were further identified. Exploration of the potential target repertoire of these miRNAs using TargetScan 5.2 revealed multiple gene targets of potential interest to emphysema pathogenesis.

Human lung miRNAs are extensively edited

The observation that let-7 miRNAs dominate the human lung miRNAome is consistent with our prior studies in mice that showed that let-7 family members are the most extensively edited of all miRNA species, leading to potential alterations in both the diversity of the target repertoire and the robustness of target suppression (Polikepahad et al, 2010). To determine if human lung miRNAs are edited, mature miRNA sequences against the human pre-miRNA database (miRBase 14) were mapped, allowing for 1-4 mismatches in the aligned reads. Comparison of nucleotide modifications between emphysematous and control lungs revealed similar patterns of miRNA editing, primarily involving the 6^th and 13^th positions (FIG. 1A). As expected based on our prior experience with human pancreas and ovary and mouse lung (Polikepahad et al, 2010; Reid et al, 2008), let-7 miRNAs were the most extensively edited of all miRNAs, although the inventor found significant editing also involving hsa-mir- 103-2, -320a and -29a (FIG. IB, FIG. 1C, Table 6). Although diverse edits were found to occur at the same nucleotide position (e.g., U— >G; U— >C) one or at most two edits tended to be dominant (FIG. ID), with distinct dominant editing patterns found at different nucleotide positions. Using the TargetScan 5.2 algorithm, the effect of miRNA editing was invariably found to restrict the target repertoire. Thus, as in other tissues in which let-7 miRNAs are abundant, post-transcriptional editing of these as well as other miRNAs occurs, leading to marked alterations in the target repertoire (FIG. 10 and Table 6). Table 6. Human lung miRNA editing at position 6 reduces the target repertoire

Conserved

Conserved

targets Control Emphysema

Edits targets

(native (%±SD) (%±SD)

. . (edited

miRNA) .

' miRNA) hsa-niir-103-2 C-»U 471 164 1.12±0.50 2.37±0.94 hsa-miR-29a C-»U 851 196 1.64±0.88 1.48±0.69 hsa-miR-320a C-»U 539 318 1.15±0.63 1.87±0.78 819 215 hsa-let-7a-l !'->C 406 38.39±1.68 34.93±2.00 U^A 360 miRNA-mRNA inverse correlations suggest functional interactions relevant to emphysema Although useful for identifying both known and novel miRNAs and other classes of short transcripts, NGS lacks sensitivity for detecting and quantitating all extant, especially low-abundance, transcripts (Polikepahad et ah, 2010). Because of this critical limitation, miRNA microarray analyses were next performed using total RNA from human lungs without (control) and with emphysema and validated findings for selected miRNAs by quantitative real time PCR (qRT-PCR). 20 miRNAs that were differentially expressed with nominal significance of O.01 between emphysema and controls (FIG. 2A) were identified. Many of these miRNAs manifested minimal fold changes, potentially due in part to microarray data compression or heterogeneity of the tissue samples and only 1 miRNA, hsa- miR-452, was found to be down-regulated in emphysema. Using a relaxed -value cutoff of p < 0.05, and a fold-change criterion of >1.5, the inventor found 12 differentially expressed miRNAs, all of which were increased in expression in emphysema; relatively few miRNAs met both standards for significance (FIG. 2B). Expression trends for selected miRNAs were confirmed using qRT-PCR (FIG. 2C).

The inventors next performed gene microarray analyses using the same total lung RNA samples from which the miRNA analyses were performed. 2443 transcripts were differentially expressed in emphysema in comparison with controls (p<0.01; select results shown in Table 7). In contrast, using criteria οΐρ<0Λ and fold change >1.5, the inventors found 214 differentially expressed genes (Table 8). Among these, 102 genes were up- regulated and 1 12 were down-regulated in emphysema relative to controls (FIG. 3 A) with expression validated using qRT-PCR for a selected number of genes that have previous been implicated in emphysema by our group and others (Shan et al, 2012; Alcorn et al, 2010; Shen et al, 201 1) (FIG. 3B). These findings further confirm the active role of many target genes in the adaptive immune system that is preferentially activated in human emphysema.

Table 7. Gene expression changes in control versus emphysema lungs. Fold changes are shown for genes that are significantly differentially express between control and emphysema lungs.

ProbelD Entrez Hyperii TargetID logFC FC Ave Ex t P.Value adj.P.V

Gene nk pr al ID

4220347 55227 55227 LRRC1 -0.7733 0.5851 7.9819 - 1.16E- 0.0229

10.178 06

2510520 27 27 ABL2 0.7380 1.6678 6.3943 9.8659 1 .55E- 0.0229

06

6770504 HS.513000 -0.4448 0.7347 8.3613 -9.7200 1 .78E- 0.0229

06

730164 30061 30061 SLC40A1 -1 .2840 0.4107 10.269 -9.51 18 2.17E- 0.0229

3 06

5720441 5915 5915 RARB -0.6160 0.6525 6.5079 -9.4348 2.34E- 0.0229

06

3290224 359948 359948 IRF2BP2 -0.6510 0.6368 8.0915 -8.7712 4.57E- 0.0362

06

2030228 9474 9474 ATG5 -0.3810 0.7679 7.6072 -8.3064 7.48E- 0.0362

06

5570037 51208 51208 CLDN18 -0.8390 0.5590 12.635 -8.2874 7.63E- 0.0362

6 06

3890475 55839 55839 CENPN 0.3526 1 .2768 6.6517 8.1 101 9.27E- 0.0362

06

780762 1453 1453 CSNK1 D 0.7686 1 .7037 9.1 1 12 8.1003 9.37E- 0.0362

06

4880201 85004 85004 RERG -0.6303 0.6461 7.9837 -8.0814 9.56E- 0.0362

06

4010064 8974 8974 P4HA2 -0.5721 0.6726 9.0574 -8.0490 9.91 E- 0.0362

06

3710075 84561 84561 SLC12A8 0.2709 1 .2066 6.6824 7.9636 1 9Ε- 0.0362

05

7000193 HS.370359 -0.5866 0.6659 10.364 -7.9527 1.10E- 0.0362

5 05

730673 55251 55251 PCMTD2 -0.7239 0.6054 8.2929 -7.9462 1.1 1 E- 0.0362

05

7510377 9242 9242 MSC 1 .5821 2.9941 7.1291 7.7983 1.31 E- 0.0401

05

1230280 29104 29104 N6AMT1 -0.4156 0.7497 6.8357 -7.6409 1 .57E- 0.0424

05 10725 9528 9528 TMEM59 -0.4336 0.7404 1 1 .629 -7.6252 1.60E- 0.0424

8 05

7210196 10160 10160 FARP1 -0.5478 0.6841 9.7545 -7.5342 1.78E- 0.0424

05

730358 56967 56967 C140RF132 -1 .1240 0.4588 9.1470 -7.5063 1 .84E- 0.0424

05

3930504 HS.561603 -0.3834 0.7666 6.4676 -7.4798 1 .90E- 0.0424

05

5490524 55900 55900 ZNF302 -0.6013 0.6592 8.8551 -7.3573 2.19E- 0.0424

05

2940452 HS.213541 -0.4220 0.7464 8.5884 -7.3501 2.21 E- 0.0424

05

4050156 2064 2064 ERBB2 -0.6230 0.6493 9.6593 -7.3072 2.32E- 0.0424

05

4150477 84171 84171 LOXL4 -0.5086 0.7029 7.5760 -7.2956 2.36E- 0.0424

05

5490601 30061 30061 SLC40A1 -0.7136 0.6098 6.7935 -7.2946 2.36E- 0.0424

05

4210215 9037 9037 SEMA5A -0.6432 0.6403 7.8403 -7.2854 2.38E- 0.0424

05

7650343 55031 55031 USP47 -0.5207 0.6970 6.9100 -7.2690 2.43E- 0.0424

05

6220403 5062 5062 PAK2 0.3870 1 .3076 7.5443 7.1323 2.87E- 0.0482

05

4780187 HS.19339 -0.6346 0.6441 7.7023 -7.1054 2.96E- 0.0482

05

2030577 7078 7078 TIMP3 -0.9169 0.5297 10.968 -7.0589 3.13E- 0.0493

7 05

270408 8974 8974 P4HA2 -0.401 1 0.7573 8.5381 -7.0226 3.27E- 0.0499

05

Table 8. 214 genes with p value < 0.1 and fold chang

ProbelD Entrez Hyperli TargetID logFC FC Ave Ex P.Value adj. P.

Gene nk pr Val ID

4220347 55227 55227 LRRC1 -0.7733 0.585 7.9819 1.16E- 0.023

1 10.178 06

6

2510520 27 27 ABL2 0.7380 1 .667 6.3943 9.8659 1 .55E- 0.023

8 06

730164 30061 30061 SLC40A1 -1 .2840 0.410 10.269 -9.51 18 2.17E- 0.023

7 3 06

5720441 5915 5915 RARB -0.6160 0.652 6.5079 -9.4348 2.34E- 0.023

5 06

3290224 35994 359948 IRF2BP2 -0.6510 0.636 8.0915 -8.7712 4.57E- 0.036

8 8 06

5570037 51208 51208 CLDN18 -0.8390 0.559 12.635 -8.2874 7.63E- 0.036

0 6 06

780762 1453 1453 CSNK1 D 0.7686 1 .703 9.11 12 8.1003 9.37E- 0.036

7 06

4880201 85004 85004 RERG -0.6303 0.646 7.9837 -8.0814 9.56E- 0.036

1 06

7000193 HS.370359 -0.5866 0.665 10.364 -7.9527 1 .10E- 0.036

9 5 05

730673 55251 55251 PCMTD2 -0.7239 0.605 8.2929 -7.9462 1 .1 1 E- 0.036

4 05

7510377 9242 9242 MSC 1.5821 2.994 7.1291 7.7983 1 .31 E- 0.040

1 05 730358 56967 56967 C140RF132 -1 .1240 0.458 9.1470 -7.5063 1 .84E- 0.042

8 05 5490524 55900 55900 ZNF302 -0.6013 0.659 8.8551 -7.3573 2.19E- 0.042

2 05 4050156 2064 2064 ERBB2 -0.6230 0.649 9.6593 -7.3072 2.32E- 0.042

3 05 5490601 30061 30061 SLC40A1 -0.7136 0.609 6.7935 -7.2946 2.36E- 0.042

8 05 4210215 9037 9037 SEMA5A -0.6432 0.640 7.8403 -7.2854 2.38E- 0.042

3 05 4780187 HS.19339 -0.6346 0.644 7.7023 -7.1054 2.96E- 0.048

1 05 2030577 7078 7078 TIMP3 -0.9169 0.529 10.968 -7.0589 3.13E- 0.049

7 7 05 6960332 8061 8061 FOSL1 1.8352 3.568 7.1188 6.9563 3.55E- 0.052

2 05 6400390 HS.7572 -0.7914 0.577 6.9854 -6.9043 3.79E- 0.052

8 05 5670424 2769 2769 GNA15 0.9831 1 .976 8.6624 6.8598 4.00E- 0.052

7 05 3840376 84913 84913 ATOH8 -0.9325 0.524 7.2490 -6.7573 4.55E- 0.052

0 05 1240333 HS.130036 -0.6266 0.647 7.9281 -6.7567 4.55E- 0.052

7 05 5860521 7779 7779 SLC30A1 0.7414 1 .671 6.9370 6.7365 4.67E- 0.052

8 05 3420075 13988 139886 SPIN4 -0.8840 0.541 7.281 1 -6.7123 4.81 E- 0.052

6 9 05 4670414 55281 55281 TMEM140 -0.7758 0.584 8.9079 -6.7099 4.83E- 0.052

1 05 3170017 5606 5606 MAP2K3 1.0892 2.127 8.3049 6.7089 4.83E- 0.052

6 05 4730133 38775 387758 FIBIN -0.8643 0.549 6.5163 -6.6406 5.27E- 0.052

8 3 05 4560592 9353 9353 SLIT2 -0.9887 0.503 10.539 -6.5677 5.78E- 0.054

9 5 05 4610672 79899 79899 FLJ14213 -0.7478 0.595 7.6688 -6.5003 6.31 E- 0.055

5 05 7210192 100 100 ADA 0.8150 1 .759 7.5985 6.4930 6.37E- 0.055

3 05 3460687 23223 23223 RRP12 1.0334 2.046 7.7930 6.4804 6.47E- 0.055

8 05 5390372 49375 493753 C20RF64 -0.6715 0.627 7.8365 -6.4764 6.50E- 0.055

3 8 05 5090500 4254 4254 KITLG -0.6365 0.643 7.9025 -6.3849 7.32E- 0.055

3 05 5260630 9021 9021 S0CS3 1.2186 2.327 6.9897 6.3512 7.65E- 0.055

2 05 5670440 3604 3604 TNFRSF9 0.8548 1 .808 6.7510 6.3389 7.78E- 0.055

5 05 1260576 84886 84886 C10RF198 -0.691 1 0.619 9.3276 -6.3287 7.88E- 0.055

4 05 6560403 9589 9589 WTAP 0.8659 1 .822 7.9470 6.3096 8.08E- 0.055

4 05 4120538 73131 731314 LOC731314 0.6619 1 .582 7.8378 6.2930 8.26E- 0.055

4 2 05 6660131 27075 27075 TSPAN13 -0.6395 0.641 10.260 -6.2827 8.37E- 0.055

9 2 05 2680561 9683 9683 N4BP1 -0.7322 0.602 8.4602 -6.2633 8.59E- 0.055

0 05 269041 1 55638 55638 GOLSYN -0.7762 0.583 7.3600 -6.2495 8.75E- 0.055

9 05 6100446 HS.105791 -0.9945 0.501 8.0166 -6.2156 9.15E- 0.055

9 05 6650280 1 1490 1 14905 C1 QTNF7 -0.5877 0.665 6.9592 -6.2086 9.23E- 0.055

5 4 05

780133 15250 152503 SH3D19 -0.7667 0.587 9.0002 -6.1845 9.53E- 0.055

3 8 05 1940343 24145 24145 PANX1 1.0451 2.063 6.9448 6.1506 9.97E- 0.055

5 05 6560072 HS.184721 1.0459 2.064 8.6542 6.1494 9.99E- 0.055

6 05 3610630 51 185 51 185 CRBN -0.6158 0.652 8.9789 -6.1445 1 .01 E- 0.055

6 04

940725 4772 4772 NFATC1 1.0677 2.096 7.2471 6.1427 1 .01 E- 0.055

1 04 4290603 2327 2327 FM02 -1.0550 0.481 10.271 -6.1277 1 3Ε- 0.055

3 8 04 7380202 7026 7026 NR2F2 -0.8448 0.556 8.4219 -6.1234 1 3Ε- 0.055

8 04 6560465 14737 147372 CCBE1 -0.6181 0.651 7.0321 -6.0628 1 .12E- 0.057

2 5 04 7560593 5008 5008 OSM 1.7383 3.336 7.7106 6.0588 1 .13E- 0.057

4 04 2810246 81606 81606 LBH -1 .2688 0.415 9.8031 -6.0490 1 .14E- 0.057

0 04 7570673 7378 7378 UPP1 1.1614 2.236 10.092 6.0463 1 .15E- 0.057

7 2 04 1770754 22998 22998 LIMCH1 -0.8592 0.551 1 1.185 -6.0255 1 .18E- 0.058

3 1 04 4010433 65083 650832 LOC650832 1.2045 2.304 9.2807 5.9941 1 .23E- 0.058

2 6 04 7560543 4337 4337 MOCS1 -0.7379 0.599 8.5656 -5.9562 1 .30E- 0.058

6 04 3850451 14366 143662 MUC15 -0.6286 0.646 6.5035 -5.9314 1 .34E- 0.058

2 8 04 264041 1 25777 25777 UNC84B -0.6269 0.647 1 1.345 -5.9286 1 .35E- 0.058

6 3 04 4480288 64782 64782 ISG20L1 1.1217 2.176 8.0308 5.9168 1 .37E- 0.058

1 04 3990731 5771 5771 PTPN2 0.5959 1 .51 1 7.6889 5.8997 1 .40E- 0.058

5 04 5490102 57050 57050 UTP3 0.6848 1 .607 7.7442 5.8867 1 .42E- 0.058

4 04 6840075 4860 4860 NP 2.0932 4.266 9.5256 5.8783 1 .44E- 0.058

9 04 3370347 124 124 ADH1A -1 .1644 0.446 1 1.177 -5.8556 1 .49E- 0.058

1 0 04 5810458 79822 79822 ARHGAP28 -0.7238 0.605 6.6959 -5.8493 1 .50E- 0.058

5 04 6840356 10724 10724 MGEA5 -0.7362 0.600 9.9859 -5.8455 1 .51 E- 0.058

3 04 6250397 28538 285381 DPH3 0.6291 1 .546 7.5091 5.8195 1 .56E- 0.058

1 6 04 1770170 10217 10217 CTDSPL -0.7447 0.596 9.7077 -5.8162 1 .57E- 0.058

8 04 7000142 9665 9665 KIAA0430 -0.7749 0.584 10.033 -5.7853 1 .64E- 0.060

4 4 04 5290397 23529 23529 CLCF1 1 .1293 2.187 7.2517 5.7742 1 .66E- 0.060

6 04 7100121 3176 3176 HNMT -0.7002 0.615 7.7242 -5.7664 1 .68E- 0.060

5 04 3390575 9037 9037 SEMA5A -0.5914 0.663 6.9917 -5.7546 1 .71 E- 0.060

7 04 360475 5329 5329 PLAUR 1.0131 2.018 7.3131 5.7413 1 .74E- 0.061

2 04 6100630 84939 84939 MUM1 -0.6256 0.648 8.6575 -5.7160 1 .80E- 0.062

2 04 3190609 22904 22904 SBN02 1 .1136 2.163 7.3468 5.7097 1 .82E- 0.062

9 04 1030333 6347 6347 CCL2 2.6270 6.177 12.604 5.7023 1 .84E- 0.062

5 9 04 3990132 6751 6751 SSTR1 -0.8920 0.538 6.5653 -5.6951 1 .86E- 0.062

9 04 1470626 976 976 CD97 0.6310 1 .548 8.1139 5.6792 1 .90E- 0.062

6 04 6370739 23499 23499 MACF1 -0.6744 0.626 10.602 -5.6729 1 .92E- 0.062

6 4 04 2070646 53831 53831 GPR84 0.7415 1 .671 6.3724 5.6265 2.04E- 0.063

9 04 1030102 6004 6004 RGS16 1.3264 2.507 8.0671 5.5906 2.15E- 0.064

7 04 7040142 8942 8942 KYNU 0.6366 1 .554 7.7369 5.5752 2.20E- 0.064

7 04 2750598 15756 157567 ANKRD46 -0.6098 0.655 8.1950 -5.5745 2.20E- 0.064

7 3 04 3990670 4254 4254 KITLG -0.9319 0.524 7.7947 -5.5738 2.20E- 0.064

2 04 2970040 8706 8706 B3GALNT1 -0.8255 0.564 7.8285 -5.5648 2.23E- 0.064

3 04 7150551 4327 4327 MMP19 0.9277 1 .902 6.5438 5.5219 2.37E- 0.065

3 04 1240553 27244 27244 SESN1 -0.6982 0.616 8.2365 -5.5036 2.43E- 0.065

4 04 430079 3977 3977 LIFR -0.7386 0.599 7.1272 -5.5019 2.44E- 0.065

3 04 770746 2119 21 19 ETV5 -1 .0491 0.483 9.7016 -5.491 1 2.48E- 0.065

3 04 4010184 83648 83648 C80RF13 -0.8493 0.555 7.6392 -5.4788 2.52E- 0.065

0 04 2260220 1 1041 11041 B3GNT6 -0.7036 0.614 7.3852 -5.4707 2.55E- 0.065

0 04 2970356 221 221 ALDH3B1 -0.7362 0.600 8.7549 -5.4677 2.56E- 0.065

3 04 1740156 14962 149620 LOC149620 -1.8793 0.271 7.8089 -5.4639 2.57E- 0.065

0 8 04 3290008 2081 2081 ERN1 0.9530 1 .935 8.1513 5.4569 2.60E- 0.066

9 04 6380484 5265 5265 SERPINA1 0.8343 1 .783 1 1.259 5.4239 2.73E- 0.068

0 0 04 2140242 7130 7130 TNFAIP6 2.4528 5.474 8.7916 5.4187 2.75E- 0.068

9 04 4200367 38911 3891 19 C30RF54 -1 .1499 0.450 7.1588 -5.4144 2.76E- 0.068

9 7 04 6620689 10797 10797 MTHFD2 1.3916 2.623 8.7789 5.4060 2.80E- 0.068

7 04 1050414 57817 57817 HAMP 0.6567 1 .576 6.2350 5.3739 2.93E- 0.069

5 04 1580475 4008 4008 LM07 -0.7634 0.589 8.2087 -5.3536 3.02E- 0.070

1 04 7100338 79148 79148 MMP28 -0.6548 0.635 8.1793 -5.3492 3.03E- 0.070

2 04 2630768 4000 4000 LMNA 1.2872 2.440 10.159 5.3158 3.18E- 0.070

5 3 04 3780717 14080 140809 SRXN1 0.9607 1 .946 7.6593 5.3096 3.21 E- 0.070

9 2 04 6510279 28538 285381 DPH3 0.6541 1 .573 7.7459 5.3087 3.22E- 0.070

1 6 04 1980403 55893 55893 ZNF395 -0.6613 0.632 8.7689 -5.3018 3.25E- 0.070

3 04 1430138 23764 23764 MAFF 0.9172 1 .888 7.8506 5.3017 3.25E- 0.070

5 04 1570273 23327 23327 NEDD4L -0.6458 0.639 8.9967 -5.2914 3.30E- 0.070

1 04 3460685 8942 8942 KYNU 0.8339 1 .782 8.6741 5.2892 3.31 E- 0.070

4 04 3710035 23037 23037 PDZD2 -0.8082 0.571 7.9420 -5.2853 3.33E- 0.070

1 04 5290475 1026 1026 CDKN1A 1.1472 2.214 6.7003 5.2736 3.39E- 0.071

9 04 2510360 51208 51208 CLDN18 -0.6260 0.648 9.6109 -5.2717 3.40E- 0.071

0 04 1690240 10826 10826 C50RF4 -0.9750 0.508 8.3041 -5.2630 3.44E- 0.071

7 04 2140121 10409 10409 BASP1 1.1425 2.207 10.073 5.2602 3.45E- 0.071

7 1 04 1170300 4495 4495 MT1 G 2.8448 7.184 8.4815 5.2542 3.48E- 0.071

3 04 1510193 9589 9589 WTAP 0.5878 1 .502 8.0224 5.2468 3.52E- 0.071

9 04 4070719 84419 84419 C150RF48 0.9978 1 .997 6.5608 5.2459 3.53E- 0.071

0 04 3120400 25959 25959 KANK2 -0.6546 0.635 8.4610 -5.2396 3.56E- 0.071

2 04 4230102 9021 9021 S0CS3 1.8254 3.544 9.1242 5.2316 3.60E- 0.072

1 04 5910594 1 1 156 11 156 PTP4A3 0.9955 1 .993 7.7501 5.2298 3.61 E- 0.072

8 04 3370129 65997 65997 RASL11 B -0.7482 0.595 6.6725 -5.2241 3.64E- 0.072

3 04 730373 6943 6943 TCF21 -0.8466 0.556 7.2684 -5.2164 3.68E- 0.072

1 04 610750 4170 4170 MCL1 0.8231 1 .769 9.8447 5.1959 3.79E- 0.072

2 04 2190452 41511 4151 16 PIM3 0.7301 1 .658 8.3123 5.1848 3.86E- 0.072

6 7 04 380026 79098 79098 C10RF1 16 -1 .2586 0.418 9.7619 -5.1586 4.01 E- 0.074

0 04 730372 4327 4327 MMP19 1 .0449 2.063 6.7667 5.1090 4.31 E- 0.076

3 04 1690170 64857 64857 PLEKHG2 0.8538 1 .807 6.8748 5.0783 4.51 E- 0.077

2 04 3800465 40045 400451 LOC400451 -0.7353 0.600 8.5523 -5.0478 4.72E- 0.077

1 7 04 6620437 3202 3202 H0XA5 -1 .3182 0.401 9.7835 -5.0401 4.77E- 0.078

0 04 1780280 3037 3037 HAS2 1.2128 2.317 7.0290 5.0316 4.84E- 0.078

9 04 6020424 4000 4000 LMNA 1.1450 2.21 1 10.171 5.0306 4.84E- 0.078

4 1 04 7210497 9891 9891 NUAK1 -0.8900 0.539 8.2338 -5.0168 4.94E- 0.078

6 04

620682 51312 51312 SLC25A37 1.0958 2.137 8.4735 5.0146 4.96E- 0.078

3 04 2230538 54674 54674 LRRN3 -1.1078 0.464 7.9846 -4.9989 5.08E- 0.079

0 04 2370041 54674 54674 LRRN3 -0.8967 0.537 6.9174 -4.9986 5.08E- 0.079

1 04 1660470 2295 2295 FOXF2 -0.7197 0.607 7.3431 -4.9942 5.1 1 E- 0.079

2 04 5900725 22822 22822 PHLDA1 1.6261 3.086 9.7737 4.9885 5.16E- 0.080

8 04 1820743 HS.434957 -0.7804 0.582 7.9708 -4.9772 5.25E- 0.080

2 04 6580593 5507 5507 PPP1 R3C -1 .3348 0.396 8.8336 -4.9761 5.25E- 0.080

5 04

730440 5971 5971 RELB 1 .0276 2.038 7.7427 4.9744 5.27E- 0.080

7 04 6480491 57669 57669 EPB41 L5 -0.8185 0.567 7.9909 -4.9657 5.34E- 0.081

0 04 1010687 HS.564109 -0.6719 0.627 7.4513 -4.9462 5.49E- 0.082

7 04

940242 7080 7080 NKX2-1 -0.9893 0.503 8.6825 -4.9436 5.52E- 0.082

7 04 3780315 1036 1036 CD01 -0.6320 0.645 7.3263 -4.9430 5.52E- 0.082

3 04

160121 23224 23224 SYNE2 -0.7461 0.596 7.6845 -4.9352 5.59E- 0.082

2 04 6620008 3730 3730 KAL1 -0.8859 0.541 9.0293 -4.9309 5.62E- 0.082

2 04 2450504 79836 79836 L0NRF3 0.6718 1 .593 7.0580 4.9250 5.67E- 0.082

1 04 2360672 55504 55504 TNFRSF19 -0.7809 0.582 9.3402 -4.9188 5.73E- 0.082

0 04 3800041 55758 55758 RC0R3 -0.7784 0.583 8.2039 -4.9164 5.75E- 0.082

0 04 5490546 7779 7779 SLC30A1 0.6053 1 .521 7.2902 4.9093 5.81 E- 0.083

3 04 10008 473 473 RERE -0.5994 0.660 9.2218 -4.9023 5.87E- 0.083

0 04 6330725 602 602 BCL3 1.2048 2.305 9.0587 4.9014 5.88E- 0.083

0 04 5390064 23294 23294 ANKS1A -0.7538 0.593 9.4475 -4.8955 5.93E- 0.083

1 04 1510181 9536 9536 PTGES 0.8703 1 .828 6.7355 4.8877 6.00E- 0.083

0 04 6280630 79098 79098 C10RF1 16 -0.81 17 0.569 7.6839 -4.8853 6.02E- 0.083

7 04 3060377 4239 4239 MFAP4 -0.5872 0.665 12.195 -4.8599 6.26E- 0.084

6 8 04 6510204 10559 10559 SLC35A1 -0.5977 0.660 9.5672 -4.8509 6.34E- 0.084

8 04 2470161 79156 79156 PLEKHF1 -0.7391 0.599 7.9060 -4.8488 6.37E- 0.084

1 04 3890326 6648 6648 S0D2 1.9377 3.831 10.024 4.8481 6.37E- 0.084

1 0 04 5860630 51554 51554 CCRL1 -0.6160 0.652 6.8766 -4.8367 6.48E- 0.084

5 04 1300706 10797 10797 MTHFD2 1.3216 2.499 7.9357 4.8275 6.57E- 0.084

4 04 540377 6374 6374 CXCL5 1.7335 3.325 7.4783 4.8250 6.60E- 0.084

3 04 4920528 65311 6531 10 LOC6531 10 -0.7238 0.605 7.2230 -4.7975 6.88E- 0.086

0 5 04 6940053 22854 22854 NTNG1 -0.6258 0.648 7.2610 -4.7885 6.98E- 0.086

1 04 3890673 4926 4926 NUMA1 -0.5948 0.662 8.2406 -4.7829 7.04E- 0.086

1 04 1990288 27 27 ABL2 0.5884 1 .503 6.3801 4.7822 7.04E- 0.086

5 04 6660162 1 1684 1 16844 LRG1 0.9133 1 .883 7.6094 4.7694 7.18E- 0.086

4 4 04 4390273 8045 8045 RASSF7 -0.7691 0.586 9.3704 -4.7606 7.28E- 0.086

8 04 4040576 3569 3569 IL6 3.5162 ##### 10.896 4.7546 7.35E- 0.086

# 3 04 130128 28501 285016 LOC285016 1.7864 3.449 9.5087 4.7497 7.40E- 0.086

6 4 04 650445 1510 1510 CTSE 0.9258 1 .899 7.8541 4.7482 7.42E- 0.086

8 04 110181 57214 57214 KIAA1199 0.9440 1 .923 7.8650 4.7447 7.46E- 0.086

9 04 1570092 84617 84617 TUBB6 0.7508 1 .682 8.9394 4.7415 7.50E- 0.086

7 04 3290639 33838 338382 RAB7B 0.7405 1 .670 7.6962 4.7360 7.56E- 0.086

2 8 04 3420241 14419 144195 SLC2A14 1.2823 2.432 7.5958 4.7334 7.59E- 0.086

5 2 04 6330204 80271 80271 ITPKC 1.0916 2.131 7.1483 4.7292 7.64E- 0.086

1 04 1010035 1 1454 1 14548 NLRP3 0.9183 1 .889 7.2460 4.7279 7.65E- 0.086

8 9 04 3520424 16072 160728 SLC5A8 0.8767 1 .836 7.0692 4.7091 7.88E- 0.086

8 2 04 2750176 361 361 AQP4 -0.6932 0.618 9.7976 -4.7068 7.91 E- 0.086

5 04 1770376 5271 5271 SERPINB8 0.9255 1 .899 7.5006 4.7018 7.97E- 0.086

4 04 6590224 7466 7466 WFS1 -0.8389 0.559 10.487 -4.6822 8.21 E- 0.087

1 2 04 3890008 CYCSL1 0.8055 1 .747 8.6278 4.6818 8.21 E- 0.087

8 04 60092 80324 80324 PUS1 0.9415 1 .920 8.9862 4.6790 8.25E- 0.087

5 04 2940746 4837 4837 NNMT 1 .1919 2.284 9.7274 4.6776 8.27E- 0.087

5 04 840204 3037 3037 HAS2 1.5999 3.031 7.5434 4.6393 8.77E- 0.088

3 04 130093 4496 4496 MT1 H 1.7660 3.401 7.0341 4.6221 9.01 E- 0.090

0 04 3130576 26511 2651 1 CHIC2 0.8408 1 .791 9.0736 4.6093 9.19E- 0.091

0 04 3450725 51449 51449 PCY0X1 -0.7905 0.578 9.4744 -4.5874 9.51 E- 0.093

2 04 1850170 13593 135932 TMEM139 -0.7530 0.593 6.5076 -4.5802 9.61 E- 0.093

2 4 04 5050470 2690 2690 GHR -0.6373 0.642 7.6432 -4.5747 9.70E- 0.093

9 04 650241 51278 51278 IER5 0.7475 1 .678 8.5423 4.5694 9.78E- 0.093

9 04 3130400 23160 23160 WDR43 0.8067 1 .749 7.2959 4.5644 9.85E- 0.093

2 04

2370450 444 444 ASPH 0.7136 1 .639 7.4852 4.5631 9.87E- 0.093

9 04

7100382 80176 80176 SPSB1 1.5857 3.001 8.0998 4.5581 9.95E- 0.094

5 04

33601 13 MEG3 0.8302 1 .777 7.9817 4.5453 1 .01 E- 0.094

9 03

2120053 1545 1545 CYP1 B1 0.9147 1 .885 8.5146 4.5451 1 2Ε- 0.094

2 03

3130220 25907 25907 TMEM158 1.6066 3.045 7.6663 4.5443 1 2Ε- 0.094

3 03

3830519 8195 8195 MKKS -0.6394 0.642 8.4258 -4.5425 1 2Ε- 0.094

0 03

3440524 1 1 156 11 156 PTP4A3 0.9484 1 .929 7.5258 4.5390 1 2Ε- 0.095

7 03

2600682 94120 94120 SYTL3 0.7248 1 .652 7.5482 4.5308 1 4Ε- 0.095

7 03

3840554 9806 9806 SPOCK2 -0.8626 0.550 1 1.548 -4.5250 1 5Ε- 0.095

0 8 03

7160706 83595 83595 SOX7 1.0005 2.000 7.9955 4.5242 1 5Ε- 0.095

7 03

110719 9123 9123 SLC16A3 0.8599 1 .814 9.7360 4.5222 1 5Ε- 0.095

9 03

627041 1 2619 2619 GAS1 -0.8004 0.574 6.8780 -4.5171 1 6Ε- 0.095

2 03

1010161 10124 10124 ARL4A 0.5925 1 .507 7.2600 4.51 14 1 7Ε- 0.095

8 03

2510196 1440 1440 CSF3 2.2035 4.606 7.4388 4.5064 1 8Ε- 0.096

0 03

4560747 21979 219790 RTKN2 -1 .0882 0.470 7.1291 -4.5031 1 8Ε- 0.096

0 4 03

5390494 1975 1975 EIF4B -0.5846 0.666 10.609 -4.4951 1 .10E- 0.096

8 3 03

450626 38913 389136 VGLL3 -0.7358 0.600 7.7995 -4.4775 1 .13E- 0.097

6 5 03

4120561 3985 3985 LIMK2 0.6709 1 .592 6.7812 4.4643 1 .15E- 0.098

1 03

5910546 1 1259 1 12597 MGC4677 0.7456 1 .676 6.5098 4.4524 1 .17E- 0.099

7 7 03

2000025 64802 648024 LOC648024 0.8629 1 .818 10.052 4.4493 1 .18E- 0.099

4 7 6 03

2190255 8771 8771 TNFRSF6B 1.8547 3.616 7.2563 4.4427 1 .19E- 0.099

9 03

4280678 6414 6414 SEPP1 -0.7158 0.608 1 1.104 -4.4382 1 .20E- 0.100

9 0 03

A large number of genes that we identified by microarray as differentially regulated in emphysema lacked miRNA recognition sites in their 3 ' UTRs and are thus unlikely to be regulated through miRNAs. Conversely, the inventors found abundant expression of let-7 miRNAs in human lung that putatively could regulate over 800 genes, including those that are critical for Thl and Thl7 cell differentiation and function. Specifically, the inventors found by qRT-PCR that CD86, a co-stimulatory molecule that belongs to the B7 molecular family and is expressed on APCs, was significantly upregulated in whole lungs of ever-smokers with emphysema while using the same cohort, there was a significant relative downregulation of let-7a (FIG. 4A). Furthermore, the inventors found that the let-7a target recognition sequence that is present in the CD86 gene 3 '-UTR is highly conserved among mammalian species and that mature let-7a aligns with the human CD86 3'- UTR (FIG. 4B, FIG. 4C). Given the specific expression of CD86 in APCs, we next examined the correlation between hsa-let-7a and CD86 in APCs isolated from smokers without (control) and with emphysema. Similarly, we found an inverse correlation between let-7a and CD86, further suggesting a functional association between this miRNA and the co- stimulatory activity of APCs (FIG. 4D). The inventors next examined the authenticity of CD86 as a target of let-7a miRNA using co-transfection of plasmids expressing the pre-miRNA for let-7a or the scrambled miRNA, and a luciferase gene containing the CD86 3 '-UTR into HEK293T cells that lack endogenous CD86 expression. Let-7a suppressed luciferase production in a dose- dependent manner, when compared to scrambled miRNA (FIG. 4E). Consistent with these findings, 293T cells transfected with scrambled or anti-let-7a LNAs representing the entire reverse complement of let-7a, progressively reversed the suppressive effect of let-7a as determined by luciferase production in a dose-dependent manner (FIG. 4F). Together, these studies confirm that human CD86 is a target of let-7a and that this miRNA can be specifically inhibited by an LNA. Let-7a suppresses lung APC maturation and Thl and Thl7 development

The inventors next used primary human lung APCs to examine the function of miRNAs in Thl and Thl 7 cell differentiation. Efficient (>90%) transfection of primary lung APCS with anti-let7a LNA by electroporation resulted in significant upregulation of CD86 mRNA, further validating CD86 as a let-7a target (FIG. 5A). These findings were further confirmed at the surface protein level by flow cytometry (FIG. 5B, FIG. 5C). Interestingly, we found a divergent lung APC response to let7a expression because increased concentration of anti-let7a LNA (i.e. >300 pmol) significantly reversed the observed CD86 expression. This finding is most likely secondary to decrease cell viability that we have previously described when most abundant miRNA are inhibited (Polikepahad et ah, 2010). Although let- 7 miRNAs regulate many independent genes, the enhanced CD86 expression on anti-let-7a- treated APC would be expected to confer enhanced T cell responses (Carreno and Collins, 2002). To determine specifically the T cell phenotype that results from let-7a neutralization in APC, we co-cultured naive human T helper cells with autologous APC that had previously been transfected with scrambled or anti-let-7a LNAs and determined their cytokine profiles by flow cytometry and ELISA. We found that while Th2 cytokines (IL-4, IL-5) were not detected, T cells exposed to anti-let-7a LNA-treated APCs demonstrated enhanced intracellular production and secretion of IL-17A and IFN-γ, indicating that an important effect of let-7a neutralization in human APCs is to enhance Thl and Thl7 responses (FIG. 5D, FIG. 5E). mir-1266 targets IL-17A in human T cells

A second miRNA that was downregulated in emphysematous lung was discovered, mir-1266, which represents the only miRNA predicted to regulate IL-17A, but not IFN-γ. Alignment of the mature hsa-miR-1266 sequence with IL17A 3 '-UTRs from diverse species revealed strong conservation (FIG. 6A, FIG. 6B). Moreover, differential expression of miR-1266 in CD4 T cells isolated from lung parenchyma of ever smokers without (control) and with emphysema (Fig. 6C) was observed. Our prior work has confirmed a strong association between Thl 7 cells and ever-smokers with emphysema (Shan et ah, 2009), and well as a functional role of Thl 7 cells in animal model of emphysema (Shan et ah, 2012). Therefore, to examine the function of miR-1266 in IL-17A expression, HEK293T cells were co-transfected with mir-1266 and IL-17A 3 'UTR reporter plasmids and further confirmed the ability of mir-1266 to regulate this cytokine (FIG. 6D). Finally, we transfected into human T cells scrambled or anti-miR-1266 LNAs representing the entire reverse complement of miR-1266. The anti-miR-1266 LNA enhanced both intracellular IL- 17A protein and mRNA expression in human PBMC-derived T cells following activation (FIG. 6E). Together, these studies demonstrate that, like let-7a, human IL17A is a target of hsa-miR-1266 and that this miRNA can specifically regulate Thl7 responses. EXAMPLE 3

MicroRNA-22 Is Required for Thl 7 Responses

Thl 7 cells are further essential mediators of diverse autoimmune disorders such as multiple sclerosis and emphysema. Utilizing miR-22-/- mice, it was observed that miR-22 is a key regulator of the Thl 7 response. In a fungus-induced model of allergic asthma, higher levels of miR-22 mRNA in lung CDl lc+ antigen presenting cells (APCs) were observed. Moreover, although miR-22-/- mice developed similar numbers of Th2 cells, which are required for expression of asthma-like disease, lack of miR-22 resulted in an overall attenuation of the disease phenotype that correlated with markedly fewer Thl7 cells in lungs relative to wild type mice. MiR-22-/- mice challenged with fungi further manifested reduced secretion of the pro-Thl7 cytokines IL-Ιβ, IL-6, TFG-β, and IL-23. MiR-22-deficient CD4+ T cells were capable of differentiating to Thl7 linage in vitro, but mice intraperitoneally sensitized with ovalbumin failed to develop ovalbumin-specific Thl7 responses. Thus, miR- 22-/- lack the ability to develop Thl7 responses. Without wishing to be bound by any theory, this may be due to a defect in antigen presenting cell function. Inhibition of miR-22 may be used as a therapy for Thl7 cell-dependent autoimmune diseases. Mir-22 was observed to be required for Thl7 responses, using the carbon black test (FIG. 7). was observed to be required for Thl7 responses and allergic lung disease (FIG.8).

Without wishing to be bound by any theory, the data provided herein is consistent with the idea that miR-22 is Required for T_H17 responses. MiR-22-/- mice developed fewer TH17 cells in lung in fungal induced allergic asthma and carbon black induced emphysema model. MiR-22-/- APCs were observed to secret less pro-TH17 cytokines. Cigarette smoke inhalation was used to induce lung destruction in miR-22-/- female mice or wild-type control mice. Mice received an equivalent of 4 cigarettes/day, 5 days/week for 4 months. At the end of tis time a CT scan was performed and mice were sacrificed and lung tissues were evaluated with microscopy and staining. As compared to wild-type controls, attenuated lung hyperinflation was observed in miR-22-/- mice. Data is shown in FIG. 11. Reduced airway inflammation was also observed in miR-22-/- mice as compared to wild-type controls (FIG: 12). These results are consistent with the idea that miR-22 is involved in Thl7 responses. MiR-22 knockdown (KD) in bone marrow-derived dendritic cells (BMDC) was observed to attenuate dendritic cell (DC) Activation (FIG. 13). MiR-22 was observed to mediates BMDC-dependent TH17 activation by carbon black (CB) in vitro (FIG: 14). Overexpression of mir-22 was observed to activate antigen-presenting cells (APCs) (FIG. 15). These results show that miR-22 is required for pro-T_H17 cytokine secretion in antigen presenting cells (APCs).

EXAMPLE 4

HDAC4 Is a miR-22 Target in Antigen Presenting Cells (APC) And Is Funtionally Relevant to APC Activation Promoted by miR-22

Microarray analysis was used to test for targets of miR-22. Both WT mice and mir-22-/- mice were challenged with carbon black for 6 weeks. CD1 lc+ antigen presenting cells were purified from the lung. Total RNA was purified from the lung tissue and used to perform the microarray analysis. The inventors compared the differentially regulated genes in 8 groups. An overview of this approach is shown in FIG. 16. As shown in Fugre 16, the target of mir-22 should locate in the bottom group, downregulated in WT mice after carbon black treatment but is upregulated in the miR-22-/- mice challenged with carbon balck (CB) than wt mice challenged with CB. The predicted target list was then compared with the gene list we identified by microarray analysis. The list was narrowed to four genes, and from this list of four genes, only histone deacetylase 4 (HDAC4) and Stromal Derived Factor- 1 (CXCL12) were identified and are immune related genes. The other two genes were ACLY and PALD. Histone deacetylase is an epigenetic regulator.

RAW264.7 cells were treated with either DMSO vehicle or HDAC Inhibitor XXIV (OSU-HDAC-44 from Millipore which can inhibit HDAC1,4,6,8,1 1) for overnight. Then the mRNA level of different cytokines was quantified in the RAW cell. It was observed that treating the RAW cell with the HDAC inhibitor can spontaneously activate the RAW cell to secret different pro-Thl7 cytokines. Transformed macrophage cells RAW treated with the pan inhibitor of HDACs (inhibits HDAc 2, 4, 8, 11), resulted in increased production of mRNA for IL-lbeta, IL-6, IL-23 and CD86— all molecules that are required for production of Thl7 cells. These results are consistent with the hypothesis that mir-22 suppresses HDAC4, leading to enhanced production of these factors and thus Thl7 responses. Results are shown in FIG. 17.

Bone marrow derived dendritic cells (BMDCs) were transfected with scrambled or miR-22 locked nucleic acid (LNA) from Exiqon (Copenhagen, Denmark). The cells were cultured in vitro for 1 day and the mRNA level of HDAC4 was measured using qRT-PCR (Left, FIG. 18) and protein levels were measured using Western blot (Right, FIG. 18). miR-22 was observed to augment TH17 by inhibiting HDAC4 in APCs. The wildtype bone marrow derived dendritic cells were transfected with mir22 LNA, HDAC4 siRNA or both, and the BMDC were treated with carbon black (CB) for 2 days. CD4+ naive T cells freshly isolated from mouse spleen were then added to the culture together with an anti-CD3 antibody at the end of day 2. The supernatant was collected on the day 5 and IL- 17A concentration was measured by ELISA. Results are shown in FIG. 19 (Upper panel). The miR-22-/- bone marrow derived dendritic cells were transfected with HDAC4 siRNA or scrambled siRNA, and the BMDC were treated with CB for 2 days. CD4+ naive T cells freshly isolated from mouse spleen were then added to the culture together with an anti-CD3 antibody at the end of day 2. The supernatant was collected on the day 5 and IL-17A concentration was measured by ELISA. Results are shown in FIG. 19 (Lower panel). Collectively, these results support the idea that HDAC4 is a miR-22 target in antigen presenting cells, and HDAC4 is functionally relevant to APC activation promoted by miR-22.

* * *

All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

U.S. Patent 5,034,506

U.S. Patent 5,235,033

U.S. Patent 5,510,270

U.S. Patent 5,556,752

U.S. Patent 5,578,832

U.S. Patent 6,268,490

U.S. Patent 6,770,748

U.S. Patent Publn. 2002/0115080

U.S. Patent Publn. 20050107325

U.S. Patent Publn. 20050182005

Alcorn et al, Annual Rev. Physiology, 72:495-516, 2010.

Alimohammadi et al, Proc. Natl. Acad. Sci. USA, 106:4396-4401, 2009.

Andorfer et al, Trends Mol. Med., 17:313-319, 2011.

Angel ei al, Cell, 49:729, 1987a.

Angel et al, Cell, 49:729, 1987b.

Atchison and Perry, Cell, 46:253, 1986.

Atchison and Perry, Cell, 48: 121, 1987.

Ausubel et al, Current Protocols in Molecular Biology, Greene Publ. Assoc. Inc. & John

Wiley & Sons, Inc., MA, 1997.

Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), Plenum Press, NY, 1 17-148,

1986.

Banerji et al, Cell, 27:299, 1981.

Banerji et al, Cell, 33(3):729-740, 1983.

Barnes et al, J. Biol. Chem., 272(17): 1 1510-1 1517, 1997.

Behm-Ansmant et al, Cold Spring Harb. Symp. Quant. Biol, 71 :523-530, 2006.

Benvenisty and Neshif, Proc. Natl. Acad. Sci. USA, 83(24):9551-9555, 1986.

Berkhout et al, Cell, 59:273-282, 1989. Bhavsar et al , Genomics, 35(1): 1 1-23, 1996.

Blanar et al, EMBO J., 8: 1139, 1989.

Bodine and Ley, EMBO J., 6:2997, 1987.

Boshart ei fl/., Cell, 41 :521, 1985.

Bosze et al , EMBO J. , 5(7): 1615- 1623 , 1986.

Braddock et al, Cell, 58:269, 1989.

Brennecke et al, Cell, 1 13(l):25-36, 2003.

Bulla and Siddiqui, J. Virol, 62: 1437, 1986.

Calin et al, Proc. Natl. Acad. Sci. USA, 105:5166-5171, 2008.

Campbell and Villarreal, Mol. Cell. Biol, 8: 1993, 1988.

Campere and Tilghman, Genes and Dev., 3 :537, 1989.

Campo et al, Nature, 303:77, 1983.

Carreno and Collins, Ann. Rev. Immunol, 20:29-53, 2002.

Carrington and Ambros, Science, 301 (5631):336-338, 2003.

Castaldi et al , Human Molec. Genetics, 19:526-534, 2010.

Cmx et al , J. Exp. Med, 180: 1841- 1847, 1994.

Celander and Haseltine, J. Virology, 61 :269, 1987.

Celander e? fl/. , J. Virology, 62: 1314, 1988.

Chang et al, Mol. Cell. Biol, 9:2153, 1989.

Chatterjee e/ a/. , Proc. Natl. Acad. Sci. USA, 86:91 14, 1989.

Chen and Okayama, Mol. Cell Biol , 7(8):2745-2752, 1987.

Chen et al, Mol. Microbiol, 53843-856, 2004.

Chen et al, PLoS ONE, 6, 201 1.

Chen, Science, 303:2022-2025, 2004.

Choi et al, J. Mol. Biol, 262(2): 151-167, 1996.

Chu and Rana, Plos. Biology., 4:e210, 2006.

Coarfa and Milosavljevic, Pash 2.0: scaleable sequence anchoring for next-generation sequencing technologies, Pacific Symposium on Biocomputing, 2008..

Coffin, In: Virology, Fields et al. (Eds.), Raven Press, NY, 1437-1500, 1990.

Cohen et al, J. Cell. Physiol, 5:75, 1987.

Cosio and Majo, Chest, 121 : 160S- 165S, 2002.

Costa et al , Mol. Cell. Biol, 8:81-90, 1988.

Coupar et al, Gene, 68: 1-10, 1988.

Cripe et al, EMBO J., 6:3745, 1987. Culotta and Hamer, Mol. Cell. Biol, 9: 1376- 1380, 1989.

Dandolo e? a/., J. Virology, 47:55-64, 1983.

De Andres et al, BioTechniques 18:42044, 1995.

Demeo et al., Amer. J. Human Genetics, 78:253-264, 2006.

DeRisi Shalon et al. , Genome Res., 6:639-645, 1996.

Deschamps et al , Science, 230: 1174-1177, 1985.

Ding and Cantor, Proc. Natl. Acad. Sci. USA, 100:3059-3064, 2003.

Dostie et al, Rna-A Publication of the Rna Society, 9: 180-186, 2003.

Dubensky et al, Proc. Natl. Acad. Sci. USA, 81 :7529-7533, 1984.

Edbrooke et al, Mol. Cell. Biol, 9: 1908-1916, 1989.

Edlund et al, Science, 230:912-916, 1985.

Esteller, Nature Rev. Genetics, 12:861-874, 201 1.

Eulalio et al, Cell, 132:9-14, 2008.

Ezzie et al, Thorax, 67: 122-131, 2012.

Fechheimer et al, Proc Natl. Acad. Sci. USA, 84:8463-8467, 1987.

Feng and Holland, Nature, 334:6178, 1988.

Ferguson et al, Proc. Natl. Acad. Sci. USA, 97(1 1):6049-6054, 2000.

Firak and Subramanian, Mol. Cell. Biol , 6:3667, 1986.

Fodor et al, Science, 251 :767-773, 1991.

Foecking and Hofstetter, Gene, 45(1): 101-105, 1986.

Fraley et al, Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979.

Franz et al, Cardioscience, 5(4):235-43, 1994.

Friedman et al, Genome Res., 19:92-105, 2009.

Fujita et al , Cell, 49:357, 1987.

Fukumura e? al, Nucl. Acids. Res., 31(16):e94, 2003.

Ghosh and Bachhawat, In: Liver Diseases, Targeted Diagnosis and Therapy Using Specific

Receptors and Ligands, Wu et al. (Eds.), Marcel Dekker, NY, 87-104, 1991.

Gillies et al, Cell, 33 :717, 1983.

Gloss et al, EMBO J. , 6:3735, 1987.

Godbout et al, Mol. Cell. Biol, 8: 1 169, 1988.

Godfrey et al, J. Molec. Diagn., 2: 84-91, 2000.

GOLD Executive Committee. Global strategy for the diagnosis, m., and prevention of COPD, www.goldcopd.org, 2008.

Goodbourn and Maniatis, Cell, 41(2):509-520, 1985. Goodbourneia/., Cell, 45:601, 1986.

Gopal, Afo/. Cell Biol, 5:1188-1190, 1985.

Gopal-Srivastavae?a/.,J. Mol. Cell. Biol.15(12):7081-7090, 1995.

Graham and Prevec, In: Methods in Molecular Biology: Gene Transfer and Expression

Protocol, Murray (Ed.), Humana Press, Clifton, NJ, 7:109-128, 1991.

Graham and Van Der Eb, Virology, 52:456-467, 1973.

Greene et al, Immunology Today, 10:272, 1989.

Grosschedl and Baltimore, Cell, 41:885, 1985.

Grumelli et al, PLoS Med., I:e8, 2004.

Gu et al, PLoS ONE, 3:e2548, 2008.

Hanaoka et al, Respir. Res., 11:179, 2010.

Harrington et al, Nature Immunology, 6:1123-1132, 2005.

Harrison et al, Immunology Lett, 121:13-21, 2008.

Haslinger and Karin, Proc. Natl Acad. Sci. USA, 82:8572, 1985.

Hauber and Cullen, J. Virology, 62:673, 1988.

Hen et al, Nature, 321:249, 1986.

Hensel et al, Lymphokine Res., 8:347, 1989.

Herr and Clarke, Cell, 45:461, 1986.

Hersh etal, Am. J. Respir. Crit. Care Med, 183:1482-1489, 2011.

Hirochikae/ /.,J. Virol, 61:2599, 1987.

Rmch etal, Mol Cell. Biol, 10:1959, 1990.

Holbrooke^/., Virology, 157:211, 1987.

Horlick and Benfield, Mol. Cell. Biol, 9:2396, 1989.

Huang etal, Cell, 27:245, 1981.

Huge/ al, Mol Cell Biol., 8:3065-3079, 1988.

Hwang et al, Mol Cell. Biol, 10:585, 1990.

Imagawaeitf/., Cell, 51:251, 1987.

Imbra and Karin, Nature, 323:555, 1986.

Imler etal, Mol. Cell. Biol, 7:2558, 1987.

Imperiale and Nevins, Mol. Cell. Biol, 4:875, 1984.

Jakobovits etal, Mol. Cell. Biol, 8:2555, 1988.

Jameel and Siddiqui, Mol. Cell. Biol, 6:710, 1986.

Jaynes etal, Mol. Cell. Biol, 8:62, 1988.

Johnson et al, Mol. Cell. Biol, 9(8):3393-3399, 1989. Jones and Shenk, Cell, 13:181-188, 1978.

Kadesch and Berg, Mol Cell Biol, 6:2593, 1986.

Kalafus etal, Genome Res., 14:672-678, 2004.

Karin etal, Mol Cell Biol, 7:606, 1987.

Karin etal, Mol Cell Biol, 7:606, 1987.

Katinka et al, Cell, 20:393, 1980.

Katinka et al, Nature, 290:720, 1981.

Kawamoto et al, Genome Res., 12:1305-1312, 1999.

Kawamoto etal, Mol. Cell Biol, 8:267, 1988.

Kelly et al. , J. Cell Biol, 129(2):383-396, 1995.

Kiledjian etal, Mol Cell. Biol, 8:145, 1988.

Kimura et al, Dev. Growth Differ.39(3):257-265, 1997.

Klamute?a/.,Mo/. Cell. Biol, 10:193, 1990.

Kleins al, Nature, 327:70-73, 1987.

Koch et al, Mol. Cell Biol, 9:303, 1989.

Kong et al, Amer. J. Respiratory Crit. Care Med., 183:43-49, 2011.

Kriegler and Botchan, Mol. Cell. Biol, 3:325, 1983.

Kriegler et al, Cell, 38:483, 1984a.

Kriegler et al, In: Cancer Cells 2/Oncogenes and Viral Genes, Van de Woude et al. eds,

Cold Spring Harbor, Cold Spring Harbor Laboratory, 1984b.

Krutzfeldt et al, Nature, 438(7068):685-689, 2005.

Kuhl etal, Cell, 50:1057, 1987.

Kunz etal, Nucl. Acids Res. , 17:1121, 1989.

Lange, Nature Methods, 7, 2010.

LaPointe et al, Hypertension 27(3 Pt 2):715-22, 1996.

LaPointe et al, J. Biol. Chem., 263(19):9075-8, 1988.

Larsen et al.,Proc. Natl. Acad. Sci. USA, 83:8283, 1986.

Laspia et al, Cell, 59:283, 1989.

Latimer et al, Mol. Cell Biol, 10:760, 1990.

Lee et al, Nat. Med., 13:567-569, 2007.

Lee et al, Nature Medicine, 13:567-569, 2007.

Lee et al, Nature, 294:228, 1981.

Lee et al. Nucleic Acids Res., 12:4191-206, 1984.

Liang and Pardee, Science, 257:967-971, 1992. Lin et al, Mol Cell Biol, 10:850, 1990.

Lockhart et al, Nat. Biotechnol, 14(13): 1675- 1680, 1996.

Lohr et al, J. Exp. Med., 203:2785-2791, 2006.

Luria et al, EMBO J., 6:3307, 1987.

Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, 1986.

Lusky et al, Mol. Cell Biol, 3:1108, 1983.

Macejak and Sarnow, Nature, 353:90-94, 1991.

Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, 1983.

Maskos and Southern, Nuc. Acids. Res., 20:1679-1,684, 1992.

Masten et al, Amer. J. Respiratory Cell .Molec. Biol, 16:335-342, 1997.

McNealle/a/., Gene, 76:81, 1989.

Melgert etal, Clinical Expert Allergy, 37:1798-1808, 2007.

Metzler etal, Genes Chromosomes Cancer, 39:167-169, 2004.

Michaels al, Mol. Cancer Res., 1:882-891,2003.

Miksicek et al, Cell, 46:203, 1986.

Mizuno et al, Am. J. Physiol. Lung Cell Mol Physiol, 300(3):L402-413, 2011.

Mordacq and Linzer, Genes and Dev., 3:760, 1989.

Moreau et al, Nucl. Acids Res., 9:6047, 1981.

Moss etal, Biol. Chem., 271 (49):31688-31694, 1996.

Motz etal, Am. J. Respir. Crit. Care Med., 181:1223-1233, 2010.

Muesing etal, Cell, 48:691, 1987.

Neuberger et al, Nucleic Acids Res., 16(14B):6713-6724, 1988.

Ng et al, Nuc. Acids Res., 17:601, 1989.

Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982.

Nicolau et al, Methods Enzymol, 149:157-176, 1987.

Oliphant et al, In: Discovery of Markers for Disease (Supplement to Biotechniques), June 2002.

Omitz etal, Mol. Cell Biol, 7:3466, 1987.

Ondek et al. , EMBO J. , 6: 1017, 1987.

Palmitere/a/., Cell, 29:701, 1982.

Parke? al, J. Hum. Genet., 50:133-138, 2005.

Parker and Barnes, Methods Mol Biol, 106:247-83, 1999.

PCT Appln. WO/0071096

Pease etal, Proc. Natl. Acad. Sci. USA, 91:5022-5026, 1994. Pech et al, Mol. Cell Biol , 9:396, 1989.

Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988.

Perez-Stable and Constantini, Mol. Cell. Biol, 10: 1 116, 1990.

Pfeffer et al, Science, 304:734-736, 2004.

Picard and Schaffner, Nature, 307:83, 1984.

Pillai et al, PLoS Genetics, 5:el000421 , 2009.

Pinheiro et al, Science, 336(6079):341-344, 2012.

Pinkert et al, Genes and Dev., 1 :268, 1987.

Polikepahad et al, J. Biolog. Chem., 285:30139-30149, 2010.

Ponta et al, Proc. Natl Acad. Sci. USA, 82: 1020, 1985.

Potter et al, Proc. Natl Acad. Sci. USA, 1 :7161 -7165, 1984.

Queen and Baltimore, Cell, 35:741, 1983.

Quinn et al, Mol. Cell Biol, 9:4713, 1989.

Redondo et al, Science, 247: 1225, 1990.

Reid ei a/., Genome Res., 18: 1571-1581, 2008.

Reinhart et al, Nature, 403:901-906, 2000.

Reisman and Rotter, Mol. Cell. Biol, 9:3571 , 1989.

Remington's Pharmaceutical Sciences, 15^th Ed., 1035-1038 and 1570- 1580, 1990. Resendez Jr. et al, Mol Cell. Biol, 8:4579, 1988.

Ridgeway, In: Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Rodrig al. (Eds.), Stoneham: Butterworth, 467-492, 1988.

Rippe et al, Mol. Cell. Biol, 9(5):2224-22277, 1989.

Rippe et al, Mol. Cell. Biol, 9(5):2224-22277, 1989.

Rittling et al, Nucl Acids Res., 17: 1619, 1989.

Rupp and Locker, Lab Invest., 56:A67, 1987.

Saldanha, Bioinformatics, 20:3246-3248, 2004.

Sayed and Abdellatif, Physiol. Rev., 91 :827-887, 2011.

Schaffner et al, J. Mol. Biol , 201 :81, 1988.

Schena et al. Science, 270:467-470, 1995.

Searle et al, Mol Cell Biol, 5: 1480, 1985.

Seth et al, J. Med. Chem., 52(1): 10-13, 2009.

Seth et al, Nucleic Acids Symp. Ser. (Oxford), 52:553-554, 2008.

Shan et al, Sci. Transl. Med., I :4ral0, 2009.

Shan et al, Science Translational Med., 4: 1 17ra9, 2012. Sharp and Marciniak, Cell, 59:229, 1989.

Shaul and Ben-Levy, EMBOJ., 6:1913, 1987.

Shen et al. , Inhalation Toxicology, 23:212-21 ,2011.

Sherman et al, Mol. Cell. Biol., 9:50, 1989.

Sleigh and Lockett, J. EMBO, 4:3831, 1985.

Soutschek et al, Nature, 432:173-178, 2004.

Spalholz etal, Cell, 42:183, 1985.

Spandau and Lee, J. Virology, 62:427, 1988.

Spandidos and Wilkie, EMBOJ., 2:1193, 1983.

Specht et. al, Am. J. Pathol, 158: 419-29, 2001.

Stephens and Hentschel, Biochem. J., 248:1, 1987.

Stuart et al, Nature, 317:828, 1985.

Sullivan and Peterlin, Mol. Cell. Biol, 7:3315, 1987.

Suzuki et al, Ann. Surg. Oncol, 17:878-888,2010.

Swartzendruber and Lehman, J. Cell. Physiology, 85:179, 1975.

Takebe et al, Mol. Cell. Biol, 8:466, 1988.

Tavernier et al, Nature, 301:634, 1983.

Taylor and Kingston, Mol. Cell. Biol, 10:165, 1990a.

Taylor and Kingston, Mol. Cell. Biol, 10:176, 1990b.

Taylor etal, J. Biol Chem., 264:15160, 1989.

Ύ θΎΆ etal, Nat. Struct. Biol, 6:535-539, 1999.

Thiesene?a/.,J. Virology, 62:614, 1988.

Thorgeirsson et al, Nature, 452:638-642, 2008.

Treisman, Cell, 42:889, 1985.

Tranche et al, Mol. Biol. Med., 7:173, 1990.

Tranche et al, Mol. Cell. Biol, 9:4759, 1989.

Trudel and Constantini, Genes and Dev., 6:954, 1987.

Tur-Kaspa etal, Mol. Cell Biol, 6:716-718, 1986.

Tyndall et al, Nuc. Acids. Res., 9:6231, 19 1.

Vasse r etal, Proc. Natl. Acad. Sci. USA, 77:1068, 1980.

Veedu et al, Bioorganic Med. Chem. Lett,, 20(22):6565-6568, 2010.

Velculescueia/., Cell, 88:243-51, 1997.

Velculescu et al, Science, 270:484-487, 1995.

Wang and Calame, Cell, 47:241, 1986. Weber et al, Cell, 36:983, 1984.

Weis et al, Trends in Genetics, 8:263 264, 1992.

Winoto and Baltimore, Cell, 59:649, 1989.

Wong et al, Gene, 10:87-94, 1980.

Wood et al , Europ. Respiratory J., 37:32-38, 201 1.

Wu and Wu, Adv. Drug Delivery Rev., 12: 159- 167, 1993.

Wu and Wu, Biochemistry, 27: 887-892, 1988.

Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987.

Xu et al, Curr. Biol , 13(9):790-795, 2003.

Yamauchi-Takihara e^>? «/., Proc. Natl. Acad. Sci. USA, 86(10):3504-8, 1989.

Yang and Russell, Proc. Natl. Acad. Sci. USA, 87:4144-4148, 1990.

Yang et al, Genome Res., 1 1 : 1888-1898, 2001.

Yutzey et al. Mol. Cell Biol, 9: 1397, 1989.

Zhao et al, Cell, 129:303-317, 2007.

Ziober and Kramer, J. Bio. Chem., 271(37):22915-22, 1996.

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A method of treating or preventing exacerbation of an inflammatory lung disease in a subject, comprising administering to said subject a pharmaceutically effective amount of a composition comprising a nucleic acid which selectively binds or inhibits Mir-22, or a nucleic acid comprising a let-7a or a mir-1266.

2. The method of claim 1, wherein the nucleic acid administered to the subject selectively binds or inhibits Mir-22.

3. The method of claim 2, wherein the nucleic acid is selected from the group consisting of a siRNA, an antisense oligonucleotide, a locked nucleic acid (LNA), an antisense RNA, and a plasmid expressing an antisense RNA.

4. The method of claim 2, wherein the nucleic acid is a LNA.

5. The method of claim 1, wherein the nucleic acid is hsa-let-7a.

6. The method of claim 1, wherein the nucleic acid is hsa-mir-1266.

7. The method of claim 1, wherein the inflammatory lung disease is emphysema, chronic obstructive pulmonary disease, an interstitial lung disease, or sarcoidosis.

8. The method of claim 7, wherein the inflammatory lung disease is emphysema.

9. The method of claim 1, wherein the inflammatory lung disease is an autoimmune disease.

10. The method of claim 9, wherein the autoimmune disease is selected from the group consisting of rheumatoid arthritis and scleroderma.

11. The method of claim 1, wherein the nucleic acid comprises a phosphoramidate linkage, a phosphorothioate linkage, a phosphorodithioate linkage, or an O- methylphosphoroamidite linkage.

12. The method of claim 1, wherein said nucleic acid comprises one or more nucleotide analogs.

13. The method of claim 1, wherein the subject is a mammal.

14. The method of claim 13, wherein the mammal is a human.

15. The method of claim 13, further comprising administering to the subject one or more secondary forms of therapy for the treatment or prevention of the inflammatory lung disease.

16. The method of claim 15, wherein the secondary form of therapy is selected from the group consisting of a corticosteroid, a beta-2 adrenergic receptor agonist, a leukotrine modifier, an anti-immunoglobulin E (IgE) antibody, a mast cell stabilizing agent, a bronchodilator, an inhaled steroid, an antibiotic, pulmonary rehabilitation, supplemental oxygen, and surgery.

17. The method of claim 13, wherein said nucleic acid is comprised in a vector.

18. The method of claim 17, wherein said vector is a viral vector.

19. The method of claim 18, wherein said viral vector is an adenovirus, an adeno- associated virus, a lentivirus, or a herpes virus.

20. The method of claim 17, wherein said vector comprises a lipid.

21. The method of claim 20, wherein said lipid is comprised in a liposome.

22. The method of claim 13, wherein the pharmaceutically effective amount of said composition is administered via an aerosol, topically, locally, intravenously, intraarterially, intraperitoneally, intramuscularly, by lavage, or by injection into the thoracic cavity.

23. A pharmaceutical composition comprising an inhibitor of miRNA-22.

24. The pharmaceutical composition of claim 23, wherein the inhibitor is a locked nucleic acid (LNA) or a modified nucleic acid.

25. The pharmaceutical composition of claim 24, wherein the inhibitor comprises a phosphoramidate linkage, a phosphorothioate linkage, a phosphorodithioate linkage, or an O- methylphosphoroamidite linkage.

26. The method of claim 24, wherein the inhibitor comprises one or more nucleotide analogs.

27. The pharmaceutical composition of claim 23, wherein the pharmaceutical composition is formulated for inhalation or parenteral administration.

28. The pharmaceutical composition of claim 27, wherein the parenteral administration is intravenous injection.

29. A method for identifying an inflammatory lung disease in a subject, comprising obtaining a biological sample from the subject, and detecting the level of one or more miRNAs in the biological sample; wherein the at least one of the one or more miRNAs comprises:

(i) miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR- 142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR- 617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, or

(ii) miR-452; and wherein an increase in the level of a miRNA from group (i) or a decrease in the level of a miRNAs from group (ii) in the biological sample compared to a reference level indicates that the has or is at risk of having an inflammatory lung disease.

30. The method of claim 29, further comprising preparing a report of said detecting.

31. The method of claim 29, wherein the subject is a human, and wherein the miRNA are human miRNA.

32. The method of claim 29, wherein the inflammatory lung disease is emphysema, chronic obstructive pulmonary disease, an interstitial lung disease, or sarcoidosis.

33. The method of claim 32, wherein the inflammatory lung disease is emphysema.

34. The method of claim 29, wherein said detecting comprises measuring the level of one or more of miR-1303, miR-376a, miR-132, or miR-452.

35. The method of claim 29, wherein the biological sample comprises white blood cells, lung tissue, or plasma.

36. A biochip comprising an isolated nucleic acid comprising: miR-223, miR-379, miR- 376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR- 1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, or miR-452.

37. The biochip of claim 36, wherein the biochip comprises a plurality of said nucleic acids.

38. The biochip of claim 36, wherein said biochip comprises microfludics.

39. A kit comprising a sealed container comprising a set of primers specific for transcription or reverse transcription of a nucleic acid sequence, wherein said nucleic acid sequence comprises: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR- 1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR- 513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR- 376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, miR-452, or a nucleic acid from Table 1.

40. The kit of claim 39, further comprising instructions for use.

41. An isolated nucleic acid comprising a nucleic acid from Table 1 or a complement thereof.

42. The nucleic acid of claim 41, wherein the nucleic acid is comprised in a vector.

43. The nucleic acid of claim 42, wherein the vector is a viral vector.

44. The nucleic acid of claim 42, wherein the vector comprises a promoter or enchancer.

45. The nucleic acid of claim 41, wherein said nucleic acid comprises a phosphoramidate linkage, a phosphorothioate linkage, a phosphorodithioate linkage, or an O- methylphosphoroamidite linkage.

46. The nucleic acid of claim 45, wherein said nucleic acid comprises one or more nucleotide analogs.

47. The isolated nucleic acid of claim 41, wherein the nucleic acid comprises a chemical modification.

48. The isolated nucleic acid of claim 41, wherein the nucleic acid is comprised in a pharmaceutically acceptable composition.

49. A method of screening for a modulator of an inflammatory lung response comprising:

(a) contacting a lung cell with a candidate substance; and

(b) measuring the expression level of one or more microR As (miR As) in the lung cell; wherein at least one of the one or more miRNAs comprises; miR-223, miR-379, miR- 376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR- 1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, miR-452; wherein a decrease in the expression level in the lung cell of one or more of miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR- 619, miR-337-3p, or miR-144:9.1 indicates that the modulator can inhibit an inflammatory lung response; and wherein an increase in the expression level in the lung cell of miR-452 indicates that the modulator can inhibit an inflammatory lung response.

50. A method for monitoring the effectiveness of an inhibitor of an inflammatory lung response comprising:

(a) administering an inhibitor of an inflammatory lung response to a subject, and

(b) measuring the expression level of one or more microRNAs (miRNAs) in a biological sample from the subject subsequent to said administering; wherein at least one of the one or more miRNAs comprises: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR- 559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR- 135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, or miR-452; wherein an a decrease in the level of one or more of miR-223, miR-379, miR-376a, miR- 1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR- 381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, or miR- 144:9.1 relative to a reference level indicates that the inhibitor is providing a therapeutic benefit; and wherein an increase in the level of miR-452 relative to a reference level indicates that the inhibitor is providing a therapeutic benefit.

51. A method of identifying a subject to receive an inhibitor of an inflammatory lung response comprising measuring the expression level of one or more microRNAs (miRNAs) in a biological sample from the subject; wherein at least one of the one or more miRNAs comprises: miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR-1290, miR-135b, miR-376a, miR- 593, miR-1246, miR-619, miR-337-3p, miR-144:9.1, or miR-452; wherein an increase in the level of one or more of miR-223, miR-379, miR-376a, miR-1246, miR-409-3p, miR-623, miR-1304, miR-142-3p, miR-431, miR-548m, miR-1276, miR-381, miR-634, miR-559, miR-513a-5p, miR-617, miR-302c, miR-372, miR-132, miR-1303, miR- 1290, miR-135b, miR-376a, miR-593, miR-1246, miR-619, miR-337-3p, or miR-144:9.1 relative to a reference level indicates that the subject may therapeutically benefit from said inhibitor; and wherein a decrease in the level of miR-452 indicates that the subject may therapeutically benefit from said inhibitor.

52. The method of claim 51, wherein the method further comprises preparing a report of said measuring.

53. The method of claim 51, wherein said measuring indicates that the subject may therapeutically benefit from said inhibitor, and wherein the method further comprises administering the inhibitor to the subject.

54. The method of claim 51, wherein the biological sample comprises lung cells or lung tissue, white blood cells, or plasma.

55. The method of claim 54, wherein the biological sample comprises lung cells or lung tissue.

56. The method of claim 51, wherein the subject is a human.

57. The method of claim 51, wherein said measuring is performed in a plurality of subjects.

58. The method of claim 57, wherein the method further comprises a method of identifying a sub-population of patients to receive said inhibitor.