WO2019160735A1 - Gamma polyglutamated tetrahydrofolates and uses thereof - Google Patents

Gamma polyglutamated tetrahydrofolates and uses thereof Download PDF

Info

Publication number
WO2019160735A1
WO2019160735A1 PCT/US2019/016966 US2019016966W WO2019160735A1 WO 2019160735 A1 WO2019160735 A1 WO 2019160735A1 US 2019016966 W US2019016966 W US 2019016966W WO 2019160735 A1 WO2019160735 A1 WO 2019160735A1
Authority
WO
WIPO (PCT)
Prior art keywords
ypthf
thf
gamma
tetrahydrofolate
polyglutamated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/016966
Other languages
English (en)
French (fr)
Inventor
Clet Niyikiza
Victor Mandla MOYO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LEAF Holdings Group LLC
Original Assignee
LEAF Holdings Group LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201980024858.2A priority Critical patent/CN111971047A/zh
Priority to EP19754705.2A priority patent/EP3755335A4/en
Priority to JP2020543517A priority patent/JP7442822B2/ja
Priority to CA3090992A priority patent/CA3090992A1/en
Priority to US16/967,203 priority patent/US12048766B2/en
Application filed by LEAF Holdings Group LLC filed Critical LEAF Holdings Group LLC
Publication of WO2019160735A1 publication Critical patent/WO2019160735A1/en
Anticipated expiration legal-status Critical
Priority to JP2024020715A priority patent/JP7676056B2/ja
Priority to US18/741,153 priority patent/US20250064736A1/en
Priority to US19/024,252 priority patent/US20250319123A1/en
Priority to JP2025070591A priority patent/JP2025111607A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A61K31/4015Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil having oxo groups directly attached to the heterocyclic ring, e.g. piracetam, ethosuximide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • A61K33/243Platinum; Compounds thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/26Carbohydrates, e.g. sugar alcohols, amino sugars, nucleic acids, mono-, di- or oligo-saccharides; Derivatives thereof, e.g. polysorbates, sorbitan fatty acid esters or glycyrrhizin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A61K47/6913Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome the liposome being modified on its surface by an antibody
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00Preparations for testing in vivo
    • A61K49/001Preparation for luminescence or biological staining
    • A61K49/0013Luminescence
    • A61K49/0017Fluorescence in vivo
    • A61K49/005Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
    • A61K49/0054Macromolecular compounds, i.e. oligomers, polymers, dendrimers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • A61K9/1272Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1277Preparation processes; Proliposomes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D475/00Heterocyclic compounds containing pteridine ring systems
    • C07D475/06Heterocyclic compounds containing pteridine ring systems with a nitrogen atom directly attached in position 4
    • C07D475/08Heterocyclic compounds containing pteridine ring systems with a nitrogen atom directly attached in position 4 with a nitrogen atom directly attached in position 2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/14Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/19Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles lyophilised, i.e. freeze-dried, solutions or dispersions
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This disclosure generally relates to gamma polyglutamated tetrahydrofolate compositions, including delivery vehicles such as liposomes containing the gamma polyglutamated tetrahydrofolate compositions, and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as rheumatoid arthritis, and infectious diseases such as HIV and malaria.
  • the polyglutamated gamma tetrahydrofolate compositions also have uses in combination therapy with one or more therapeutic agents such as a chemotherapeutic drug (e.g., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent(s) or as a “chemoprotectant” (e.g., in combination with antifolates such as methotrexate) to reduce toxic side effects associated with the therapeutic agent(s).
  • chemotherapeutic drug e.g., 5-fluorouracil
  • chemoprotectant e.g., in combination with antifolates such as methotrexate
  • Folate is an essential cofactor that mediates the transfer of one-carbon units involved in nucleotide biosynthesis and DNA repair, the remethylation of homocysteine (Hey), and the methylation of DNA, proteins, and lipids.
  • the only circulating forms of folates in the blood are monoglutamates and folate monoglutamates are the only form of folate that is transported across the cell membrane - likewise, the monoglutamate form of tetrahydrofolate, are transported across the cell membrane.
  • intracellular tetrahydrofolate is polyglutamated by the enzyme folylpoly-gamma-glutamate synthetase (FPGS).
  • the polyglutamation of tetrahydrofolate by FPGS serves at least 2 main therapeutic purposes: (1) it greatly enhances tetrahydrofolate affinity for DHFR; and (2) it facilitates the accumulation of polyglutamated tetrahydrofolate, which unlike tetrahydrofolate (monoglutamate), is not easily transported out of cells by cell efflux pumps.
  • the provided gamma polyglutamated tetrahydrofolate compositions deliver a strategy for improving the therapeutic efficacy of tetrahydrofolate.
  • This disclosure generally relates gamma polyglutamated tetrahydrofolate (THF) compositions and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, and infectious disease such as HIV and malaria.
  • the alpha polyglutamated tetrahydrofolate compositions also have uses in combination therapy with one or more therapeutic agents such as a chemotherapeutic drug (e.g., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent(s) or as a“chemoprotectant” (e.g., in combination with antifolates such as methotrexate) to reduce toxic side effects associated with the therapeutic agent(s).
  • a chemotherapeutic drug e.g., 5-fluorouracil
  • a“chemoprotectant” e.g., in combination with antifolates such as methotrexate
  • the disclosure provides:
  • composition comprising a gamma polyglutamated tetrahydrofolate.
  • polyglutamated 5-formyl-THF e.g., polyglutamated [6S]-5-formyl-THF
  • polyglutamated lO-formyl-THF e.g., polyglutamated [6R]-lO-formyl-THF
  • polyglutamated 5,l0-methenyl-THF e.g., polyglutamated [6R]-5,l0-methenyl- THF
  • polyglutamated 5-methyl-THF e.g., polyglutamated [6S]-5-methyl-THF
  • polyglutamated tetrahydrofolate e.g., polyglutamated [6S] -tetrahydrofolate
  • polyglutamated 5,l0-methylene-THF e.g., polyglutamated [6R]-5,l0- methylene-THF
  • polyglutamated 5-formimino-THF e.g., polyglutamated [6S]-5-formimino- THF
  • the gamma polyglutamated tetrahydrofolate comprises two or more glutamyl groups in the L-form having gamma carboxyl group linkages
  • each of the glutamyl groups of the gamma polyglutamated tetrahydrofolate is in the L-form and has a gamma carboxyl group linkage;
  • tetrahydrofolate is in the D-form and has a gamma carboxyl group linkage
  • each of the glutamyl groups of the gamma polyglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form and has a gamma carboxyl group linkage, or
  • the gamma polyglutamated tetrahydrofolate comprises two or more glutamyl groups in the L-form and at least one glutamyl group in the D-form having gamma carboxyl group linkages;
  • each of the glutamyl groups is in the L-form and has a gamma carboxyl group linkage or (b) each of the glutamyl groups other than the glutamyl group of tetrahydrofolate is in the D-form and and each of the gluytamyl groups has a gamma carboxyl group linkage;
  • each of the glutamyl groups is in the L-form and has a gamma carboxyl group linkage or (b) each of the glutamyl groups other than the glutamyl group of tetrahydrofolate is in the D-form and and each of the gluytamyl groups has a gamma carboxyl group linkage;
  • a liposomal composition comprising the gamma polyglutamated tetrahydrofolate according to any of [l]-[l 1] (Lp-yPTHF);
  • the Lp-yPTHF composition according to any of [ l2]-[ 15] , wherein the liposome comprises a gamma polyglutamated tetrahydrofolate comprising 1-10 glutamyl groups having gamma carboxyl group linkages;
  • the Lp-yPTHF composition according to any of [ l2]-[ 16] , wherein the liposome comprises a gamma polyglutamated tetrahydrofolate containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups;
  • the Lp-yPTHF composition according to any of [ l2]-[ 17] , wherein the liposome comprises gamma pentaglutamated tetrahydrofolate;
  • the Lp-yPTHF composition according to any of [l2]-[22], wherein the liposomes comprise at least 1% weight by weight (w/w) of the gamma polyglutamated tetrahydrofolate or wherein during the process of preparing the Lp- yPTHF, at least 1% of the starting material of gamma polyglutamated THF is encapsulated
  • components comprise at least one selected from the group consisting of: DSPE; DSPE-PEG; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol- PEG; and cholesterol-maleimide;
  • the Lp-yPTHF composition according to any of [27]-[29], wherein the liposomal components comprise at least one selected from the group consisting of: DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • poly(acrylamide) PAA
  • poly(2-methyl-2-oxazoline) poly(2-ethyl-2-oxazoline); phosphatidyl polyglycerol; poly[N-(2-hydroxypropyl) methacrylamide]; amphiphilic poly-N-vinylpyrrolidones; L-amino-acid-based polymer; oligoglycerol, copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol; [33] the Lp-yPTHF composition according to [32], wherein the steric stabilizer is PEG and the PEG has a number average molecular weight (Mn) of 200 to 5000 daltons;
  • Mn number average molecular weight
  • the Lp-yPTHF composition according to any of [l2]-[38], wherein the liposome has an interior space comprising the gamma polyglutamated tetrahydrofolate and an aqueous pharmaceutically acceptable carrier;
  • a tonicity agent such as dextrose, mannitol, glycerine, potassium chloride, sodium chloride, at a concentration of greater than 1%;
  • acceptable carrier is trehalose
  • pharmaceutically acceptable carrier comprises 1% to 50% dextrose solution
  • the Lp-yPTHF composition according to any of [39] -[43], wherein the interior space of the liposome comprises 5% dextrose suspended in an HEPES buffered solution;
  • pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of between 2 to 8; [46] the Lp-yPTHF composition according to any of [39]-[45], wherein the
  • pharmaceutically acceptable carrier comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM;
  • the Lp-yPTHF composition according to any of [l2]-[47], wherein the liposome comprises less than 500,000 or less than 200,000 molecules of the gamma polyglutamated tetrahydrofolate;
  • the Lp-yPTHF composition according to any of [l2]-[48], wherein the liposome comprises between 10 to 100,000 molecules of the gamma polyglutamated tetrahydrofolate, or any range therein between;
  • the Lp-yPTHF composition according to any of [l2]-[49], which further comprises a targeting moiety and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest;
  • targeting moiety is attached to one or both of the PEG and the exterior of the liposome by a covalent bond
  • the Lp-yPTHF composition according to any of [50]-[52], wherein the targeting moiety is an antibody or an antigen binding fragment of an antibody;
  • the Lp-yPTHF composition according to any of [50]-[53], wherein the targeting moiety binds the surface antigen with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10 10 to 10 x 10 6 as determined using BIACORE® analysis;
  • each pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties;
  • the Lp-yPTHF composition according to any of [39]-[57], further comprising one or more of an immunostimulatory agent, a detectable marker and a maleimide, wherein the immunostimulatory agent, the detectable marker or the maleimide is attached to said PEG or the exterior of the liposome;
  • immunostimulatory agent and the detectable marker is the same;
  • a pharmaceutical composition comprising the liposomal gamma polyglutamated tetrahydrofolate composition according to any of [12] -[67];
  • a pharmaceutical composition comprising gamma polyglutamated tetrahydrofolate composition according to any of [l]-[7];
  • composition of any of [l]-[70] in the manufacture of a medicament for the treatment of disease and/or for use in combination therapy with one or more therapeutic agents such as a chemotherapeutic drug (e.g ., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent(s) or as a“chemoprotectant” (e.g., in combination with an antifolate such as methotrexate) to reduce a toxic side effect associated with the therapeutic agent(s);
  • a chemotherapeutic drug e.g ., 5-fluorouracil
  • a“chemoprotectant” e.g., in combination with an antifolate such as methotrexate
  • [73] a method for treating (e.g., treating or preventing) a disease or chemical induced toxicity in a subject needing such treatment or prevention, the method comprising administering the liposomal gamma polyglutamated tetrahydrofolate composition of any of [l2]-[69] to the subject;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbla
  • cancer is a member selected from the group consisting of: lung cancer, breast cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head and neck cancer, ovarian cancer, and cervical cancer;
  • cancer is a member selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer;
  • gastric cancer e.g., stomach cancer
  • pancreatic cancer liver cancer
  • lung cancer e.g., non-small cell lung cancer and/or adenocarcinoma
  • head and neck cancer ovarian cancer
  • gallbladder cancer gallbladder cancer
  • basal cell cancer basal cell cancer
  • composition of any of [l]-[69] to a subject that is undergoing or has undergone cancer therapy
  • a maintenance therapy that comprises administering an effective amount of the
  • liposomal gamma polyglutamated tetrahydrofolate composition of any of [l2]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a method for treating e.g ., treating or preventing a disorder of the immune system that comprises administering an effective amount of the composition of any of [1]- [69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from:
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • a method for treating e.g., treating or preventing a disorder of the immune system that comprises administering an effective amount of the liposomal gamma polyglutamated tetrahydrofolate composition of any of [8] -[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., dermatomyositis/ polymyositis
  • leukopenia that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having leukopenia;
  • an infectious disease that comprises administering an effective amount of the composition according to any of [l]-[69] to a subject having or at risk of having an infectious disease
  • cardiovascular disease or metabolic disease that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having an infectious disease, cardiovascular disease, or another disease, wherein the disease is a member selected from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic disease, and ectopic pregnancy;
  • an autoimmune disease that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having an autoimmune disease;
  • rheumatoid arthritis that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having rheumatoid arthritis;
  • an inflammatory condition that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having inflammation, optionally wherein the inflammation is acute, chronic, and/or systemic inflammation; or
  • composition according to any of [l]-[59] to a subject having or at risk of having a skin condition, optionally wherein the skin condition is psoriasis;
  • polyglutamated tetrahydrofolate composition of any of [l2]-[69] to a subject having or at risk of having an infectious disease
  • a folate receptor on its surface comprising: administering the Lp-yPTHF composition of any of [l]-[69] to a subject having the tumor in an amount to deliver a therapeutically effective dose of the gamma polyglutamated tetrahydrofolate to the tumor; [91] a method of preparing a gamma polyglutamated tetrahydrofolate composition comprising the liposomal gamma polyglutamated tetrahydrofolate composition of any of [l2]-[69], the method comprising: forming a mixture comprising: liposomal components and gamma polyglutamated antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing gamma polyglutamated tetrahydrofolate;
  • [92] a method of preparing the composition of any of [l2]-[69] comprising the steps of: forming a mixture comprising: liposomal components and gamma polyglutamated tetrahydrofolate in a solution; homogenizing the mixture to form liposomes in the solution; processing the mixture to form liposomes entrapping and/or encapsulating gamma polyglutamated tetrahydrofolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • the processing step includes one or more steps of: thin film hydration, extrusion, in-line mixing, ethanol injection technique, freezing-and-thawing technique, reverse-phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and/or
  • processing step includes one or more steps of modifying the size of the liposomes by one or more of steps of extrusion, high- pressure microfluidization, and/or sonication.
  • the disclosure provides a gamma polyglutamated tetrahydrofolate (yPTHF) composition wherein at least 2 of the glutamyl residues of the gamma polyglutamated tetrahydrofolate have a gamma carboxyl group linkage.
  • the yPTHF contains 2-20, 2-15, 2-10, 2-5, or more than 5, glutamyl groups (including the glutamyl group in tetrahydrofolate).
  • the yPTHF comprises two or more glutamyl groups in the L-form.
  • the yPTHF comprises a glutamyl group in the D-form.
  • the yPTHF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF composition contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., a tetraglutamated tetrahydrofolate).
  • the tetraglutamated THF comprises two or more glutamyl groups in the L-form.
  • the tetraglutamated THF comprises a glutamyl group in the D- form.
  • the tetraglutamated THF comprises a glutamyl group in the D- form and two or more glutamyl groups in the L-form.
  • the yPTHF composition contains a chain of 4 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate (e.g ., g-pentaglutamated tetrahydrofolate).
  • the gamma pentaglutamated THF comprises two or more glutamyl groups in the L-form.
  • the gamma pentaglutamated THF comprises a glutamyl group in the D-form.
  • the gamma pentaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF composition contains a chain of 5 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate (e.g., g-hexaglutamated tetrahydrofolate).
  • the gamma hexaglutamated THF comprises two or more glutamyl groups in the L-form.
  • the gamma hexaglutamated THF comprises a glutamyl group in the D-form.
  • the gamma hexaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • compositions containing delivery vehicles such as liposomes filled with (e.g., encapsulating) and/or otherwise associated with gamma polyglutamated tetrahydrofolate, and methods of making and using the yPTHF filled/associated delivery vehicle compositions (DV-yPTHF) to deliver gamma polyglutamated tetrahydrofolate to diseased (e.g., cancerous) and/or targeted cells.
  • delivery vehicles such as liposomes filled with (e.g., encapsulating) and/or otherwise associated with gamma polyglutamated tetrahydrofolate
  • DV-yPTHF yPTHF filled/associated delivery vehicle compositions
  • diseases include for example, hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, and infectious disease such as HIV and malaria.
  • gamma polyglutamated tetrahydrofolate in the DV- yPTHF contains 2-20, 2-15, 2-10, 2-5, more than 5, or more than 20, glutamyl groups (including the glutamyl group in tetrahydrofolate).
  • the DV-yPTHF filled/associated delivery vehicle compositions provide improvements to the efficacy and safety of delivering tetrahydrofolate to cancer cells by providing the preferential delivery of a more cytotoxic payload (e.g., polyglutamated tetrahydrofolate) compared to the cytotoxicity of tetrahydrofolate administered in its monoglutamate state (THF).
  • compositions containing delivery vehicles such as liposomes filled with (e.g., encapsulating) and/or otherwise associated with gamma polyglutamated tetrahydrofolate in combination therapy with one or more therapeutic agents such as a chemotherapeutic drug (e.g., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent(s) or as a“chemoprotectant” (e.g., in combination with antifolates such as methotrexate) to reduce toxic side effects associated with the therapeutic agent(s).
  • chemotherapeutic drug e.g., 5-fluorouracil
  • a“chemoprotectant” e.g., in combination with antifolates such as methotrexate
  • gamma polyglutamated tetrahydrofolate in the DV-aPTHF contains 2-20, 2-15, 2-10, 2-5, more than 5, or more than 20, glutamyl groups (including the glutamyl group in tetrahydrofolate).
  • the DV-aPTHF filled/associated delivery vehicle compositions provide improvements to the efficacy and safety of delivering tetrahydrofolate to cancer cells by providing the preferential delivery of a more cytotoxic payload (e.g., polyglutamated tetrahydrofolate) compared to the cytotoxicity of tetrahydrofolate administered in its monoglutamate state (THF).
  • a more cytotoxic payload e.g., polyglutamated tetrahydrofolate
  • the disclosure provides a composition comprising a gamma polyglutamated tetrahydrofolate (yPTHF).
  • yPTHF gamma polyglutamated tetrahydrofolate
  • the disclosure provides a composition comprising a gamma polyglutamated 5-formyl-THF.
  • the gamma polyglutamated 5-formyl- THF gamma polyglutamated [6S] -5-formyl-THF.
  • the composition comprises gamma polyglutamated [6R,S]-5-formyl-THF.
  • the composition comprises gamma polyglutamated [6R]-5-formyl-THF.
  • the composition contains gamma polyglutamated 5-formyl-THF that has 2-20, 2-15, 2-10, 2- 5, or more than 20, glutamyl groups (including the glutamyl group in 5-formyl-THF). In some embodiments, the composition contains gamma polyglutamated 5-formyl-THF that has two or more glutamyl groups in the L-form. In other embodiments, the composition contains gamma polyglutamated 5-formyl-THF that has a glutamyl group in the D-form. In further embodiments, the composition contains gamma polyglutamated 5-formyl-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-formyl-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., tetraglutamated 5-formyl-THF).
  • the composition comprises gamma tetraglutamated [6S]-5-formyl-THF.
  • the composition comprises gamma tetraglutamated [6R,S] -5-formyl- THF.
  • the composition comprises gamma tetraglutamated [6R]-5- formyl-THF.
  • the gamma tetraglutamated 5-formyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated 5-formyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated 5-formyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-formyl-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e ., pentaglutamated 5-formyl-THF).
  • the composition comprises gamma pentaglutamated [6S]-5-formyl-THF.
  • the composition comprises gamma pentaglutamated [6R,S]-5-formyl- THF.
  • the composition comprises gamma pentaglutamated [6R]-5- formyl-THF.
  • the pentaglutamated 5-formyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the pentaglutamated 5-formyl- THF comprises a glutamyl group in the D-form. In further embodiments, the pentaglutamated 5-formyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-formyl-THF that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., hexaglutamated 5-formyl-THF).
  • the composition comprises gamma hexaglutamated [6S]-5-formyl-THF.
  • the composition comprises gamma hexaglutamated [6R,S]-5-formyl- THF.
  • the composition comprises gamma hexaglutamated [6R]-5- formyl-THF.
  • the gamma hexaglutamated 5-formyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the hexaglutamated THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5-formyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5,l0-methenyl-THF.
  • the composition comprises gamma polyglutamated [6R]-5,l0-methenyl-THF.
  • the composition comprises gamma polyglutamated [6R,S]-5,l0-methenyl-THF.
  • the composition comprises gamma polyglutamated [6S]-5,l0-methenyl-THF.
  • the composition contains gamma polyglutamated 5,l0-methenyl-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5,10- methenyl-THF).
  • the composition contains gamma polyglutamated 5- formyl-THF that has two or more glutamyl groups in the L-form.
  • the composition contains gamma polyglutamated 5,l0-methenyl-THF that has a glutamyl group in the D-form.
  • the composition contains gamma polyglutamated 5,l0-methenyl-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5,l0-methenyl-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e ., tetraglutamated 5,l0-methenyl-THF).
  • the composition comprises gamma tetraglutamated [6R]-5,l0-methenyl-THF.
  • the composition comprises gamma tetraglutamated [6R,S]-5,l0- methenyl-THF.
  • the composition comprises gamma tetraglutamated [6S]-5,l0-methenyl-THF.
  • the gamma tetraglutamated 5,l0-methenyl- THF comprises two or more glutamyl groups in the L-form.
  • the gamma tetraglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form.
  • the gamma tetraglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5,l0-methenyl-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate ⁇ i.e., pentaglutamated 5,l0-methenyl-THF).
  • the composition comprises gamma pentaglutamated [6R]-5,l0-methenyl-THF.
  • the composition comprises gamma pentaglutamated [6R,S]-5,l0- methenyl-THF.
  • the composition comprises gamma pentaglutamated [6S]-5,l0-methenyl-THF.
  • the gamma pentaglutamated 5,10- methenyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5,l0-methenyl-THF that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e hexaglutamated 5,l0-methenyl-THF).
  • the composition comprises gamma hexaglutamated [6R]-5,l0-methenyl-THF.
  • the composition comprises gamma hexaglutamated [6R,S]-5,l0- methenyl-THF.
  • the composition comprises gamma hexaglutamated [6S]-5,l0-methenyl-THF.
  • the gamma hexaglutamated 5,l0-methenyl- THF comprises two or more glutamyl groups in the L-form.
  • the gamma hexaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form.
  • the gamma hexaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-methyl-THF.
  • the composition comprises gamma polyglutamated [6S] -5-methyl-THF.
  • the composition comprises gamma polyglutamated [6R,S] -5-methyl-THF.
  • the composition comprises gamma polyglutamated [6R]-5-methyl-THF.
  • the composition contains gamma polyglutamated 5-methyl-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5-methyl-THF).
  • the composition contains gamma polyglutamated 5-methyl-THF that has two or more glutamyl groups in the L-form. In other embodiments, the composition contains gamma polyglutamated 5-methyl-THF that has a glutamyl group in the D-form. In further embodiments, the composition contains gamma polyglutamated 5-methyl-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-methyl-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., tetraglutamated 5-methyl-THF).
  • the composition comprises gamma tetraglutamated [6S]-5-methyl-THF.
  • the composition comprises gamma tetraglutamated [6R,S] -5-methyl- THF.
  • the composition comprises gamma tetraglutamated [6R]-5- methyl-THF.
  • the gamma tetraglutamated 5-methyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated 5-methyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated 5-methyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-methyl-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e ., pentaglutamated 5-methyl-THF).
  • the composition comprises gamma pentaglutamated [6S]-5-methyl-THF.
  • the composition comprises gamma pentaglutamated [6R,S] -5-methyl- THF.
  • the composition comprises gamma pentaglutamated [6R]-5- methyl-THF.
  • the gamma pentaglutamated 5-methyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated 5-methyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5-methyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-methyl-THF that that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., hexaglutamated 5-methyl-THF).
  • the composition comprises gamma hexaglutamated [6S]-5-methyl-THF.
  • the composition comprises gamma hexaglutamated [6R,S] -5-methyl- THF.
  • the composition comprises gamma hexaglutamated [6R]-5- methyl-THF.
  • the gamma hexaglutamated 5-methyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated 5-methyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5-methyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated THF.
  • the composition comprises gamma polyglutamated [6S]-THF.
  • the composition comprises gamma polyglutamated [6R,S]-THF.
  • the composition comprises gamma polyglutamated [6R -THF.
  • the composition contains gamma polyglutamated THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in THF).
  • the composition contains gamma polyglutamated THF that has two or more glutamyl groups in the L-form.
  • the composition contains gamma polyglutamated THF that has a glutamyl group in the D-form. In further embodiments, the composition contains gamma polyglutamated THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated tetrahydrofolate that contains a chain of 3 glutamyl groups attached to the glutamyl group of Tetrahydrofolate THF (i.e tetraglutamated Tetrahydrofolate THF).
  • the composition comprises gamma tetraglutamated [6S] Tetrahydrofolate THF.
  • the composition comprises gamma tetraglutamated [6R,S]- Tetrahydrofolate THF.
  • the composition comprises gamma tetraglutamated [6R]- Tetrahydrofolate THF.
  • the gamma tetraglutamated Tetrahydrofolate THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated Tetrahydrofolate THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated Tetrahydrofolate THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated tetrahydrofolate that contains a chain of 4 glutamyl groups attached to the glutamyl group of Tetrahydrofolate THF (i.e ., pentaglutamated Tetrahydrofolate THF).
  • the composition comprises gamma pentaglutamated [6S] tetrahydrofolate.
  • the composition comprises gamma pentaglutamated [6R,S]- Tetrahydrofolate THF.
  • the composition comprises gamma pentaglutamated [6R]- Tetrahydrofolate THF.
  • the gamma pentaglutamated Tetrahydrofolate THF comprises two or more glutamyl groups in the L- form. In other embodiments, the gamma pentaglutamated Tetrahydrofolate THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated Tetrahydrofolate THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated tetrahydrofolate that contains a chain of 5 glutamyl groups attached to the glutamyl group of Tetrahydrofolate THF (i.e., hexaglutamated Tetrahydrofolate THF).
  • the composition comprises gamma hexaglutamated [6S] Tetrahydrofolate THF.
  • the composition comprises gamma hexaglutamated [6R,S]- Tetrahydrofolate THF.
  • the composition comprises gamma hexaglutamated [6R]- Tetrahydrofolate THF.
  • the gamma hexaglutamated Tetrahydrofolate THF comprises two or more glutamyl groups in the L-form. In other embodiments, the hexaglutamated Tetrahydrofolate THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated Tetrahydrofolate THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5,l0-methylene-THF.
  • the composition comprises gamma polyglutamated [6R]-5,l0-methylene-THF.
  • the composition comprises gamma polyglutamated [6R,S]-5,l0-methylene-THF.
  • the composition comprises gamma polyglutamated [6S]-5,l0-methylene-THF.
  • the composition contains gamma polyglutamated 5, lO-methylene-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5,10- methylene-THF).
  • the composition contains gamma polyglutamated 5,l0-methylene-THF that has two or more glutamyl groups in the L-form.
  • the composition contains gamma polyglutamated 5, lO-methylene-THF that has a glutamyl group in the D-form.
  • the composition contains gamma polyglutamated 5, lO-methylene-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5, lO-methylene-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (/. ⁇ ? ., tetraglutamated 5, lO-methylene-THF).
  • the composition comprises gamma tetraglutamated [6R] -5, lO-methylene-THF.
  • the composition comprises gamma tetraglutamated [6R,S]-5,l0- methylene-THF.
  • the composition comprises gamma tetraglutamated [6S]-5, lO-methylene-THF.
  • the gamma tetraglutamated 5,10- methylene-THF comprises two or more glutamyl groups in the L-form.
  • the gamma tetraglutamated 5, lO-methylene-THF comprises a glutamyl group in the D-form.
  • the gamma tetraglutamated 5, lO-methylene-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5, lO-methylene-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e pentaglutamated lO-methylene-THF).
  • the composition comprises gamma pentaglutamated [6R] 5,l0-methylene- THF.
  • the composition comprises gamma pentaglutamated [6R,S]- 5, lO-methylene-THF.
  • the composition comprises gamma pentaglutamated [6S] -5, lO-methylene-THF.
  • the gamma pentaglutamated 5, lO-methylene-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated 5, lO-methylene-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5,10- methylene-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5,l0-methylene-THF that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate (/. ⁇ ? ., hexaglutamated 5,l0-methylene-THF).
  • the composition comprises gamma hexaglutamated [6R] 5,l0-methylene-THF.
  • the composition comprises gamma hexaglutamated [6R] 5,10- methylene-THF.
  • the composition comprises gamma hexaglutamated [6R,S]-5,l0-methylene-THF.
  • the composition comprises gamma hexaglutamated [6S]-5,l0-methylene-THF.
  • the gamma hexaglutamated 5,l0-methylene-THF comprises two or more glutamyl groups in the L-form.
  • the gamma hexaglutamated 5,l0-methylene-THF comprises a glutamyl group in the D-form.
  • the gamma hexaglutamated 5,10- methylene-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated 5-formimino-THF.
  • the composition comprises gamma polyglutamated [6S] -5-formimino-THF.
  • the composition comprises gamma polyglutamated [6R,S]-5-formimino-THF.
  • the composition comprises gamma polyglutamated [6R]-5-formimino-THF.
  • the composition contains gamma polyglutamated 5-formimino-THF that has 2-20, 2-15, 2-10, 2- 5, or more than 20, glutamyl groups (including the glutamyl group in 5-formimino-THF). In some embodiments, the composition contains gamma polyglutamated 5-formimino-THF that has two or more glutamyl groups in the L-form. In other embodiments, the composition contains gamma polyglutamated 5-formimino-THF that has a glutamyl group in the D-form. In further embodiments, the composition contains gamma polyglutamated 5-formimino-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a gamma polyglutamated (b) polyglutamated-5-formyl-THF; (c) polyglutamated-5,l0-methenyl-THF; (d) polyglutamated-5-methyl-THF; (e) polyglutamated-tetrahydrofolate; (f) polyglutamated- 5,l0-methylene-THF; and (g) polyglutamated-5-formimino-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( i.e tetraglutamated 5- formimino-THF).
  • the composition comprises gamma tetraglutamated [6S]-5-formimino-THF. In some embodiments, the composition comprises gamma tetraglutamated [6S] 5-formimino-THF. In some embodiments, the composition comprises gamma tetraglutamated [6R,S]-5-formimino-THF. In some embodiments, the composition comprises gamma tetraglutamated [6R]-5-formimino-THF. In some embodiments, the gamma tetraglutamated 5-formimino-THF comprises two or more glutamyl groups in the L- form.
  • the gamma tetraglutamated 5-formimino-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated 5- formimino-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the composition comprises a gamma polyglutamated 5-formimino-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( . ⁇ ? ., pentaglutamated 5-formimino-THF).
  • the composition comprises gamma pentaglutamated [6S]-5-formimino-THF.
  • the composition comprises gamma pentaglutamated [6R,S]-5-formimino-THF.
  • the composition comprises gamma pentaglutamated [6R] 5- formimino-THF.
  • the gamma pentaglutamated 5-formimino-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated 5-formimino-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5-formimino-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the composition comprises a gamma polyglutamated 5- formimino-THF that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( i.e hexaglutamated 5-formimino-THF).
  • the composition comprises gamma hexaglutamated [6S] -5-formimino-THF.
  • the composition comprises gamma hexaglutamated [6R,S]-5-formimino-THF.
  • the composition comprises gamma hexaglutamated [6R] 5-formimino- THF.
  • the gamma hexaglutamated 5-formimino-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated 5- formimino-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5-formimino-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated tetrahydro folate (Lp-yPTHF).
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated 5-formyl-THF.
  • the liposome comprises gamma polyglutamated [6S] -5-formyl-THF.
  • the liposome comprises gamma polyglutamated [6R,S]-5-formyl-THF.
  • the liposome comprises gamma polyglutamated [6R]-5-formyl-THF.
  • the liposome contains gamma polyglutamated 5-formyl-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5-formyl-THF). In some embodiments, the liposome contains gamma polyglutamated 5-formyl-THF that has two or more glutamyl groups in the L-form. In other embodiments, the liposome contains gamma polyglutamated 5-formyl-THF that has a glutamyl group in the D-form. In further embodiments, the liposome contains gamma polyglutamated 5-formyl-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5-formyl-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( . ⁇ ? ., tetraglutamated 5-formyl-THF).
  • the liposome comprises gamma tetraglutamated [6S]-5-formyl-THF.
  • the liposome comprises gamma tetraglutamated [6R,S]-5-formyl-THF.
  • the liposome comprises gamma tetraglutamated [6R]-5-formyl-THF.
  • the gamma tetraglutamated 5-formyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated 5-formyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated 5-formyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5-formyl-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( i.e pentaglutamated 5-formyl-THF).
  • the liposome comprises gamma pentaglutamated [6S] -5-formyl-THF.
  • the liposome comprises gamma pentaglutamated [6R,S]-5-formyl-THF.
  • the liposome comprises gamma pentaglutamated [6R]-5-formyl-THF.
  • the pentaglutamated 5-formyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the pentaglutamated 5-formyl-THF comprises a glutamyl group in the D- form. In further embodiments, the pentaglutamated 5-formyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5-formyl-THF that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( . ⁇ ? ., hexaglutamated 5-formyl-THF).
  • the liposome comprises gamma hexaglutamated [6S]-5-formyl-THF.
  • the liposome comprises gamma hexaglutamated [6R,S]-5-formyl-THF.
  • the liposome comprises gamma hexaglutamated [6R]-5-formyl-THF.
  • the gamma hexaglutamated 5-formyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the hexaglutamated THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5-formyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated 5,l0-methenyl-THF.
  • the liposome comprises gamma polyglutamated [6R]-5,l0-methenyl-THF.
  • the liposome comprises gamma polyglutamated [6R,S]-5,l0-methenyl- THF.
  • the liposome comprises gamma polyglutamated [6S]-5,l0- methenyl-THF.
  • the liposome contains gamma polyglutamated 5,10- methenyl-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5,l0-methenyl-THF). In some embodiments, the liposome contains gamma polyglutamated 5-formyl-THF that has two or more glutamyl groups in the L-form. In other embodiments, the liposome contains gamma polyglutamated 5,l0-methenyl-THF that has a glutamyl group in the D-form.
  • the liposome contains gamma polyglutamated 5,l0-methenyl-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma tetraglutamated [6R]-5,l0-methenyl-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6R,S]-5,l0-methenyl-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6S]-5,l0-methenyl- THF. In some embodiments, the gamma tetraglutamated 5,l0-methenyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated
  • 5,l0-methenyl-THF comprises a glutamyl group in the D-form.
  • the gamma tetraglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma pentaglutamated [6R]-5,l0-methenyl-THF. In some embodiments, the liposome comprises gamma pentaglutamated [6R,S]-5,l0-methenyl-THF. In some embodiments, the liposome comprises gamma pentaglutamated [6S]-5,l0-methenyl- THF. In some embodiments, the gamma pentaglutamated 5,l0-methenyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated
  • 5,l0-methenyl-THF comprises a glutamyl group in the D-form.
  • the gamma pentaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma hexaglutamated [6R]-5,l0-methenyl-THF. In some embodiments, the liposome comprises gamma hexaglutamated [6R,S]-5,l0-methenyl-THF. In some embodiments, the liposome comprises gamma hexaglutamated [6S]-5,l0-methenyl- THF.
  • the gamma hexaglutamated 5,l0-methenyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5,l0-methenyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated 5-methyl-THF.
  • the liposome comprises gamma polyglutamated [6S] -5-methyl-THF.
  • the liposome comprises gamma polyglutamated [6R,S]-5-methyl-THF.
  • the liposome comprises gamma polyglutamated [6R]-5-methyl-THF.
  • the liposome contains gamma polyglutamated 5-methyl-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5-methyl-THF). In some embodiments, the liposome contains gamma polyglutamated 5-methyl-THF that has two or more glutamyl groups in the L-form. In other embodiments, the liposome contains gamma polyglutamated 5-methyl-THF that has a glutamyl group in the D-form. In further embodiments, the liposome contains gamma polyglutamated 5-methyl-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5-methyl-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (/. ⁇ ? ., tetraglutamated 5-methyl-THF).
  • the liposome comprises gamma tetraglutamated [6S]-5-methyl-THF.
  • the liposome comprises gamma tetraglutamated [6R,S]-5-methyl-THF.
  • the liposome comprises gamma tetraglutamated [6R]-5-methyl-THF.
  • the gamma tetraglutamated 5-methyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated 5-methyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated 5-methyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5-methyl-THF that contains a chain of 4 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( i.e pentaglutamated 5-methyl-THF).
  • the liposome comprises gamma pentaglutamated [6S]-5-methyl-THF.
  • the liposome comprises gamma pentaglutamated [6R,S]-5-methyl-THF.
  • the liposome comprises gamma pentaglutamated [6R]-5-methyl-THF.
  • the gamma pentaglutamated 5-methyl-THF comprises two or more glutamyl groups in the L- form. In other embodiments, the gamma pentaglutamated 5-methyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5-methyl- THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L- form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5-methyl-THF that that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate (/. ⁇ ? ., hexaglutamated 5-methyl-THF).
  • the liposome comprises gamma hexaglutamated [6S] -5-methyl-THF.
  • the liposome comprises gamma hexaglutamated [6R,S]-5-methyl-THF.
  • the liposome comprises gamma hexaglutamated [6R]-5-methyl-THF.
  • the gamma hexaglutamated 5-methyl-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated 5-methyl-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5-methyl-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated THF.
  • the liposome comprises gamma polyglutamated [6S]-THF.
  • the liposome comprises gamma polyglutamated [6R,S]-THF.
  • the liposome comprises gamma polyglutamated [6R]-THF.
  • the liposome contains gamma polyglutamated THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in THF).
  • the liposome contains gamma polyglutamated THF that has two or more glutamyl groups in the L-form. In other embodiments, the liposome contains gamma polyglutamated THF that has a glutamyl group in the D-form. In further embodiments, the liposome contains gamma polyglutamated THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form. d.
  • the Lp-yPTHF composition comprises a gamma polyglutamated tetrahydrofolate that contains a chain of 3 glutamyl groups attached to the glutamyl group of THF (i.e tetraglutamated tetrahydrofolate).
  • the liposome comprises gamma tetraglutamated [6S] tetrahydrofolate.
  • the liposome comprises gamma tetraglutamated [6R,S]-THF.
  • the liposome comprises gamma tetraglutamated [6R]-THF.
  • the gamma tetraglutamated THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated tetrahydrofolate that contains a chain of 4 glutamyl groups attached to the glutamyl group of THF (i.e ., pentaglutamated tetrahydrofolate).
  • the liposome comprises gamma pentaglutamated [6S] tetrahydrofolate.
  • the liposome comprises gamma pentaglutamated [6R,S]-THF.
  • the liposome comprises gamma pentaglutamated [6R]-THF.
  • the gamma pentaglutamated THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated tetrahydrofolate that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., hexaglutamated tetrahydrofolate).
  • the liposome comprises gamma hexaglutamated [6S] tetrahydrofolate.
  • the liposome comprises gamma hexaglutamated [6R,S]-THF.
  • the liposome comprises gamma hexaglutamated [6R]-THF.
  • the gamma hexaglutamated THF comprises two or more glutamyl groups in the L-form. In other embodiments, the hexaglutamated THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated 5,l0-methylene-THF.
  • the liposome comprises gamma polyglutamated [6R]-5,l0-methylene-THF.
  • the liposome comprises gamma polyglutamated [6R,S]-5,l0-methylene- THF.
  • the liposome comprises gamma polyglutamated [6S]-5,l0- methylene-THF.
  • the liposome contains gamma polyglutamated 5,10- methylene-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5,l0-methylene-THF). In some embodiments, the liposome contains gamma polyglutamated 5,l0-methylene-THF that has two or more glutamyl groups in the L- form. In other embodiments, the liposome contains gamma polyglutamated 5,l0-methylene- THF that has a glutamyl group in the D-form. In further embodiments, the liposome contains gamma polyglutamated 5,l0-methylene-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma tetraglutamated [6R]-5,l0-methylene-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6S]-5,l0-methylene- THF. In some embodiments, the gamma tetraglutamated 5,l0-methylene-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma tetraglutamated
  • 5,l0-methylene-THF comprises a glutamyl group in the D-form.
  • the gamma tetraglutamated 5,l0-methylene-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma pentaglutamated [6R] 5, lO-methylene-THF. In some embodiments, the liposome comprises gamma pentaglutamated [6R,S]-5, lO-methylene-THF. In some embodiments, the liposome comprises gamma pentaglutamated [6S]-5,l0- methylene-THF.
  • the gamma pentaglutamated 5, lO-methylene-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated 5, lO-methylene-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5,l0-methylene-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated 5,l0-methylene-THF that contains a chain of 5 glutamyl groups attached to the glutamyl group of tetrahydrofolate ( . ⁇ ? ., hexaglutamated 5,l0-methylene-THF).
  • the liposome comprises gamma hexaglutamated [6R] 5,l0-methylene-THF.
  • the liposome comprises gamma hexaglutamated [6R] 5,l0-methylene-THF.
  • the liposome comprises gamma hexaglutamated [6R,S]-5,l0-methylene- THF. In some embodiments, the liposome comprises gamma hexaglutamated [6S]-5,l0- methylene-THF. In some embodiments, the gamma hexaglutamated 5,l0-methylene-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated 5,l0-methylene-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5,l0-methylene-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the disclosure provides a composition comprising a liposome encapsulating (filled with) gamma polyglutamated 5-formimino-THF.
  • the liposome comprises gamma polyglutamated [6S]-5-formimino-THF.
  • the liposome comprises gamma polyglutamated [6R,S]-5-formimino-THF.
  • the liposome comprises gamma polyglutamated [6R] -5-formimino-THF.
  • the liposome contains gamma polyglutamated 5-formimino-THF that has 2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the glutamyl group in 5-formimino-THF). In some embodiments, the liposome contains gamma polyglutamated 5- formimino-THF that has two or more glutamyl groups in the L-form. In other embodiments, the liposome contains gamma polyglutamated 5-formimino-THF that has a glutamyl group in the D-form. In further embodiments, the liposome contains gamma polyglutamated 5- formimino-THF that has a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated (b) polyglutamated-5-formyl-THF; (c) polyglutamated-5,l0-methenyl-THF; (d) poly- glutamated-5-methyl-THF; (e) polyglutamated-tetrahydrofolate; (f) polyglutamated-5,l0- methylene-THF; and (g) polyglutamated-5-formimino-THF that contains a chain of 3 glutamyl groups attached to the glutamyl group of tetrahydrofolate (i.e., tetraglutamated 5- formimino-THF).
  • the liposome comprises gamma tetraglutamated [6S]-5-formimino-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6S] 5-formimino-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6R,S] -5-formimino-THF. In some embodiments, the liposome comprises gamma tetraglutamated [6R]-5-formimino-THF. In some embodiments, the gamma tetraglutamated 5-formimino-THF comprises two or more glutamyl groups in the L-form.
  • the gamma tetraglutamated 5-formimino-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma tetraglutamated 5-formimino-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma pentaglutamated [6S]-5-formimino-THF. In some embodiments, the liposome comprises gamma pentaglutamated [6R,S] -5-formimino-THF. In some embodiments, the liposome comprises gamma pentaglutamated [6R] 5-formimino-THF.
  • the gamma pentaglutamated 5-formimino-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma pentaglutamated 5- formimino-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma pentaglutamated 5-formimino-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition comprises a gamma polyglutamated
  • the liposome comprises gamma hexaglutamated [6S]-5-formimino-THF. In some embodiments, the liposome comprises gamma hexaglutamated [6R,S]-5-formimino-THF. In some embodiments, the liposome comprises gamma hexaglutamated [6R] 5-formimino-THF.
  • the gamma hexaglutamated 5-formimino-THF comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated 5- formimino-THF comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated 5-formimino-THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the Lp-yPTHF composition is cationic.
  • the Lp-yPTHF liposome is cationic and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between.
  • the Lp-yPTHF liposome is cationic and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the cationic Lp-yPTHF composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma polyglutamated THF.
  • at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, of the starting material of gamma polyglutamated THF is encapsulated (entrapped) in the cationic Lp-yPTHF.
  • the gamma polyglutamated tetrahydrofolate encapsulated by the liposome is in a HEPES buffered solution within the liposome.
  • Lp-yPTHF composition is anionic or neutral.
  • the Lp-yPTHF liposome is anionic or neutral and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between.
  • the Lp-yPTHF liposome is anionic or neutral and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the Lp-yPTHF liposome is anionic and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further embodiments, the Lp-yPTHF liposome is anionic and the composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the Lp-yPTHF liposome is neutral and has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between.
  • the anionic or neutral Lp-yPTHF composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma polyglutamated THF.
  • the anionic or neutral Lp-yPTHF composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma tetraglutamated THF.
  • the anionic or neutral Lp- yPTHF composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma pentaglutamated THF. In some embodiments, the anionic or neutral Lp-yPTHF composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma hexaglutamated THF. In additional embodiments, the gamma polyglutamated tetrahydrofolate encapsulated by the liposome is in a HEPES buffered solution within the liposome.
  • the liposomal gamma polyglutamated tetrahydrofolate composition is pegylated (PLp-yPTHF).
  • the liposomal gamma polyglutamated tetrahydrofolate composition is non-targeted (NTLp-yPTHF). That is, the NTLp-yPTHF composition does not have specific affinity towards an epitope (e.g ., an epitope of a surface antigen) expressed on the surface of a target cell of interest.
  • the non-targeted liposomal gamma polyglutamated tetrahydrofolate composition is pegylated (NTPLp-yPTHF).
  • the liposomal gamma polyglutamated tetrahydrofolate composition is targeted (TLp-yPTHF). That is, the TLp-yPTHF composition contains a targeting moiety that has specific affinity for an epitope (surface antigen) on a target cell of interest. In some embodiments, the targeting moiety of the TLp-yPTHF or TPLp-yPTHF is not attached to the liposome through a covalent bond. In other embodiments, the targeting moiety of the TLp-yPTHF or TPLp-yPTHF is attached to one or both of a PEG and the exterior of the liposome.
  • Targeted liposomal gamma polyglutamated tetrahydrofolate compositions provide further improvements over the efficacy and safety profile of tetrahydrofolate, by specifically delivering gamma polyglutamated (e.g., g-pentaglutamated and/or g-hexaglutamated) tetrahydrofolate to target cells such as cancer cells.
  • the targeted liposomal gamma polyglutamated tetrahydrofolate composition is pegylated (TPLp-yPTHF).
  • the targeting moiety of the TLp-yPTHF or TPLp-yPTHF is attached to one or both of a PEG and the exterior of the liposome. In some embodiments, the targeting moiety of the TLp-yPTHF or TPLp-yPTHF is attached to the liposome through a covalent bond.
  • Function of the targeting moiety of the TLp-yPTHF and/or TPLp-yPTHF compositions include but are not limited to, targeting the liposome to the target cell of interest in vivo or in vitro; interacting with the surface antigen for which the targeting moiety has specific affinity, and delivering the liposome payload (yPTHF) into the cell.
  • Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen-binding antibody fragments, scaffold proteins, polypeptides, and peptides.
  • the targeting moiety is a polypeptide.
  • the targeting moiety is a polypeptide that comprises at least 3, 5, 10, 15, 20, 30, 40, 50, or 100, amino acid residues.
  • the targeting moiety of the TLp-yPTHF or TPLp-yPTHF is an antibody or an antigen-binding antibody fragment.
  • the targeting moiety comprises one or more of an antibody, a humanized antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi-specific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody.
  • the targeting moiety of the TLp-yPTHF or TPLp-yPTHF has specific affinity for an epitope that is preferentially expressed on a target cell such as a tumor cell, compared to normal or non-tumor cells.
  • the targeting moiety has specific affinity for an epitope on a tumor cell surface antigen that is present on a tumor cell but absent or inaccessible on a non-tumor cell. In some embodiments, the targeting moiety binds an epitope of interest with an equilibrium dissociation constant (Kd) in a range of 0.5 x l0 10 to 10 x 10 6 as determined using BIACORE® analysis.
  • Kd equilibrium dissociation constant
  • the TLp-yPTHF or TPLp-yPTHF targeting moiety comprises a polypeptide that specifically binds a folate receptor.
  • the targeting moiety is an antibody or an antigen-binding antibody fragment.
  • the folate receptor bound by the targeting moiety is one or more folate receptors selected from the group consisting of: folate receptor alpha (FR-a, FOLR1), folate receptor beta (FR-b, FOLR2), and folate receptor delta (FR-d, FOLR4).
  • the folate receptor bound by the targeting moiety is folate receptor alpha (FR-a).
  • the folate receptor bound by the targeting moiety is folate receptor beta (FR-b).
  • the targeting moiety specifically binds FR-a and FR-b.
  • the Lp-yPTHF composition comprises one or more of an immunostimulatory agent, a detectable marker, and a maleimide, disposed on at least one of the PEG and the exterior of the liposome.
  • the liposome yPTHF composition e.g ., Lp-yPTHF, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF, or TPLp-yPTHF
  • Lp-yPTHF, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF, or TPLp-yPTHF is cationic.
  • the liposome yPTHF composition e.g., Lp- yPTHF, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF or TPLp-yPTHF
  • Lp- yPTHF, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF or TPLp-yPTHF is anionic or neutral.
  • the liposome of the liposome yPTHF composition (e.g., Lp-yPTHF, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF or TPLp-yPTHF) has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, 30 nm to 175 nm, 50 nm to 150 nm, or any range therein between. In some embodiments, the liposome of the liposomc-yPTHF composition has a diameter in the range of 30 nm to 175 nm or 50 nm to 150 nm, or any range therein between.
  • the liposome of the liposome yPTHF composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the liposome yPTHF composition is pegylated (e.g., PLp-yPTHF, NTPLp- yPTHF, or TPLp-yPTHF).
  • the liposome yPTHF composition comprises a targeting moiety (e.g., TLp-yPTHF or TPLp-yPTHF).
  • the liposome yPTHF composition is pegylated and targeted (e.g., TPLp-yPTHF).
  • the liposome yPTHF composition comprises gamma polyglutamated tetrahydro folate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome yPTHF composition comprises gamma tetraglutamated tetrahydrofolate. In some embodiments, the liposome yPTHF composition comprises gamma pentaglutamated tetrahydrofolate. In other embodiments, the liposome yPTHF composition comprises gamma hexaglutamated tetrahydrofolate.
  • the liposome compositions comprise a gamma polyglutamated tetrahydrofolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups and at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma polyglutamated THF.
  • the Lp-yPTHF composition comprises gamma polyglutamated tetrahydrofolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups and l%-98.5% w/w of the gamma polyglutamated THF.
  • the liposomes comprise gamma polyglutamated tetrahydrofolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups and wherein during the process of preparing the Lp-yPTHF, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of gamma polyglutamated THF is encapsulated (entrapped) in the Lp-yPTHF.
  • the liposome compositions comprise a gamma tetraglutamated tetrahydrofolate and at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma tetraglutamated THF.
  • the Lp-yPTHF composition comprises gamma tetraglutamated tetrahydrofolate and l%-98.5% w/w of the gamma tetraglutamated THF.
  • the liposomes comprise gamma tetraglutamated tetrahydrofolate and wherein during the process of preparing the Lp-yPTHF, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of gamma tetraglutamated THF is encapsulated (entrapped) in the Lp-yPTHF.
  • the liposome compositions comprise a gamma pentaglutamated tetrahydrofolate and at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma pentaglutamated THF.
  • the Lp-yPTHF composition comprises gamma pentaglutamated tetrahydrofolate and 1 %-98.5% w/w of the gamma pentaglutamated THF.
  • the liposomes comprise gamma pentaglutamated tetrahydrofolate and wherein during the process of preparing the Lp-yPTHF, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of gamma pentaglutamated THF is encapsulated (entrapped) in the Lp-yPTHF.
  • the liposome compositions comprise a gamma hexaglutamated tetrahydrofolate and at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma hexaglutamated THF.
  • the Lp-yPTHF composition comprises gamma hexaglutamated tetrahydrofolate and l%-98.5% w/w of the gamma hexaglutamated THF.
  • the liposomes comprise gamma hexaglutamated tetrahydrofolate and wherein during the process of preparing the Lp-yPTHF, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% of the starting material of gamma pentaglutamated THF is encapsulated (entrapped) in the Lp-yPTHF.
  • Liposomal compositions comprising liposomes encapsulating yPTHF are also provided.
  • the liposomal composition comprises a pegylated yPTHF composition.
  • the liposomal composition comprises a yPTHF composition that is linked to or otherwise associated with a targeting moiety.
  • the liposomal composition comprises a yPTHF composition that is pegylated and linked to or otherwise associated with a targeting moiety.
  • the liposomal composition comprises yPTHF that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the liposomal composition comprises gamma tetraglutamated tetrahydrofolate. In some embodiments, the liposomal composition comprises gamma pentaglutamated tetrahydrofolate. In other embodiments, the liposomal composition comprises gamma hexaglutamated tetrahydrofolate.
  • the liposomal composition comprises a liposome yPTHF (e.g.,
  • the liposome yPTHF is pegylated (e.g., NTPLp-yPTHF, and TPLp- yPTHF).
  • the liposome yPTHF comprises a targeting moiety that has a specific affinity for an epitope of an antigen on the surface of a target cell of interest such as a cancer cell (e.g., TLp-yPTHF or TPLp-yPTHF)).
  • the liposomal composition comprises a liposome yPTHF that is pegylated and further comprises a targeting moiety that has a specific affinity for an epitope of an antigen on the surface of a target cell of interest such as a cancer cell (e.g., TPLp-yPTHF).
  • a target cell of interest such as a cancer cell
  • the liposomal composition comprises a liposome yPTHF that is cationic.
  • the liposomal composition comprises a liposome yPTHF that is anionic or neutral.
  • the liposomal composition comprises a liposome yPTHF that has a diameter in the range of 20 nm to 500 nm, 20 nm to 200 nm, or any range therein between. In further embodiments, the liposome yPTHF has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • compositions comprising gamma polyglutamated tetrahydrofolate
  • the pharmaceutical composition comprises a pegylated yPTHF composition.
  • the pharmaceutical composition comprise a yPTHF composition that is linked to or otherwise associated with a targeting moiety.
  • the pharmaceutical composition comprise a yPTHF composition that is pegylated and linked to or otherwise associated with a targeting moiety.
  • the pharmaceutical composition comprises yPTHF that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the pharmaceutical composition comprises gamma tetraglutamated tetrahydrofolate.
  • the pharmaceutical composition comprises gamma pentaglutamated tetrahydrofolate.
  • the pharmaceutical composition comprises gamma hexaglutamated tetrahydrofolate.
  • the pharmaceutical compositions comprise a liposome yPTHF
  • the liposome yPTHF composition is pegylated (e.g., NTPLp- yPTHF, and TPLp-yPTHF).
  • the liposome yPTHF comprises a targeting moiety that has a specific affinity for an epitope of an antigen on the surface of a target cell of interest such as a cancer cell (e.g., TLp-yPTHF or TPLp-yPTHF)).
  • the pharmaceutical composition comprises a liposome yPTHF composition that is pegylated and further comprises a targeting moiety that has a specific affinity for an epitope of an antigen on the surface of a target cell of interest such as a cancer cell (e.g., TPLp-yPTHF).
  • the pharmaceutical composition comprises a liposome yPTHF that is cationic.
  • the pharmaceutical composition comprises a liposome yPTHF that is anionic or neutral.
  • the pharmaceutical composition comprises a liposome yPTHF that has a diameter in the range of 20 nm to 500 nm or 20 nm to 500 nm, or any range therein between.
  • the liposome yPTHF composition has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the disclosure provides a method of killing a cell that comprises contacting the cell with a composition comprising a gamma polyglutamated tetrahydrofolate (yPTHF) composition (e.g., a yPTHF disclosed herein).
  • yPTHF gamma polyglutamated tetrahydrofolate
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the hyperproliferative cell is a cancer cell.
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from the group consisting of: a non-hemato logic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non-hemato logic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from the group consisting of: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central Nervous System (CNS) lymphoma.
  • a cancer selected from the group consisting of: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chor
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from colorectal cancer.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the yPTHF contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups. In some embodiments, the yPTHF contains 5-formyl-THF contains 4 g-glutamyl groups. In some embodiments, the yPTHF contains 5-formyl-THF contains 5 g-glutamyl groups. In some embodiments, the yPTHF contains contains 6 g-glutamyl groups. In some embodiments the yPTHF comprises g-glutamyl groups in the D-form. In some embodiments, the yPTHF contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D-form.
  • the yPTHF comprises g-glutamyl groups in the L-form. In some embodiments, the yPTHF contains 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form. In some embodiments the yPTHF comprises g-glutamyl groups in the L and D-form. In some embodiments the yPTHF contains 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form. In some embodiments, the yPTHF composition comprises gamma tetraglutamated tetrahydrofolate. In some embodiments, the yPTHF composition comprises gamma pentaglutamated tetrahydrofolate. In other embodiments, the yPTHF composition comprises gamma hexaglutamated tetrahydrofolate .
  • the disclosure provides a method of killing a cell that comprises contacting the cell with a liposome containing gamma polyglutamated tetrahydrofolate (e.g ., an Lp-yPTHF such as, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF or TPLp-yPTHF).
  • a liposome containing gamma polyglutamated tetrahydrofolate e.g ., an Lp-yPTHF such as, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF or TPLp-yPTHF.
  • the contacted cell is a mammalian cell.
  • the contacted cell is a human cell.
  • the contacted cell is a hyperproliferative cell.
  • the contacted hyperproliferative cell is a cancer cell.
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from the group consisting of: a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gas
  • the contacted cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from the group consisting of: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central Nervous System (CNS) lymphoma.
  • a cancer selected from the group consisting of: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chor
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from colorectal cancer.
  • the method is performed in vivo. In other embodiments, the method is performed in vitro.
  • the liposome contains a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome contains gamma tetraglutamated tetrahydrofolate. In some embodiments, the liposome contains gamma pentaglutamated tetrahydrofolate. In other embodiments, the liposome contains gamma hexaglutamated tetrahydrofolate.
  • the liposome comprises a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups. In some embodiments, the liposome comprises a yPTHF containing 4 g-glutamyl groups. In some embodiments, the liposome comprises a yPTHF containing 5 g-glutamyl groups. In some embodiments, the liposome comprises a yPTHF containing 6 g-glutamyl groups. In some embodiments, the liposome comprises a yPTHF comprising a g-glutamyl group in the D-form.
  • the liposome comprises a yPTHF containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D- form. In some embodiments, the liposome comprises a yPTHF comprising g-glutamyl groups in the L-form. In some embodiments, the liposome comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form. In some embodiments, the liposome comprises a yPTHF comprising g-glutamyl groups in the L form and the D form.
  • the liposome comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g- glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D- form.
  • the liposome comprises gamma pentaglutamated tetrahydrofolate. In other embodiments, the liposome comprises gamma hexaglutamated tetrahydrofolate .
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a delivery vehicle (( e.g ., an immunoconjugate or liposome) comprising gamma polyglutamated tetrahydrofolate to a subject having or at risk of having cancer.
  • a delivery vehicle (( e.g ., an immunoconjugate or liposome) comprising gamma polyglutamated tetrahydrofolate to a subject having or at risk of having cancer.
  • the delivery vehicle is an antibody-containing immunoconjugate (comprising e.g., a full-length IgG antibody, a bispecific antibody, or a scFv).
  • the delivery vehicle is a liposome (e.g., an Lp-yPTHF such as, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF, or TPLp-yPTHF).
  • the administered delivery vehicle is pegylated. In some embodiments, the administered delivery vehicle is not pegylated. In additional embodiments, the administered delivery vehicle comprises a targeting moiety that has a specific affinity for an epitope of an antigen on the surface of a cancer cell.
  • the delivery vehicle comprises a targeting moiety that has specific affinity for an epitope of a cell surface antigen selected from the group consisting of: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P cadherin, fibronectin extra-domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER3,
  • the delivery vehicle comprises a targeting moiety that specifically binds a cell surface antigen(s) derived from, or determined to be expressed on, a specific subject’s cancer (tumor) such as a neoantigen.
  • the targeting moiety has specific affinity for an epitope of a cell surface antigen(s) derived from or determined to be expressed on a specific subject’s tumor such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the administered delivery vehicle comprises yPTHF containing 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the administered delivery vehicle comprises yPTHF containing 4 g-glutamyl groups. In some embodiments, the administered delivery vehicle comprises yPTHF containing 5 g-glutamyl groups. In some embodiments, the administered delivery vehicle comprises yPTHF containing 6 g-glutamyl groups.
  • the yPTHF is a member selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5- formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl- THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0- methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl- THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S]-Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-THF (e.g., polyglutamated [6R]-5,l0-methylene- THF); and (g)
  • the yPTHF is polyglutamated 5,l0-methylene-THF. In further embodiments, the yPTHF is polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the yPTHF is polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the yPTHF is polyglutamated 5-methyl-THF. In further embodiments, the yPTHF is [6S]-5-methyl-THF. In other embodiments, the yPTHF is [6R,S]-5-methyl-THF. In some embodiments, the yPTHF is polyglutamated 5-formyl-THF.
  • the yPTHF is polyglutamated[is polyglutamated [6S] -5-formyl-THF. In other embodiments, the yPTHF is polyglutamated [6R,S]-5-formyl-THF.
  • the delivery vehicle comprises a yPTHF containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D-form. In some embodiments, the delivery vehicle comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g- glutamyl groups in the L-form. In some embodiments the delivery vehicle comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form. In some embodiments, the administered delivery vehicle comprises gamma tetraglutamated tetrahydrofolate.
  • the administered delivery vehicle comprises gamma pentaglutamated tetrahydrofolate. In other embodiments, the administered delivery vehicle comprises gamma hexaglutamated tetrahydrofolate. In some embodiments, the administered delivery vehicle comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated 5-form
  • the administered delivery vehicle comprises polyglutamated 5,10- methylene-THF. In further embodiments, the administered delivery vehicle comprises polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the administered delivery vehicle comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered delivery vehicle comprises polyglutamated 5-methyl-THF. In further embodiments, the administered delivery vehicle comprises [6S] -5-methyl-THF. In other embodiments, the administered delivery vehicle comprises [6R,S]-5-methyl-THF. In some embodiments, the administered delivery vehicle comprises polyglutamated 5-formyl-THF.
  • the administered delivery vehicle comprises polyglutamated [6S]-5- formyl-THF. In other embodiments, the administered delivery vehicle comprises polyglutamated [6R,S]-5-formyl-THF. In some embodiments, the administered delivery vehicle comprises L gamma polyglutamated tetrahydrofolate. In some embodiments, the administered delivery vehicle comprises D gamma polyglutamated tetrahydrofolate. In further embodiments, the administered delivery vehicle comprises L and D gamma polyglutamated tetrahydrofolate.
  • the cancer is selected from the group consisting of: a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma, brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary
  • the cancer is selected from the group consisting of: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central Nervous System (CNS) lymphoma.
  • NHL Non-Hodgkin's lymphoma
  • ALL acute lymphoblastic leukemia
  • mycosis fungoides cutaneous T-cell lymphoma
  • choriocarcinoma choriocarcinoma
  • chorioadenoma nonleukemic meningeal cancer
  • soft tissue sarcoma desmoid tumors, aggressive fibromatosis, bladder cancer
  • CNS central Nervous
  • the cancer is selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • the cancer is colorectal cancer.
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a liposome comprising gamma polyglutamated tetrahydrofolate (e.g., an Lp-yPTHF such as, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF, or TPLp-yPTHF) to a subject having or at risk of having cancer.
  • a liposome comprising gamma polyglutamated tetrahydrofolate (e.g., an Lp-yPTHF such as, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF, or TPLp-yPTHF)
  • an Lp-yPTHF such as, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF, or TPLp-yPTHF
  • the liposome is pe
  • the liposome comprises a targeting moiety that has specific affinity for an epitope of a cell surface antigen selected from the group consisting of: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-l (ZIP6), CGEN-15027, P cadherin, fibronectin extra-domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER
  • the liposome comprises a targeting moiety that has specific affinity for an epitope of a cell surface antigen(s) derived from or determined to be expressed on a specific subject’s tumor such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the liposome comprises yPTHF containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered liposome comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S]-Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-THF (e.g., polyglutamated [6R]-5,l0-methylene-THF); and
  • the administered liposome comprises polyglutamated 5,l0-methylene-THF. In further embodiments, the administered liposome comprises polyglutamated [6R]-5,l0- methylene-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered liposome comprises polyglutamated 5-methyl-THF. In further embodiments, the administered liposome comprises [6S] -5-methyl-THF. In other embodiments, the administered liposome comprises [6R,S]-5- methyl-THF. In some embodiments, the administered liposome comprises polyglutamated 5- formyl-THF.
  • the administered liposome comprises polyglutamated [6S] -5-formyl-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5-formyl-THF. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing g-glutamyl groups in the L-form. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form.
  • a liposome of the administered liposomal composition comprises a yPTHF containing g-glutamyl groups in the L and D-forms. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D- form. In some embodiments the administered liposomal composition comprises tetraglutamated yPTHF. In some embodiments the administered liposomal composition comprises pentaglutamated yPTHF. In some embodiments the administered liposomal composition comprises hexaglutamated yPTHF.
  • the cancer is selected from the group consisting of: lung (e.g ., non-small lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, and a hematologic malignancy (e.g., a leukemia or lymphoma).
  • lung e.g ., non-small lung cancer
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esophageal cancer
  • cervical cancer cervical cancer
  • liver cancer liver cancer
  • kidney cancer biliary duct cancer
  • gallbladder cancer gallbladder cancer
  • bladder cancer sarcoma
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from a cancer selected from colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • the cancer cell is a primary cell or a cell from a cell line obtained/derived from colorectal cancer.
  • the disclosure provides a method for treating cancer that comprises administering to a subject having or at risk of having cancer, an effective amount of a liposomal composition comprising a liposome that comprises gamma polyglutamated tetrahydrofolate and a targeting moiety that has a specific affinity for an epitope of an antigen on the surface of the cancer.
  • the liposome comprises a targeting moiety that has specific affinity for an epitope of a cell surface antigen selected from the group consisting of: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC- 16, Tissue factor, LIV-l (ZIP6), CGEN- 15027, P cadherin, fibronectin extra-domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER
  • the liposome comprises a targeting moiety that a targeting moiety that has specific affinity for an epitope of a cell surface antigen(s) derived from, or determined to be expressed on, a specific subject’s cancer (tumor) such as a neoantigen.
  • the targeting moiety is an antibody or an antigen binding antibody fragment.
  • the liposome comprises yPTHF containing 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 4 g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 5 g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 6 g-glutamyl groups.
  • the administered liposome comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S]-Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-
  • the administered liposome comprises polyglutamated 5,l0-methylene- THF. In further embodiments, the administered liposome comprises polyglutamated [6R]- 5,l0-methylene-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered liposome comprises polyglutamated 5-methyl-THF. In further embodiments, the administered liposome comprises [6S]-5-methyl-THF. In other embodiments, the administered liposome comprises [6R,S]-5-methyl-THF. In some embodiments, the administered liposome comprises polyglutamated 5-formyl-THF.
  • the administered liposome comprises polyglutamated [6S]-5-formyl-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5-formyl-THF. In some embodiments, the liposome comprises a yPTHF containing g-glutamyl groups in the L-form. In some embodiments, the liposome comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form. In some embodiments, the liposome comprises a yPTHF containing g-glutamyl groups in the D-form.
  • the liposome comprises a yPTHF containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D-form. In some embodiments, the liposome comprises a gamma tetraglutamated tetrahydrofolate. In some embodiments, the liposome comprises a gamma pentaglutamated tetrahydrofolate. In some embodiments, the liposome comprises a gamma hexaglutamated tetrahydrofolate .
  • the administered liposomal composition comprises pegylated liposomes (e.g., TPLp-yPTHF). In some embodiments, the administered liposomal composition comprises liposomes that are not pegylated. In some embodiments, liposomes of the administered liposomal composition comprise a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, gamma glutamyl groups. In some embodiments, the administered liposome comprises yPTHF containing 4 g-glutamyl groups. In some embodiments, the administered liposome comprises yPTHF containing 5 g-glutamyl groups.
  • pegylated liposomes e.g., TPLp-yPTHF
  • the administered liposomal composition comprises liposomes that are not pegylated.
  • liposomes of the administered liposomal composition comprise a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, gamma glutamyl groups.
  • the administered liposome comprises yPTHF containing 6 g-glutamyl groups.
  • the administered liposome comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S] -5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S]-Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene
  • the administered liposome comprises polyglutamated 5,l0-methylene-THF. In further embodiments, the administered liposome comprises polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered liposome comprises polyglutamated 5-methyl-THF. In further embodiments, the administered liposome comprises [6S]-5-methyl-THF. In other embodiments, the administered liposome comprises [6R,S]-5-methyl-THF. In some embodiments, the administered liposome comprises polyglutamated 5-formyl-THF.
  • the administered liposome comprises polyglutamated [6S]-5-formyl-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S] -5-formyl- THF. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing g-glutamyl groups in the D-form. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D-form.
  • a liposome of the administered liposomal composition comprises a yPTHF containing g-glutamyl groups in the L-form. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing g-glutamyl groups in the L and D-forms.
  • a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form.
  • liposomes of the administered liposomal composition comprise gamma tetraglutamated tetrahydrofolate.
  • liposomes of the administered liposomal composition comprise gamma pentaglutamated tetrahydrofolate.
  • liposomes of the administered liposomal composition comprise gamma hexaglutamated tetrahydrofolate.
  • the liposomal composition is administered to treat a cancer selected from the group consisting of: lung cancer (e.g., non-small cell), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, myeloma, a leukemia and a lymphoma.
  • lung cancer e.g., non-small cell
  • pancreatic cancer breast cancer, ovarian cancer, prostate cancer, head and neck cancer
  • gastric cancer gastrointestinal cancer
  • colorectal cancer esophageal cancer
  • cervical cancer cervical cancer
  • liver cancer liver cancer
  • kidney cancer biliary duct cancer
  • gallbladder cancer gallbladder cancer
  • bladder cancer sarcom
  • the liposomal composition is administered to treat a cancer selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • a cancer selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • the liposomal composition is administered to treat colorectal cancer.
  • the disclosure provides a method for treating cancer that comprises administering an effective amount of a liposomal composition to a subject having or at risk of having a cancer that expresses folate receptor on its cell surface, wherein the liposomal composition comprises liposomes that comprise (a) gamma polyglutamated tetrahydrofolate (yPTHF) and (b) a targeting moiety that has specific binding affinity for a folate receptor.
  • the targeting moiety has specific binding affinity for folate receptor alpha (FR-a), folate receptor beta (FR-b), and/or folate receptor delta (FR-d).
  • the targeting moiety has a specific binding affinity for folate receptor alpha (FR-a), folate receptor beta (FR-b), and/or folate receptor delta (FR-d). In some embodiments, the targeting moiety has a specific binding affinity for folate receptor alpha (FR-a) and folate receptor beta (FR-b).
  • the administered liposomal composition comprises pegylated liposomes (e.g., TPLp-yPTHF). In some embodiments, the administered liposomal composition comprises liposomes that are not pegylated. In some embodiments, liposomes of the administered liposomal composition comprises a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 4 g-glutamyl groups. In some embodiments, the administered liposome comprises yPTHF containing 5 g-glutamyl groups. In some embodiments, the administered liposome comprises yPTHF containing 6 g-glutamyl groups.
  • the administered liposome comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S]-Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-THF (e.g., polyglutamated [6R]-5,l0-methylene-THF); and
  • the administered liposome comprises polyglutamated 5,l0-methylene- THF. In further embodiments, the administered liposome comprises polyglutamated [6R]- 5,l0-methylene-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered liposome comprises polyglutamated 5-methyl-THF. In further embodiments, the administered liposome comprises [6S]-5-methyl-THF. In other embodiments, the administered liposome comprises [6R,S]-5-methyl-THF. In some embodiments, the administered liposome comprises polyglutamated 5-formyl-THF.
  • the administered liposome comprises polyglutamated [6S]-5-formyl-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5-formyl-THF. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 1, 2, 3,
  • a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4,
  • a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form.
  • a liposome of the administered liposomal composition comprises gamma pentaglutamated tetrahydrofolate.
  • a liposome of the administered liposomal composition comprises gamma hexaglutamated tetrahydrofolate.
  • the liposomal composition is administered to treat a cancer selected from the group consisting of: a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma ( e.g ., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a cancer selected from the group consisting of: a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gas
  • the liposomal composition is administered to treat a cancer is selected from the group consisting of: breast cancer, head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, and chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis, bladder cancer, and central Nervous System (CNS) lymphoma.
  • NHL Non-Hodgkin's lymphoma
  • ALL acute lymphoblastic leukemia
  • mycosis fungoides cutaneous T-cell lymphoma
  • choriocarcinoma choriocarcinoma
  • chorioadenoma nonleukemic meningeal cancer
  • soft tissue sarcoma desmoid tumors, aggressive fibromatos
  • the liposomal composition is administered to treat a cancer selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • a cancer selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • the disclosure provides a method for cancer maintenance therapy that comprises administering an effective amount of a liposomal composition comprising liposomes that contain gamma polyglutamated tetrahydrofolate (Lp-yPTHF) to a subject that is undergoing or has undergone cancer therapy.
  • the administered liposomal composition is a PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp- yPTHF or TPLp-yPTHF.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-yPTHF, NTPLp-yPTHF, or TPLp-yPTHF).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPTHF or TPLp-yPTHF).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-yPTHF).
  • a liposome of the administered liposomal composition comprises gamma polyglutamated tetrahydrofolate that contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 4 g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 5 g-glutamyl groups. In some embodiments, the administered liposome comprises yPTHF containing 6 g-glutamyl groups. In some embodiments, the administered liposome comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]- lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated
  • the administered liposome comprises polyglutamated 5,l0-methylene-THF. In further embodiments, the administered liposome comprises polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered liposome comprises polyglutamated 5-methyl-THF. In further embodiments, the administered liposome comprises [6S]-5-methyl-THF. In other embodiments, the administered liposome comprises [6R,S]-5-methyl-THF. In some embodiments, the administered liposome comprises polyglutamated 5-formyl-THF.
  • the administered liposome comprises polyglutamated [6S]-5-formyl-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S] -5-formyl- THF. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D- form. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form.
  • a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form.
  • a liposome of the administered liposomal composition comprises gamma tetraglutamated tetrahydrofolate.
  • a liposome of the administered liposomal composition comprises gamma pentaglutamated tetrahydrofolate.
  • a liposome of the administered liposomal composition comprises gamma hexaglutamated tetrahydrofolate.
  • the disclosure provides a method for treating a disorder of the immune system that comprises administering an effective amount of a liposomal composition comprising liposomes that contain gamma polyglutamated tetrahydrofolate (e.g ., Lp-yPTHF, PLp-yPTHF, NTLp-yPTHF, NTPLp-yPTHF, TLp-yPTHF or TPLp-yPTHF) to a subject having or at risk of having a disorder of the immune system.
  • the liposomal composition is administered to treat an autoimmune disease.
  • the liposomal composition is administered to treat rheumatoid arthritis.
  • the liposomal composition is administered to treat inflammation.
  • the administered liposomal composition comprises pegylated liposomes (e.g., PLp-yPTHF, NTPLp-yPTHF, or TPLp-yPTHF).
  • the administered liposomal composition comprises targeted liposomes (e.g., TLp-yPTHF or TPLp-yPTHF) that contain a targeting moiety having a specific affinity for a surface antigen on a target cell of interest (e.g., an immune cell).
  • the administered liposomal composition comprises liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-yPTHF)).
  • a liposome of the administered liposomal composition comprises gamma pentaglutamated tetrahydrofolate that contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 4 g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 5 g-glutamyl groups.
  • the administered liposome comprises yPTHF containing 6 g-glutamyl groups.
  • the administered liposome comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]- lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S] -5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S] -Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-THF (e.g., polyglutamated [6R]-5,l0-methylene-THF); (
  • the administered liposome comprises polyglutamated 5,l0-methylene-THF. In further embodiments, the administered liposome comprises polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered liposome comprises polyglutamated 5-methyl-THF. In further embodiments, the administered liposome comprises [6S]-5-methyl-THF. In other embodiments, the administered liposome comprises [6R,S] -5-methyl-THF. In some embodiments, the administered liposome comprises polyglutamated 5-formyl-THF.
  • the administered liposome comprises polyglutamated [6S]-5-formyl-THF. In other embodiments, the administered liposome comprises polyglutamated [6R,S] -5-formyl- THF. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the D- form. In some embodiments, a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form.
  • a liposome of the administered liposomal composition comprises a yPTHF containing 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form.
  • a liposome of the administered liposomal composition comprise gamma tetraglutamated tetrahydrofolate.
  • a liposome of the administered liposomal composition comprise gamma pentaglutamated tetrahydrofolate.
  • liposomes of the administered liposomal composition comprise gamma hexaglutamated tetrahydrofolate.
  • the disclosure also provides a method of delivering gamma polyglutamated tetrahydrofolate to a tumor and/or cancer cell that comprises: administering to a subject having the tumor, a composition comprising gamma polyglutamated tetrahydrofolate (L-yPTHF) and a targeting moiety that has a specific binding affinity for an epitope of a surface antigen on the tumor cell or cancer cell.
  • the administered targeting moiety is associated with a delivery vehicle.
  • the delivery vehicle is an antibody or an antigen binding fragment of an antibody.
  • the delivery vehicle is a liposome.
  • the antibody, antigen-binding antibody fragment, or liposome is pegylated.
  • the administered composition comprises gamma polyglutamated tetrahydrofolate that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the administered composition comprises gamma tetraglutamated tetrahydrofolate.
  • the administered composition comprises gamma pentaglutamated tetrahydrofolate.
  • the administered composition comprises gamma hexaglutamated tetrahydrofolate.
  • the administered composition comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]- lO-formyl-THF); (c) polyglutamated 5,l0-methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl-THF (e.g., polyglutamated [6S] -5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S] -Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-THF (e.g., polyglutamated [6R]-5,l0-methylene-THF);
  • the administered composition comprises polyglutamated 5,l0-methylene-THF. In further embodiments, the administered composition comprises polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the administered composition comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the administered composition comprises polyglutamated 5-methyl-THF. In further embodiments, the administered composition comprises [6S] -5-methyl-THF. In other embodiments, the administered composition comprises [6R,S] -5-methyl-THF. In some embodiments, the administered composition comprises polyglutamated 5-formyl-THF. In further embodiments, the administered composition comprises polyglutamated [6S] -5-formyl- THF. In other embodiments, the administered composition comprises polyglutamated [6R,S]- 5-formyl-THF.
  • the disclosure provides a method of preparing a liposomal composition that comprises a liposomal gamma polyglutamated tetrahydrofolate (yPTHF) composition, the method comprising: forming a mixture comprising: liposomal components and g polyglutamated tetrahydrofolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing polyglutamated tetrahydrofolate.
  • the gamma polyglutamated tetrahydrofolate contains 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups.
  • the yPTHF composition contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g- glutamyl groups in the D-form. In some embodiments, the yPTHF composition contains 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, g-glutamyl groups in the L-form. In some embodiments, the yPTHF composition contains 2, 3, 4, 5, or more than 5, g-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, g-glutamyl groups in the D-form. In some embodiments, the yPTHF composition comprises gamma pentaglutamated tetrahydrofolate.
  • the yPTHF composition comprises gamma tetraglutamated tetrahydrofolate. In other embodiments, the yPTHF composition comprises gamma hexaglutamated tetrahydrofolate.
  • composition comprises a yPTHF selected from: (a) polyglutamated 5-formyl-THF (e.g., polyglutamated [6S]-5-formyl-THF); (b) polyglutamated lO-formyl-THF (e.g., polyglutamated [6R]-lO-formyl-THF); (c) polyglutamated 5,10- methenyl-THF (e.g., polyglutamated [6R]-5,l0-methenyl-THF); (d) polyglutamated 5-methyl- THF (e.g., polyglutamated [6S]-5-methyl-THF); (e) polyglutamated Tetrahydrofolate THF (e.g., polyglutamated [6S]-Tetrahydrofolate THF); (f) polyglutamated 5,l0-methylene-THF (e.g., polyglutamated [6R]-5,l0-methylene-THF); and (g) polyglutamated 5,
  • the composition comprises polyglutamated 5,l0-methylene-THF. In further embodiments, the composition comprises polyglutamated [6R]-5,l0-methylene-THF. In other embodiments, the composition comprises polyglutamated [6R,S]-5,l0-methylene-THF. In some embodiments, the composition comprises polyglutamated 5-methyl-THF. In further embodiments, the composition comprises [6S]-5-methyl-THF. In other embodiments, the composition comprises [6R,S] -5-methyl-THF. In some embodiments, the composition comprises polyglutamated 5- formyl-THF. In further embodiments, the composition comprises polyglutamated [6S]-5- formyl-THF. In other embodiments, the administered composition comprises polyglutamated [6R,S] -5-formyl-THF.
  • the disclosure provides a kit comprising a gamma polyglutamated tetrahydrofolate composition and/or a yPTHF delivery vehicle such as a liposome containing yPTHF or a yPTHF immunoconjugate (e.g., an ADC) described herein.
  • a gamma polyglutamated tetrahydrofolate composition and/or a yPTHF delivery vehicle such as a liposome containing yPTHF or a yPTHF immunoconjugate (e.g., an ADC) described herein.
  • FIGS. 1A-1L show chemical formulas of exemplary 5-10 methylene THF derivatives: 5-10 methylene THF (FIG. 1A), gamma 5-10 methylene THF diglutamate (FIG. IB), gamma 5- 10 methylene THF triglutamates (FIGS. 1C and ID), gamma 5-10 methylene THF tetraglutamates (FIGS. IE and IF), gamma 5-10 methylene THF pentaglutamates (FIGS. 1G and 1H), gamma 5-10 methylene THF hexaglutamates (FIGS. II and 1J), gamma 5-10 methylene THF heptaglutamates (FIGS.
  • THF octaglutamates gamma 5-10 methylene THF octaglutamates
  • FIG. 1M and IN gamma 5-10 methylene THF octaglutamates
  • FIG. 2 presents an example dose response relationship of free pemetrexed L-gamma hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6), pemetrexed, and folate receptor alpha targeting antibody (FRlAb) liposomal pemetrexed L- gamma hexaglutamate (liposomal gG6-FRlAb) in the NCI H2342 non-small cell lung cancer (NSCLC), adenocarcinoma subtype depicted as the percentage of viable cells after 48 hours of treatment.
  • NCI H2342 non-small cell lung cancer NCI H2342 non-small cell lung cancer
  • FIG. 3 presents an example dose response relationship of free pemetrexed L-gamma hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6), pemetrexed, and folate receptor alpha targeting antibody (FRlAb) liposomal pemetrexed L- gamma hexaglutamate (liposomal gG6-FRlAb) in the HT-29 (colon cancer) at 48 hours.
  • gG6 free pemetrexed L-gamma hexaglutamate
  • liposomal pemetrexed L-gamma hexaglutamate liposomal gG6-FRlAb
  • HT-29 colon cancer
  • FIG. 4 shows the effect of free pemetrexed L-gamma hexaglutamate (hexa gG6) and liposomal pemetrexed L-gamma hexaglutamate (liposomal hexa gG6), on the growth of colon cancer SW260 cells following exposure of 256 nM of the corresponding agent for 48 hours.
  • the non-targeted and targeted liposomal pemetrexed hexa gG6 are able to enter cells more efficiently than free pemetrexed hexa gG6 to inhibit growth of the colon cancer SW260 cells.
  • FIG. 5 presents the relative potency of liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6) and its mirror image, liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6) relative to pemetrexed following exposure of the cancer cell lines SW620 (CRC), HT-29 (colon cancer), H1806 (triple negative breast cancer), OAW28 (ovarian cancer), H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC, adenocarcinoma subtype), over 48 hours.
  • CRC cancer cell lines
  • HT-29 colon cancer
  • H1806 triple negative breast cancer
  • OAW28 ovarian cancer
  • H292 NSCLC, adenocarcinoma subtype
  • H2342 NSCLC, adenocarcinoma subtype
  • FIG. 6 presents the treatment effect on HCC1806 triple negative breast cancer cells following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and to pemetrexed over 48 hours.
  • Lps Hexa gG6 liposomal pemetrexed gamma-L hexaglutamate
  • Lps Hexa gDG6 liposomal pemetrexed gamma-D hexaglutamate
  • FIG. 7 presents the treatment effect on OAW28 ovarian cancer cells following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), as compared to pemetrexed over 48 hours.
  • Lps Hexa gG6 liposomal pemetrexed gamma-L hexaglutamate
  • Lps Hexa gDG6 liposomal pemetrexed gamma-D hexaglutamate
  • FIG. 8 presents the treatment effect on H292 non- small cell lung cancer cells following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and to pemetrexed over 48 hours.
  • Lps Hexa gG6 liposomal pemetrexed gamma-L hexaglutamate
  • Lps Hexa gDG6 liposomal pemetrexed gamma-D hexaglutamate
  • FIG. 9 presents the treatment effect on H292 non- small cell lung cancer cells following exposure of various dose levels ranging from 16 to 128 nM of liposomal pemetrexed gamma-L hexaglutamate (Liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (Liposomal gDG6), and pemetrexed over 48 hours.
  • the liposomal pemetrexed gG6 formulation is superior to inhibiting H292 non-small cell lung cancer cells compared to pemetrexed.
  • FIG. 10 presents the treatment effect on HCC1806 triple negative breast cancer cells following exposure of various dose levels ranging from 16 to 128 nM of liposomal pemetrexed gamma-L hexaglutamate (Liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (Liposomal gDG6), and pemetrexed over 48 hours.
  • the liposomal pemetrexed gG6 formulation is superior to pemetrexed in inhibiting HCC1806 triple negative breast cancer cells.
  • FIG. 11 presents the treatment effect on OAW28 ovarian cancer cells of liposomal pemetrexed gamma-L hexaglutamate (LiposomalgG6), liposomal gamma-D hexaglutamate (LiposomalgDG6), and pemetrexed following exposure over 48 hours following exposure over a range of concentrations.
  • LiposomalgG6 liposomal pemetrexed gamma-L hexaglutamate
  • LiposomalgDG6 liposomal gamma-D hexaglutamate
  • pemetrexed following exposure over 48 hours following exposure over a range of concentrations.
  • pemetrexed appears to more effective than the Liposomal pemetrexed gG6 liposomal formulation, whereas the liposomal formulation at the dose of 32 nM and 64 nM has a better treatment effect than pemetrexed; at 16 nM the Liposomal pemetrexed gG6 treatment effect is similar in to pemetrexed.
  • FIG. 12 shows the toxicity of liposomal pemetrexed gamma-L hexaglutamate (LiposomalgG6), liposomal pemetrexed gamma-D hexaglutamate (Liposomal gDG6), and pemetrexed on differentiating human neutrophils at 64 nM, 128 nM, and 264 nM.
  • the figure demonstrates that liposomal pemetrexed gG6 is significantly less toxic to differentiating human neutrophils than pemetrexed.
  • FIG. 13 shows the effect of liposomal pemetrexed gamma-L hexaglutamate (liposomalgG6), liposomal gamma-D hexaglutamate (liposomalgDG6), and pemetrexed on on neutrophils (differentiated from CD34+ cells) following exposure of various dose levels ranging from 16 to 128 nM of the corresponding agent over 48 hours.
  • FIG. 14 shows the effect of liposomal pemetrexed gamma-L hexaglutamate (liposomalgG6), liposomal pemetrexed gamma-D hexaglutamate (liposomalgDG6), and pemetrexed on AML12 liver cells following exposure over 48 hours at 16 nM, 32 nM, and 64 nM, and 128 nM of the corresponding agent. Strikingly, there does not appear to be any toxicity to the AML12 liver cells following treatment with a liposomal pemetrexed gG6 at any of the liposomal agents at the dose levels tested. In contrast, pemetrexed treatment results in a reduction in the AML12 liver cell counts of approximately 40% at all doses studied.
  • FIG. 15 shows the effect of liposomal pemetrexed gamma-L hexaglutamate (liposomalgG6), liposomal pemetrexed gamma-D hexaglutamate (liposomalgDG6), and pemetrexed on CCD841 colon epithelium cells following exposure over 48 hours at 16 nM, 32 nM, and 64 nM, and 128 nM, of the corresponding agent. At all of the concentrations tested, pemetrexed leads to approximately a >50% decrease in the number of CCD841 colon epithelium cells compared to approximately a 20% or less decrease in cell number after treatment with each of the liposome compositions tested.
  • FIG. 16 depicts the structure of polyglutamate antifolate, Cisplatin (CDDP) and two potential gG6-Cisplatin complexes.
  • CDDP Cisplatin
  • the pH dependent formation of the interstrand and/or instrastrand coordination between the carboxyl groups of the polyglutamated antifolate and cisplatin is likely to disassemble into individual molecules of gG6 and cisplatin upon encountering acidic pH of lysosomes (pH 3-5) and presence of chloride ions inside the cells.
  • FIG. 17 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and 80 mg/kg given once weekly for 4 weeks upon the hematologic parameters: white blood cell (WBC) counts, neutrophil counts and as platelet counts. No appreciable decrease in mean neutrophil, mean white blood cell or mean platelet counts was observed.
  • WBC white blood cell
  • FIG. 18 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and 80 mg/kg given once weekly for 4 weeks upon hemoglobin and reticulocyte indices. There is a minimal decrease in mean hemoglobin concentrations at the higher dose level. In parallel there is a slight increase in mean reticulocytosis indices
  • FIG. 19 presents the effects of liposomal aG6 treatment of mice with 40 mg/kg and 80 mg/kg given once weekly for 4 weeks upon hepatic markers including serum aspartate transaminase (AST) and serum alanine transaminase (ALT) along with serum albumin.
  • AST serum aspartate transaminase
  • ALT serum alanine transaminase
  • FIG. 20 presents the relative tumor volume of immunodeficient female Nu/J mice (6- 8 weeks old) inoculated with NCI-H292 (Non-Small Cell Lung Cancer) cells and administered control, pemetexed, and Liposomal aG6 intravenously at 167 mg/kg once every three weeks.
  • liposomal aG6 provides reduced tumor control compared to pemetrexed.
  • FIGS. 21A-F present the dose response relationship of liposomal pemetrexed alpha- L triglutamate (Liposomal aG3), liposomal pemetrexed alpha-L pentaglutamate (Liposomal aG5), liposomal pemetrexed alpha-L octaglutamate (Liposomal aG7), and a combination of liposomal pemetrexed alpha-L hexaglutamate (aG6) and alpha-L dodecaglutamate (aGl2) (Liposomal aG6 and aGl2), over 48 hours on H2342 (NSCLC, adenocarcinoma subtype)(FIG.
  • NSCLC adenocarcinoma subtype
  • FIG. 21A H292 (NSCLC, adenocarcinoma subtype)(FIG. 21B), HT-29 (colon cancer)(FIG. 21C), HCC1806 (triple negative breast cancer)(FIG. 21D), MCF7 (ER+ breast cancer)(FIG. 21E), and OAW28 (ovarian cancer)(FIG. 21F).
  • CCG CellTiter-Glo®
  • the disclosure generally relates to gamma polyglutamated tetrahydrofolate compositions.
  • the compositions provide advances over prior treatments of hyperproliferative diseases such as cancer.
  • Methods of making, delivering and using the gamma polyglutamated tetrahydrofolate compositions are also provided.
  • the gamma polyglutamated compositions have uses that include but are not limited to treating (e.g., treating and/or preventing) hyperproliferative diseases such as cancer, disorders of the immune system such as inflammation and rheumatoid arthritis, and infectious disease such as HIV and malaria.
  • the gamma polyglutamated compositions also have uses in combination therapy with one or more therapeutic agents such as a chemotherapy drug (e.g., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent or as a“chemoprotectant” (e.g., in combination with an antifolate such as methotrexate) to reduce toxic side effects associated with the therapeutic agent(s).
  • a chemotherapy drug e.g., 5-fluorouracil
  • a“chemoprotectant” e.g., in combination with an antifolate such as methotrexate
  • the term“and/or” as used in a phrase such as“A and/or B” herein is intended to include both A and B; A or B; A (alone); and B (alone).
  • the term“and/or” as used in a phrase such as“A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C;
  • Headings and subheadings are used for convenience and/or formal compliance only, do not limit the subject technology, and are not referred to in connection with the
  • tetrahydrofolate and“THF” are used interchangeably to include a salt, acid and and/or free base form of tetrahydrofolate (e.g ., tetrahydrofolate disodium).
  • “THF(s)” and “tetrahydrofolate(s)” include natural and unnatural THF forms, including one carbon- substituted TNF derivatives.
  • “THF(s)” and“tetrahydrofolate(s)” include diasteromeric compositions having a [6R] configuration at the C-6 atom of the tetrahydropterin component of the THF, diasteromeric compositions having a [6S] configuration at the C-6 atom, and/or mixtures of [6,R,S] diastereomers (e.g., 1:1).
  • “THF(s)” and“tetrahydrofolate(s)” include : (a) 5-formyl-THF (e.g., [6S], [6R,S], or [6R] -5-formyl-THF); (b) 5-formyl-THF (e.g., [6S], [6R,S], or [6R] -5-formyl- THF); (c) 5, lO-methenyl-THF (e.g., [6R], [6R,S], or [6S], -5,l0-methenyl-THF) ; (d) 5- methyl-THF (e.g., [6S], [6R,S], or [6R], -5-methyl-THF); (e) Tetrahydrofolate THF ((2S)-2- ⁇ [4-( ⁇ [2-amino-4-oxo-l,4,5,6,7,8-he
  • the disclosure provides a composition containing a THF diastereomer selected from (a) [6S]-5- formyl-THF; (b) [6R]-5-formyl-THF; (c) [6R]-5,l0-methenyl-THF; (d) [6S]-5-methyl-THF; (e) [6S]-tetrahydrofolate; (f) [6R]-5,l0-methylene-THF; and (g) [6S]-5-formimino-THF.
  • the disclosure provides a composition containing a THF diastereomer mixture (e.g., a diastereoisomeric mixture [6R,S]-5-methyl-THF (1:1), and/or a
  • compositions containing a THF salt may further contain any of a variety of cations, such as Na + , Mg 2+ , K + , NH 4 + , and/or Ca 2+ .
  • the salts are pharmaceutically acceptable salts.
  • the THF salt contains Na + .
  • Tetrahydrofolate contains one L-gamma glutamyl group, and is therefore considered to be monoglutamated for the purpose of this disclosure.
  • THF Tetrahydrofolate THF
  • A“Tetrahydrofolate THF” may also be referred to herein as a species of tetrathydrolate (THF).
  • polyglutamated-tetrahydrofolate “polyglutamated-THF”,“THF-PG”, “PTHF” and iterations thereof, are used interchangeably herein to refer to a tetrahydrofolate composition that comprises at least one glutamyl group in addition to the glutamyl group of tetrahydrofolate (i.e., THF-PG n , wherein n > 1).
  • THF-PG tetrahydrofolate
  • a THF-PG composition containing 5 glutamyl residues in addition to the glutamyl group of THF is referred to herein as hexaglutamated tetrahydrofolate or tetrahydrofolate hexaglutamate.
  • Polyglutamate chains comprise an N-terminal glutamyl group and one or more C-terminal glutamyl groups.
  • the N-terminal glutamyl group of a polyglutamate chain is not linked to another glutamyl group via its amine group, but is linked to one or more glutamyl group via its carboxylic acid group.
  • the N-terminal glutamyl group of a polyglutamated-tetrahydrofolate is the glutamyl group of tetrahydrofolate.
  • the C- terminal glutamyl group or groups of a polyglutamate chain are linked to another glutamyl group via their amine group, but are not linked to another glutamyl group via their carboxylic acid group.
  • polyglutamated-tetrahydrofolate is a member selected from:
  • the polyglutamated-tetrahydrofolate is a member selected from: (a) polyglutamated [6S]-5-formyl-THF; (b) polyglutamated [6R]- lO-formyl-THF; (c)
  • polyglutamated[6R]-5,l0-methenyl-THF polyglutamated [6S]-5-methyl-THF; (e) polyglutamated [6S]-tetrahydrofolate; (f) polyglutamated [6R]-5,l0-methylene-THF; and (g) polyglutamate[6S]-5-formimino-THF.
  • the polyglutamated- tetrahydrofolate is [6R]-5,l0-methylene-THF.
  • polyglutamated- tetrahydrofolate is [6S]-5-methyl-THF.
  • the polyglutamated- tetrahydrofolate is [6S] -5-formyl-THF. In other embodiments, the polyglutamated- tetrahydrofolate is a [6R,S]-5,l0-methylene-THF diastereomeric mixture, a [6R,S] -5-methyl- THF diastereomeric mixture, or a [6R,S]-5-formyl-THF diastereomeric mixture (e.g., 1:1 w/w).
  • the terms“gamma glutamyl group”,“gamma glutamyl group”, and“gamma linkage”, as they relate to the linkage of a glutamyl group refers to a glutamyl group that contains a gamma carboxyl group linkage.
  • the gamma linkage can be between a glutamyl group and the glutamyl group of tetrahydrofolate, or between a glutamyl group and a second glutamyl group that is not present in tetrahydrofolate (e.g., a glutamyl group within a polyglutamate chain attached to tetrahydrofolate).
  • the gamma linkage is an amide bond between the gamma carboxyl group of one glutamyl group and a second glutamyl group. In some embodiments, the gamma linkage refers to the amide bond of the glutamyl group in tetrahydrofolate. In some embodiments, the gamma linkage is an amide bond between the gamma carboxyl group of one glutamyl group and a second glutamyl group. Reference to gamma linkages are inclusive of the gamma linkage of the glutamyl group in tetrahydrofolate unless it is expressly stated or is unambiguously clear from the context that such is not intended.
  • the gamma glutamyl group is in the L-form. In some embodiments, the gamma glutamyl group is in the D-form.
  • tetrahydrofolate enters the cell and is polyglutamated by the enzyme folylpoly-gamma-glutamate synthetase (FPGS), which adds L glutamyl groups serially to the gamma carboxyl group of the glutamate within tetrahydrofolate L-glutamyl group of tetrahydrofolate. Consequently, D-gamma polyglutamated tetrahydrofolate compositions are not formed within cells during tetrahydrofolate therapy.
  • FPGS folylpoly-gamma-glutamate synthetase
  • gamma polyglutamated tetrahydrofolate “g-polyglutamated tetrahydrofolate”, “yPTHF”, “gamma polyglutamated-tetrahydrofolate”, “polyglutamated- THF”,“yTHF-PG”, and iterations thereof, are used interchangeably herein to refer to a tetrahydrofolate composition that comprises at least one gamma glutamyl group having a gamma carboxyl group linkage in addition to the gamma glutamyl group of tetrahydrofolate (e.g., THF-PG n , wherein n > 1 g glutamyl group).
  • alpha glutamyl group refers to a glutamyl group that contains an alpha carboxyl group linkage.
  • Isolated refers to a composition which is in a form not found in nature.
  • Isolated gamma polyglutamated compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature.
  • a gamma polyglutamated tetrahydrofolate which is isolated is substantially pure.
  • Isolated compositions will be free or substantially free of material with which they are naturally associated such as other cellular components such as proteins and nucleic acids with which they may potentially be found in nature, or the environment in which they are prepared (e.g., cell culture).
  • the gamma polyglutamated compositions may be formulated with diluents or adjuvants and still for practical purposes be isolated - for example, the gamma polyglutamated compositions will normally be mixed with pharmaceutically acceptable carriers or diluents when used in diagnosis or therapy.
  • the isolated gamma polyglutamated compositions e.g., gamma polyglutamates and delivery vehicles such as liposomes containing the gamma polyglutamate contain less than 1% or less than 0.1% undesired DNA or protein content.
  • the gamma polyglutamate compositions are "isolated.”
  • targeting moiety is used herein to refer to a molecule that provides an enhanced affinity for a selected target, e.g., a cell, cell type, tissue, organ, region of the body, or a compartment, e.g., a cellular, tissue or organ compartment.
  • the targeting moiety can comprise a wide variety of entities. Targeting moieties can include naturally occurring molecules, or recombinant or synthetic molecules. In some embodiments, the targeting moiety is an antibody, antigen-binding antibody fragment, bispecific antibody or other antibody-based molecule or compound.
  • the targeting moiety is an aptamer, avimer, a receptor-binding ligand, a nucleic acid, a biotin-avidin binding pair, a peptide, protein, carbohydrate, lipid, vitamin, toxin, a component of a microorganism, a hormone, a receptor ligand or any derivative thereof.
  • Other targeting moieties are known in the art and are encompassed by the disclosure.
  • the terms“specific affinity”,“specifically binds”, and“enhanced affinity”, mean that a targeting moiety such as an antibody or antigen binding antibody fragment, reacts or associates more frequently, more rapidly, with greater duration, with greater affinity, or with some combination of the above to the epitope, protein, or target molecule than with alternative substances, including proteins unrelated to antigens containing the target epitope. Because of the sequence identity between homologous proteins in different species, specific affinity can, in several embodiments, include a binding agent that recognizes an epitope on a protein and/or target molecule in more than one species.
  • the term“specific affinity” or“specifically binds” can include a binding agent that recognizes an epitope that is present on more than one protein and/or target molecule. It is understood that, in certain embodiments, a targeting moiety that specifically binds a first target may or may not specifically bind a second target. As such,“specific affinity” does not necessarily require (although it can include) exclusive binding, e.g., binding to an epitope on a single target. Thus, a targeting moiety may, in certain embodiments, specifically bind an epitope that is present on more than one target. In certain embodiments, multiple targets may be bound by the same targeting moiety specifically binds an epitope that is present on multiple targets.
  • epitope refers to that portion of an antigen capable of being recognized and specifically bound by a targeting moiety (i.e ., binding moiety) such as an antibody.
  • epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing.
  • An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
  • Expressions like“binding affinity for a target”,“binding to a target”,“enhanced affinity”, and analogous expressions known in the art refer to a property of a targeting moiety which may be directly measured through the determination of the affinity constants, e.g., the amount of targeting moiety that associates and dissociates at a given antigen concentration.
  • Different methods can be used to characterize the molecular interaction, such as, but not limited to, competition analysis, equilibrium analysis and microcalorimetric analysis, and real-time interaction analysis based on surface plasmon resonance interaction (for example using a Biacore® instrument).
  • delivery vehicle refers generally to any compositions that acts to assist, promote or facilitate entry of gamma polyglutamated tetrahydrofolate into a cell.
  • delivery vehicles include, but are not limited to, liposomes, lipospheres, polymers (e.g., polymer-conjugates), peptides, proteins such as antibodies (e.g., immunoconjugates, such as Antibody Drug Conjugates (ADCs) and antigen binding antibody fragments and derivatives thereof), cellular components, cyclic oligosaccharides (e.g ., cyclodextrins), micelles, microparticles (e.g., microspheres), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), hydrogels, lipoprotein particles, viral sequences, viral material, or lipid or liposome formulations, and combinations thereof.
  • the delivery vehicle refers generally to any compositions that acts to assist,
  • A“subject” refers to a human or vertebrate mammal including but not limited to a dog, cat, horse, goat and primate, e.g., monkey.
  • the invention can also be used to treat diseases or conditions in non-human subjects. For instance, cancer is one of the leading causes of death in companion animals (e.g., cats and dogs).
  • the subject is a human.
  • the term“subject” and“patient” is used
  • a maximum dose that is, the highest safe dose according to sound medical judgment.
  • an“effective amount” refers to a dosage of an agent sufficient to provide a medically desirable result.
  • the effective amount will vary with the desired outcome, the particular condition being treated or prevented, the age and physical condition of the subject being treated, the severity of the condition, the duration of the treatment, the nature of the concurrent or combination therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner.
  • An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
  • the effective amount of an agent may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the disorder.
  • the drug may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic.
  • efficacy in vivo can, for example, be measured by assessing the duration of survival, duration of progression free survival (PFS), the response rates (RR), duration of response, and/or quality of life.
  • the terms“hyperproliferative disorder”, “proliferative disease”, and“proliferative disorder”, are used interchangeably herein to pertain to an unwanted or uncontrolled cellular proliferation of excessive or abnormal cells which is undesired, such as, neoplastic or hyperplastic growth, whether in vitro or in vivo.
  • the proliferative disease is cancer or tumor disease (including benign or cancerous) and/or any metastases, wherever the cancer, tumor and/or the metastasis is located.
  • the proliferative disease is a benign or malignant tumor.
  • the proliferative disease is a non-cancerous disease.
  • the proliferative disease is a hyperproliferative condition such as hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • hyperproliferative condition such as hyperplasias, fibrosis (especially pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth muscle proliferation in the blood vessels, such as stenosis or restenosis following angioplasty.
  • Cancer “tumor”, or“malignancy”, are used as synonymous terms and refer to any of a number of cell types or diseases that are characterized by uncontrolled, abnormal proliferation of cells, the ability of affected cells to spread locally or through the bloodstream and lymphatic system to other parts of the body (metastasize) and/or any of the characteristic structural and/or molecular features known to be associated with these cell types or diseases.
  • Tuor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • A“cancerous tumor”, or“malignant cell” is understood as a cell having specific structural properties, lacking differentiation and being capable of invasion and metastasis.
  • a cancer that can be treated using a yPTHF composition provided herein includes without limitation, a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma ( e.g ., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • a non- hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colore
  • the cancer is selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer.
  • gastric cancer e.g., stomach cancer
  • pancreatic cancer liver cancer
  • lung cancer e.g., non-small cell lung cancer and/or adenocarcinoma
  • head and neck cancer ovarian cancer
  • gallbladder cancer gallbladder cancer
  • basal cell cancer basal cell cancer
  • cancer and tumors that may be treated using a yPTHF composition are described herein or otherwise known in the art.
  • the terms“cancer,”“cancerous,”“cell proliferative disorder,”“proliferative disorder,” and“tumor” are not mutually exclusive as referred to herein.
  • Terms such as “treating”, “treatment”, or “to treat”, refer to both (a) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and (b) prophylactic or preventative measures that prevent and/or slow the development of a targeted disease or condition.
  • subjects in need of treatment include those already with the cancer, disorder or disease; those at risk of having the cancer or condition; and those in whom the infection or condition is to be prevented.
  • Subjects are identified as“having or at risk of having” cancer, an infectious disease, a disorder of the immune system, a hyperproliferative disease, or another disease or disorder referred to herein using well-known medical and diagnostic techniques.
  • a subject is successfully "treated” according to the methods provided herein if the subject shows, e.g., total, partial, or transient amelioration or elimination of a symptom associated with the disease or condition (e.g., cancer, inflammation, and rheumatoid arthritis).
  • a symptom associated with the disease or condition e.g., cancer, inflammation, and rheumatoid arthritis.
  • the terms treating”, or “treatment”, or “to treat” refer to the amelioration of at least one measurable physical parameter of a proliferative disorder, such as growth of a tumor, not necessarily discernible by the patient.
  • the terms treating”, or “treatment”, or “to treat”, refer to the inhibition of the progression of a proliferative disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both.
  • the terms treating”, or “treatment”, or “to treat”, refer to the reduction or stabilization of tumor size, tumor cell proliferation or survival, or cancerous cell count. Treatment can be with a g-PTHF composition, alone or in combination with an additional therapeutic agent.
  • Subject “Subject”,“patient”, and“animal”, are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as chickens, amphibians, and reptiles.“Mammal” as used herein refers to any member of the class Mammalia, including, without limitation, humans and nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and other members of the class Mammalia known in the art. In a particular embodiment, the subject is a human.
  • Treatment of a proliferative disorder is used herein to include maintaining or decreasing tumor size, inducing tumor regression (either partial or complete), inhibiting tumor growth, and/or increasing the life span of a subject having the proliferative disorder.
  • the proliferative disorder is a solid tumor.
  • Such tumors include, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma.
  • the proliferative disorder is a hematologic malignancy.
  • Such hematologic malignancies include for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dysplasias or dyscrasias.
  • autoimmune disease as used herein is defined as a disorder that results from an autoimmune response.
  • An autoimmune disease is the result of an inappropriate and excessive response to a self-antigen.
  • autoimmune diseases include but are not limited to, Addison’s disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (Type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, inflammation and rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyl
  • therapeutic agent is used herein to refer to an agent or a derivative thereof that can interact with a hyperproliferative cell such as a cancer cell or an immune cell, thereby reducing the proliferative status of the cell and/or killing the cell.
  • therapeutic agents include, but are not limited to, chemotherapeutic agents, cytotoxic agents, platinum- based agents (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., TAXOL®), etoposide, alkylating agents (e.g., cyclophosphamide, ifosamide), metabolic antagonists (e.g., tetrahydrofolate (THF), 5- fluorouracil gemcitabine, or derivatives thereof), antitumor antibiotics (e.g., mitomycin, doxorubicin), plant-derived antitumor agents (e.g., vincristine, vindesine, Taxol).
  • chemotherapeutic agents e.g., cytotoxic agents, platinum- based agents (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., TAXOL®), etoposide, al
  • Such agents may further include, but are not limited to, the anticancer agents trimetrexate, temozolomide, tetrahydrofolate, S-(4-Nitrobenzyl)-6-thioinosine (NBMPR), 6-benzyguanidine (6-BG), bis-chloronitrosourea (BCNU) and camptothecin, or a therapeutic derivative of any thereof.
  • NBMPR S-(4-Nitrobenzyl)-6-thioinosine
  • 6-BG 6-benzyguanidine
  • BCNU bis-chloronitrosourea
  • camptothecin or a therapeutic derivative of any thereof.
  • therapeutic agents include, without limitation, anti restenosis, pro- or anti-proliferative, anti-inflammatory, anti-neoplastic, antimitotic, anti platelet, anticoagulant, antifibrin, antithrombin, cytostatic, antibiotic and other anti-infective agents, anti-enzymatic, anti-metabolic, angiogenic, cytoprotective, angiotensin converting enzyme (ACE) inhibiting, angiotensin II receptor antagonizing and/or cardioprotective agents.
  • “Therapeutic agents” also refer to salts, acids, and free based forms of the above agents.
  • the term“chemotherapeutic agent” when used in relation to cancer therapy refers to any agent that results in the death of cancer cells or inhibits the growth or spread of cancer cells.
  • chemotherapeutic agents include alkylating agents, antibiotics, antimetabolites, plant-derived agents, and hormones.
  • the disclosed gamma polyglutamated tetrahydrofolate compositions are used in combination with a chemotherapeutic agent.
  • the chemotherapeutic agent is 5- fluorouracil.
  • the chemotherapeutic agent is cisplatin.
  • the chemotherapeutic agent is carboplatin.
  • the chemotherapeutic agent is oxaliplatin. In other embodiments, the chemotherapeutic agent is gemcitabine. In other embodiments, the chemotherapeutic agent is doxorubicin. In particualr embodidments, the chemotherapeutic agent is a pyrimidine analog (e.g. , a fluorpyrimidine such as 5-fluorouracil (5-FU)).
  • a fluorpyrimidine such as 5-fluorouracil (5-FU)
  • antimetabolite is used herein to refer to a therapeutic agent that inhibits the utilization of a metabolite or a prodrug thereof.
  • antimetabolites include 5-FU and 5-FU metabolites and/or prodrugs such as 5-FUMP, 5-FUDP, 5-FdUMP, capecitabine, tegafur 5-fluorodeoxyuridine monophosphate; and cytarabine and cytarabine prodrugs such as nelarabine, 5-azacytidine, gemcitabine, mercaptopurine, thioguanine, azathioprine, adenosine, pentostatin, erythrohydroxynonyladenine, and cladribine.
  • Anti-metabolites useful for practicing the disclosed methods include nucleoside analogs, including a purine or pyrimidine analogs.
  • the gamma polyglutamated tetrahydrofolate compositions are used in combination with an antimetabolite selected from the group consisting of: a fluoropyrimidine, 5-fluorouracil, 5-fluoro-l-(oxolan-2-yl)pyrimidine-2,4- dione, 5-fluoro-2'-deoxycytidine, cytarabine, gemcitabine, troxacitabine, decitabine, Azacytidine, pseudoisocytidine, Zebularine, Ancitabine, Fazarabine, 6-azacytidine, capecitabine, N4-octadecyl-cytarabine, elaidic acid cytarabine, fludarabine, cladribine, clofarabine, nelarabine, forodesine, and pentostat
  • the nucleoside analog is a substrate for a nucleoside deaminase that is adenosine deaminase or cytidine deaminase.
  • the nucleoside analog is selected from among fludarabine, cytarabine, gemcitabine, decitabine and azacytidine or derivatives thereof.
  • the nucleoside analog is selected from N3-alkylated analogues of 5- fluorouracil, 5-fluorouracil derivatives with l,4-oxaheteroepane moieties, 5-fluorouracil and nucleoside analogues, cis- and trans-5-fluoro-5,6-dihydro-6-alkoxyuracil, cyclopentane 5- fluorouracil analogues, A-OT-fluorouracil, N4-trimethoxybenzoyl-5'-deoxy-5-fluoro- cytidine and 5'-deoxy-5-fluorouridine, l-hexylcarbamoyl-5-fluorouracil, B-3839, uracil-l-(2- tetrahydrofuryl)-5-fluorouracil, l-(2'-deoxy-2'-fluoro-P-D-arabinofuranosyl)-5-fl-
  • the antimetabolite is a pyrimidine analog or a pyrimidine analog prodrug (e.g . , a fluorpyrimidine).
  • the antimetabolite is 5-fluorouracil.
  • a“taxane” is an anti-cancer agent that interferes with or disrupts microtubule stability, formation and/or function.
  • Taxane agents include paclitaxel and docetaxel as well as derivatives thereof, wherein the derivatives function against microtubules by the same mode of action as the taxane from which they are derived.
  • the taxane is paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid, or derivative of paclitaxel or docetaxel.
  • the taxane is paclitaxel (TAXOL®), docetaxel (TAXOTERE®), albumin-bound paclitaxel (nab-paclitaxel; ABRAXANE®), DHA-paclitaxel, or PG-paclitaxel.
  • pharmaceutically-acceptable carrier refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, carrier, excipient, stabilizer, diluent, or preservative.
  • Pharmaceutically-acceptable carriers can include for example, one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other subject.
  • This disclosure generally relates to gamma polyglutamated tetrahydrofolate (yPTHF) compositions and methods of making and using the compositions to treat diseases including hyperproliferative diseases such as cancer, disorders of the immune system such as rheumatoid arthritis, and infectious disease such as HIV and malaria.
  • the gamma polyglutamated compositions also have uses in combination therapy with one or more therapeutic agents such as a chemotherapy drug (e.g ., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent(s) or as a “chemoprotectant” (e.g., in combination with an antifolate such as methotrexate) to reduce toxic side effects associated with the therapeutic agent(s).
  • a chemotherapy drug e.g ., 5-fluorouracil
  • chemoprotectant e.g., in combination with an antifolate such as methotrexate
  • the disclosure provides:
  • composition comprising a yPTHF
  • polyglutamated 5-formyl-THF e.g., polyglutamated [6S]-5-formyl-THF
  • polyglutamated lO-formyl-THF e.g., polyglutamated [6R]-lO-formyl-THF
  • polyglutamated 5,l0-methenyl-THF e.g., polyglutamated [6R]-5,l0-methenyl- THF
  • polyglutamated 5-methyl-THF e.g., polyglutamated [6S]-5-methyl-THF
  • polyglutamated tetrahydrofolate e.g., polyglutamated [6S] -tetrahydrofolate
  • polyglutamated-5,l0-methylene-THF e.g., polyglutamated [6R]-5,l0- methylene-THF
  • polyglutamated 5-formimino-THF e.g., polyglutamated [6S]-5-formimino- THF
  • the yPTHF comprises two or more glutamyl groups in the L-form having gamma carboxyl group linkages
  • each of the glutamyl groups of the yPTHF is in the L-form and has a gamma carboxyl group linkage
  • At least one of the glutamyl groups of the yPTHF is in the D-form and has a gamma carboxyl group linkage
  • each of the glutamyl groups of the yPTHF other than the glutamyl group of tetrahydrofolate is in the D-form and has a gamma carboxyl group linkage, or
  • the yPTHF comprises two or more glutamyl groups in the L-form and at least one glutamyl group in the D-form having gamma carboxyl group linkages;
  • each of the glutamyl groups is in the L-form and has a gamma carboxyl group linkage or (b) each of the glutamyl groups other than the glutamyl group of tetrahydrofolate is in the D-form and and each of the gluytamyl groups has a gamma carboxyl group linkage;
  • a liposomal composition comprising the yPTHF according to any of [l]-[l 1] (Lp- yPTHF);
  • the Lp-yPTHF composition according to any of [ l2]-[ 15] , wherein the liposome comprises a yPTHF comprising 1-10 glutamyl groups having gamma carboxyl group linkages;
  • the Lp-yPTHF composition according to any of [ l2]-[ 16] , wherein the liposome comprises a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups;
  • the Lp-yPTHF composition according to any of [ l2]-[ 17] , wherein the liposome comprises gamma pentaglutamated tetrahydrofolate;
  • components comprise at least one selected from the group consisting of: DSPE; DSPE-PEG; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol- PEG; and cholesterol-maleimide;
  • the Lp-yPTHF composition according to any of [27]-[29], wherein the liposomal components comprise at least one selected from the group consisting of: DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • poly(acrylamide) PAA
  • poly(2-methyl-2-oxazoline) poly(2-ethyl-2-oxazoline); phosphatidyl polyglycerol; poly[N-(2-hydroxypropyl) methacrylamide]; amphiphilic poly-N-vinylpyrrolidones; L-amino-acid-based polymer; oligoglycerol, copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol;
  • PAA poly(acrylamide)
  • poly(2-methyl-2-oxazoline) poly(2-ethyl-2-oxazoline)
  • phosphatidyl polyglycerol poly[N-(2-hydroxypropyl) methacrylamide]
  • amphiphilic poly-N-vinylpyrrolidones L-amino-acid-based polymer
  • oligoglycerol copolymer containing polyethylene glycol and polypropylene oxide
  • a tonicity agent such as dextrose, mannitol, glycerine, potassium chloride, sodium chloride, at a concentration of greater than 1%;
  • acceptable carrier is trehalose
  • pharmaceutically acceptable carrier comprises 1% to 50% dextrose solution
  • the Lp-yPTHF composition according to any of [39] -[43], wherein the interior space of the liposome comprises 5% dextrose suspended in an HEPES buffered solution;
  • pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of between 2 to 8;
  • HBS HEPES Buffered Saline
  • pharmaceutically acceptable carrier comprises a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM;
  • the Lp-yPTHF composition according to any of [l2]-[48], wherein the liposome comprises between 10 to 100,000 molecules of the yPTHF, or any range therein between;
  • the Lp-yPTHF composition according to any of [l2]-[49], which further comprises a targeting moiety and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest;
  • targeting moiety is attached to one or both of the PEG and the exterior of the liposome by a covalent bond
  • the Lp-yPTHF composition according to any of [50]-[52], wherein the targeting moiety is an antibody or an antigen binding fragment of an antibody;
  • the Lp-yPTHF composition according to any of [50]-[53], wherein the targeting moiety binds the surface antigen with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10 10 to 10 x 10 6 as determined using BIACORE® analysis;
  • each pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties;
  • the Lp-yPTHF composition according to any of [39]-[57], further comprising one or more of an immunostimulatory agent, a detectable marker and a maleimide, wherein the immunostimulatory agent, the detectable marker or the maleimide is attached to said PEG or the exterior of the liposome;
  • immunostimulatory agent and the detectable marker is the same;
  • composition comprising the liposomal yPTHF composition
  • composition of any of [l]-[70] in the manufacture of a medicament for the treatment of disease and/or for use in combination therapy with one or more therapeutic agents such as a chemotherapeutic drug (e.g ., 5-fluorouracil) to enhance the effectiveness of the therapeutic agent(s) or as a“chemoprotectant” (e.g., in combination with an antifolate such as methotrexate) to reduce a toxic side effect associated with the therapeutic agent(s);
  • chemotherapeutic drug e.g ., 5-fluorouracil
  • a“chemoprotectant” e.g., in combination with an antifolate such as methotrexate
  • [73] a method for treating (e.g., treating and/or preventing) disease or chemical induced toxicity in a subject needing such treatment or prevention, the method comprising administering the liposomal yPTHF composition of any of [l2]-[69] to the subject;
  • the hyperproliferative cell is a cancer cell, a mammalian cell, and/or a human cell;
  • [77] a method for treating cancer that comprises administering an effective amount of the composition of any of [l]-[69] to a subject having or at risk of having cancer;
  • a method for treating (e.g ., treating and/or preventing) cancer that comprises administering an effective amount of the liposomal yPTHF composition of any of [l2]-[68] to a subject having or at risk of having cancer;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and a hematologic malignancy such as for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma cell dyscrasias;
  • a non-hematologic malignancy including such as for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer, gallbla
  • cancer is a member selected from the group consisting of: lung cancer, breast cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head and neck cancer, ovarian cancer, and cervical cancer;
  • cancer is a member selected from the group consisting of: colorectal cancer, breast cancer, gastric cancer (e.g., stomach cancer), pancreatic cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer and/or adenocarcinoma), head and neck cancer, ovarian cancer, gallbladder cancer, and basal cell cancer;
  • gastric cancer e.g., stomach cancer
  • pancreatic cancer liver cancer
  • lung cancer e.g., non-small cell lung cancer and/or adenocarcinoma
  • head and neck cancer ovarian cancer
  • gallbladder cancer gallbladder cancer
  • basal cell cancer basal cell cancer
  • a maintenance therapy that comprises administering an effective amount of the composition of any of [l]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a maintenance therapy that comprises administering an effective amount of the
  • liposomal yPTHF composition of any of [l2]-[69] to a subject that is undergoing or has undergone cancer therapy;
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the composition of any of [l]-[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g ., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g ., acute and chronic
  • systemic inflammation e.g ., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g inflammatory bowel disease
  • dermatomyositis/ polymyositis e.g erythematosus
  • Takayasu psoriasis
  • a method for treating a disorder of the immune system that comprises administering an effective amount of the liposomal yPTHF composition of any of [8]-[69] to a subject having or at risk of having a disorder of the immune system, optionally wherein the disorder of the immune system is selected from: inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus, and Takayasu, and psoriasis;
  • inflammation e.g., acute and chronic
  • systemic inflammation e.g., rheumatoid arthritis
  • IBD inflammatory bowel disease
  • Crohn disease e.g., dermatomyositis/ polymyositis
  • systemic lupus erythematosus e.g., Takayasu, and ps
  • leukopenia that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having leukopenia;
  • cardiovascular disease or metabolic disease that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having an infectious disease, cardiovascular disease, or another disease, wherein the disease is a member selected from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic disease, and ectopic pregnancy;
  • CVD cardiovascular disease
  • CVD cardiovascular disease
  • coronary artery disease myocardial infarction
  • stroke stroke
  • metabolic syndrome a gestational trophoblastic disease
  • ectopic pregnancy ectopic pregnancy
  • an autoimmune disease that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having an autoimmune disease;
  • rheumatoid arthritis that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having rheumatoid arthritis;
  • an inflammatory condition that comprises administering an effective amount of the composition according to any of [l]-[59] to a subject having or at risk of having inflammation, optionally wherein the inflammation is acute, chronic, and/or systemic inflammation; or
  • composition according to any of [l]-[59] to a subject having or at risk of having a skin condition, optionally wherein the skin condition is psoriasis;
  • [89] a method for treating an infectious disease that comprises administering an effective amount of the liposomal yPTHF composition of any of [l2]-[69] to a subject having or at risk of having an infectious disease;
  • [90] a method of delivering yPTHF to a tumor expressing a folate receptor on its surface, the method comprising: administering the Lp-yPTHF composition of any of [l]-[69] to a subject having the tumor in an amount to deliver a therapeutically effective dose of the yPTHF to the tumor;
  • a method of preparing a gamma polyglutamated tetrahydrofolate composition comprising the liposomal gamma polyglutamated tetrahydrofolate composition of any of [l2]-[69] the method comprising: forming a mixture comprising: liposomal components and gamma polyglutamated antifolate in solution; homogenizing the mixture to form liposomes in the solution; and processing the mixture to form liposomes containing gamma polyglutamated tetrahydrofolate; [92] a method of preparing a gamma polyglutamated tetrahydrofolate composition comprising the liposomal gamma polyglutamated tetrahydrofolate composition of any of [l2]-[69], the method comprising: forming a mixture comprising: liposomal components and gamma polyglutamated tetrahydrofolate in solution; and processing the mixture to form liposomes containing gamm
  • [94] a method of preparing the composition of any of [50] -[69] comprising the steps of: forming a mixture comprising: liposomal components and gamma polyglutamated tetrahydrofolate in a solution; homogenizing the mixture to form liposomes in the solution; processing the mixture to form liposomes entrapping and/or encapsulating gamma polyglutamated tetrahydrofolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • a method of preparing the composition of any of [50]-[69], comprising the steps of: forming a mixture comprising: liposomal components and gamma polyglutamated tetrahydrofolate in a solution; processing the mixture to form liposomes entrapping and/or encapsulating gamma polyglutamated tetrahydrofolate; and providing a targeting moiety on a surface of the liposomes, the targeting moiety having specific affinity for at least one of folate receptor alpha (FR-a), folate receptor beta (FR-b) and folate receptor delta (FR-d);
  • FR-a folate receptor alpha
  • FR-b folate receptor beta
  • FR-d folate receptor delta
  • the processing step includes one or more steps of: thin film hydration, extrusion, in-line mixing, ethanol injection technique, freezing-and-thawing technique, reverse-phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and/or [98] the method according to any of [95] to [97], wherein said processing step includes one or more steps of modifying the size of the liposomes by one or more of steps of extrusion, high-pressure microfluidization, and/or sonication; and/or
  • the disclosure generally relates yPTHF (yPTHF) compositions.
  • the yPTHF compositions comprise at least one glutamyl group having a gamma carboxyl group linkage. These structurally distinct from the L-gamma polyglutamated forms of tetrahydrofolate (LylPTHF) that are produced by the enzyme folylpoly-gamma-glutamate synthetase (FPGS) in cells during tetrahydrofolate therapy.
  • L-gamma polyglutamated forms of tetrahydrofolate L-gamma polyglutamated forms of tetrahydrofolate (LylPTHF) that are produced by the enzyme folylpoly-gamma-glutamate synthetase (FPGS) in cells during tetrahydrofolate therapy.
  • FPGS folylpoly-gamma-glutamate synthetase
  • the yPTHF composition contains 2-20, 2-15, 2-10, 2-5, or more than 5, glutamyl groups (including the glutamyl group in tetrahydrofolate).
  • each of the glutamyl groups in the yPTHF other than the glutamyl group of tetrahydrofolate have a gamma linkage.
  • 2 or more of the glutamyl groups in the yPTHF have a glamma linkage.
  • each of the glutamyl groups in the yPTHF is in the L-form.
  • each of the glutamyl groups in the yPTHF other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the yPTHF comprises two or more glutamyl groups in the L-form and one or more glutamyl groups in the D-form.
  • the yPTHF is diglutamated. That is, the yPTHF contains 1 g- glutamyl group in addition to the glutamyl group of tetrahydrofolate (yTHF-PGi). In some embodiments, each of the glutamyl groups of the gamma diglutamated tetrahydrofolate is in the L-form. In other embodiments, the gamma diglutamated THF comprises a glutamyl group in the D-form.
  • the yPTHF is triglutamated. That is, the yPTHF contains 2 g- glutamyl groups in addition to the glutamyl group of tetrahydrofolate (yTHF-PG 2 ). In some embodiments, each of the glutamyl groups of the gamma triglutamated tetrahydrofolate is in the L-form. In other embodiments, the gamma triglutamated THF comprises a glutamyl group in the D-form. In further embodiments, each of the glutamyl groups of the g-triglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate, is in the D-form. In additional embodiments, the g-triglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is tetraglutamated and thus contains 3 g-glutamyl groups in addition to the g-glutamyl group in tetrahydrofolate (YTHF-PG 3 ).
  • the gamma tetraglutamated THF comprises two or more g-glutamyl groups in the L-form.
  • each of the g-glutamyl groups of the gamma tetraglutamated tetrahydrofolate is in the L-form.
  • the gamma tetraglutamated THF comprises a g-glutamyl group in the D-form.
  • the gamma tetraglutamated THF comprises 2 g-glutamyl groups in the D-form.
  • each of the glutamyl groups of the gamma tetraglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the tetraglutamated THF comprises a g-glutamyl group in the D-form and two or more g- glutamyl groups in the L-form.
  • the yPTHF is pentaglutamated (yTHF-PGG and contains a chain of 4 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma pentaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma pentaglutamated tetrahydrofolate is in the L-form.
  • the gamma pentaglutamated THF comprises a glutamyl group in the D-form.
  • the gamma tetraglutamated THF comprises 2 or 3, g-glutamyl groups in the D-form.
  • each of the g-glutamyl groups of the gamma pentaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the pentaglutamated THF comprises a g-glutamyl group in the D-form and two or more g- glutamyl groups in the L-form.
  • the yPTHF is hexaglutamated (yTHF-PGs) and contains a chain of 5 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma hexaglutamated THF comprises two or more g-glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma hexaglutamated tetrahydrofolate is in the L-form.
  • the gamma hexaglutamated THF comprises a g-glutamyl group in the D-form.
  • the gamma tetraglutamated THF comprises 2, 3, 4, or 5, g-glutamyl groups in the D-form.
  • each of the glutamyl groups of the gamma hexaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the hexaglutamated THF comprises a g-glutamyl group in the D-form and two or more g- glutamyl groups in the L-form.
  • the yPTHF is heptaglutamated (yTHF-PG f ,) and thus contains a chain of 6 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma heptaglutamated THF comprises two or more g-glutamyl groups in the L-form.
  • each of the g-glutamyl groups of the gamma heptaglutamated tetrahydrofolate is in the L-form.
  • the gamma heptaglutamated THF comprises a g-glutamyl group in the D-form.
  • the gamma tetraglutamated THF comprises 2, 3, 4, 5, or 6, g-glutamyl groups in the D-form.
  • each of the g-glutamyl groups of the gamma heptaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the heptaglutamated THF comprises a g-glutamyl group in the D- form and two or more g-glutamyl groups in the L-form.
  • the yPTHF is octaglutamated (yTHF-PG 7 ) and thus contains a chain of 7 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma octaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma octaglutamated tetrahydrofolate is in the L-form.
  • the gamma octaglutamated THF comprises a glutamyl group in the D-form.
  • the gamma octaglutamated THF comprises 2, 3, 4, 5, 6, or 7, g-glutamyl groups in the D-form.
  • each of the glutamyl groups of the gamma octaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the octaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is nonaglutamated (yTHF-PGs) and contains a chain of 8 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma nonaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma nonaglutamated tetrahydrofolate is in the L-form.
  • the gamma nonaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma nonaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the nonaglutamated THF comprises a g-glutamyl group in the D-form and two or more g-glutamyl groups in the L-form.
  • the yPTHF is decaglutamated (yTHF-PGg) and contains a chain of 9 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma decaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma decaglutamated tetrahydrofolate is in the L-form.
  • the gamma decaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma decaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the decaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is undecaglutamated (yTHF-PGio) and contains a chain of 10 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma undecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma undecaglutamated tetrahydrofolate is in the L-form.
  • the gamma undecaglutamated THF comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma undecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the undecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is dodecaglutamated (yTHF-PGn) and contains a chain of 11 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma dodecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma dodecaglutamated tetrahydrofolate is in the L-form.
  • the gamma dodecaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma dodecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the dodecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is triskaidecaglutamated (yTHF-PGn) and contains a chain of 12 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma triskaidecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma triskaidecaglutamated tetrahydrofolate is in the L-form.
  • the gamma triskaidecaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma triskaidecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the triskaidecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is tetradecaglutamated (YTHF-PG ) and contains a chain of 13 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma tetradecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma tetradecaglutamated tetrahydrofolate is in the L-form.
  • the gamma tetradecaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma tetradecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the tetradecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is pentadecaglutamated (yTHF-PGu) and contains a chain of 14 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma pentadecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma pentadecaglutamated tetrahydrofolate is in the L-form.
  • the gamma pentadecaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma pentadecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the pentadecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is hexadecaglutamated (yTHF-PGis) and contains a chain of 15 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma hexadecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma hexadecaglutamated tetrahydrofolate is in the L-form.
  • the gamma hexadecaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma hexadecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the hexadecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is heptadecaglutamated (yTHF-PGir,) and contains a chain of 16 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma heptadecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma heptadecaglutamated tetrahydrofolate is in the L-form.
  • the gamma heptadecaglutamated THF comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma heptadecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the heptadecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is octadecaglutamated (yTHF-PGn) and contains a chain of 17 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma octadecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma octadecaglutamated tetrahydrofolate is in the L-form.
  • the gamma octadecaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma octadecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the octadecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is enneadecaglutamated (yTHF-PGis) and contains a chain of 18 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma enneadecaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma enneadecaglutamated tetrahydrofolate is in the L-form.
  • the gamma enneadecaglutamated THF comprises a D glutamyl group.
  • each of the glutamyl groups of the gamma enneadecaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the enneadecaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is icosiglutamated (yTHF-PGiy) and contains a chain of 19 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma icosiglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma icosiglutamated tetrahydrofolate is in the L-form.
  • the gamma icosiglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma icosiglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the icosiglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the yPTHF is icosikaihenaglutamated (yTHF-PG 2 o) and contains a chain of 20 g-glutamyl groups attached to the glutamyl group of tetrahydrofolate.
  • the gamma icosikaihenaglutamated THF comprises two or more glutamyl groups in the L-form.
  • each of the glutamyl groups of the gamma icosikaihenaglutamated tetrahydrofolate is in the L-form.
  • the gamma icosikaihenaglutamated THF comprises a glutamyl group in the D-form.
  • each of the glutamyl groups of the gamma icosikaihenaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • the icosikaihenaglutamated THF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • each of the 4-7 attached glutamyl groups is in the L-form.
  • each of the 4-7 attached glutamyl groups is in the D-form.
  • the 4-7 attached glutamyl groups are in the L-form and the D-form.
  • the yPTHF is tetraglutamated and each of the 3 glutamyl groups in the polyglutamate chain attached to the tetrahydrofolate contains a gamma linkage.
  • each of the 4 glutamyl groups is in the L-form.
  • each of the glutamyl groups in the gamma tetraglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • at least two glutamyl groups in the gamma tetraglutamate tetrahydrofolate are in the L-form and at least one glutamyl group is in the D-form.
  • the yPTHF is pentaglutamated and each of the 4 glutamyl groups in the polyglutamate chain attached to the tetrahydrofolate contains a gamma linkage.
  • each of the 4 glutamyl groups is in the L-form.
  • each of the glutamyl groups in the gamma pentaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • at least two glutamyl groups in the gamma pentaglutamated tetrahydrofolate are in the L-form and at least one glutamyl group is in the D-form.
  • the yPTHF is hexaglutamated.
  • each of the 5 glutamyl groups is in the L-form.
  • each of the glutamyl groups in the gamma hexaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate is in the D-form.
  • at least two glutamyl groups in the gamma hexaglutamated tetrahydrofolate are in the L-form and at least one glutamyl group is in the D-form.
  • the yPTHF is heptaglutamated.
  • each of the 6 glutamyl groups is in the L-form. In some embodiments, each of the glutamyl groups in the gamma heptaglutamated tetrahydrofolate other than the glutamyl group of tetrahydrofolate, is in the D-form. In other embodiments, at least two glutamyl groups in the gamma heptaglutamated tetrahydrofolate are in the L-form and at least one glutamyl group is in the D-form.
  • the yPTHF contains a total of 1-15, 1-10, 2-15, 2-10, 3-15, 3- 10, 3-6, 3-5, 4-10, 4-7, or 4-6, glutamyl groups including the glutamyl group in tetrahydrofolate, or any range therein between.
  • each of the glutamyl groups in the yPTHF other than the glutamyl group of tetrahydrofolate have a gamma linkage.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the yPTHF have a gamma linkage.
  • the yPTHF comprises g glutamyl groups in the L-form and the D-form.
  • each of the glutamyl groups in the polyglutamate structure of the polyglutamated tetrahydrofolate is in the L-form.
  • each of the glutamyl groups in the yPTHF other than the glutamyl group of tetrahydrofolate is in the D-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, of the glutamyl groups in the yPTHF is in the L-form.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14, of the glutamyl groups in the yPTHF is in the D-form.
  • the yPTHF contains 20-100, 20-75, 20-50, 20-40, 20-30, 20-25, or more than 100, gamma glutamyl groups, or any range therein between.
  • each of the glutamyl groups of the yPTHF is in the L-form.
  • each of the glutamyl groups of the yPTHF other than the glutamyl group of tetrahydrofolate is in the D-form.
  • at least two of the glutamyl groups in the yPTHF are in the L-form and at least one of the glutamyl groups in the yPTHF is in the D-form
  • the provided compositions comprise a yPTHF that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups that have gamma linkages.
  • the yPTHF contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the L-form.
  • the yPTHF contains 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1- 20, glutamyl groups in the D-form.
  • the yPTHF contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the L-form and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10 or 1-20, glutamyl groups in the D- form.
  • the yPTHF composition provided herein is capbable of adding one or more additional glutamyl groups that, is the composition is able to act as a substrate for by FPGS (folylpolyglutamate synthetase).
  • FPGS fluorescence-activated glutamate synthetase
  • Reagents and assays and reagents for determining the ability of a yPTHF composition to act as a substrate for FPGS e.g., human FPGS, or rat liver FPGS
  • the rate of uptake of naked gamma PPMX compositions disclosed herein are taken up by hepatic cells at a significantly reduced rated compared to the uptake rate of tetrahydrofolate under the same physiological conditions.
  • the rate of hepatic cell uptake of the naked gamma PTHF composition is less than 30%, 20%, 15%, or 10% compared to the rate of tetrahydrofolate.
  • the rate of the efflux (transport out) of gamma PTHF compositions disclosed herein from hepatic-cells occurs at a rate that is significantly reduced compared to tetrahydrofolate (e.g., less than 30%, 20%, 15%, or 10%) compared to the rate of tetrahydrofolate.
  • the /PTHF compositions do not contain a fluorine atom. In some embodiments, the /PTHF compositions do not contain a 4-fluoroglutamyl group.
  • the disclosure also encompasses / PTHF derivatives and analogs.
  • the compositions and methods disclosed herein are envisioned to apply to any and every known derivative or analog of tetrahydrofolate that is polyglutamated.
  • the polyglutamated tetrahydrofolate analog or derivative composition prepared and used according to the disclosed compositions and methods is depicted in FIGS. 1I-1J.
  • the analog corresponds to a modified form of tetrahydrofolate wherein the glutamly group of tetrahydrofolate is not linked to the remainder of tetrahydrofolate molecule through a gamma peptide linkage.
  • the analog is a variant form of tetrahydrofolate wherein the glutamyl group of tetrahydrofolate in in the D-form.
  • the polyglutamated form of tetrahydrofolate, or polyglutamated tetrahydrofolate analog or derivative is not fluorinated.
  • the tetrahydrofolate polyglutamate compositions provided herein may be obtained by following synthetic procedures using available reagents and synthetic intermdiates.
  • the addition of glutamyl residues to the glutamyl residues of tetrahydrofolate can be accomplished using synthetic procedures known in the art.
  • glutamyl residues are added serially to the glutamyl residue of tetrahydrofolate.
  • polyglutamates are added to the glutamyl reside of tetrahydrofolate using“click chemistry” methods or other bioconjugate chemistries known to those in the art.
  • a peptide of glutamyl residues can be generated of the desired length and added to a precurser of tetrahydrofolate which does not have a glutamyl residue.
  • the peptide can be produced using synthetic procedures known in the art.
  • an initial glutamyl residue is bonded to wang resin and additional glutamyl residues are added serially via solid phase peptide synthesis using F-moc chemistry. After the final glutamyl residue is added the tetrahydrofolate precurser is coupled to the peptide and the molecule is cleaved from the resin.
  • glutamyl residues to the glutamyl residues of tetrahydrofolate can be accomplished using synthetic procedures known in the art.
  • glutamyl residues are added serially to the glutamyl residue of tetrahydrofolate.
  • polyglutamates are added to the glutamyl reside of tetrahydrofolate using “click chemistry” methods or other bioconjugate chemistries known to those in the art.
  • a peptide of glutamyl residues can be generated of the desired length and added to a precurser of tetrahydrofolate which does not have a glutamyl residue.
  • the peptide can be produced using synthetic procedures known in the art.
  • an initial glutamyl residue is bonded to wang resin and additional glutamyl residues are added serially via solid phase peptide synthesis using F-moc chemistry. After the final glutamyl residue is added the tetrahydrofolate precurser is coupled to the peptide and the molecule is cleaved from the resin.
  • the disclosure provides a complex of a yPTHF (e.g., a yPTHF disclosed herein) and a therapeutic agent or a salt or acid thereof.
  • a yPTHF e.g., a yPTHF disclosed herein
  • the yPTHF/complex comprise yPTHF and a therapeutic agent.
  • the therapeutic agent is a cytotoxic compound such as a chemotherapeutic agent.
  • the yPTHF/complex contains a platinum- based drug such as platinum-based chemotherapeutic agent (e.g., cisplatin, carboplatin and oxaliplatin).
  • the aPTHF/complex contains a taxane-based chemotherapeutic agent (e.g., paclitaxel and docetaxel).
  • the yPTHF/complex contains a cyclodextrin.
  • the yPTHF/complex is encapsulated in a liposome
  • the disclosure provides a composition comprising a complex of a yPTHF and a therapeutic agent or a salt or acid thereof.
  • the yPTHF/therapeutic agent complex comprises one or more yPTHF containing 2-150, 2-100, 2- 75, 2-50, 2-24, 2-30, 2-20, 2-19, 2-15, 2-10, or 2-5, glutamyl groups.
  • the yPTHF/therapeutic agent complex comprises one or more yPTHF containing 3-10, 3-9, 3- 8, or 3-7, glutamyl groups, or any range therein between.
  • the yPTHF/therapeutic agent complex comprises one or more yPTHF containing 4-10, 4-9, 4-8, 4- 7, 4-6, or 4-5, glutamyl groups, or any range therein between.
  • the complex comprises one or more yPTHF containing 3-10 glutamyl groups.
  • the yPTHF/therapeutic agent complex comprises one or more yPTHF containing 3-7 glutamyl groups.
  • the yPTHF/therapeutic agent complex comprises one or more yPTHF containing 5 glutamyl groups.
  • the yPTHF/therapeutic agent complex comprises one or more yPTHF containing 6 glutamyl groups.
  • the therapeutic agent is a cytotoxic compound or a salt or acid thereof. In a further embodiment, the therapeutic agent is a chemotherapeutic agent or a salt or acid thereof. In another embodiment, the therapeutic agent is a platinum-based drug. In another embodiment, the therapeutic agent is a taxane-based drug. In additional embodiments, the molar ratio of yPTHF/therapeutic agent in the complex is in the range 1-10:1.
  • the molar ratio of yPTHF/therapeutic agent in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/therapeutic agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPPTHF/ therapeutic agent is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/therapeutic agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the yPTHF complex comprises yPTHF and cyclodextrin.
  • the molar ratio of yPTHF (e.g., yPTHF salt)/cyclodextrin in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of g PT H F/c y c 1 ode x ti n in the complex is in the range 1-10:1, or any range therein between.
  • the molar ratio of yPTHF/cyclodextrin in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/cyclodextrin in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of g PT H F/c y c 1 ode x t ri n in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/cyclodextrin is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/cyclodcxt in complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a composition comprising a g PT H F/p 1 a t i n u m - based chemotherapeutic agent complex.
  • the platinum- based chemotherapeutic agent is selected from the group consisting of: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the g PT H F/p 1 a t i n u m -based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of g PT H F/p 1 a t i n u m -based agent in the complex is in the range 1-20:1, or any range therein between. In some embodiments, the molar ratio of g PT H F/p 1 a t i n u m -based agent in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of g PT H F/p 1 a t i n u m -based agent in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of g PT H F/p 1 a t i n u m -based agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of g PT H F/p 1 a t i n u m -based agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/platinum-based agent is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the g PT H F//p 1 a t i n u m - based agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the g PT H F/p 1 a t i n u m - based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of gRTH F/p 1 at i n u m- based analog in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of g PT H F/p 1 a t i n u m - based analog in the complex is in the range 1-10:1, or any range therein between.
  • the molar ratio of g PT H F/p 1 a t i n u m - based agent in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/platinum-based analog in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of g PT H F/p 1 a t i n u m - based analog in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/platinum-based analog is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the g PT H F//p 1 a t i n u m -based analog complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing yPTHF and cisplatin or a salt or acid thereof.
  • the molar ratio of yPTHF/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPTHF/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/cisplatin (or cisplatin salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/cisplatin (or cisplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/cisplatin (or cisplatin salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/cisplatin (or cisplatin salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF//cisplatin (or cisplatin salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing yPTHF and carboplatin or a salt or acid thereof.
  • the molar ratio of g PT H F/c a bo p 1 a t i n (or carboplatin salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of gRTH F/carbop 1 at i n (or carboplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between.
  • the molar ratio of gRTH F/carbop 1 at i n (or carboplatin salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/ carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/carboplatin (or carboplatin salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/carboplatin (or carboplatin salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/carboplatin (or carboplatin salt or acid) complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing yPTHF and oxaliplatin, or a salt or acid thereof.
  • the molar ratio of yPTHF/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPTHF/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10:1, or any range therein between.
  • the molar ratio of yPTHF/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/oxaliplatin (or oxaliplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21- 50): 1, or >50:1.
  • the molar ratio of yPTHF/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/oxaliplatin (or oxaliplatin salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1: 10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/oxaliplatin (or oxaliplatin salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising yPTHF and a platinum-based chemotherapeutic agent (platinum) selected from the group consisting of: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • platinum-based chemotherapeutic agent platinum-based chemotherapeutic agent selected from the group consisting of: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, t
  • the gRTH F/p 1 at i n u m- based chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof.
  • the molar ratio of yPTHF/platinum (or platinum salt or acid) in the complex is in the range 1-20:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/platinum (or platinum salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/platinum (or platinum salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/platinum (or platinum salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of of yPTHF/platinum (or platinum salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of of yPTHF/platinum (or platinum salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/platinum (or salt or acid or analog thereof) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a composition comprising a yPTHF/taxane-based chemotherapeutic agent (taxane) complex.
  • the taxane -based chemotherapeutic agent is selected from the group consisting of: paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX), and cabazitaxel (CTX), or a salt or acid thereof.
  • PTX paclitaxel
  • DTX docetaxel
  • LTX larotaxel
  • CTX cabazitaxel
  • the molar ratio of g PT H F/t a x a n c- b a s cd agent in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPTHF/taxane (or taxane salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/taxane (or taxane salt or acid) in the complex is in the range 2-8:1, or any range therein between. In some embodiments, the molar ratio of yPTHF/taxane (or taxane salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of yPTHF/taxane (or taxane salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of g yPTHF/taxane (or taxane salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the g PT H F/t a x a n c- b a s cd agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising yPTHF and paclitaxel (PTX), or a salt or acid thereof.
  • the yPTHF/taxane-based chemotherapeutic agent complex comprises an analog of paclitaxel (PTX), or a salt or acid thereof.
  • the molar ratio of yPTHF/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/paclitaxel (or paclitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/paclitaxel (or paclitaxel salt or acid) is: 1: 1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/paclitaxel (or paclitaxel salt or acid) complex is encapsulated in a liposome (e.g as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising yPTHF and docetaxel (DTX), or a salt or acid thereof.
  • the yPTHF/taxane-based chemotherapeutic agent complex comprises an analog of docetaxel (DTX), or a salt or acid thereof.
  • the molar ratio of yPTHF/docetaxel (or docetaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPTHF/docetaxel (or docetaxel salt or acid) in the complex is in the range 1-10:1, or any range therein between.
  • the molar ratio of yPTHF/docetaxel (or docetaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between. In some embodiments, the molar ratio of yPTHF/docetaxel (or docetaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/docetaxel (or docetaxel salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/docetaxel (or docetaxel salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/docetaxel (or docetaxel salt or acid) complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising yPTHF and larotaxel (LTX), or a salt or acid thereof.
  • the yPTHF/taxane-based chemotherapeutic agent complex comprises an analog of larotaxel (LTX), or a salt or acid thereof.
  • the molar ratio of yPTHF/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPTHF/ larotaxel (or larotaxel salt or acid) in the complex is in the range 1- 10:1, or any range therein between.
  • the molar ratio of yPTHF/ larotaxel (or larotaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between. In some embodiments, the molar ratio of yPTHF/larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/larotaxel (or larotaxel salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1 : 2- 8, or any range therein between.
  • the molar ratio of yPTHF/larotaxel (or larotaxel salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/larotaxel (or larotaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising yPTHF and cabazitaxel (CTX), or a salt or acid thereof.
  • CTX cabazitaxel
  • the yPTHF/taxane-based chemotherapeutic agent complex comprises an analog of cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of yPTHF/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-20:1, or any range therein between.
  • the molar ratio of yPTHF/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/cabazitaxel (or cabazitaxel salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/cabazitaxel (or cabazitaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising yPTHF and another anti-metabolite, or a salt or acid thereof.
  • An anti-metabolite is a chemical with a structure that is similar to a metabolite required for normal biochemical reactions, yet different enough to interfere with one or more normal functions of cells, such as cell division.
  • the disclosure provides a complex comprising yPTHF and tetrahydrofolate (THF), or a salt or acid thereof.
  • the disclosure provides a complex comprising yPTHF and an anti-metabolite selected from the group consisting of, gemcitabine, fluorouracil, capecitabine, an antifoilate (e.g., tetrahydrofolate, tetrahydrofolate), tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6-mercaptopurine, azathioprine, 6- thioguanine, pentostatin, fludarabine phosphate, and cladribine, as well as pharmaceutically acceptable salt or acids, acids, or derivatives of any of these.
  • an anti-metabolite selected from the group consisting of, gemcitabine, fluorouracil, capecitabine, an antifoilate (e.g., tetrahydrofolate, tetrahydrofolate), tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6-mercap
  • the molar ratio of gRTH F/an t i - rnctabo 1 i tc (or anti-metabolite salt or acid) in the complex is in the range 1-20:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/ anti metabolite (or anti-metabolite salt or acid) in the complex is in the range 1-10:1, or any range therein between. In further embodiments, the molar ratio of yPTHF/ anti-metabolite (or anti metabolite salt or acid) in the complex is in the range 2-8:1, or any range therein between.
  • the molar ratio of yPTHF/ anti-metabolite (or anti-metabolite salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of yPTHF/ anti-metabolite (or anti-metabolite salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of yPTHF/ anti-metabolite (or anti-metabolite salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF/ anti-metabolite (or anti-metabolite salt or acid) complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex of yPTHF (e.g., a yPTHF disclosed herein) and a cyclodextrin.
  • Cyclodextrins are groups of cyclic oligosaccharides which have been shown to improve physicochemical properties of many drugs through formation of complexes.
  • CDs are cyclic oligosaccharides composed of several D-glucose units linked by a-(l,4) bonds. This cyclic configuration provides a hydrophobic internal cavity and gives the CDs a truncated cone shape. Many hydroxyl groups are situated on the edges of the ring which make the CDs both lipophilic and soluble in water. As a result, CDs are able to form complexes with a wide variety of hydrophobic agents, and thus change the physical-chemical properties of these complexed agents.
  • cyclodextrin refer generally to a parent or derivatized cyclic oligosaccharide containing a variable number of (a- l,4)-linked D-glucopyranoside units that is able to form a complex with a tetrahydrofolate-PG.
  • Each cyclodextrin glucopyranoside subunit has secondary hydroxyl groups at the 2 and 3 positions and a primary hydroxyl group at the 6-position.
  • cyclodextrin refer to a cyclodextrin containing D-glucopyranoside units having the basic formula C6H12O6 and a glucose structure without any additional chemical substitutions (e.g., a-cyclodextrin consisting of 6 D-glucopyranoside units, a b-cyclodextrin cyclodextrin consisting of 7 D-glucopyranoside units, and a g-cyclodextrin cyclodextrin consisting of 8 D- glucopyranoside units).
  • the physical and chemical properties of a parent cyclodextrin can be modified by derivatizing the hydroxyl groups with other functional groups. Any substance located within the cyclodextrin internal phase is said to be "complexed" with the cyclodextrin, or to have formed a complex (inclusion complex) with the cyclodextrin.
  • the cyclodextrin component of the yPTHF/cyclodextrin complexes there are no particular limitations on the cyclodextrin component of the yPTHF/cyclodextrin complexes so long as the cyclodextrins can form complexes with the yPTHF.
  • the cyclodextrins have been derivatized to bear ionizable (. e.g ., weakly basic and/or weakly acidic) functional groups to facilitate complex formation with yPTHF and/or liposome encapsulation.
  • the cyclodextrin of the g PT H F/c y c 1 ode x t i n complex has at least 2, 3, 4, 5, 6, 6, 7, 8, 9, or 10, hydroxyl group substituted with an ionizable chemical group.
  • charged cyclodextrin refers to a cyclodextrin having one or more of its hydroxyl groups substituted with a charged moiety.
  • a moiety can itself be a charged group or it can comprise an organic moiety (e.g., a Ci-C 6 alkyl or Ci-C 6 alkyl ether moiety) substituted with one or more charged moieties.
  • the "ionizable" or “charged” moieties of a CD derivative are weakly ionizable.
  • Weakly ionizable moieties are those that are either weakly basic or weakly acidic.
  • Weakly basic functional groups (W) have a pKa of between about 6.0-9.0, 6.5-8.5, 7.0- 8.0, 7.5-8.0, and any range in between inclusive according to CH3-W.
  • weakly acidic functional groups (X) have a log dissociation constant (pKa) of between about 3.0-7.0, 4.0- 6.5, 4.5-6.5, 5.0-6.0, 5.0-5.5, and any range in between inclusive according to CH3-X.
  • Representative anionic moieties include, without limitation, carboxylate, carboxymethyl, succinyl, sulfonyl, phosphate, sulfoalkyl ether, sulphate carbonate, thiocarbonate, dithiocarbonate, phosphate, phosphonate, sulfonate, nitrate, and borate groups.
  • Representative cationic moieties include, without limitation, amino, guanidine, and quartemary ammonium groups.
  • the derivatized cyclodextrin is a "polyanion” or “polycation.”
  • a polyanion is a derivatized cyclodextrin having more than one negatively charged group resulting in net a negative ionic charge of more than two units.
  • a polycation is a derivatized cyclodextrin having more than one positively charged group resulting in net positive ionic charger of more than two units.
  • the derivatized cyclodextrin is a "chargeable amphiphile.”
  • chargeable is meant that the amphiphile has a pK in the range pH 4 to 8, or pH 4 to 8.5.
  • a chargeable amphiphile may therefore be a weak acid or base.
  • amphoteric herein is meant a derivatized cyclodextrin having a ionizable groups of both anionic and cationic character wherein: (a) at least one, and optionally both, of the cation and anionic amphiphiles is chargeable, having at least one charged group with a pK between 4 and 8 to 8.5, (b) the cationic charge prevails at pH 4, and (c) the anionic charge prevails at pH 8 to 8.5.
  • the "ionizable" or “charged” derivatized cyclodextrin as a whole, whether polyionic, amphiphilic, or otherwise, are weakly ionizable (e.g., have a pKai of between about 4.0-8.5, 4.5-8.0, 5.0-7.5, 5.5-7.0, 6.0-6.5, and any range in between inclusive).
  • Any one, some, or all hydroxyl groups of any one, some or all a-D-glucopyranoside units of a cyclodextrin can be modified to an ionizable chemical group as described herein. Since each cyclodextrin hydroxyl group differs in chemical reactivity, reaction with a modifying moiety can produce an amorphous mixture of positional and optical isomers. Alternatively, certain chemistry can allow for pre-modified a-D-glucopyranoside units to be reacted to form uniform products.
  • the aggregate substitution that occurs for cyclodextrin derivatives in a mixture is described by a term referred to as the degree of substitution.
  • a 6-ethylenediamino- b-cyclodextrin with a degree of substitution of seven would be composed of a distribution of isomers of 6-ethylenediamino-P-cyclodextrin in which the average number of ethylenediamino groups per 6-ethylenediamino-P-cyclodextrin molecule is seven.
  • the degree of substitution for a cyclodextrin derivative mixture can routinely be determined using mass spectrometry or nuclear magnetic resonance spectroscopy.
  • At least one hydroxyl moieties facing away from the cyclodextrin interior is substituted with an ionizable chemical group.
  • the C2, C3, C6, C2 and C3, C2 and C6, C3 and C6, and all three of C2-C3-C6 hydroxyls of at least one g-D- glucopyranoside unit are substituted with an ionizable chemical group.
  • Any such combination of hydroxyls can similarly be combined with at least two, three, four, five, six, seven, eight, nine, ten, eleven, up to all of the alpha-D-glucopyranoside units in the modified cyclodextrin as well as in combination with any degree of substitution described herein.
  • SAE-CD sulfoalkyl ether cyclodextrin
  • SBE-P-CD beta cyclodextrin
  • Additional cyclodextrin derivatives that may be complexed with therapeutic agents in the disclosed liposome compositions include sugammadex or Org-25969, in which the 6- hydroxy groups on g-CD have been replaced by carboxythio acetate ether linkages, and hydroxybutenyl-P-CD.
  • cyclodextrin examples include: 2,6-Di-O-methyl-P-CD (DIMEB), 2-hydroxylpropyl-3-cyclodextrin (HP-P-CD), randomly methylated-P-cyclodextrin (RAMEB), sulfobutyl ether P-cyclodextrin (SBE-P-CD), and s u 1 fo b u t y 1 et hcr-y-c yc 1 odcx t i n (SBEyCD), sulfobutylated beta-cyclodextrin sodium salt, (2-Hydroxypropyl)-gamma- cyclodextrin, (2-Hydroxypropyl)-beta-cyclodextrin, (2-Hydroxypropyl)-y-cyclodextrin, 2,6- di-0-methyl)-beta-cyclodextrin (DIMEB-50 H
  • the cyclodextrin(s) has a high solubility in water in order to facilitate entrapment of a larger amount of the cyclodextrin in the liposome internal phase.
  • the water solubility of the cyclodextrin is at least 10 mg/mL, 20 mg/mL, 30 mg/mL, 40 mg/mL, 50 mg/mL, 60 mg/mL, 70 mg/mL, 80 mg/mL, 90 mg/mL, 100 mg/mL or higher.
  • the water solubility of the cyclodextrin(s) is within a range of 10-150 mg/mL, 20-100 mg/mL 20-75 mg/mL, and any range in between inclusive.
  • a large association constant between the cyclodextrin and the gRTHE and/or other therapeutic agent complexed with cyclodextrin is preferable and can be obtained by selecting the number of glucose units in the cyclodextrin based on the size of the therapeutic agent (see, for example, Albers et al, Crit. Rev. Therap. Drug Carrier Syst. 12:311- 337 (1995); Stella et al, Toxicol. Pathol. 36:30-42 (2008).
  • the association constant depends on pH
  • the cyclodextrin can be selected such that the association constant becomes large at the pH of the liposome internal phase.
  • the solubility (nominal solubility) of the therapeutic agent in the presence of cyclodextrin can be further improved.
  • the association constant of the cyclodextrin with the therapeutic agent is 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, or higher.
  • the association constant of the cyclodextrin with the therapeutic agent is in the range 100-1, 200, 200-1,000, 300-750, and any range therein between.
  • the cylcodextrin of the yPTHF/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is underivatized.
  • the cylcodextrin of the yPTHF/cyclodextrin complex and/or cyclodextrin/therapeutic agent complex is derivatized.
  • the cyclodextrin derivative of the complex has the structure of Formula I:
  • n 4, 5, or 6;
  • Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs, and R9 are each, independently, -H, a straight chain or branched Ci-C 8 - alkylene group, or an optionally substituted straight-chain or branched Ci- C 6 group, wherein at least one of Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs and R9 is a straight-chain or branched Ci-Cs- alkylene (e.g., Ci-C 8 -(alkylene)-S03 group);
  • the cyclodextrin derivative of the g PT H F/c y c 1 ode x t i n complex and/or cyclodextrin/therapeutic agent complex has the structure of formula II:
  • n 4, 5, or 6;
  • Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs, and R9 are each, independently, -O- or a -0-(C 2 -C 6 alkylene)-S0 3 - group; wherein at least one of Ri and R 2 is independently a -0-(C 2 -C 6 alkylene)-S03 _ group; and Si, S 2 , S3, S4, Ss, S 6 , S7, Ss, and S9 are each, independently, a pharmaceutically acceptable cation.
  • the pharmaceutically acceptable cation is selected from: an alkali metal such as Li + , Na + , or K + ; an alkaline earth metal such as Ca +2 , or Mg +2 and ammonium ions and amine cations such as the cations of (C1-C6)- alkylamines, piperidine, pyrazine, (Cl-C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • an alkali metal such as Li + , Na + , or K +
  • an alkaline earth metal such as Ca +2 , or Mg +2
  • ammonium ions and amine cations such as the cations of (C1-C6)- alkylamines, piperidine, pyrazine, (Cl-C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • At least one of Rl and R2 is independently a -0-(C2-C6 alkylene)-S03- group that is a -0-(CH 2 ) m S03- group, wherein m is 2 to 6, preferably 2 to 4, (e.g., -O- CH2CH2CH2SO3- or -O- CH2CH2CH2CH2SO3-); and Si, S 2 , S3, S 4 , Ss, S 6 , S 7 , S 8 , and S 9 are each, independently, H or a pharmaceutically cation which includes for example, alkali metals (e.g., Li + , Na + , K + ) alkaline earth metals (e.g., Ca +2 , Mg +2 ), ammonium ions and amine cations such as the cations of (Ci-C 6 )-alkylamines, piperidine, pyrazine, (Ci-C 6 )-alkanol
  • a cyclodextrin derivative of the g PT H F/c y c 1 ode x t ri n complex and/or cyclodextrin/therapeutic agent complex is a cyclodextrin disclosed in U.S. Pat. Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013, 6,869,939; and Intl. Appl. Publ. No. WO 02005/117911, the contents each of which is herein incorporated by reference in its priority.
  • the cyclodextrin derivative of the g PT H F/c y c 1 ode x t ri n complex and/or cyclodextrin/therapeutic agent complex is a sulfoalkyl ether cyclodextrin.
  • the cyclodextrin derivative of complex is a sulfobutyl ether-3-cyclodextrin such as CAPTISOL® (CyDex Pharma. Inc., Lenexa, Kansas. Methods for preparing sulfobutyl ether-3- cyclodextrin and other rsulfoalkyl ether cyclodextrins are known in the art.
  • the cyclodextrin derivative in of the yPTHF/cyclodcxtrin complex and/or cyclodextrin/therapeutic agent complex is a compound of Formula III:
  • the g PT H F/c y c 1 ode x t ri n complex and/or cyclodextrin/therapeutic agent complex is encapsulated in a liposome ( e.g ., as described herein or otherwise known in the art).
  • the disclosure provides yPTHF delivery systems and their use to deliver a payload of yPTHF to a cell or cells in vitro or in vivo.
  • yPTHF is complexed with or incorporated into a delivery vehicle.
  • Such delivery vehicles include, but are not limited to, liposomes, lipospheres, polymers, peptides, proteins, antibodies (e.g., ADCs such as Antibody- yPTHF conjugates), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), lipoprotein particles, and combinations thereof.
  • the delivery vehicle is a liposome.
  • the delivery vehicle is an antibody or an antigen binding antibody fragment.
  • the disclosure provides liposomal compositions that comprise a liposome encapsulating (i.e., filled with) a yPTHF (e.g., a yPTHF disclosed herein).
  • a liposome in the liposomal composition comprises a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups (including the glutamyl group in tetrahydrofolate).
  • the yPTHF in the Lp-yPTHF comprises two or more glutamyl groups in the L-form.
  • the yPTHF in the Lp-yPTHF comprises a glutamyl group in the D-form.
  • the yPTHF in the Lp-yPTHF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the yPTHF in the Lp-yPTHF comprises two or more glutamyl groups that have a glamma carboxyl linkage.
  • the liposomal composition comprises a liposome comprising a g pentaglutamated THF. In further embodiments, the liposome comprises an L-g pentaglutamated THF, a D-g pentaglutamated THF, or an L- and D-g pentaglutamated THF.
  • the liposomal composition comprises a liposome comprising a g hexaglutamated THF (Lp-yPTHF).
  • the liposome comprises an L-g hexaglutamated THF, a D-g hexaglutamated THF, or an L- and D-g hexaglutamated THF.
  • the liposomal composition comprises a liposome that is anionic or neutral.
  • the liposomal composition comprises a liposome that is cationic.
  • the Lp-yPTHF composition is unpegylated.
  • the Lp-yPTHF composition is non-targeted (NTLp- yPTHF). In other embodiments, the Lp-yPTHF composition is targeted (TLp-yPTHF).
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 500 nm, or any range therein between. In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 400 nm, or any range therein between. In some embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 300 nm or any range therein between.
  • the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 200 nm, or any range therein between. In further embodiments, the liposomal composition comprises a liposome having a diameter in the range of 20 nm to 150 nm, or any range therein between. In further embodiments, the liposomal composition comprises a liposome having a diameter in the range of 80 nm to 120 nm, or any range therein between. In additional embodiments, 30-70%, 30-60%, or 30-50% w/w yPTHF, or any range therein between, is encapsulated (entrapped) in the Lp-yPTHF during the process of preparing the liposomes.
  • the Lp-aPTHF composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma polyglutamated THF. In some embodiments, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more than 75%, w/w, yPTHF, is encapsulated in the Lp-yPTHF during the process of preparing the liposomes.
  • the provided liposomes further comprise an immuno stimulatory agent, a detectable marker, or both disposed on its exterior.
  • the immuno stimulatory agent or detectable marker can be ionically bonded or covalently bonded to an exterior of the liposome, including, for example, optionally to a steric stabilizer component of the liposome.
  • immuno stimulatory agents also known as“immunostimulants”, and “immuno stimulators”, refer to substances that stimulate an immune (including a preexisting immune response) by inducing activation or increasing activity of any of the components of the immune system.
  • immuno stimulatory agents can include one or more of a hapten, an adjuvant, a protein immuno stimulating agent, a nucleic acid immuno stimulating agent, and a chemical immuno stimulating agent.
  • Many adjuvants contain a substance designed to stimulate immune responses, such as lipid A, Bortadella pertussis or Mycobacterium tuberculosis derived proteins.
  • adjuvants are commercially available as, for example, Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.); AS-2 (SmithKline Beecham, Philadelphia, PA.); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; IFN-alpha, IFN-gamma, FLT3-ligand; and immuno stimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3.
  • immuno stimulatory antibodies e.g., anti-CTLA-4, anti-CD28, anti-CD3.
  • Cytokines such as GM-CSF, interleukin-2, -7, -12, and -15, and other like growth factors, can also be used as adjuvants.
  • the immunostimulant can be at least one selected from the group consisting of fluorescein, DNP, beta glucan, beta-l,3-glucan, beta-l,6-glucan.
  • the immunostimulant is a Toll-like receptor (TLR) modulating agent.
  • TLR Toll-like receptor
  • the Toll-like receptor (TLR) modulating agent is one or more of: an oxidized low-density lipoprotein (e.g.,.
  • the liposomes comprise fluorescein isothiocyanate (FITC) which, based on our experiments, surprisingly serves as both an immunostimulant and a detectable marker.
  • FITC fluorescein isothiocyanate
  • the liposomes comprise a detectable marker.
  • a detectable marker may, for example, include, at least, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator, an enzyme, a dye, an ink, a magnetic compound, a biocatalyst or a pigment that is detectable by any suitable means known in the art, e.g., magnetic resonance imaging (MRI), optical imaging, fluorescent/luminescent imaging, and/or nuclear imaging techniques.
  • MRI magnetic resonance imaging
  • optical imaging fluorescent/luminescent imaging
  • nuclear imaging techniques e.g., nuclear imaging techniques.
  • the immunostimulatory agent and/or detectable marker is attached to the exterior by co-incubating it with the liposome.
  • the immuno stimulatory agent and/or detectable marker may be associated with the liposomal membrane by hydrophobic interactions or by an ionic bond such as an avidin/biotin bond or a metal chelation bond ( e.g ., Ni-NTA).
  • the immuno stimulatory agent or detectable marker may be covalently bonded to the exterior of the liposome such as, for example, by being covalently bonded to a liposomal component or to the steric stabilizer which is the PEG.
  • the liposomes further comprise an agent that increases the uptake of liposomes into a cellular compartment of interest including the cytosol.
  • the liposomes comprise a mitochondrial-targeting agent.
  • the liposomes comprise triphenylphosphonium (TPP).
  • TPP triphenylphosphonium
  • Methods and mechanisms for surface functionalizing liposomes with TPP are known in the art (e.g., attaching TPP to the lipid anchor via a peg spacer group and modifying TPP with a steady group (stearyl triphenylphosphonium (STPP)).
  • STPP stearyl triphenylphosphonium
  • the liposomes comprise high-density octa-arginine.
  • the liposomes comprise sphingomyelin and/or a sphingomyelin metabolite.
  • Sphingomyelin metabolite used to formulate the liposomes of the present invention can include, for example ceramide, sphingosine or sphingosine 1 -phosphate.
  • the liposomes comprise Rhodamine 123.
  • the liposomes comprise, a mitochondria penetrating peptide.
  • the liposomes comprise, a mitochondria penetrating agent selected from the group consisting of: a mitofusin peptide, a mitochondrial targeting signal peptide, and Antennapedia helix III homeodomain cell-penetrating peptide (ANT) (e.g., comprising RQIKIWFQNRRMKWKKRKKRRQR RR (SEQ ID NO:l), RKKRRXR RRGC where X is any natural or non-natural amino acid (SEQ ID NO:2), CCGCCAAGAAGCG (SEQ ID NOG), GCGTGCACACGCGCGTAGACTTCCCCCGCAAGTCACTCGTT AGCCCGCCAAGAAGCGACCCCTCCGGGGCGAGCTGAGCGGCGTGGCGCGGG GGCGTCAT (SEQ ID NO:4), ACGTGCATACGCACGTAGACATTCCCCGCTTCC CACTCCAAAGTCCGCCAAGAAGCGTATCCCGCTGAGCGGCGTGGCGCGGGGGC GTCATCCGTCA
  • ANT
  • liposomes in the provided liposome compositions comprise a mitochondria penetrating agent selected from the group: a guanidine-rich peptoid, tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenyl-phosphonium and/or tetraphenylphosphonium).
  • a mitochondria penetrating agent selected from the group: a guanidine-rich peptoid, tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenyl-phosphonium and
  • liposomes in the provided liposome compositions comprise sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes comprise sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes comprise DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-arginine.
  • the liposomes comprise DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-arginine at a molar ratio of 9:2:1.
  • the liposomes comprise the MITO-porter® system or a variant thereof.
  • liposomes in the provided liposome compositions comprise an agent such as a cell penetrating agent that that facilitates delivery of the liposome across a cell membrane and provides the liposome with the ability to bypass the endocytic pathway and the harsh environment of lysosomes.
  • Cell penetrating agents are known in the art and can routinely be used and adapted for manufacture and use of the provided liposome compositions.
  • the cell penetrating/lysosome bypassing agent is chloroquine.
  • the cell penetrating agent is a cell penetrating peptide.
  • liposomes in the provided liposome compositions comprise a cell penetrating agent selected from the group: RKKRRQRRR (SEQ ID NO:7), GRKKRRQRRRTPQ (SEQ ID NO:8), Y GRKKRRQRRR (SEQ ID NO:9), AAVAL LPAVLLALLA (SEQ ID NO: 10), MGLGLHLLVLAAALQ (SEQ ID NO: 11), GALFL GFLGAAGSTM (SEQ ID NO: 12), AGYLLGKINLKALAALAKKIL (SEQ ID NO: 13), RVIRVWFQNKRCKDKK (SEQ ID NO: 14), RQIKIWFQNRRMKWKK (SEQ ID NO: 15), GLFE AIAGFIEN GWEGMID G (SEQ ID NO: 16), GWTLN S AG YLLGKIN (SEQ ID NO: 17), RS QS RS RY YRQRQRS (SEQ ID NO: 18), LAIPEQEY
  • the liposomes may comprise a steric stabilizer that can increase their longevity in circulation.
  • the steric stabilizer may be at least one member selected from the group consisting of polyethylene glycol (PEG), poly-L-lysine (PLL), monosialoganglioside (GM1), poly(vinyl pyrrolidone) (PVP), poly(acrylamide) (PAA), poly(2-methyl-2-oxazoline), poly(2-ethyl-2- oxazoline), phosphatidyl polyglycerol, poly[N-(2-hydroxypropyl) methacrylamide], amphiphilic poly-N-vinylpyrrolidones, L-amino-acid-based polymer, oligoglycerol, copolymer containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and polyvinyl alcohol.
  • the steric stabilizer or the population of steric stabilizer is PEG.
  • the steric stabilizer is a PEG.
  • the PEG has a number average molecular weight (Mn) of 200 to 5000 daltons.
  • Mn number average molecular weight
  • the liposomal composition comprises a pegylated liposome (PLp-yPTHF).
  • a pegylated liposome in the liposomal composition comprises a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups.
  • the yPTHF in the Lp-yPTHF comprises two or more glutamyl groups in the L- form.
  • the yPTHF in the Lp-yPTHF comprises a glutamyl group in the D-form.
  • the yPTHF in the Lp-yPTHF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.
  • the liposomal composition comprises a pegylated liposome comprising a g pentaglutamated THF.
  • the liposome comprises an L-g pentaglutamated THF, a D-g pentaglutamated THF, or an L- and D-g pentaglutamated THF.
  • the liposomal composition comprises a pegylated liposome comprising a g hexaglutamated THF.
  • the liposome comprises an L-g hexaglutamated THF, a D-g hexaglutamated THF, or an L- and D-g hexaglutamated THF.
  • the liposomal composition comprises a pegylated liposome that is anionic or neutral.
  • the liposomal composition comprises a pegylated liposome that is cationic.
  • the PLp-yPTHF composition is non-targeted (NTPLp-yPTHF). In other embodiments, the PLp-yPTHF composition is targeted (TPLp-yPTHF).
  • the liposomal composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the yPTHF.
  • the liposomal composition comprises a pegylated liposome comprising at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the yPTHF is encapsulated (entrapped) in the PLp-yPTHF during the process of preparing the liposomes.
  • the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 500 nm. In some embodiments, the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 400 nm. In some embodiments, the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 300 nm. In some embodiments, the liposomal composition comprises a pegylated liposome having a diameter in the range of 20 nm to 200 nm. In further embodiments, the liposomal composition comprises a pegylated liposome having a diameter in the range of 80 nm to 120 nm.
  • greater than 70%, 80% or 90% of the polyglutamated tetrahydrofolate in a provided liposomal composition is pentaglutamated. In some embodiments, greater than 70%, 80% or 90% of the polyglutamated tetrahydrofolate in a provided composition is hexaglutamated. In some embodiments, greater than 70%, 80% or 90% of the polyglutamated tetrahydrofolate in the composition has 4-10, 4-6, or more than 5, g-glutamyl groups.
  • the yPTHF compositions are in an aqueous solution.
  • the yPTHF composition is administered in a liposomal composition at a dose of between 0.005 and 5000 mg of yPTHF per square meter (m 2 ) of body surface area, or any range therein between.
  • the yPTHF composition is administered in a liposomal composition at a dose of between 0.1 and 1000 mg yPTHF per square meter of body surface area, or any range therein between.
  • the lipids and other components of the liposomes contained in the liposomal compositions can be any lipid, lipid combination and ratio, or combination of lipids and other liposome components and their respective ratios known in the art.
  • liposomal encapsulation of any particular drug such as, and without limitation, the gamma polyglutamated THF discussed herein, may involve substantial routine experimentation to achieve a useful and functional liposomal formulation.
  • the provided liposomes may have any liposome structure, e.g., structures having an inner space sequestered from the outer medium by one or more lipid bilayers, or any microcapsule that has a semi-permeable membrane with a lipophilic central part where the membrane sequesters an interior.
  • the lipid bilayer can be any arrangement of amphiphilic molecules characterized by a hydrophilic part (hydrophilic moiety) and a hydrophobic part (hydrophobic moiety).
  • amphiphilic molecules in a bilayer are arranged into two dimensional sheets in which hydrophobic moieties are oriented inward the sheet while hydrophilic moieties are oriented outward.
  • Amphiphilic molecules forming the provided liposomes can be any known or later discovered amphiphilic molecules, e.g., lipids of synthetic or natural origin or biocompatible lipids.
  • the liposomes can also be formed by amphiphilic polymers and surfactants, e.g., polymerosomes and niosomes.
  • these liposome-forming materials also are referred to as "lipids".
  • the liposome composition formulations provided herein can be in liquid or dry form such as a dry powder or dry cake.
  • the dry powder or dry cake may have undergone primary drying under, for example, lyophilization conditions or optionally, the dry cake or dry powder may have undergone both primary drying only or both primary drying and secondary drying.
  • the powder or cake may, for example, have between 1% to 6% moisture, for example, such as between 2% to 5% moisture or between 2% to 4% moisture.
  • One example method of drying is lyophilization (also called freeze-drying, or cyrodessication).
  • compositions and methods of the disclosure may include liposomes, lyophilized liposomes or liposomes reconstituted from lyophilized liposomes.
  • the disclosed compositions and methods include one or more lyoprotectants or cryoprotectants. These protectants are typically polyhydroxy compounds such as sugars (mono-, di-, and polysaccharides), polyalcohols, and their derivatives, glycerol, or polyethyleneglycol, trehalose, maltose, sucrose, glucose, lactose, dextran, glycerol, or aminoglycosides.
  • the lyoprotectants or cryoprotectants comprise up to 10% or up to 20% of a solution outside the liposome, inside the liposome, or both outside and inside the liposome.
  • the liposomes include a steric stabilizer that increases their longevity in circulation.
  • a steric stabilizer such as a hydrophilic polymer (Polyethylene glycol (PEG)), a glycolipid (monosialoganglioside (GM1)) or others occupies the space immediately adjacent to the liposome surface and excludes other macromolecules from this space. Consequently, access and binding of blood plasma opsonins to the liposome surface are hindered, and thus interactions of macrophages with such liposomes, or any other clearing mechanism, are inhibited and longevity of the liposome in circulation is enhanced.
  • PEG Polyethylene glycol
  • GM1 glycolipid
  • the steric stabilizer or the population of steric stabilizers is a PEG or a combination comprising PEG.
  • the steric stabilizer is a PEG or a combination comprising PEG with a number average molecular weight (Mn) of 200 to 5000 daltons.
  • Mn number average molecular weight
  • These PEG(s) can be of any structure such as linear, branched, star or comb structure and are commercially available.
  • the diameter of the disclosed liposomes is not particularly limited.
  • the liposomes have a diameter in the range of for example, 30-150 nm (nanometer). In other embodiments, the liposomes have a diameter in the range of 40-70 nm.
  • the properties of liposomes are influenced by the nature of lipids used to make the liposomes.
  • lipids have been used to make liposomes. These include cationic, anionic and neutral lipids.
  • the liposomes comprising the yPTHF are anionic or neutral.
  • the provided liposomes are cationic.
  • the determination of the charge can routinely be determined by measuring the zeta potential of the liposome.
  • the zeta potential of the liposome can be positive, zero or negative.
  • the zeta potential of the liposome is less than or equal to zero.
  • the zeta potential of the liposome is in a range of 0 to -150 mV. In another embodiment, the zeta potential of the liposome is in the range of -30 to -50 mV.
  • cationic lipids are used to make cationic liposomes which are commonly used as gene transfection agents.
  • the positive charge on cationic liposomes enables interaction with the negative charge on cell surfaces. Following binding of the cationic liposomes to the cell, the liposome is transported inside the cell through endocytosis.
  • a neutral to anionic liposome is used.
  • an anionic liposome is used.
  • Using a mixture of, for example, neutral lipids such as HSPC and anionic lipids such as PEG-DSPE results in the formation of anionic liposomes which are less likely to non- specifically bind to normal cells.
  • Specific binding to tumor cells can be achieved by using a tumor targeting antibody such as, for example, a folate receptor antibody, including, for example, folate receptor alpha antibody, folate receptor beta antibody and/or folate receptor delta antibody.
  • At least one (or some) of the lipids is/are amphipathic lipids, defined as having a hydrophilic and a hydrophobic portions (typically a hydrophilic head and a hydrophobic tail).
  • the hydrophobic portion typically orients into a hydrophobic phase (e.g ., within the bilayer), while the hydrophilic portion typically orients toward the aqueous phase (e.g., outside the bilayer).
  • the hydrophilic portion can comprise polar or charged groups such as carbohydrates, phosphate, carboxylic, sulfato, amino, sulfhydryl, nitro, hydroxy and other like groups.
  • the hydrophobic portion can comprise apolar groups that include without limitation long chain saturated and unsaturated aliphatic hydrocarbon groups and groups substituted by one or more aromatic, cyclo-aliphatic or heterocyclic group(s).
  • amphipathic compounds include, but are not limited to, phospholipids, aminolipids and sphingolipids.
  • the lipids are phospholipids.
  • Phospholipids include without limitation phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, and the like. It is to be understood that other lipid membrane components, such as cholesterol, sphingomyelin, and cardiolipin, can be used.
  • the lipids comprising the liposomes provided herein can be anionic and neutral (including zwitterionic and polar) lipids including anionic and neutral phospholipids.
  • Neutral lipids exist in an uncharged or neutral zwitterionic form at a selected pH.
  • such lipids include, for example, dioleoylphosphatidylglycerol (DOPG), diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides and diacylglycerols.
  • DOPG dioleoylphosphatidylglycerol
  • zwitterionic lipids include without limitation dioleoylphosphatidylcholine (DOPC), dimyristoylphos- phatidylcholine (DMPC), and dioleoylphosphatidylserine (DOPS).
  • DOPC dioleoylphosphatidylcholine
  • DMPC dimyristoylphos- phatidylcholine
  • DOPS dioleoylphosphatidylserine
  • Anionic lipids are negatively charged at physiological pH.
  • lipids include without limitation phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N- dode- canoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphos- phatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.
  • POPG palmitoyloleyolphos- phatidylglycerol
  • anionic and neutral lipids are referred to herein as non-cationic lipids.
  • Such lipids may contain phosphorus but they are not so limited.
  • non-cationic lipids include lecithin, lysolecithin, phosphatidylethanolamine, lysophosphatidylethan- olamine, dioleoylphosphati- dylethanolamine (DOPE), dipalmitoyl phosphatidyl ethanol- amine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidy l-ethan- olamine (DSPE), palmitoyloleoyl-phosphatidylethanolamine (POPE) palmitoyl-oleoyl- phosphatidylcholine (POPC), egg phosphatidylcholine (EPC), distearoylphosphatidyl- choline (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphospha-tidylcholine (DPPC),
  • the liposomes may be assembled using any liposomal assembly method using liposomal components (also referred to as liposome components) known in the art.
  • Liposomal components include, for example, lipids such as DSPE, HSPC, cholesterol and derivatives of these components.
  • Other suitable lipids are commercially available for example, by Avanti Polar Lipids, Inc. (Alabaster, Alabama, USA).
  • a partial listing of available negatively or neutrally charged lipids suitable for making anionic liposomes can be, for example, at least one of the following: DLPC, DMPC, DPPC, DSPC, DOPC, DMPE, DPPE, DOPE, DMPA'Na, DPPA*Na, DOPA*Na, DMPG*Na, DPPG*Na, DOPG*Na, DMPS*Na, DPPS*Na, DOPS*Na, DOPE-Glutaryl»(Na)2, Tetramyristoyl Cardiolipin »(Na)2, DSPE-mPEG- 2000Na, DSPE-mPEG-5000Na, and DSPE-Maleimide PEG-2000*Na.
  • the yPTHF compositions provided herein are formulated in a liposome comprising a cationic lipid.
  • the cationic lipid is selected from, but not limited to, a cationic lipid described in Intl. Appl. Publ. Nos. W02012/040184, WO2011/153120, WO2011/149733, WO2011/090965, WO2011/043913, WO2011/022460, WO2012/061259, WO2012/054365, WO2012/ 044638, W02010/080724, W02010/21865 and W02008/103276, U.S. Pat. Nos.
  • the cationic lipid may be selected from, but not limited to, formula A described in Intl. Appl. Publ. Nos W02012/040184, WO2011/153120, WO201/1149733, WO2011/090965, WO2011/043913, WO2011/022460, WO2012/061259, WO2012/054365 and WO2012/044638; each of which is herein incorporated by reference in their entirety.
  • the cationic lipid may be selected from, but not limited to, formula CLI-CLXXIX of International Publication No. W 02008103276, formula CLI-CLXXIX of U.S. Pat. No. 7,893,302, formula CLI- CLXXXXII of U.S. Pat. No. 7,404,969 and formula I- VI of US Patent Publication No. US20100036115; each of which is herein incorporated by reference in their entirety.
  • the cationic lipid may be selected from (20Z,23Z)-N,N- dimethylnonacosa-20,23-dien-l0-amine, (l7Z,20Z)-N,N-dimemyl-hexacosa-l7,20-dien-9- amine, (lZ,l9Z)-N5N-dimethylpentacosa-l6, l9-dien-8-amine, (l3Z,l6Z)-N,N-dimethyl- docosa-l3,l6-dien-5-amine, (l2Z,l5Z)-N,N-dimethylhenicosa-l2,l5-dien-4-amine,
  • the lipid may be a cleavable lipid such as those described in in Intl. Publ. No. WO2012/170889, which is herein incorporated by reference in its entirety
  • the cationic lipid can routinely be synthesized using methods known in the art and/or as described in Intl. Publ. Nos. W02012/040184, WO2011/153120, WO2011/149733, WO2011/090965, W0201/1043913, WO2011/022460, WO2012/061259, WO2012/054365, WO2012/044638, W02010/080724 and W02010/21865; each of which is herein incorporated by reference in its entirety.
  • Lipid derivatives can include, for example, at least, the bonding (preferably covalent bonding) of one or more steric stabilizers and/or functional groups to the liposomal component after which the steric stabilizers and/or functional groups should be considered part of the liposomal components.
  • Functional groups comprises groups that can be used to attach a liposomal component to another moiety such as a protein. Such functional groups include, at least, maleimide.
  • steric stabilizers include at least one from the group consisting of: polyethylene glycol (PEG); poly-L-lysine (PLL); monosialoganglioside (GM1); poly(vinyl pyrrolidone) (PVP); poly(acrylamide) (PAA); poly(2-methyl-2- oxazoline); poly(2-ethyl-2-oxazoline); phosphatidyl polyglycerol; poly[N-(2-hydroxy- propyl) methacrylamide]; amphiphilic poly-N-vinylpyrrolidones; L-amino-acid-based polymer; and polyvinyl alcohol.
  • PEG polyethylene glycol
  • PLL poly-L-lysine
  • GM1 monosialoganglioside
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylamide)
  • PAA poly(2-methyl-2- oxazoline)
  • the yPTHF compositions are formulated in a lipid-polycation complex.
  • the formation of the lipid-polycation complex may be accomplished using methods known in the art and/or as described in U.S. Pub. No. 20120178702, herein incorporated by reference in its entirety.
  • the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyomithine and/or polyarginine and the cationic peptides described in International Pub. No. WO2012/013326; herein incorporated by reference in its entirety.
  • the yPTHF is formulated in a lipid-polycation complex which further includes a neutral lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).
  • DOPE dioleoyl phosphatidylethanolamine
  • the components of a liposome can include any molecule(s) (e.g., chemical/reagent/protein) that is bound to it
  • the components of the provided liposomes include, at least, a member selected from the group DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG; and cholesterol-maleimide.
  • the components of the provided liposomes include DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG; and cholesterol-maleimide.
  • the liposomal components that make up the liposome comprises DSPE; DSPE-FITC; DSPE- maleimide; cholesterol; and HSPC.
  • the liposomes of the liposome compositions provided herein comprise oxidized phospholipids.
  • the liposomes comprise an oxidize phospholipid of a member selected from the group consisting of phosphatidylserines, phosphatidylinositols, phosphatidylethan-olamines, phosphatidyl-cholines and l-palmytoyl- 2-arachidonoyl-sn-glycero-2-phosphate.
  • the phospholipids have unsaturated bonds.
  • the phospholipids are arachidonic acid containing phospholipids.
  • the phospholipids are sn-2-oxygenated.
  • the phospholipids are not fragmented.
  • the liposomes of the disclosed liposome compositions comprise oxidized l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine (OxPAPC).
  • OxPAPC oxidized l-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine
  • oxPAPC refers to lipids generated by the oxidation of l-palmitoyl- 2-arachidonyl-sn-glycero-3-phosphorylcholine (PAPC), which results in a mixture of oxidized phospholipids containing either fragmented or full length oxygenated sn-2 residues.
  • Well-characterized oxidatively fragmented species contain a five- carbon sn-2 residue bearing omega-aldehyde or omega-carboxyl groups.
  • Oxidation of arachidonic acid residue also produces phospholipids containing esterified isoprostanes.
  • OxPAPC includes HOdiA-PC, KOdiA-PC, HOOA-PC and KOOA-PC species, among other oxidized products present in oxPAPC.
  • the oxPAPCs are epoxyisoprostane-containing phospholipids.
  • the oxPAPC is l-palmitoyl-2-(5,6-epoxyisoprostane E2)-sn-glycero-3-phosphocholine (5,6-PEIPC), l-palmitoyl-2-(epoxy-cyclo-pentenone)-sn- glycero-3-phosphorylcholine (PECPC) and/or l-palmitoyl-2-(epoxy-isoprostane E2)-sn- glycero-4-phosphocholine (PEIPC).
  • the phospholipids have unsaturated bonds.
  • the phospholipids are arachidonic acid containing phospholipids.
  • the phospholipids are sn-2-oxygenated.
  • the phospholipids are not fragmented.
  • the liposomal yPTHF composition is pegylated (/. ⁇ ? ., a pegylated liposomal gamma polyglutamated (e.g pentaglutamated or hexaglutamated) antifolate (PLp-yPTHF or TPLp-yPTHF)).
  • PLp-yPTHF or TPLp-yPTHF is water soluble. That is, the PLp-yPTHF or TPLp-yPTHF is in the form an aqueous solution.
  • the liposomes of the disclosed liposome compositions comprise a lipid selected from: l-palmitoyl-2-glutaroyl-sn-glycero-3-phosphocholine (PGPC); l-palmitoyl-2-(9'oxo-nonanoyl)-sn-glycero-3-phosphocholine; l-palmitoyl-2- arachinodoyl-sn-glycero-3-phosphocholine; l-palmitoyl-2-myristoyl-sn-glycero-3- phosphocholine; l-palmitoyl-2-hexadecyl-sn-glycero-3-phosphocholine; l-palmitoyl-2- azelaoyl-sn-glycero-3-phosphocholine; and l-palmitoyl-2-acetoyl-sn-glycero-3-phospho- choline.
  • PGPC l-palmit
  • the pH of solutions comprising the liposome composition is from pH 5 to 8 or from pH 2 to 6. 2 to 8, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 5 to 8, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from pH 6 to 7, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • At least one component of the liposome lipid bilayer is functionalized (or reactive).
  • a functionalized component is a component that comprises a reactive group that can be used to crosslink reagents and moieties to the lipid. If the lipid is functionalized, any liposome that it forms is also functionalized.
  • the reactive group is one that will react with a crosslinker (or other moiety) to form crosslinks.
  • the reactive group in the liposome lipid bilayer is located anywhere on the lipid that allows it to contact a crosslinker and be crosslinked to another moiety (e.g ., a steric stabilizer or targeting moiety).
  • the reactive group is in the head group of the lipid, including for example a phospholipid.
  • the reactive group is a maleimide group.
  • Maleimide groups can be crosslinked to each other in the presence of dithiol crosslinkers including but not limited to dithiolthrietol (DTT).
  • contemplated reactive groups include but are not limited to other thiol reactive groups, amino groups such as primary and secondary amines, carboxyl groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups, carbonyls, halo acetyl (e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters, sulfhydryl groups, and pyridyl disulfide groups.
  • thiol reactive groups amino groups such as primary and secondary amines, carboxyl groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups, carbonyls, halo acetyl (e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters, sulfhydryl groups, and pyridyl disulfide groups.
  • the provided liposomes enclose an interior space.
  • the interior space comprises, but is not limited to, an aqueous solution.
  • the interior space comprises a yPTHF as provided herein.
  • the interior space of the liposome comprises a tonicity agent.
  • the concentration (weight percent) of the tonicity agent is 0.1-20%, 1-20%, 0.5-15%, 1-15%, or 1-50%, or any range therein between.
  • the interior space of the liposome includes a sugar (e.g ., trehalose, maltose, sucrose, lactose, mannose, mannitol, glycerol, dextrose, fructose, etc.).
  • the concentration (weight percent) of the sugar is 0.1-20%, 1-20%, 0.5-15%, 1-15%, or 1-50%, or any range therein between.
  • the pH of the interior space of the liposome is from pH 2 to 8, or any range therein between.
  • the pH of solutions comprising the liposome composition is from pH 5 to 8, or any range therein between.
  • the pH of solutions comprising the liposome composition is from pH 6 to 7, or any range therein between. In some embodiments, the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer a buffer selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is HEPES. In some embodiments, the buffer is citrate. In some embodiments, the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between. In yet further embodiments, the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between. In some embodiments, the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between. In some embodiments, the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein between.
  • the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the interior space of the liposome includes trehalose.
  • the concentration weight percent of trehalose is 0.1-20%, 1-20%, 0.5-15%, l%- 15%, or 5-20%, or any range therein between.
  • the concentration (weight percent) of trehalose is 1-15%, or any range therein between.
  • the trehalose is present at about 5% to 20% weight percent of trehalose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between.
  • the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein betweenln additional embodiments, the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the interior space of the liposome includes dextrose.
  • the concentration weight percent of dextrose is 0.1-20%, 1-20%, 0.5-15%, l%- 15%, or 5-20%, or any range therein between.
  • the concentration (weight percent) of dextrose is 1-15%, or any range therein between.
  • the dextrose is present at about 5% to 20% weight percent of dextrose or any combination of one or more lyoprotectants or cryoprotectants at a total concentration of 5% to 20%.
  • the pH of solutions comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
  • the interior space comprises buffer.
  • the buffer is selected from HEPES, citrate, or sodium phosphate ( e.g ., monobasic and/or dibasic sodium phosphate).
  • the buffer is HEPES.
  • the buffer is citrate.
  • the buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
  • the buffer is at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range therein between.
  • the buffer is HEPES at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is citrate at a concentration of 15 to 200 mM, or any range therein between.
  • the buffer is sodium phosphate at a concentration of 15 to 200 mM, or any range therein betweenln additional embodiments, the interior space of the liposome comprises sodium acetate and/or calcium acetate. In some embodiments, the interior space of the liposome comprises a total concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
  • the disclosure provides liposomal compositions that comprise a liposome encapsulating (filled with) a yPTHF (e.g., a yPTHF disclosed herein).
  • a liposome in the liposomal composition comprises a yPTHF containing 4, 5, 2-10, 4-6, or more than 5, g-glutamyl groups (including the glutamyl group in tetrahydrofolate).
  • the yPTHF in the Lp-yPTHF comprises two or more glutamyl groups in the L-form.
  • the yPTHF in the Lp-yPTHF comprises a glutamyl group in the D-form.
  • the yPTHF in the Lp-yPTHF comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In additional embodiments, the yPTHF in the Lp-yPTHF comprises two or more glutamyl groups that have a glamma carboxyl linkage.
  • the liposomal composition comprises a liposome comprising a g pentaglutamated THF. In further embodiments, the liposome comprises an L-g pentaglutamated THF, a D-g pentaglutamated THF, or an L- and D-g pentaglutamated THF.
  • the liposomal composition comprises a liposome comprising a g hexaglutamated THF (Lp-yPTHF).
  • the liposome comprises an L-g hexaglutamated THF, a D-g hexaglutamated THF, or an L- and D-g hexaglutamated THF.
  • the targeted pegylated liposomal gamma polyglutamated (e.g., pentaglutamated or hexaglutamated) tetrahydrofolate comprises a medium comprising a liposome including an interior space; an aqueous yPTHF disposed within the interior space; and a targeting moiety comprising a protein with specific affinity for at least one folate receptor, and wherein the targeting moiety disposed at the exterior of the liposome.
  • the medium is an aqueous solution.
  • the interior space, the exterior space (e.g., the medium), or both the interior space and the medium contains one or more lyoprotectants or cryoprotectants which are listed above.
  • the cryoprotectant is mannitol, trehalose, sorbitol, or sucrose.
  • the liposome encapsulating yPTHF i.e., Lp-yPTHF, including
  • PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF has an interior space that contains less than 500,000 or less than 200,000 molecules of yPTHF.
  • the liposome interior space contains between 10 to 100,000 molecules of yPTHF, or any range therein between.
  • the liposome interior space contains between 10,000 to 100,000 molecules of yPTHF, or any range therein between.
  • the liposome is unpegylated and has an interior space that contains less than 500,000 or less than 200,000 molecules of yPTHF.
  • the liposome is unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of yPTHF, or any range therein between. In further embodiments, the liposome is unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of yPTHF, or any range therein between. In some embodiments, the liposome is targeted and unpegylated (TLp- yPTHF) and has an interior space that contains less than 500,000 or less than 200,000 molecules of yPTHF. In some embodiments, the liposome is targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of yPTHF, or any range therein between.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of yPTHF, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp-yPTHF) and has an interior space that contains less than 500,000 or less than 200,000 molecules of yPTHF.
  • NTLp-yPTHF non-targeted and unpegylated
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of yPTHF, or any range therein between.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of yPTHF, or any range therein between.
  • the liposome encapsulates gamma polyglutamated containing
  • 2-10 glutamyl groups i.e ., Lp-yPTHF, including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF
  • Lp-yPTHF including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF
  • the liposome interior space contains between 10 to 100,000 molecules of yPTHF containing 2-10 glutamyl groups, or any range therein between.
  • the liposome interior space contains between 10,000 to 100,000 molecules of yPTHF containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is unpegylated and has an interior space that contains less than 500,000 or 200,000 molecules of yPTHF containing 2- 10 glutamyl groups. In some embodiments, the liposome is unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of yPTHF containing 2-10 glutamyl groups, or any range therein between. In further embodiments, the liposome is unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of yPTHF containing 2-10 glutamyl groups, or any range therein between.
  • the liposome is targeted and unpegylated (TLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of yPTHF containing 2-10 glutamyl groups. In some embodiments, the liposome is targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules yPTHF containing 2-10 glutamyl groups, or any range therein between. In further embodiments, the liposome is targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules yPTHF containing 2-10 glutamyl groups, or any range therein between.
  • TLp-yPTHF targeted and unpegylated
  • the liposome is non-targeted and unpegylated (NTLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of yPTHF containing 2- 10 glutamyl groups. In some embodiments, the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of yPTHF containing 2-10 glutamyl groups, or any range therein between. In further embodiments, the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of yPTHF containing 2-10 glutamyl groups, or any range therein between.
  • NTLp-yPTHF non-targeted and unpegylated
  • the liposome encapsulates gamma tetraglutamated tetrahydrofolate (i.e., Lp-yPTHF, including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma tetraglutamated tetrahydrofolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between.
  • Lp-yPTHF including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between. In some embodiments, the liposome is unpegylated and has an interior space that contains less than 500,000 or 200,000 molecules of gamma tetraglutamated tetrahydrofolate. In some embodiments, the liposome is unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between.
  • the liposome is unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between.
  • the liposome is targeted and unpegylated (TLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma tetraglutamated tetrahydrofolate.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp- yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma tetraglutamated tetrahydrofolate.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between. In further embodiments, the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated tetrahydrofolate, or any range therein between.
  • the liposome encapsulates gamma pentaglutamated tetrahydrofolate (i.e ., Lp-yPTHF, including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma pentaglutamated tetrahydrofolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • Lp-yPTHF including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between. In some embodiments, the liposome is unpegylated and has an interior space that contains less than 500,000 or 200,000 molecules of gamma pentaglutamated tetrahydrofolate. In some embodiments, the liposome is unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is targeted and unpegylated (TLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma pentaglutamated tetrahydrofolate.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp- yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma pentaglutamated tetrahydrofolate.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma pentaglutamated tetrahydrofolate, or any range therein between.
  • the liposome encapsulates gamma hexaglutamated tetrahydrofolate (i.e ., Lp-yPTHF, including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma hexaglutamated tetrahydrofolate. In some embodiments, the liposome interior space contains between 10 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • Lp-yPTHF including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF
  • the liposome interior space contains between 10,000 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is unpegylated and has an interior space that contains less than 500,000 or 200,000 molecules of gamma hexaglutamated tetrahydrofolate.
  • the liposome is unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is targeted and unpegylated (TLp-yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma hexaglutamated tetrahydrofolate.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • the liposome is non-targeted and unpegylated (NTLp- yPTHF) and has an interior space that contains less than 500,000 or 200,000 molecules of gamma hexaglutamated tetrahydrofolate.
  • the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between. In further embodiments, the liposome is non-targeted and unpegylated and the interior space of the liposome contains between 10,000 to 100,000 molecules of gamma hexaglutamated tetrahydrofolate, or any range therein between.
  • the disclosure provides a liposomal yPTHF composition wherein the liposome encapsulates yPTHF or a salt or acid thereof, and one or more aqueous pharmaceutically acceptable carriers.
  • the liposome interior space contains trehalose. In some embodiments, the liposome interior space contains 5% to 20% weight of trehalose. In some embodiments, the liposome interior space contains HBS at a concentration of between 1 to 200 mM and a pH of between 2 to 8. In some embodiments, liposome interior space has a pH 5-8, or any range therein between. In some embodiments, liposome interior space has a pH 6-7, or any range therein between. In some embodiments, the liposome interior space has a total concentration of sodium acetate and calcium acetate of between 50 mM to 500 mM, or any range therein between.
  • the liposome yPTHF (e.g., Lp-yPTHF, including PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) compositions comprise yPTHF e.g., a yPTHF disclosed herein) and one or more non-polyglutamated, polyglutamatable antifolate compositions.
  • the Lp-yPTHF (e.g., PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) comprises yPTHF (e.g., a yPTHF disclosed herein) and tetrahydrofolate (THF).
  • yPTHF e.g., a yPTHF disclosed herein
  • THF tetrahydrofolate
  • the Lp-yPTHF (i.e., liposome gamma polyglutamated tetrahydrofolate) comprises gamma polyglutamated tetrahydrofolate and a polyglutamatable antifolate selected from the group consisting of: tetrahydrofolate, methotrexate (MTX), pemetrexed (PMX), lometrexol (LMX), raltitrexed (RTX), pralatrexate, AG2034, GW1843, aminopterin, and LY309887.
  • the Lp-yPTHF comprises gamma polyglutamated tetrahydrofolate and lometrexol.
  • the Lp-yPTHF comprises gamma polyglutamated tetrahydrofolate and pemetrexed. In some embodiments, the Lp-yPTHF comprises gamma polyglutamated tetrahydrofolate and leucovorin. In some embodiments, the Lp-yPTHF comprises gamma polyglutamated tetrahydrofolate and a triazine antifolate derivative (e.g., a sulphonyl fluoride triazine such as NSC 127755). In some embodiments, the Lp-yPTHF comprises gamma polyglutamated tetrahydrofolate and a serine hydroxymethyltransferase (SHMT2) inhibitor. In some embodiments, the SHMT2 inhibitor is an antifolate (e.g., a polyglutamatable or nonpolyglutamatable antifolate). In some embodiments, the SHMT2 inhibitor is an antifolate.
  • SHMT2 inhibitor is an antifolate
  • the Lp-yPTHF (e.g., PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) comprises a yPTHF (e.g., a yPTHF disclosed herein) and a so-called“non polyglutamatable” antifolate.
  • the liposome comprises a yPTHF and a non-polyglutamatable antifolate that inhibits one or more enzymes in the folate cycle metabolic pathway.
  • the non-polyglutamatable antifolate inhibits one or more enzymes selected from: thymidylate synthase (TS), dihydrofolate reductase (DHFR), glycinamide ribonucleotide (GAR) transformylase, and aminoimidazole carboxamide ribonucleotide (AICAR) transformylase.
  • TS thymidylate synthase
  • DHFR dihydrofolate reductase
  • GAR glycinamide ribonucleotide
  • AICAR aminoimidazole carboxamide ribonucleotide
  • the liposome comprises a yPTHF and a non-polyglutamatable antifolate that inhibits DHFR.
  • the liposome comprises a yPTHF and a non-polyglutamatable antifolate that inhibits TS.
  • the liposome comprises a yPTHF and a non-polyglutamatable antifolate that inhibits GAR or AICAR transformylase.
  • the non-polyglutamatable antifolate is selected from the group consisting of: trimetrexate (TMQ), piritrexim (BW301U), and talotrexin (PT523).
  • the non-polyglutamatable antifolate is selected from the group consisting of: nolatrexed (AG337), plevitrexed (ZD9331, BGC9331), and BGC 945 (ONX 0801).
  • the liposome comprises a yPTHF (Lp-yPTHF, such as e.g., PLp-yPTHF, TPLp-yPTHF, TLp-yPTHF, and NTLp-yPTHF) comprises a yPTHF (e.g., a yPTHF disclosed herein) and a platinum-based chemotherapeutic agent or a salt or acid, thereof.
  • the liposome contains a yPTHF/platinum based agent complex (e.g., as described in Section IIC).
  • the Lp-yPTHF comprises a platinum-based chemotherapeutic agent selected from the group consisting of: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the Lp-yPTHF comprises an analog of a platinum-based chemotherapeutic agent selected from the group consisting of: cisplatin, carboplatin, or oxaliplatin, or a salt or acid thereof.
  • the Lp-yPTHF comprises a yPTHF and cisplatin or a salt or acid thereof. In some embodiments, the Lp-yPTHF comprises a yPTHF and a cisplatin analog, or a salt or acid thereof.
  • the Lp-yPTHF comprises a yPTHF and carboplatin, or a salt or acid thereof.
  • the liposome comprises a yPTHF and carboplatin analog, or a salt or acid thereof.
  • the Lp-yPTHF comprises a yPTHF and oxaliplatin, or a salt or acid thereof.
  • the liposome comprises a yPTHF and an oxaliplatin analog, or a salt or acid thereof.
  • the liposome comprises a yPTHF (e.g., a yPTHF disclosed herein) and a platinum-based chemotherapeutic agent selected from the group consisting of: nedaplatin, heptaplatin, and lobaplatin, nedaplatin, heptaplatin, and lobaplatin or a salt or acid thereof.
  • the Lp-yPTHF comprises a yPTHF and an analog of a platinum-based chemotherapeutic agent selected from the group consisting of: nedaplatin, heptaplatin, and lobaplatin, or a salt or acid thereof.
  • the Lp-yPTHF comprises a yPTHF and a platinum-based chemotherapeutic agent selected from the group consisting of: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, 254S, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • a platinum-based chemotherapeutic agent selected from the group consisting of: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, 254S, NK121, CI
  • the Lp- yPTHF comprises a yPTHF and an analog of a platinum-based chemotherapeutic agent selected from the group consisting of: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, 254S, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • a platinum-based chemotherapeutic agent selected from the group consisting of: stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, 254S, NK
  • the liposome composition comprises liposomes that further contain one or more of an immunostimulatory agent, a detectable marker and a maleimide disposed on at least one of the PEG and the exterior of the liposome.
  • the yPTHF liposome comprise a yPTHF (e.g., a yPTHF disclosed herein) and a cyclodextrin (e.g., a cyclodextrin in Section IIC, herein).
  • a yPTHF e.g., a yPTHF disclosed herein
  • a cyclodextrin e.g., a cyclodextrin in Section IIC, herein.
  • the yPTHF liposome comprises a complex formed by a cyclodextrin and a therapeutic agent.
  • the therapeutic agent is a cytotoxic compound or a salt or acid thereof.
  • the therapeutic agent is a chemotherapeutic agent or a salt or acid thereof.
  • the therapeutic agent is a platinum-based drug.
  • the therapeutic agent is a taxane-based drug.
  • the therapeutic agent of the cyclodextrin/therapeutic agent complex is a member selected from the group consisting of: gemcitabine, a gemcitabine-based therapeutic agent, doxorubicin, an antifolate, an antifolate-based chemotherapeutic, or a salt or acid, acid or free base form thereof.
  • the molar ratio of cyclodextrin/therapeutic agent in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin /therapeutic agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin /therapeutic agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin /therapeutic agent is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the yPTHF liposome comprises yPTHF and a cyclodextrin/platinum-based chemotherapeutic agent complex.
  • the platinum-based chemotherapeutic agent is selected from the group consisting of: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/platinum-based agent is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the platinum-based chemotherapeutic agent is selected from the group consisting of: cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof.
  • the cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/platinum-based agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/platinum- based agent is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin//platinum-based agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing cyclodextrin and cisplatin or a salt or acid thereof.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50): 1, or >50:1.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin//cisplatin (or cisplatin salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing cyclodextrin and carboplatin or a salt or acid thereof.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is in the range 1 : 1-20, 1:1- 10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/carboplatin (or carboplatin salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/carboplatin (or carboplatin salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex containing cyclodextrin and oxaliplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13: 1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1:1-20, 1:1- 10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and a platinum-based chemotherapeutic agent selected from the group consisting of: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
  • a platinum-based chemotherapeutic agent selected from the group consisting of: nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin,
  • the cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof.
  • the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is in the range 1-10:1. In some embodiments, the molar ratio of cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) in the complex 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between. In some embodiments, the molar ratio of cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50. In additional embodiments, the cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog thereof) complex is encapsulated in a liposome ( e.g as described herein or otherwise known in the art).
  • the disclosure provides a composition comprising a cyclodextrin/taxane-based chemotherapeutic agent complex.
  • the taxane-based chemotherapeutic agent is selected from the group consisting of: paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX), and cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/taxane-based agent in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/taxane -based agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/taxane-based agent in the complex is in the range 1 : 1-20, 1 : 1- 10, or 1 :2-8, or any range therein between.
  • the molar ratio of of cyclodextrin/taxane-based agent is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/taxane- based agent complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and paclitaxel (PTX), or a salt or acid thereof.
  • PTX cyclodextrin and paclitaxel
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of paclitaxel (PTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is in the range 1:1-20, 1:1- 10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/paclitaxel (or paclitaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and docetaxel (DTX), or a salt or acid thereof.
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of docetaxel (DTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is in the range 1:1-20, 1:1- 10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/docetaxel (or docetaxel salt or acid) complex is encapsulated in a liposome (e.g ., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and larotaxel (LTX), or a salt or acid thereof.
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of larotaxel (LTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/larotaxel (or larotaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the disclosure provides a complex comprising cyclodextrin and cabazitaxel (CTX), or a salt or acid thereof.
  • CTX cyclodextrin and cabazitaxel
  • the cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog of cabazitaxel (CTX), or a salt or acid thereof.
  • the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1-10:1.
  • the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (2l-50):l, or >50:1.
  • the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range therein between.
  • the molar ratio of cyclodextrin/cabazitaxel is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, l:(2l-50), or l:>50.
  • the cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art).
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex can be derivatized or underivatized.
  • the cyclodextrin is derivatized.
  • the cyclodextrin is a derivatized beta-cyclodextrin (e.g a hydroxypropyl beta-cyclodextrin (HP-beta-CD), and a sulfobutyl ether beta-CD (SBE)-beta-cyclodextrin).
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex is a derivatized beta-cyclodextrin comprising: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more 2-hydroxylpropyl-3 -group substitutions of hydroxy groups; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sulfoalkyl ether group substitutions of hydroxy groups.
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex is a derivatized beta-cyclodextrin comprising: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more sulfobutyl ether group substitutions of hydroxy groups.
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex contained in the yPTHF liposome composition is a derivatized cyclodextrin of Formula I:
  • Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs, and R9 are each, independently, -H, a straight chain or branched Ci-C 8 - alkylene group, a 2-hydroxylpropyl-3- group; or an optionally substituted straight-chain or branched Ci-C 6 group, wherein at least one of Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs and R9 is a straight-chain or branched Ci-Cs- alkylene group or a 2-hydroxylpropyl-3- group.
  • the cyclodextrin of the cyclodextrin/therapeutic agent complex contained in the yPTHF liposome composition is a derivatized cyclodextrin of Formula II:
  • n 4, 5, or 6; and wherein Ri, R 2 , R3, R4, Rs, R 6 , R7, Rs, and R9 are each, independently, -O- or a -0-(C 2 -C 6 alkylene)-S03 group; wherein at least one of Ri and R 2 is independently a -0-(C 2 -C6 alkylene)-S0 3 group; and Si, S 2 , S3, S 4 , S5, S 6 , S 7 , Ss, and S9 are each, independently, a -H or a H or a pharmaceutically acceptable cation.
  • the wherein the pharmaceutically acceptable cation is selected from: an alkali metal such as Li + , Na + , or K + ; an alkaline earth metal such as Ca +2 , or Mg +2 , and ammonium ions and amine cations such as the cations of (Cl-C6)-alkylamines, piperidine, pyrazine, (Cl- C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • an alkali metal such as Li + , Na + , or K +
  • an alkaline earth metal such as Ca +2 , or Mg +2
  • ammonium ions and amine cations such as the cations of (Cl-C6)-alkylamines, piperidine, pyrazine, (Cl- C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
  • the yPTHF liposome comprises between 100 to 100,000 of the cyclodextrin/therapeutic agent complexes.
  • a cyclodextrin derivative of the g PT H F/c y c 1 ode x t i n complex and/or cyclodextrin/therapeutic agent complex is a cyclodextrin disclosed in U.S. Pat. Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013, 6,869,939; and Intl. Appl. Publ. No. WO 02005/117911, the contents each of which is herein incorporated by reference in its priority.
  • the cyclodextrin derivative of the cyclodextrin/therapeutic agent complex is a sulfoalkyl ether cyclodextrin.
  • the cyclodextrin derivative of complex is a sulfobutyl ether-3 -cyclodextrin such as CAPTISOL® (CyDex Pharma. Inc., Lenexa, Kansas. Methods for preparing sulfobutyl ether-3- cyclodextrin and other rsulfoalkyl ether cyclodextrins are known in the art.
  • the cyclodextrin derivative of the cyclodextrin/therapeutic agent complex is a compound of Formula III:
  • the yPTHF liposome comprises a complex of a cyclodextrin and a platinum-based chemotherapeutic agent, or a salt thereof.
  • the platinum-based chemotherapeutic agent is cisplatin or a cisplatin analog.
  • the platinum-based chemotherapeutic agent is carboplatin.
  • the liposome composition comprises a platinum-based chemotherapeutic agent is a member selected from the group consisting of: carboplatin, cisplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, tetraplatin, lipoplatin, lobaplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM216, 254S, NK121, CI973, DWA 2114R, NDDP, and dedaplatin.
  • the yPTHF liposome comprises between 100 to 100,000 platinum-based chemotherapeutic agent/CD complexes.
  • the liposome composition comprises liposomes that have a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm, or any range therein between. In some embodiments, liposomes in the composition comprise between 100 to 100,000 platinum.
  • the disclosure provides a liposomal yPTHF composition wherein the liposome comprises a yPTHF and a targeting moiety attached to one or both of a PEG and the exterior of the liposome, and wherein the targeting moiety has a specific affinity for a surface antigen on a target cell of interest.
  • liposomes may generally be referred to herein as“targeted liposomes”, e.g., liposomes including one or more targeting moieties or biodistribution modifiers on the surface of, or otherwise attached to, the liposomes.
  • the targeting moiety of the targeted liposomes can be any moiety or agent that is capable of specifically binding a desired target (e.g., an antigen target expressed on the surface of a target cell of interest).
  • a desired target e.g., an antigen target expressed on the surface of a target cell of interest.
  • the targeted liposome specifically and preferentially binds to a target on the surface of a target cell of interest that internalizes the targeted liposome into which the liposome encapsulated yPTHF (e.g., gamma pentaglutamated THF or gamma hexaglutamated THF) exerts its cytotoxic effect.
  • the target cell is a cancer cell, a tumor cell or a metastatic cell.
  • the targeted liposome is pegylated.
  • the term“attach” or“attached” refers, for example, to any type of bonding such as covalent bonding, ionic bonding (e.g., avidin-biotin) bonding by hydrophobic interactions, and bonding via functional groups such as maleimide, or linkers such as PEG.
  • a detectable marker, a steric stabilizer, a liposome, a liposomal component, an immuno stimulating agent may be attached to each other directly, by a maleimide functional group, or by a PEG-malemide group.
  • the targeting moiety attached to the liposome is a polypeptide or peptidomimetic ligand.
  • Peptide and peptidomimetic targeting moieties include those having naturally occurring or modified peptides, e.g., D or L peptides; gamma, beta, or glamma peptides; N-methyl peptides; azapeptides; peptides having one or more amide, i.e., peptide, linkages replaced with one or more urea, thiourea, carbamate, or sulfonyl urea linkages; or cyclic peptides.
  • a peptidomimetic is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide.
  • the peptide or peptidomimetic targeting moiety is 2-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long
  • the targeting moiety polypeptide is at least 40 amino acid residues in length. In other embodiments, the targeting moiety polypeptide is at least 50, 60, 75, 100, 125, 150, 175, 200, 250, or 300 amino acid residues in length.
  • the targeting moiety polypeptide such as an antibody or an antigen-binding antibody fragment that binds a target antigen with an equilibrium dissociation constant (Kd) in a range of 0.5 x 10 10 to 10 x 10 6 as determined using BIACORE® analysis.
  • the targeting moiety is an antibody or an antibody derivative.
  • the binding domain of the targeting moiety polypeptide is not derived from the antigen binding domain of an antibody.
  • the targeting moiety is a polypeptide derived from a binding scaffold selected from the group consisting of a DARPin, affilin, and armadillo repeat, D domain (see, e.g., WO 2016/164308), Z-domain (Affibody), adnectin, lipocalin, affilin, anticalin, knottin, fynomer, atrimer, kunitz domain (see, e.g., WO 2004/063337), CTLA4, or avimer (see, e.g., U.S. Publ. Nos. 2004/0175756, 2005/0053973, 2005/0048512, and 2006/0008844).
  • the targeting moiety is an antibody or a derivative of the antigen binding domain of an antibody that has specific affinity for an epitope of a cell surface antigen of interest expressed on the surface of a target cell.
  • the targeting moiety is a full-length antibody.
  • the targeting moiety is an antigen binding portion of an antibody.
  • the targeting moiety is an scFv.
  • the targeting moiety is a Fab.
  • the targeting moiety comprises a binding domain derived from the antigen binding domain of an antibody (e.g., an scFv, Fab, Fab', F(ab')2, an Fv fragment, a disulfide-linked Fv (sdFv), a Fd fragment containing VH and CH1 domains, an scFv, a minibody, a BiTE, a Tandab, a diabody ((VL- VH) 2 or (VH-VL) 2 ), a single domain antibody (e.g., an sdAb such as a nanobody (either VL or VH)), and a camelid VHH domain).
  • an antibody e.g., an scFv, Fab, Fab', F(ab')2, an Fv fragment, a disulfide-linked Fv (sdFv), a Fd fragment containing VH and CH1 domains, an scFv, a minibody, a
  • the targeting moiety comprises one or more complementarity determining regions (CDRs) of antibody origin.
  • CDRs complementarity determining regions
  • suitable antibody-based targeting moieties for the disclosed targeted liposomes include a full- length human antibody, a humanized antibody, a chimeric antibody, an antigen binding fragment of an antibody, a single chain antibody, a single-domain antibody, a bi- specific antibody, a synthetic antibody, a pegylated antibody and a multimeric antibody.
  • the antibody of the provided targeted liposomes can have a combination of the above characteristics.
  • a humanized antibody can be an antigen binding fragment and can be pegylated and multimerized as well.
  • humanized antibody refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences.
  • humanized antibodies are human immunoglobulins in which residues from the complementary determining region (CDR) are replaced by residues from the CDR of a non-human species (e.g., mouse, rat, rabbit, and hamster) that have the desired specificity, affinity, and capability (Jones et al, Nature 321:522-525 (1986); Riechmann et al, Nature 332:323-327 (1988); Verhoeyen et al, Science 239:1534-1536 (1988)).
  • the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capability.
  • the humanized antibody can be further modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability.
  • the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat. Nos. 5,225,539 and 5,639,641.
  • the targeting moiety has specific affinity for an epitope of a surface antigen of a target cell of interest.
  • the target cell is a cancer cell.
  • the target cell is a tumor cell.
  • the target cell is an immune cell.
  • the targeting moiety has specific affinity for an epitope expressed on a tumor cell surface antigen.
  • tumor cell surface antigen refers to an antigen that is common to a specific hyperproliferative disorder such as cancer.
  • the targeting moiety has specific affinity for an epitope of a tumor cell surface antigen that is a tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • a TAA is an antigen that is found on both tumor and some normal cells.
  • a TAA may be expressed on normal cells during fetal development when the immune system is immature and unable to respond or may be normally present at extremely low levels on normal cells but which are expressed at much higher levels on tumor cells.
  • tumor cells may express unique antigens at certain stages, and at others also express antigens that are also expressed on non-tumor cells. Thus, inclusion of a certain marker as a TAA does not preclude it being considered a tumor specific antigen.
  • the targeting moiety has specific affinity for an epitope of a tumor cell surface antigen that is a tumor specific antigen (TSA).
  • TSA tumor specific antigen
  • the targeting moiety has specific affinity for an epitope of a tumor cell surface antigen expressed on the surface of a cancer including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer (e.g ., NSCLC or SCLC), liver cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemias, multiple myeloma, glioblastoma, neuroblastoma, uterine cancer, cervical cancer, renal cancer, thyroid cancer, bladder cancer, kidney cancer, mesothelioma, and adenocarcinomas such as breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, lung cancer, colon cancer and other cancers known in the art
  • the targeting moiety has specific affinity for an epitope of a cell surface antigen expressed on the surface of a cell in the tumor microenvironment (e.g., and antigen such as
  • the targeted liposome yPTHF composition (e.g., TLp-yPTHF or TPLp-yPTHF) comprises a targeting moiety that has specific affinity for an epitope of a cancer or tumor cell surface antigen that is preferentially/differentially expressed on a target cell such as a cancer cell or tumor cell, compared to normal or non-tumor cells, that is present on a tumor cell but absent or inaccessible on a non-tumor cell.
  • a target cell such as a cancer cell or tumor cell
  • the tumor antigen is on the surface of both normal cells and malignant cancer cells but the tumor epitope is only exposed in a cancer cell.
  • a tumor cell surface antigen may experience a confirmation change in a cancerous state that causes a cancer cell specific epitope to be present.
  • a targeting moiety with specific affinity to an epitope on a targetable tumor cell surface antigen described herein or otherwise known in the art is useful and is encompassed by the disclosed compositions and methods.
  • the tumor cell with the tumor cell surface antigen is a cancer cell.
  • tumor cell surface antigens include, without limitation folate receptor alpha, folate receptor beta and folate receptor delta.
  • the targeting moiety comprises a polypeptide targeting moiety such as an antibody or an antigen-binding antibody fragment and the targeting moiety has binding specificity for a folate receptor.
  • the targeting moiety binds a folate receptor with an equilibrium dissociation constant (Kd) in a range of 0.5 x l0 10 to 10 x 10 6 as determined using BIACORE® analysis.
  • the folate receptor bound by the targeting moiety is one or more folate receptors selected from the group consisting of: folate receptor alpha (FR-a), folate receptor beta (FR-b), and folate receptor delta (FR-d).
  • the targeting moiety has specific affinity for at least two antigens selected from the group consisting of folate receptor alpha, folate receptor beta, and folate receptor delta.
  • the targeting moiety has specific affinity for folate receptor alpha; folate receptor beta; and folate receptor delta.
  • the targeting moiety has a specific affinity for an epitope of a cell surface antigen that internalizes the targeting moiety upon binding.
  • a cell surface antigen that internalizes the targeting moiety upon binding Numerous cell surface antigens that internalize binding partners such as antibodies upon binding are known in the art and are envisioned to be binding targets for the targeting moieties expressed on the targeted liposome yPTHF compositions (e.g., TLp-yPTHF or TPLp-yPTHF) disclosed herein.
  • the targeting moiety has a specific affinity for an epitope of a cell surface antigen selected from the group consisting of: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-b or folate receptor-d), Mucin 1 (MUC-l), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SFC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SFTRK6, SC-16, Tissue factor, FIV-l (ZIP6), CGEN-15027, P cadherin, fibronectin extra-domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER3,
  • the targeting moiety has a specific affinity for an epitope of a cell surface antigen selected from the group consisting of mannose-6-phosphate receptor, transferrin receptor, and a cell adhesion molecule (CAM).
  • CAM cell adhesion molecule
  • the targeting moiety has a specific affinity for an epitope of a CAM is selected from the group consist of: intercellular adhesion molecule (ICAM), platelet-endothelial cell adhesion molecule (PECAM), activated leukocyte cell adhesion molecule (AFCAM), B-lymphocyte cell adhesion molecule (BF-CAM), vascular cell adhesion molecule (VCAM), mucosal vascular addressin cell adhesion molecule (MAdCAM), CD44, FFA-2, FFA-3, and basigin.
  • IAM intercellular adhesion molecule
  • PECAM platelet-endothelial cell adhesion molecule
  • AFCAM activated leukocyte cell adhesion molecule
  • BF-CAM B-lymph
  • folate receptors are distinct from reduced folate carriers (RFCs) and exploit different pathways for bringing folates and antifolates into cells.
  • the targeting moiety specifically binds a folate receptor.
  • the targeting moiety specifically binds a folate receptor selected from folate receptor alpha, folate receptor beta and folate receptor delta.
  • Antibodies to folate receptor alpha can routinely be generated using techniques known in the art.
  • sequences of numerous anti-folate receptor antibodies are in the public domain and/or commercially available and are readily obtainable.
  • Murine antibodies against folate receptor are examples of antibodies that can be used as targeting moieties of the disclosed targeted liposome is a murine antibody against folate receptor.
  • the sequence of these antibodies are known and are described, for example, in U.S. Pat. Nos. 5,646,253; 8,388,972; 8,871,206; and 9,133,275, and Intl. Appl. Nos. PCT/US2011/056966, and PCT/US2012/046672.
  • the gene for the antibodies can be synthesized and placed into a transient expression vector and the antibody was produced in HEK-293 transient expression system.
  • the antibody can be a complete antibody, a Fab, or any of the various antibody variations discussed herein or otherwise known in the art.
  • the targeted liposome (e.g ., TL-yPTHF or TPL-yPTHF) contains from 1 to 1,000, 30-1,000, 50-1,000, or more than 1,000, targeting moieties on its surface. In some embodiments, the targeted liposome contains from 30 to 500, 30 to 250 or 30-200, targeting moieties, or any range therein between. In some embodiments, the targeted liposome contains less than 220 targeting moieties, less than 200 targeting moieties, or less than 175 targeting moieties. In some embodiments, the targeting moiety is non-covalently bonded to the outside of the liposome (e.g., via ionic interaction or a GPI anchor).
  • the molecules on the outside of the targeted liposome include a lipid, a targeting moiety, a steric stabilizer (e.g., a PEG), a maleimide, and a cholesterol.
  • a targeting moiety is covalently bound via a maleimide functional group.
  • the targeting moiety is covalently bound to a liposomal component or a steric stabilizer such as a PEG molecule.
  • all the targeting moieties of the liposome are bound to one component of the liposome such as a PEG.
  • the targeting moieties of the targeted liposome are bound to different components of the liposome.
  • some targeting moieties may be bound to the lipid components or cholesterol
  • some targeting moieties may be bound to the steric stabilizer (e.g., PEG) and still other targeting moieties may be bound to a detectable marker or to another targeting moiety.
  • the outside of the targeted liposome e.g., TL-yPTHF or TPL-yPTHF
  • the targeted liposome (e.g., TL-yPTHF or TPL-yPTHF) is anionic or neutral.
  • the targeted anionic or neutral liposome has a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm, or any range therein between.
  • the targeted anionic or neutral liposome has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the targeted liposome (e.g., TL-yPTHF or TPL-yPTHF) is cationic.
  • the targeted anionic or neutral liposome has a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm, or any range therein between. In further embodiments, the targeted anionic or neutral liposome has a diameter in the range of 80 nm to 120 nm, or any range therein between.
  • the liposomal composition comprises targeted liposomes (e.g TL-yPTHF or TPL-yPTHF) and 30-70%, 30-60%, or 30-50%, w/w of the gamma polyglutamated THF, or any range therein between.
  • the targeted liposomes comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the alpha polyglutamated THF.
  • the targeted liposomes during the process of preparing the targeted liposomes, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, of the starting material of gamma polyglutamated THF is encapsulated (entrapped) in the targeted liposomes.
  • the targeted liposomal compositions comprise 30-70%, 30- 60%, or 30-50%, w/w of the gamma tetraglutamated THF, or any range therein between In some embodiments, the targeted liposomes comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma tetraglutamated THF.
  • the starting material of gamma tetraglutamated THF is encapsulated (entrapped) in the targeted liposomes.
  • the targeted liposomal compositions comprise 30-70%, 30- 60%, or 30-50%, w/w of the gamma pentaglutamated THF, or any range therein between In some embodiments, the targeted liposomes comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma pentaglutamated THF.
  • the starting material of gamma pentaglutamated THF is encapsulated (entrapped) in the targeted liposomes.
  • the targeted liposomal compositions comprise 30-70%, 30- 60%, or 30-50%, w/w of the gamma hexaglutamated THF, or any range therein between In some embodiments, the targeted liposomes comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the gamma hexaglutamated THF.
  • the targeted liposomes during the process of preparing the targeted liposomes, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, of the starting material of gamma hexaglutamated THF is encapsulated (entrapped) in the targeted liposomes.
  • non-proteinaceous targeting moieties and other compositions may be employed.
  • a non-proteinaceous moiety may be covalently or non-covalently linked to, embedded or adsorbed onto the liposome using any linking or binding method and/or any suitable chemical linker known in the art.
  • the exact type and chemical nature of such cross-linkers and cross linking methods is preferably adapted to the type of affinity group used and the nature of the liposome. Methods for binding or adsorbing or linking the targeting moiety are also well known in the art.
  • the targeting moiety may be attached to a group at the interface via, but not limited to, polar groups such as amino, SH, hydroxyl, aldehyde, formyl, carboxyl, His-tag or other polypeptides.
  • polar groups such as amino, SH, hydroxyl, aldehyde, formyl, carboxyl, His-tag or other polypeptides.
  • the targeting moiety may be attached via, but not limited to, active groups such as succinimidyl succinate, cyanuric chloride, tosyl activated groups, imidazole groups, CNBr, NHS, Activated CH, ECH, EAH, Epoxy, Thiopropyl, Activated Thiol, etc.
  • the targeting moiety may be attached via, but not limited to, hydrophobic bonds (Van Der Waals) or electrostatic interactions that may or may not include cross-linking agents (e.g ., bivalent anions, poly-anions, poly-cations etc.).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Dispersion Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Inorganic Chemistry (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2019/016966 2018-02-14 2019-02-07 Gamma polyglutamated tetrahydrofolates and uses thereof Ceased WO2019160735A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CN201980024858.2A CN111971047A (zh) 2018-02-14 2019-02-07 γ聚谷氨酸化四氢叶酸及其用途
EP19754705.2A EP3755335A4 (en) 2018-02-14 2019-02-07 GAMMA POLYGLUTAMIC TETRAHYDROFOLATES AND THEIR USES
JP2020543517A JP7442822B2 (ja) 2018-02-14 2019-02-07 γポリグルタミン酸化テトラヒドロ葉酸およびその使用
CA3090992A CA3090992A1 (en) 2018-02-14 2019-02-07 Gamma polyglutamated tetrahydrofolates and uses thereof
US16/967,203 US12048766B2 (en) 2018-02-14 2019-02-07 Gamma polyglutamated tetrahydrofolates and uses thereof
JP2024020715A JP7676056B2 (ja) 2018-02-14 2024-02-14 γポリグルタミン酸化テトラヒドロ葉酸およびその使用
US18/741,153 US20250064736A1 (en) 2018-02-14 2024-06-12 Gamma polyglutamated tetrahydrofolates and uses thereof
US19/024,252 US20250319123A1 (en) 2019-02-07 2025-01-16 Gamma polyglutamated antifolates and uses thereof
JP2025070591A JP2025111607A (ja) 2018-02-14 2025-04-22 γポリグルタミン酸化テトラヒドロ葉酸およびその使用

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US201862630824P 2018-02-14 2018-02-14
US62/630,824 2018-02-14
US201862636289P 2018-02-28 2018-02-28
US62/636,289 2018-02-28
US201862662372P 2018-04-25 2018-04-25
US62/662,372 2018-04-25
US201862702774P 2018-07-24 2018-07-24
US62/702,774 2018-07-24
US201862764945P 2018-08-17 2018-08-17
US62/764,945 2018-08-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/967,203 A-371-Of-International US12048766B2 (en) 2018-02-14 2019-02-07 Gamma polyglutamated tetrahydrofolates and uses thereof
US18/741,153 Continuation US20250064736A1 (en) 2018-02-14 2024-06-12 Gamma polyglutamated tetrahydrofolates and uses thereof

Publications (1)

Publication Number Publication Date
WO2019160735A1 true WO2019160735A1 (en) 2019-08-22

Family

ID=67618810

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/016966 Ceased WO2019160735A1 (en) 2018-02-14 2019-02-07 Gamma polyglutamated tetrahydrofolates and uses thereof

Country Status (6)

Country Link
US (1) US12048766B2 (https=)
EP (1) EP3755335A4 (https=)
JP (3) JP7442822B2 (https=)
CN (1) CN111971047A (https=)
CA (1) CA3090992A1 (https=)
WO (1) WO2019160735A1 (https=)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3749321A4 (en) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Gamma polyglutamated antifolates and uses thereof
EP3752158A4 (en) * 2018-02-14 2022-03-09 L.E.A.F Holdings Group LLC GAMMA-POLYGLUTAMATED AMINOPTERINE AND USES THEREOF
US11344628B2 (en) 2016-08-12 2022-05-31 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US11534498B2 (en) 2016-08-12 2022-12-27 L.E.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
US11730738B2 (en) 2018-02-07 2023-08-22 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
US11771700B2 (en) 2018-02-14 2023-10-03 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
US11779584B2 (en) 2018-02-07 2023-10-10 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12048766B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
US12048767B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof
US12076402B2 (en) 2018-02-07 2024-09-03 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US12128046B2 (en) 2018-02-07 2024-10-29 L.E.A.F. Holdings Group Llc Alpha polyglutamated methotrexate and uses thereof
US12220431B2 (en) 2018-02-07 2025-02-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated antifolates and uses thereof
US12239734B2 (en) 2018-02-07 2025-03-04 L.E.A.F. Holdings Group Llc Gamma polyglutamated raltitrexed and uses thereof
US12246018B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
US12246015B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
US12246019B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated lometrexol and uses thereof
US12290518B2 (en) 2018-02-14 2025-05-06 L.E.A.F. Holdings Group Llc Gamma polyglutamated methotrexate and uses thereof
US12310966B2 (en) 2018-02-07 2025-05-27 L.E.A.F. Holdings Group Llc Alpha polyglutamated aminopterin and uses thereof
US12336994B2 (en) 2018-02-07 2025-06-24 L.E.A.F. Holdings Group Llc Alpha polyglutamated tetrahydrofolates and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010046533A1 (en) * 1996-01-31 2001-11-29 Bailey Steven W. Method for treating a subject afflicted with intestinal malabsorption
US20030125302A1 (en) * 2000-04-17 2003-07-03 Fudan University Folic acid-polysaccharide complex, its preparation method and pharmaceutical composition containing the same as active component
US20060063768A1 (en) * 2002-02-26 2006-03-23 Thomas Mueller Use of folates for producing a preparation suitable for preventing and treating inflammation and diseases associated with inflammation, especially for influencing the inflammation markers crp and saa
US7446120B2 (en) * 2000-01-24 2008-11-04 Adherex Technologies, Inc. Peptidomimetic modulators of cell adhesion

Family Cites Families (94)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2564319A1 (fr) 1984-05-21 1985-11-22 Inst Nat Sante Rech Med Nouvelles compositions de liposomes dotees d'une action specifique vis-a-vis de la proliferation de cellules donnees
US4584375A (en) 1984-08-21 1986-04-22 Rensselaer Polytechnic Institute Fluorine-containing antifolates incapable of polyglutamate formation
CA2057635A1 (en) 1990-12-14 1992-06-15 Hiroshi Akimoto Condensed heterocyclic compounds, their production and use
US5646253A (en) 1994-03-08 1997-07-08 Memorial Sloan-Kettering Cancer Center Recombinant human anti-LK26 antibodies
US6569432B1 (en) * 1995-02-24 2003-05-27 Sloan-Kettering Institute For Cancer Research Prostate-specific membrane antigen and uses thereof
US5912251A (en) 1998-01-17 1999-06-15 Nair; Madhavan G. Metabolically inert anti-inflammatory and anti-tumor antifolates
US20050031679A1 (en) 1998-03-27 2005-02-10 Clemens Unger Method for producing liposomal formulations of active ingredients
CN1239545C (zh) 1998-07-09 2006-02-01 罗狄亚化学公司 水溶性或水可分散性接枝共聚物
WO2001005405A1 (en) 1999-07-16 2001-01-25 The General Hospital Corporation Folylpolyglutamyl synthetase gene transfer to enhance antifolate drug sensitivity
EP1286661A2 (en) 2000-06-09 2003-03-05 OSI Pharmaceuticals, Inc. Liposomal benzoquinazoline thymidylate synthase inhibitor formulations
JP5102928B2 (ja) * 2000-06-30 2012-12-19 イーライ リリー アンド カンパニー 新規な葉酸代謝拮抗薬の組み合わせ療法
AU2003211103A1 (en) 2002-02-13 2003-09-04 Northeastern University Intracellular delivery of therapeutic agents
US7563590B2 (en) 2002-08-30 2009-07-21 Cypress Bioscience Inc. Methods of quantifying methotrexate metabolites
US6921667B2 (en) 2003-03-07 2005-07-26 Prometheus Laboratories, Inc. Methods for direct detection of individual methotrexate metabolites
US20040265368A1 (en) 2003-04-02 2004-12-30 Lawrence Mayer Combination compositions of camptothecins and fluoropyrimidines
AU2005206163B2 (en) 2004-01-14 2011-06-30 Gilead Sciences, Inc. Lipid-based dispersions useful for drug delivery
EP3101034A1 (en) 2004-02-12 2016-12-07 Morphotek, Inc. Monoclonal antibodies that specifically bind to folate receptor alpha
US7612071B2 (en) 2004-03-12 2009-11-03 Syntrix Biosystems, Inc. Compositions and methods employing aminopterin
US20080260812A1 (en) 2004-04-26 2008-10-23 Takami Matsuyama C/O Kagoshima University Therapeutic Medicine Containing Monoclonal Antibody Against Folate Receptor Beta (Fr-Beta)
LT3173073T (lt) 2004-05-03 2025-01-10 Ipsen Biopharm Ltd. Liposomos, skirtos vaistų pristatymui
US7695908B2 (en) 2004-06-15 2010-04-13 Prometheus Laboratories Inc. Methods for predicting methotrexate polyglutamate levels using pharmacogenetics
JP2008512490A (ja) 2004-09-08 2008-04-24 チェルシー・セラピューティクス,インコーポレイテッド 異常細胞増殖および炎症の障害を治療するための代謝的に不活性な葉酸拮抗剤
JPWO2006035876A1 (ja) 2004-09-29 2008-05-15 興和株式会社 関節リウマチの予防及び/又は治療薬
US8126089B2 (en) 2004-09-30 2012-02-28 Alcatel Lucent Method and apparatus for providing frame synchronization in a digital communication system that supports multiple modulation formats
US20100266709A1 (en) 2004-12-16 2010-10-21 Hicks Terry Lee Compositions and Methods for Treating Burns
WO2006074416A1 (en) 2005-01-07 2006-07-13 Health Research Inc. 5-amino-4-imidazolecarboxamide riboside and its nucleobase as potentiators of antifolate transport and metabolism
JP2006248978A (ja) 2005-03-10 2006-09-21 Mebiopharm Co Ltd 新規なリポソーム製剤
GB2424837B (en) 2005-04-06 2010-10-06 Cilag Ag Int Injection device
AU2005335876A1 (en) 2005-08-24 2007-03-01 Protherics Medicines Development Limited Cleavage of antifolate compounds
EP1962796A2 (en) 2005-12-08 2008-09-03 Yissum Research Development Company Of The Hebrew University Of Jerusalem Methods for affecting liposome composition by ultrasound irradiation
WO2007098089A2 (en) 2006-02-17 2007-08-30 Novacea, Inc. Treatment of hyperproliferative diseases with methotrexate n-oxide and analogs
US9265746B2 (en) 2006-05-31 2016-02-23 Merck & Cie Method for cell-specific targeting
WO2008030818A2 (en) 2006-09-05 2008-03-13 Mebiopharm Co., Ltd. Novel liposome compositions
GB2453011B (en) 2006-12-29 2010-06-23 Tracon Pharmaceuticals Inc Antifolate agent compositions in the treatment of cancer
RU2423114C2 (ru) 2006-12-29 2011-07-10 Тракон Фармасьютикалз, Инк. Комбинации антифолатного агента в лечении рака
JP2010516694A (ja) 2007-01-19 2010-05-20 チェルシー・セラピューティクス,インコーポレイテッド 新規な伝統的葉酸拮抗剤
US20100166848A1 (en) * 2007-09-11 2010-07-01 Joseph Ciccolini Liposomal formulations for treating cancer
CN101977620B (zh) 2008-03-18 2014-05-07 英国技术集团国际有限公司 用于治疗类风湿性关节炎或急性骨髓性白血病的环戊二烯并[g]喹唑啉衍生物
GB0811360D0 (en) * 2008-06-20 2008-07-30 Imp Innovations Ltd Methods
EP2437596B1 (en) 2009-06-03 2017-05-03 Ex-Tek, LLC Skin treatment compositions
TW201118098A (en) 2009-08-13 2011-06-01 Reddy S Lab Liimited Dr Processes for preparing pemetrexed
TWI622402B (zh) 2010-02-24 2018-05-01 免疫遺傳股份有限公司 葉酸受體1抗體類和免疫共軛物類及彼等之用途
CN102917690B (zh) 2010-03-19 2016-08-24 麻省理工学院 脂质囊泡组合物和使用方法
US9770414B2 (en) * 2010-05-13 2017-09-26 Pacira Pharmaceuticals, Inc. Sustained release formulation of methotrexate as a disease-modifying antirheumatic drug (DMARD) and an anti-cancer agent
EP2394640A1 (en) 2010-05-21 2011-12-14 MediGene AG Improved liposomal formulations of lipophilic compounds
CA2800693A1 (en) 2010-05-28 2011-12-01 Purdue Research Foundation Delivery of therapeutic agents to inflamed tissues using folate-targeted agents
WO2012033987A2 (en) 2010-09-09 2012-03-15 Purdue Research Foundation Anti-human folate receptor beta antibodies and methods of use
WO2012037068A1 (en) 2010-09-13 2012-03-22 De Novo Diagnostics, Inc. Methods for monitoring methotrexate therapy
WO2012061469A2 (en) 2010-11-02 2012-05-10 Sicor Inc. Crystalline forms of pralatrexate
MX343607B (es) 2010-11-05 2016-11-11 Morphotek Inc Receptor alfa de folato como marcador de diagnóstico y pronóstico para cánceres que expresan receptor alfa de folato.
WO2012078708A1 (en) 2010-12-07 2012-06-14 Chelsea Therapeutics, Inc. Combination comprising methotrexate and an antifolate compound
WO2012118806A2 (en) 2011-02-28 2012-09-07 The Regents Of The University Of California Compositions and methods for detecting and treating cancer
PL226015B1 (pl) * 2011-03-03 2017-06-30 Wrocławskie Centrum Badań Eit + Spółka Z Ograniczoną Liposomowy preparat zawierajacy przeciwnowotworowa substancje aktywna, sposob jego wytwarzania i zawierajaca go kompozycja farmaceutyczna
WO2012121682A2 (en) 2011-03-10 2012-09-13 National Science And Technology Development Agency Anti-folate antimalarials with dual-binding modes and their preparation
US8673914B2 (en) 2011-03-28 2014-03-18 St. John's University Use of phosphodiesterase inhibitors for treating multidrug resistance
EP2508894A1 (en) 2011-04-05 2012-10-10 Receptomon LLC Method for monitoring gene expression of translation and Integral/Secretory protein synthesis by magnetic resonance spectroscopy (MRS)
US8183227B1 (en) * 2011-07-07 2012-05-22 Chemo S. A. France Compositions, kits and methods for nutrition supplementation
RS61235B1 (sr) 2011-07-13 2021-01-29 Yissum Res Dev Co Of Hebrew Univ Jerusalem Ltd Lipozomi koji ko-inkapsuliraju bisfosfonat i amfipatički agens
SI2731972T1 (en) 2011-07-15 2018-04-30 Eisai R&D Management Co., Ltd. Anti-folate receptor alpha antibodies and uses thereof
US20130122096A1 (en) 2011-11-14 2013-05-16 Silenseed Ltd. Compositions for drug delivery and methods of manufacturing and using same
EP2617421A1 (en) * 2012-01-20 2013-07-24 Isofol Medical AB Tetrahydrofolates in combination with EGFR-inhibitors in the use of treating cancer
JP5977060B2 (ja) * 2012-03-29 2016-08-24 株式会社コーセー 葉酸配合製品
JPWO2014003137A1 (ja) 2012-06-27 2016-06-02 旭化成メディカル株式会社 高アフィニティー抗体、及びその製造方法
WO2014016740A2 (en) 2012-07-23 2014-01-30 Fresenius Kabi Oncology Ltd. Improved process for the preparation of pralatrexate
US20140120157A1 (en) 2012-09-19 2014-05-01 Georgetown University Targeted liposomes
WO2014046630A1 (en) 2012-09-19 2014-03-27 Keskin, Dilek Tumor targeted liposomal drug delivery system
US9207238B2 (en) 2012-12-07 2015-12-08 Kyowa Hakko Kirin Co., Ltd. Anti-FOLR1 antibody
CN103040748B (zh) 2012-12-18 2014-07-02 海南圣欣医药科技有限公司 一种培美曲塞二钠脂质体注射剂
US9192609B2 (en) 2013-04-17 2015-11-24 Hedgepath Pharmaceuticals, Inc. Treatment and prognostic monitoring of proliferation disorders using hedgehog pathway inhibitors
SG11201509043RA (en) 2013-05-14 2015-12-30 Immunogen Inc Anti-folr1 immunoconjugate dosing regimens
MA40428A (fr) * 2014-08-14 2016-02-18 L E A F Holdings Group Llc Médicament à affinité encapsulé dans un liposome
JOP20170004B1 (ar) 2016-01-15 2022-09-15 Lilly Co Eli الأجسام المضادة لببتيد بيتا النشوي مضاد N3pGlu واستخداماته
WO2017189961A1 (en) 2016-04-29 2017-11-02 Memorial Sloan Kettering Cancer Center Compositions and methods for targeted particle penetration, distribution, and response in malignant brain tumors
CN121177507A (zh) 2016-08-12 2025-12-23 L.E.A.F.控股集团公司 α和γ-D聚谷氨酸化抗叶酸剂及其用途
WO2018031968A1 (en) 2016-08-12 2018-02-15 L.E.A.F. Holdings Group Llc Alpha and gamma-d polyglutamated antifolates and uses thereof
WO2018031980A1 (en) 2016-08-12 2018-02-15 L.E.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
ES3062820T3 (en) 2017-11-08 2026-04-14 L E A F Holdings Group Llc Platinum complexes and uses thereof
CA3090389A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
JP7491572B2 (ja) 2018-02-07 2024-05-28 エル.イー.エー.エフ. ホールディングス グループ エルエルシー アルファポリグルタミン酸化ペメトレキセドおよびその使用
US12310966B2 (en) 2018-02-07 2025-05-27 L.E.A.F. Holdings Group Llc Alpha polyglutamated aminopterin and uses thereof
WO2019157145A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
WO2019157129A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
CN111867593A (zh) 2018-02-07 2020-10-30 L.E.A.F.控股集团公司 α聚谷氨酸化抗叶酸剂及其用途
EP3749319A4 (en) 2018-02-07 2022-06-22 L.E.A.F Holdings Group LLC TETRAHYDROFOLATES ALPHA POLYGLUTAMATE AND THEIR USES
EP3749321A4 (en) 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Gamma polyglutamated antifolates and uses thereof
EP3749314A4 (en) 2018-02-07 2022-02-23 L.E.A.F Holdings Group LLC ALPHA-POLYGLUTAMATE METHOTREXATE AND ITS USES
WO2019157121A1 (en) 2018-02-07 2019-08-15 L.E.A.F. Holdings Group Llc Alpha polyglutamated lometrexol and uses thereof
EP3749318A4 (en) 2018-02-07 2022-07-06 L.E.A.F Holdings Group LLC GAMMA-POLYGLUTAMATED RALTITREXED AND ITS USES
US12350271B2 (en) 2018-02-14 2025-07-08 L.E.A.F. Holdings Group Llc Gamma polyglutamated aminopterin and uses thereof
CA3090753A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof
JP7462950B2 (ja) 2018-02-14 2024-04-08 エル.イー.エー.エフ. ホールディングス グループ エルエルシー ガンマポリグルタミン酸化メトトレキセートおよびその使用
WO2019160734A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
WO2019160735A1 (en) 2018-02-14 2019-08-22 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
US20230000997A1 (en) 2019-08-06 2023-01-05 L.E.A.F. Holdings Group Llc Processes of preparing polyglutamated antifolates and uses of their compositions

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010046533A1 (en) * 1996-01-31 2001-11-29 Bailey Steven W. Method for treating a subject afflicted with intestinal malabsorption
US7446120B2 (en) * 2000-01-24 2008-11-04 Adherex Technologies, Inc. Peptidomimetic modulators of cell adhesion
US20030125302A1 (en) * 2000-04-17 2003-07-03 Fudan University Folic acid-polysaccharide complex, its preparation method and pharmaceutical composition containing the same as active component
US20060063768A1 (en) * 2002-02-26 2006-03-23 Thomas Mueller Use of folates for producing a preparation suitable for preventing and treating inflammation and diseases associated with inflammation, especially for influencing the inflammation markers crp and saa

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Pubmed Compound Summary U.S. National Library of Medicine; 28 December 2015 (2015-12-28), Database accession no. 102483590 *
See also references of EP3755335A4 *

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12178882B2 (en) 2016-08-12 2024-12-31 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12296022B2 (en) 2016-08-12 2025-05-13 L.E.A.F. Holdings Group Llc D glutamate polyglutamated antifolates and uses thereof
US11344628B2 (en) 2016-08-12 2022-05-31 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US11534498B2 (en) 2016-08-12 2022-12-27 L.E.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
US11701432B2 (en) 2016-08-12 2023-07-18 Le.A.F. Holdings Group Llc Polyglutamated antifolates and uses thereof
US12201695B2 (en) 2016-08-12 2025-01-21 L.E.A.F. Holdings Group Llc Polyglutamated pemetrexed and uses thereof
US12178883B2 (en) 2016-08-12 2024-12-31 L.E.A.F. Holdings Group Llc Alpha and gamma-D polyglutamated pemetrexed antifolates and uses thereof
US12246018B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated pemetrexed and uses thereof
US12220431B2 (en) 2018-02-07 2025-02-11 L.E.A.F. Holdings Group Llc Gamma polyglutamated antifolates and uses thereof
US12433893B2 (en) 2018-02-07 2025-10-07 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12076402B2 (en) 2018-02-07 2024-09-03 L.E.A.F. Holdings Group Llc Alpha polyglutamated antifolates and uses thereof
US12128046B2 (en) 2018-02-07 2024-10-29 L.E.A.F. Holdings Group Llc Alpha polyglutamated methotrexate and uses thereof
US11779584B2 (en) 2018-02-07 2023-10-10 L.E.A.F. Holdings Group Llc Alpha polyglutamated pemetrexed and uses thereof
US12336994B2 (en) 2018-02-07 2025-06-24 L.E.A.F. Holdings Group Llc Alpha polyglutamated tetrahydrofolates and uses thereof
US11730738B2 (en) 2018-02-07 2023-08-22 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
US12213981B2 (en) 2018-02-07 2025-02-04 L.E.A.F. Holdings Group Llc Alpha polyglutamated pralatrexate and uses thereof
US12310966B2 (en) 2018-02-07 2025-05-27 L.E.A.F. Holdings Group Llc Alpha polyglutamated aminopterin and uses thereof
US12239734B2 (en) 2018-02-07 2025-03-04 L.E.A.F. Holdings Group Llc Gamma polyglutamated raltitrexed and uses thereof
EP3749321A4 (en) * 2018-02-07 2022-03-09 L.E.A.F Holdings Group LLC Gamma polyglutamated antifolates and uses thereof
US12246015B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated raltitrexed and uses thereof
US12246019B2 (en) 2018-02-07 2025-03-11 L.E.A.F. Holdings Group Llc Alpha polyglutamated lometrexol and uses thereof
US12290518B2 (en) 2018-02-14 2025-05-06 L.E.A.F. Holdings Group Llc Gamma polyglutamated methotrexate and uses thereof
EP3752158A4 (en) * 2018-02-14 2022-03-09 L.E.A.F Holdings Group LLC GAMMA-POLYGLUTAMATED AMINOPTERINE AND USES THEREOF
US12048766B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated tetrahydrofolates and uses thereof
US11771700B2 (en) 2018-02-14 2023-10-03 L.E.A.F. Holdings Group Llc Gamma polyglutamated lometrexol and uses thereof
US12350271B2 (en) 2018-02-14 2025-07-08 L.E.A.F. Holdings Group Llc Gamma polyglutamated aminopterin and uses thereof
US12048767B2 (en) 2018-02-14 2024-07-30 L.E.A.F. Holdings Group Llc Gamma polyglutamated pralatrexate and uses thereof

Also Published As

Publication number Publication date
JP2021513550A (ja) 2021-05-27
JP7676056B2 (ja) 2025-05-14
JP7442822B2 (ja) 2024-03-05
US12048766B2 (en) 2024-07-30
CA3090992A1 (en) 2019-08-22
JP2025111607A (ja) 2025-07-30
CN111971047A (zh) 2020-11-20
EP3755335A1 (en) 2020-12-30
JP2024056882A (ja) 2024-04-23
EP3755335A4 (en) 2022-06-22
US20210128469A1 (en) 2021-05-06

Similar Documents

Publication Publication Date Title
US12433893B2 (en) Alpha polyglutamated pemetrexed and uses thereof
US20260048054A1 (en) Alpha polyglutamated tetrahydrofolates and uses thereof
US20250213577A1 (en) Alpha polyglutamated lometrexol and uses thereof
US20250082639A1 (en) Alpha polyglutamated methotrexate and uses thereof
US12048766B2 (en) Gamma polyglutamated tetrahydrofolates and uses thereof
US12310966B2 (en) Alpha polyglutamated aminopterin and uses thereof
US12246015B2 (en) Alpha polyglutamated raltitrexed and uses thereof
US20210023006A1 (en) Gamma polyglutamated raltitrexed and uses thereof
WO2019157145A1 (en) Gamma polyglutamated pemetrexed and uses thereof
WO2019160733A1 (en) Gamma polyglutamated methotrexate and uses thereof
WO2019160736A1 (en) Gamma polyglutamated pralatrexate and uses thereof
WO2019160734A1 (en) Gamma polyglutamated lometrexol and uses thereof
WO2019157129A1 (en) Alpha polyglutamated pralatrexate and uses thereof
EP3752158A1 (en) Gamma polyglutamated aminopterin and uses thereof
US20250064736A1 (en) Gamma polyglutamated tetrahydrofolates and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19754705

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3090992

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020543517

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019754705

Country of ref document: EP

Effective date: 20200914