WO2019107671A1 - 항-ros1 항체 및 그의 용도 - Google Patents

항-ros1 항체 및 그의 용도 Download PDF

Info

Publication number
WO2019107671A1
WO2019107671A1 PCT/KR2018/002655 KR2018002655W WO2019107671A1 WO 2019107671 A1 WO2019107671 A1 WO 2019107671A1 KR 2018002655 W KR2018002655 W KR 2018002655W WO 2019107671 A1 WO2019107671 A1 WO 2019107671A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
antibody
antigen
amino acid
acid sequence
Prior art date
Application number
PCT/KR2018/002655
Other languages
English (en)
French (fr)
Inventor
정준호
이유진
김지은
이화경
박종배
김효리
진준영
Original Assignee
서울대학교 산학협력단
국립암센터
재단법인 아산사회복지재단
울산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단, 국립암센터, 재단법인 아산사회복지재단, 울산대학교 산학협력단 filed Critical 서울대학교 산학협력단
Priority to US16/767,245 priority Critical patent/US20230242670A1/en
Priority to KR1020187006693A priority patent/KR102078775B1/ko
Priority to JP2020529420A priority patent/JP7041265B2/ja
Publication of WO2019107671A1 publication Critical patent/WO2019107671A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57423—Specifically defined cancers of lung
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/10—Protein-tyrosine kinases (2.7.10)
    • C12Y207/10001—Receptor protein-tyrosine kinase (2.7.10.1)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Definitions

  • hybrids monoclonal antibodies are made using hybridoma technology, and these monoclonal antibodies are specified by hybridoma cell lines deposited in an approved cell line depository.
  • R0S1 protein is cleaved and the 30 regions of R0S1 are divided into v-ros, FIG, SLC34A2, CD74, EZR, LRIG3, and TPM3.
  • R0S1 is known to activate cell signaling associated with proliferation, metastasis, and anti-apoptotic function, but its biological function has not been elucidated.
  • the specificity may be one having more enhanced characteristics.
  • One example provides an anti-R0S1 antibody or an antigen-binding fragment thereof that specifically recognizes the N-terminal region of the ROS1 protein.
  • the R0S1 protein may be a human ROS1 (e.g., NP_002935.2 (SEQ ID NO: 9), etc.).
  • the N-terminal region of the R0S1 protein may be the 37th to 290th region or a portion thereof in the amino acid sequence of the R0S1 protein (SEQ ID NO: 9), and the portion may be, for example, 56, or a part thereof (e.g., D46-L47-G48-T49
  • the anti-R0S1 antibody or antigen-binding fragment thereof comprises an amino acid 39-56 of R0S1 (NP_002935.2; SEQ ID NO: 9) or a portion thereof (eg, D46-L47-G48-T49 of R0S1 ) Or the amino acid of L45-D46-L47-G48-T49 (SEQ ID NO: 11).
  • the anti-R0S1 antibody or antibody-derived antigen binding fragment comprises or consists of D46-L47-G48-T49 (SEQ ID NO: 10) or L45-D46-L47-G48-T49 (SEQ ID NO: It is possible to specifically recognize (and / or bind) an epitope that has been made essentially.
  • the anti-R0S1 antibody or antigen-binding fragment thereof provided herein may not bind to a peptide consisting of IDLGT (SEQ ID NO: 12).
  • the peptide consisting of IDLGT may be present in HSP family proteins such as Heat shock protein 70 (HSP70), HSP71, GRP75 and GRP78.
  • HSP70 Heat shock protein 70
  • HSP71 HSP71, GRP75 and GRP78.
  • the anti-R0S1 antibody or antigen-binding fragment thereof provided herein may not bind to HSP family proteins such as HSP70, HSP71, GRP75 and GRP78.
  • the anti-R0S1 antibody or antigen-binding fragment thereof may comprise the following complementarity determining region (3 R): 2019/107671 1 »(: 1 ⁇ ⁇ 2018/002655
  • SEQ ID NO: 60 or SEQ ID NO: 13 (( ⁇ ), particularly SEQ ID NO: 60).
  • Another example provides use for use in the diagnosis of cancer of the anti-salvage antibody or antibody-derived antigen binding fragment, or for use in the preparation of an anti-cancer agent or cancer diagnostic agent.
  • Another example is the ability of the anti-R0S1 antibody to increase the specificity for ROS1
  • the epitope may be located at the N-terminal site of the ROSl protein (e. (For example, the region from 37 th to 290 th in the amino acid sequence of NP_002935.2 (SEQ ID NO: 9)) or a part thereof (for example, four or more consecutive or five or more consecutive , 6, 7, 8, 9, or 1 ⁇ amino acid), or a portion thereof.
  • the ROSl protein e. (For example, the region from 37 th to 290 th in the amino acid sequence of NP_002935.2 (SEQ ID NO: 9)
  • a part thereof for example, four or more consecutive or five or more consecutive , 6, 7, 8, 9, or 1 ⁇ amino acid
  • the epitope of ROS1 comprises a region from position 39 to 56 of the ROS1 protein (SEQ ID NO: 9), or a portion thereof (e.g., D46-L47-G48-T49 -G48-T49 (SEQ ID NO: 11)).
  • Another example is
  • One example provides a method for enhancing the specificity of an anti-R0S1 antibody, including introducing a point mutation into the heavy chain complementarity determining region 3 (HCDR3).
  • a method of enhancing the specificity of an anti-R0S1 antibody comprises the step of replacing glycine (G), the first amino acid of H3 R3 of an antibody or antigen-binding fragment thereof comprising the following CDRs with raisin can do:
  • LCDR1 SGGSYGYG (SEQ ID NO: 1)
  • LCDR2 DNTNRPS (SEQ ID NO: 2)
  • LCDR3 GSADSSSIAT (SEQ ID NO: 3)
  • HCDR1 GFSFSDRGMH (SEQ ID NO: 4),
  • HCDR2 ISGDGYITHYGAAVKG (SEQ ID NO: 5), and
  • HCDR3 GGGGNIDA (SEQ ID NO: 13).
  • SEQ ID NO: 2 IXDR3 (SEQ ID NO: 3), H (SEQ ID NO: 4), H (SEQ ID NO: ), A heavy chain variable region (SEQ ID NO: 8 or SEQ ID NO: 13), and a scFv (SEQ ID NO: 24 or SEQ ID NO: 26).
  • the recombination vector may comprise or comprise the light chain variable region (SEQ ID NO: 7) and the heavy chain variable region (SEQ ID NO: 8 or SEQ ID NO: 14, respectively).
  • the recombinant vector may comprise the anti-R0S1 scFv (SEQ ID NO: 24 or SEQ ID NO: 26).
  • Another example provides a recombinant cell comprising said recombinant vector.
  • Another example provides a method for producing an anti-R0S1 antibody or antigen-binding fragment thereof, comprising the step of expressing the recombinant cell.
  • the R0S1 protein is a proto-oncogene tyrosine kinase encoded by the ROS1 gene and plays an important role in carcogenesis through the rearrangement of genes and the formation of fusion proteins with other genes involved in the C-terminal intracellular region of R0S1 .
  • the possibility of overexpression of wild-type ROS1 through epigenet ic regulat ion has been proposed.
  • an anti-ROS1 antibody (3B20) is provided that binds to the N-terminus of ROSl, which can be used to detect wild-type ROS1 in cancer tissues (e.g., cancerous tissues).
  • cancer tissues e.g., cancerous tissues.
  • the ability of 3B20 to react with heat shock proteins e.
  • Hsp70s has been identified through conventional analytical techniques such as immunoblotting and immunoprecipitation.
  • the amino acid sequence of ROS1 and the amino acid sequence of Hsp70s were analyzed to confirm that these sequences shared the amino acid sequence. Through an alanine substitution mutation test of R0S1, it was confirmed that the epitope of ROS1 contained the above sequence.
  • Anti-R0S 1 antibody (3B20) H 3 Randomly replacing each amino acid constituting R 3 with an amino acid different from the original amino acid.
  • the mutant clone 3B20-G1K which has cross reactivity to react with other proteins (such as Hsp70s) while retaining its reactivity (binding force) with ROS1 through mutation, was prepared.
  • R0S1 is not observed in normal tissue (e.g., normal lung tissue) using 3B20-G1K, whereas R0S1 is overexpressed in lung cancer tissue (e.g., lung tissue with lung adenocarcinoma) Respectively.
  • normal tissue e.g., normal lung tissue
  • lung cancer tissue e.g., lung tissue with lung adenocarcinoma
  • the present specification provides an epitope of ROS1, an anti-ROS1 antibody or antigen-binding fragment thereof specifically recognizing the epitope, and the use of the antibody, which can enhance the specificity for ROS1.
  • the anti-R0S1 antibody or antigen-binding fragment thereof may be characterized in that the specificity for ROS1 is further enhanced by recognizing a specific region of ROS1.
  • One example provides an anti-R0S1 antibody or an antigen-binding fragment thereof that specifically recognizes the N-terminal region of the ROS1 protein.
  • the R0S1 protein may be a human ROS1 (e.g., NP_002935.2 (SEQ ID NO: 9), etc.).
  • the N-terminal region of the R0S1 protein may be the 37th to 290th region or a portion thereof in the amino acid sequence of the R0S1 protein (SEQ ID NO: 9), and the portion may be, for example, (For example, amino acids of D46-L47-G48-T49 (SEQ ID NO: 10) or L45-D46-L47-G48-T49 (SEQ ID NO: 11)).
  • the anti-R0S1 antibody or antigen-binding fragment thereof comprises amino acids 39-56 of R0S1 (NP_002935.2; SEQ ID NO: 9) or a portion thereof (e.g., D46-L47-G48-T49 of SEQ ID NO: Or amino acid of L45-D46-L47-G48-T49 (SEQ ID NO: 11)).
  • An epitope comprising or consisting essentially of D46-L47-G48-T49 (SEQ ID NO: 10) or L45-D46-L47-G48-T49 (SEQ ID NO: 11) can be specifically recognized.
  • the anti-R0S1 antibody or antigen-binding fragment thereof may not bind (and / or recognize) a peptide composed of IDLGT (SEQ ID NO: 12).
  • the peptide consisting of IDLGT may be present in HSP family proteins such as Heat shock protein 70 (HSP70), HSP71, GRP75 and GRP78.
  • HSP70 Heat shock protein 70
  • HSP71 HSP71
  • GRP75 GRP78
  • this protein does not bind to this protein, such as 70, 70, 075, and 78.
  • the anti-human antibody or antigen-binding fragment thereof binds (and / or recognizes) a peptide consisting of 145-046-147-048-149 (SEQ ID NO: 11) and 1 (SEQ ID NO: 12) It may be possible.
  • the anti-urine and the antibody or antigen-binding fragment thereof may be at least one kind selected from the group consisting of sputum proteins 70, 71, 0175 and 78, (And / or recognizable) to more than one species, to more than four species, or to all five species.
  • the anti-salvage antibody or antigen-binding fragment thereof may comprise the following complementarity determining regions (3):
  • the anti-CD4 antibody or antigen-binding fragment thereof may comprise the following variable regions:
  • the anti-R0S1 antibody or antigen-binding fragment thereof may be an anti-R0S1 antibody or antigen-binding fragment thereof, defined as:
  • an anti-R0S1 antibody or an antigen-binding fragment thereof comprising: (a) a complementary determining region (CDRs)
  • LCDR1 comprising the amino acid sequence of SEQ ID NO: 1 (SGGSYGYG), LCDR2 comprising the amino acid sequence of SEQ ID NO: 2 (DNTNRPS)
  • An LCDR3 comprising the amino acid sequence of SEQ ID NO: 3 (GSADSSSIAT).
  • HCDR1 comprising the amino acid sequence of SEQ ID NO: 4 (GFSFSDRGMH), HCDR2 comprising the amino acid sequence of SEQ ID NO: 5 (ISGDGYITHYGMVKG), and
  • HCDR3 comprising the amino acid sequence of SEQ ID NO: 6 (KGGGNIDA); or
  • an anti-R0S1 antibody or antigen-binding fragment thereof comprising the following variable regions:
  • a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7, and
  • a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8,
  • the anti-R0S1 antibody or antigen-binding fragment thereof may bind to SEQ ID NO: 11 (LDLGT) and not to SEQ ID NO: 12 (IDLGT) .
  • the anti-R0S1 antibody or antigen-binding fragment thereof may be an anti-R0S1 antibody or antigen-binding fragment thereof, defined as follows:
  • an anti-R0S1 antibody or antigen-binding fragment thereof comprising the following complement determining region (CDRs):
  • LCDR1 comprising the amino acid sequence of SEQ ID NO: 1 (SGGSYGYG)
  • An LCDR2 comprising the amino acid sequence of SEQ ID NO: 2 (DNTNRPS)
  • An LCDR3 comprising the amino acid sequence of SEQ ID NO: 3 (GSADSSSIAT).
  • HCDR1 comprising the amino acid sequence of SEQ ID NO: 4 (GFSFSDRGMH), HCDR2 comprising the amino acid sequence of SEQ ID NO: 5 (ISGDGYITHYGMVKG), and
  • HCDR3 comprising the amino acid sequence of SEQ ID NO: 13 (GGGGNIDA); or
  • a light chain variable region comprising the amino acid sequence of SEQ ID NO: 23 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 14, wherein the anti-1/3 antibody or antigen binding fragment thereof comprises SEQ ID NO: ), And SEQ ID NO: 12 ( ⁇ liver). Due to this feature, one or more selected from the group consisting of 0, 3 ⁇ 4 70 , 3 ⁇ 4 71 , 0 75 and 0 78 Or more, 3 kinds or more, 4 kinds or more, or 5 kinds.
  • the antigen-binding fragment of the anti-1/4 antibody comprises 10 of the above-mentioned anti-Yo and 6 of the antibody Any polypeptide comprising, e. (Kappa constant region), 1 - (: 1 (lambda constant region),
  • the antigen-binding fragment comprises 1% or Immunoglobulins (e. G., Fusion sites and fused
  • a pharmaceutical composition comprising the anti-13 ⁇ 4) and the antibody or antibody-derived antigen-binding fragment.
  • the pharmaceutical composition 25 may be a composition for diagnosing cancer.
  • Another example provides the use for use in the diagnosis of cancer of the anti-human and antibody or antibody-derived antigen-binding fragment, or for use in the manufacture of an anti-cancer agent or cancer diagnostic agent.
  • a method for diagnosing cancer or a method for providing information to diagnosis of cancer can be carried out by confirming whether the antigen-antibody complex is formed (detecting the complex) by a conventional method.
  • the biological sample may be selected from the group consisting of (isolated) cells, tissues, body fluids and cultures thereof obtained from an object (for example, a mammal such as a human).
  • the method for providing information on the diagnosis method of cancer or the diagnosis of cancer is characterized in that after the step (2)
  • step (3) If the antigen-antibody reaction in the reactant of step (1) is confirmed (e.g., formation of an antigen-antibody complex is confirmed (complex detected), the subject is at risk of developing cancer or cancer Determination (or confirmation) of the information.
  • the epitope may be located at the terminal end of a protein (e. / ⁇ ( 6331011 ). Or a part thereof (for example, in the region from the 37th to the 290th in the amino acid sequence of SEQ ID NO: 9) or a part thereof (for example, 4 or more consecutive or 5 consecutive Or more of the above amino acids).
  • the epitope with the tide is the region 39 to 56 of SEQ ID NO: 9 (SEQ ID NO: 15), or a portion thereof (e.g.,
  • SEQ ID NO: 10 or one amino acid of 5-046 DOO 47 48 49 (SEQ ID NO: 11) or SEQ ID NO: 10 or SEQ ID NO: 11 in SEQ ID NO: Or a site comprising or consisting of 5 or more amino acids).
  • Another example is
  • the antibody or antigen-binding fragment specifically binds to a gonad comprising the antibody or antigen-binding fragment thereof.
  • the selected antibody or antigen-binding fragment is one that is capable of binding to SEQ ID NO: 11 (1) and SEQ ID NO: 12 (1) And 1 3 ⁇ 4 light 1, 2019/107671 1 »(: 1 ⁇ ⁇ 2018/002655
  • the selected antibody or antigen binding fragment binds to SEQ ID NO: 11 (1 ⁇ Jiang, SEQ ID NO: 12
  • SEQ ID NO: 11 1011 Jiang
  • the selected antibody or antigen binding fragment binds to SEQ ID NO: 11 (1 ⁇ Jiang, SEQ ID NO: 12
  • the recombinant vector may comprise or comprise the light chain variable region (SEQ ID NO: 7) and the heavy chain variable region (SEQ ID NO: 8 or SEQ ID NO: 14, respectively).
  • the recombinant vector may comprise the anti-CDNA ⁇ SEQ ID NO: 24 or SEQ ID NO: 26).
  • Another example provides a recombinant cell comprising said recombinant vector.
  • Another example provides a method of producing an anti-antibody or antigen-binding fragment thereof, comprising the step of expressing the recombinant cell.
  • the urine that acts as an antigen of the antibody or antigen-binding fragment provided herein may be of mammalian origin, for example, (E.g., GenBank accession numbers NP_002935.2, etc.).
  • the anti-R0S1 antibody provided herein recognizes and / or binds to the N-terminal portion of R0S1 (i.e., the epitope region described above).
  • the term " antibody " refers collectively to a protein specifically binding to a specific antigen, and may be a protein produced by stimulation of an antigen in the immune system or a protein prepared chemically or recombinantly , The kind thereof is not particularly limited.
  • the antibody may be an unnatural one, for example, recombinantly or synthetically produced.
  • the antibody may be an animal antibody (e.g., mouse antibody, etc.), a chimeric antibody, a humanized antibody or a human antibody.
  • the antibody may be a monoclonal antibody or a polyclonal antibody.
  • a complete antibody is a structure with two full length light chains and two full length heavy chains, each light chain linked by a heavy chain and a disulfide bond.
  • the constant region of the antibody is divided into a heavy chain constant region and a light chain constant region and the heavy chain constant region has gamma U), mu (U), alpha U), delta (5) gamma 2 (Y 2), gamma 3 (Y 3), gamma 4 (Y 4), alpha 1 (a 1) and alpha 2 (a 2).
  • the constant region of the light chain has the kappa (K) and lambda (X) types.
  • variable chain refers to a variable region domain V H comprising an amino acid sequence having a sufficient variable region sequence sufficient to impart specificity to an antigen and three constant region domains C HI, C H2 and C H3 , quot; includes both a full-length heavy chain including a hinge and fragments thereof.
  • light chain also encompasses both the full-length light chain comprising the variable region domain V L and the constant region domain C L comprising the amino acid sequence having a sufficient variable region sequence to confer specificity to the antigen and fragments thereof Is interpreted to mean inclusive.
  • CDR complementarity determining region
  • an antibody can be understood to include an antigen-binding fragment of an antibody that retains antigen-binding ability, unless otherwise specified.
  • antigen-binding fragment refers to any form of polypeptide comprising a moiety capable of binding an antigen (eg, 6 (3) R as defined herein).
  • an antigen eg, 6 (3) R as defined herein.
  • the antigen-binding fragment may be a scFv, or a scFv that is fused with an Fc region of an immunoglobulin (e.g. IgGl, IgG2, IgG3, IgG4, etc.) or a constant region of a light chain (e.g. kappa or lambda) Lt; / RTI > polypeptide.
  • Fab among the antigen-binding fragments has one variable region of light and heavy chains, a constant region of light chain and a first constant region (C H1) of heavy chain, and has one antigen-binding site.
  • the F (ab ') 2 antibody is produced when the cysteine residue of the hinge region of the Fab forms a disulfide bond.
  • Recombinant techniques for generating Fv fragments with minimal antibody fragments having only a heavy chain variable region and a light chain variable region are well known in the art.
  • Double chain Fv (two-chain Fv) is the heavy chain variable region and light chain variable region linked to a non-covalent bond
  • single chain Fv (s ingl e ⁇ chain Fv ) is generally the variable region of the heavy chain through a peptide linker, a variable region and a short chain Is connected to the covalent bond or is directly connected to the C-terminal, so that a dimer-like structure can be obtained like the double-chain Fv .
  • the antigen-binding fragment can be obtained using a protein hydrolyzing enzyme (for example, when the whole antibody is restricted to papain, a Fab can be obtained and when cut with pepsin, an F (ab ') 2 fragment can be obtained) It can be produced through recombinant DNA technology.
  • a protein hydrolyzing enzyme for example, when the whole antibody is restricted to papain, a Fab can be obtained and when cut with pepsin, an F (ab ') 2 fragment can be obtained
  • It can be produced through recombinant DNA technology.
  • the term "hinge region” is a region contained in the heavy chain of the antibody, which exists between the CH1 and CH2 regions and which functions to provide the flexibility (antigenicity) of the antigen binding site in the antibody The area is known.
  • the anti-R0S1 antibody may be a monoclonal antibody.
  • Monoclonal antibodies can be prepared by methods well known in the art. For example, it can be prepared using the phage di sp l ay technique. Alternatively, the anti-R0S1 antibody can be prepared and used as a monoclonal antibody derived from a mouse by a conventional method.
  • individual monoclonal antibodies can be screened based on their ability to bind to R0S1 using a typical ELISA (Enzyme-Linked ImmunoSorbent Assay) format. Can be assayed for inhibitory activity through functional assays such as competitively EL ISA (Competitve ive ELISA) or CE-based assays for assaying molecular interactions for the conjugates have. Each affinity for R0S1 (Kd va lues) can then be assayed for selected monoclonal antibody members based on strong inhibitory activity. The finally selected antibodies can be used as humanized antibodies as well as human immunoglobulin antibodies except for the antigen binding portion. Methods for making humanized antibodies are well known in the art.
  • the patient to which the present invention is applied may be a mammal including a primate including a human, a monkey, etc., a rodent including a mouse, a rat, and the like.
  • the cancer is a solid tumor or blood may amil, but are not limited to, lung cancer (e.g. small cell lung cancer, non-small cell lung cancer, lung cancer, lung squamous cell carcinoma, etc.), peritoneal cancer, skin cancer, cutaneous or intraocular melanoma, colon cancer, around the anus (Eg chronic or acute leukemia), lymphoma, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, endometrioid carcinoma, A cancer selected from the group consisting of liver cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colon cancer, endometrial or uterine cancer, salivary cancer, kidney cancer, liver cancer, prostate cancer, mucin cancer, thyroid cancer, liver cancer, head and neck cancer, It can be more than a species.
  • the cancer may be a primary cancer or a metastatic cancer.
  • the anti-R0S1 antibody or antigen-binding fragment thereof specifically binds to the N-terminal region of ROS1, particularly ROS1 (for example, the epitope region described above), so that ROS1 can be detected or confirmed.
  • another embodiment of the present invention provides a composition for detecting ROS, comprising the anti-ROS1 antibody or antigen-binding fragment thereof.
  • Another example includes treating the biological sample with the anti-R0S1 antibody or antigen-binding fragment thereof; And a step of confirming whether or not the antigen-antibody reaction is confirmed. In this detection method, when the antigen-antibody reaction is confirmed (antigen-antibody Complex is detected), it can be determined that ROS1 is present in the biological sample.
  • the detection method may further comprise, after the identifying step, determining that ROSl is present in the biological sample if an antigen-antibody reaction is detected.
  • the biological sample may be selected from the group consisting of (isolated) cells, tissues, body fluids, cultures thereof, etc. obtained from a mammal such as a human (for example, a cancer patient).
  • the step of confirming whether an antigen-antibody reaction is confirmed can be performed through various methods known in the art. For example, it can be measured by a conventional enzyme reaction, fluorescence, luminescence and / or radiation detection, and specifically, immunochromatography,
  • Immunohistochemical staining (Clmmunohy stoichiometry), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), fluorescence immunoassay but are not limited to, immunoassay (FIA), luminescence immunoassay (LIA), Western blotting, microarray, and the like.
  • the heavy chain complementarity determining region, the light chain complementarity determining region, or a combination thereof of the anti-R0S1 antibody described above Or a polypeptide chain comprising a heavy chain variable region, a light chain variable region , or a combination thereof .
  • the polypeptide molecule can be used as a precursor of an antibody as well as a component of a protein scaffold (e.g., a peptibody), a bispecific antibody, a multispecific antibody, have.
  • Another example provides nucleic acid molecules encoding heavy chain complementarity determining regions, heavy chain variable regions or heavy chains of anti-R0S1 antibodies.
  • Another example provides nucleic acid molecules encoding light chain complementarity determining regions, light chain variable regions or light chains of anti-R0S1 antibodies.
  • heavy chain complementarity determining region of the anti-R0S1 antibody examples include the heavy chain complementarity determining region of the anti-R0S1 antibody, the nucleic acid molecule encoding the heavy chain variable region or heavy chain, and the light chain
  • a recombinant vector containing a nucleic acid molecule encoding a complementarity determining region, a light chain variable region or a light chain is contained in one vector or each vector in a separate vector.
  • vector means means for expressing a gene of interest in a host cell.
  • viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, lentivirus vectors, adenovirus vectors, retroviral vectors, and adeno-associated viral vectors.
  • Vectors that can be used with the recombinant vector include, for plasmid (for example, often used in the art, pSClOl, pGV1106, pACYC177, ColEl , P KT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFRl, (e.g., pHV14, pGEX series, pET series, pUC19, etc.), phage (e.g., A gt4XB, X-Charon, Aza1 and M13) or viruses (e.g., SV40, etc.) .
  • plasmid for example, often used in the art, pSClOl, pGV1106, pACYC177, ColEl , P KT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ
  • the nucleic acid molecule in the recombinant vector may be operatively linked to a promoter.
  • the term " operatably linked" refers to a functional linkage between a nucleotide expression control sequence (e.g., a promoter sequence) and another nucleotide sequence.
  • the regulatory sequence may be operatively linked to regulate transcription and / or translation of other nucleotide sequences.
  • the recombinant vector can typically be constructed as a vector for cloning or as a vector for expression.
  • the expression vector may be any conventional vector used in the art to express an exogenous protein in plants, animals or microorganisms.
  • the recombinant vector can be constructed through a variety of methods known in the art.
  • the recombinant vector may be constructed with prokaryotic or eukaryotic cells as hosts.
  • a strong promoter capable of promoting transcription for example, a pL A promoter, a CMV promoter, a trp promoter, a lac promoter, a tac promoter, T7 promoter, etc.
  • a ribosome binding site for initiation of translation and a transcription / translation termination sequence for example, a pL A promoter, a CMV promoter, a trp promoter, a lac promoter, a tac promoter, T7 promoter, etc.
  • the origin of replication that functions in the eukaryotic cells contained in the vector is the origin of cl replication, the origin of SV40 replication, the origin of replication of pMBl, the origin of adenope replication, the origin of AAV replication, but are not limited thereto.
  • promoters derived from the genome of mammalian cells e.g., metallothionein promoter
  • mammalian viruses e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, Cytomegalovirus promoter and promoter of HSV
  • adenovirus late promoter vaccinia virus 7.5K promoter
  • SV40 promoter vaccinia virus 7.5K promoter
  • the recombinant cell may be obtained by introducing the recombinant vector into an appropriate host cell.
  • the host cell may be any host cell known in the art as a cell capable of successively cloning or expressing the recombinant vector stably.
  • Examples of the prokaryotic cell include E. coli JM109, E. coli Bacillus subtilis, Bacillus subtilis, and Bacillus strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E.
  • coli W3110 Bacillus subtilis, and Salmonella typhimurium, Yeast, Saccharomyces cerevisiae), gut cells, plant cells, and animal cells, such as, for example, E. coli, S. cerevisiae, HEK293T, Sp2 / 0, CHOCChinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, no.
  • the transfer (introduction) of the nucleic acid molecule or the recombinant vector containing the nucleic acid molecule into a host cell can be carried out by a method well known in the art.
  • the host cell is a prokaryotic cell
  • the CaCl 2 method or the electroporation method can be used.
  • the host cell is a eukaryotic cell
  • the microinjection method, the calcium phosphate precipitation method, the electroporation method, Liposome-mediated transfection methods, and gene bombardment but the present invention is not limited thereto.
  • the method of screening the transformed host cells can be easily carried out according to methods well known in the art, using phenotypes expressed by selection markers.
  • the selection mark is a specific antibiotic resistance gene
  • the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.
  • the method of manufacture may include culturing the recombinant cells comprising the recombinant vector, and optionally isolating and / or purifying the antibody from the culture medium.
  • an anti-rROS1 antibody or antigen-binding fragment thereof that reacts with the N-terminal region of ROSl wherein the epitope is ROS1 (NPJ302935.2; L47-G48-T49 of SEQ ID NO: 9).
  • the antibody binding to D46-L47-G48-T49 of R0S1 could cross-react with Hsp70s having the same DLGT sequence, and mutation (for example, amino acid substitution ) was introduced to further increase the specificity of the antibody. From the IDLGT sequence of Hsp70, an antibody that accurately discriminates the LDLGT sequence of ROS1 is provided.
  • the present specification provides an anti-R0S1 antibody that specifically binds to the R0S1 N-terminal region, thereby enabling more accurate and efficient detection of R0S1 (N-terminal or full-length), a study of the biological function of R0S1, And can be usefully used for diagnosis of related diseases.
  • Figure la is a graph showing the amount of 3B20 scFv-rFc fusion protein bound to ROS1.
  • Figure lb shows the result of immune precipitation of HEK293T cells transfected with a lentiviral vector encoding human ROS1 (full-l eng) and lysates by immunoprecipitation with 3B20 scFv-rFc fusion protein and confirmed by immunoblotting.
  • Figure lc shows the GFP (control; 3B20 antibody treated with a lentiviral vector of HEK293T cells transformed with a lentiviral vector encoding ROS (C) or ROS1 (R), followed by MS analysis of immunoprecipitated and isolated protein fractions.
  • FIGS. 2A to 2C show the results of identification of the 3B20 epitope by alanine substitution mutagenesis at the Gly42 to Ser54 regions of the human ROS1 protein, wherein 2a is a 3B20 scFv-CK fusion protein, 2b is BSA, 2c is an i rrel evant scFv - K K fusion proteins to alanine substituted mutants, respectively.
  • Figures 3a and 3b show the results of ELISA for the reaction specificity of 3B20 and 3B20-G1K on the recombinant ROS1 (amino acid 37-290) -CK fusion protein, 3a 3B20, and 3b is the result of 3B20-G1K.
  • Figure 3c shows a 3B20, 3B20-G1K, or R0S1 antibody (Abeam product number ab5512) was added to a lysate of HEK293T cells transformed with the R0S1 coding lentiviral vector (lane R) or the control vector (lane C; GFP) Immunoblotting results obtained by treatment are shown.
  • FIG. 3D shows the result of immunoprecipitation of 3B20 or 3B20-G1K with a lysate of HEK293T cells transformed with the R0S1 coding lentiviral vector (lane R) or the control vector (lane C; GFP).
  • FIG. 4 shows immunohistochemical staining (IHC) results using 3B20-G1K.
  • the synthetic peptide (TNLGQQLDLGTPHNLGPGGC (SEQ ID NO: 16); R0S1 (GenBank Accession No. NPJ302935.2) conjugated to keyhole limpet hemocyanin (Peptron; Daejun, S. Korea)
  • scFv Chicken single-chain variable fragment
  • BSA Bovine serum albumin
  • OVA ovalbumin
  • ELISA enzyme-1 inked immunosorbent assay
  • the gene encoding the selected scFv (3B20) was subcloned into modified pCEP4 mammalian expression vectors (V04450; Thermo Fisher Scientific, Rockford, Ill., USA) Fusion protein (scFv (3B20) -rFc fusion protein) fused with Fc (rFc) [H. Kim, S. Park, HK Lee, J. Chung, Application of bispecific antibodies against antigen and hapten for immunodetection and immunopurification, Exp. Mol. Med. 45 (2013) e43. Or a fusion protein (scFv-CK fusion protein) in which the ScFv is fused with a human kappa light chain constant region (CK) [Y. Lee, H.
  • CK fusion protein, irrelevant protein (prostate cancer specific antigen (NP_001025218.1)), a recombinant ROS1 (37-290 amino acid) -cK fusion protein (Costar, Cambridge, Mass., USA) was coated with a coating solution in which a synthetic peptide (TNLGQQLDLGTPHNL condition PGGG-BSA conjugate or GRP75 (Enzo Life Sciences, Farmingdale, NY, USA) was dissolved in 0.1 M sodium bicarbonate, pH 8.6. After blocking, 3B20 -rFc or 3B20-G1K (the first amino acid G of HCDR3 of 3B20 was replaced with K) -rFc fusion protein was added.
  • a synthetic peptide TNLGQQLDLGTPHNL condition PGGG-BSA conjugate or GRP75 (Enzo Life Sciences, Farmingdale, NY, USA
  • the amount of antibody bound was determined using horseradish peroxidase (HRP) -conjugated goat anti- rabbit IgG antibody (Abeam, (Amersco LLC, Solon, OH, USA) was used as a substrate solution in the presence of 2, 20-azinobis [3-ethylbenzothiazol ine-6-sul fonic acid] The amount of antibody bound to each sample was measured. It was performed.
  • HRP horseradish peroxidase
  • Abeam (Amersco LLC, Solon, OH, USA) was used as a substrate solution in the presence of 2, 20-azinobis [3-ethylbenzothiazol ine-6-sul fonic acid]
  • microtiter plates (Corning Costar) were incubated with 3B20 scFv-CK fusion protein 100 ng of bovine serum albumin, or 100 ng of irrelevant SCFV-CK overnight at 4 ° C.
  • the plate was incubated with an alanine-substituted ROS1-human antibody Fc (hFc) fusion protein (the 42nd amino acid residue of ROS1 (from the 54th amino acid residue (Ser) replaced by each alanine) or wild type ROS1- hFc fusion protein
  • hFc alanine-substituted ROS1-human antibody Fc
  • the amount of fusion protein bound to the plate was measured using HRP-conjugated rabbit anti-human IgG Fc antibody (Thermo Fisher
  • Human ROS1 Open Biosystems, Huntsville, AL
  • Gateway recombinant coolding technology and Gateway LR Clonase TM (Thermo Fisher Scientific) to construct pLent i 6-human ROS- , USA) with pLent i6 / V5-DEST (Thermo Fisher Scientific,
  • GFP green fluorescent protein
  • Lentiviruses were then produced with reference to the following references: [J. Yin, G. Park, T.H. Kim, J.H. Hong, Y.J. Kim, X. J, S. Kang, J.E. Jung,
  • PEDF Pigment epithelium-derived factor
  • the cells were cultured in HEK293T cells (American Type Culture Collection, Manassas, VA USA) in the presence of 6 g / mL polybrene using the prepared pLent i 6-human
  • R0S1-DEST or GFP lentivirus as described [J. HES1 and SIRT1 expression, Oncotarget, Gene Park, JE Lee, JY Park, TH Kim, YJ Kim, SH Lee, H. Yoo, JH Kim, JB Park, CPEB1 modulates differentiation of glioma stem cells 5 (2014) 6756 [6769].
  • GIBC0 Grand Island, NY, USA
  • the resulting cell lysate was incubated with 3B20 scFv or 3B20 scFv-GIK fused with rFc fusion protein 30 (5 g / mL) and protein A-conjugated agarose bead (Repl iGen, Waltham, MA, USA). After washing, the protein bound to beads was eluted by boiling in NuPAGE LDS Sample Buffer (Thermo Fisher Scientific), and SDS-PAGE and immunoblotting (Reference Example 4 ). The eluted proteins separated by S-PAGE were separated by Coomassie
  • alanine scanning mutagenesis assay was performed. (Amino acid residues 37 to 290 of R0SKR0S1) as a template and one of the amino acid residues from the 42nd (Gly) to the 54th (Ser) of R0S1 by PCR amplification was substituted with alanine A gene encoding the sequence was prepared.
  • the PCR was performed using [Y. Lee, H., Kim, J. Chung, An antibody reactive to the Gly63-Lys68 epitope of NT-proBNP exhibits 0-glycosyl ation- independent binding, Exp. Mol. Med. 46 (2014) ell4].
  • the primers and the PCR conditions used for the alanine substitution were as follows. After pre-denaturation of DNA at 95 ° C for 5 min, DNA denaturation at 95 ° C for 30 sec, binding of primer at 56 ° C for 30 sec, elongation at 72 ° C for 30 sec, and then 30 cycles of incubation at 72 ° C The incubation was terminated after 5 minutes of incubation.
  • the gene coding for 3B20 scFv was amplified by PCR amplification by degenerate codon NNK, independently of A, C, G, or T; As a template.
  • the first fragment was PCR amplified using forward primer (5'-CTGGCTGGTTTCGCTACCGTGGCC-3 '; SEQ ID NO: 19) and reverse primer (5'-TCTGGTGCAGTAGTAGGTGGC-3'; SEQ ID NO: 20);
  • the second fragment was designated as forward primer (5'-GCCACCACTACTGCACCAGA [GGT / GGT / GGT / GGT / AAC / ATC / GAC / GCA] TGGGGCCAC-3 ';
  • Protein bands of about 70 kDa and 260 kDa were cut out on an SDS-PAGE gel (Reference Example 5) to perform in-gel tryptic digestion [A. Shevchenko, H. Tomas, J. Havl is, J.V. Olsen, M. Mann, In-gel digestion for mass spectroscopic characterization of proteins and proteomes, Nat. Protoc. 1 (2006) 2856-2860). The cleaved protein bands were de-stained
  • the extracted peptide sample was suspended in 0.1% formic acid in water, loaded onto an EASY-Spray C18 column (75 x 50 cm x 2) and eluted with 0.1% formic acid (in) at a flow rate of 300 nL / acetonitri le).
  • MS spectra were recorded on a Q_ Exact ive hybrid quadrupole-Orbi trap mass spectrometer (Thermo Fisher Scientific) interfaced to a nano-ultra-HPLC system (Easy-nLCl000; Thermo Scientific).
  • the obtained MS / MS raw files were converted into mzXML files using the Trans-Proteomic Pipeline (version 4.4) and analyzed using the Sequest (version 27) algorithm on a SORCERER (Sage-N Research, Milpitas, .
  • the search was performed using the Intemational Protein Index human database (version 3.83, 186578 entries). Full trypsin-sensitive specificity and up to two missed cleavage sites were acceptable.
  • the mass tolerances for precursor ions and fragment ions were set to lOppm and IDa, respectively. Fixed modification for conventional carbamidomethyl-cysteine and variable modi fi cation for methionine oxidation were used.
  • Immunoprecipitation analysis was performed using a lysate of HEK293T cells transfected with a lentiviral vector encoding human ROS1 (full length) and 3B20 scFv-rFc fusion protein, with reference to Reference Example 5. Immunoprecipitated proteins were analyzed by immunoblotting using a commercially available anti-ROS1 antibody reactive to the C-terminal region of ROS1, and the results are shown in Figure Ib. . More specifically, Fig.
  • 1b shows a lysate of HEK293T cells transfected with a lentiviral vector encoding human ROSl (full-length) with 3B20 scFv-rFc fusion protein 2019/107671 1 »(: 1/10/10 Public 018/002655
  • Immunoprecipitation was performed by treating 3B20 scFv-rFc fusion protein with HEK293T cell lysate transfected with a lentiviral vector encoding human ROS1 (battlefield) or GFP (control) to examine the protein responsive to 3B20 scFv. Proteins bound to the 3B20 scFv protein were separated by SDS-PAGE. After electrophoresis, the gel was stained with Coomassie blue. Bands corresponding to 70 kDa and 260 kDa were collected from the gel and analyzed by liquid chromatography / MS. The obtained results are shown in FIG.
  • the values listed in the transfected controle / transfected ROSl column represent the number of spectral counts derived from the LC-MS / MS data.
  • the band of approximately 70 kDa is Hsp70, Hsp71 , GRP75 and GRP78. ≪ / RTI >
  • an alanine scanning mutagenesis assay was performed using a recombinant ROS1 protein corresponding to amino acid residues 37-290 of the ROS1 protein.
  • an R0S1 mutant in which the amino acid residue of any one of Gly42 to Ser54 of the recombinant ROS1 protein was substituted with alanine was prepared.
  • the microtiter plate wells were coated with 3B20 scFv-CK fusion protein, BSA or irrelevant scFv-CK fusion protein and the plate incubated with alanine substituted ROSl-hFc fusion protein or wild type ROSl-hFc fusion protein Respectively.
  • the amount of ROSl-hFc fusion protein bound to the plate was measured using HRP-conjugated anti-hFc antibody and ATBS solution. The results obtained are shown in Fig. 2A (coated with 3B20 scFv-CK fusion protein), 2b (coated with BSA), and 2c (coated with i rrelevant SCFV-CK fusion protein).
  • the 3B20 scFv-CK fusion protein showed markedly decreased reactivity with the L45A mutation, the L47A mutation, and the G48A mutation of the R0S1 protein, while the other mutants showed similar reactivity with the wild-type R0S1 protein.
  • the BSA or negative control scFv-Fc fusion protein did not react with the ROSl mutants. Based on these results, it was concluded that three residues of Leu45, Leu47 and Gly48 of ROS1 play an important role in binding properties to 3B20 scFv.
  • three residues of Leu45, Leu47 and Gly48 of ROS1 play an important role in binding properties to 3B20 scFv.
  • an H 3 R 3 site-directed mutagenesis library was constructed by the method described in Reference Example 7 to generate a monoclonal antibody clone that does not react with Hsp70 but reacts with ROS1.
  • the H3R3 region (GGGGNIDA) of 3B20 scFv is composed of 8 amino acids,
  • NNK phage display libraries were constructed using PCR primers designed to include N, N, K, N, G, and T respectively in each of the amino acid positions of H < 3 > Reference) .
  • Forty-eight clones were randomly selected from each library and phage ELISA was performed on recombinant ROS1 and GRP75.
  • a mAb clone that responds only to ROS1 in the first amino acid residue random library, but not GRP75.
  • G glycine
  • K lysine
  • 3B20-G1K scFv-CK fusion protein was prepared. ELISA, immunoblotting and immunoprecipitation analysis of the prepared fusion proteins were performed in parallel with 3B20. More specifically, microtiter plate wells were incubated with 100 ng of recombinant ROSl
  • a lysate of HEK293T cells transformed with the R0S1 (fulll eng) coding lentivirus vector (lane R) or the control vector (lane C; GFP) was applied to SDS-PAGE, transferred to nitrocellulose membranes and blocked , The membrane was incubated with 3B20, 3B20-G1K or control antibody (ab5512; Abeam) to perform immunoblotting.
  • the obtained immunoblotting results are shown in Fig. 3C. As shown in FIG.
  • Immunoprecipitation analysis was also performed as follows.
  • the HEK293T cells transformed with the R0S1 (full-length) coding lentivirus vector (lane R) or the control vector (lane C; GFP) were lysed and the 3B20 (scFv) -rFc fusion protein and 3B20 (scFv) -GlK- Incubated with protein and reacted with protein A agarose beads. After washing, the proteins bound to the beads were eluted and subjected to SDS-PAGE. Proteins bound to beads were visualized by staining with Coomassie Blue. The obtained immunoprecipitation analysis result is shown in Fig.
  • Example 9 IHC analysis of human lung cancer using B20-G1K monoclonal antibody
  • human ROS1 full-length
  • human non-neoplast ic lung tissue (benign bronchial epithelia), which were transformed with the coding lentiviral vector And alveolar pneumocytes (provided by Boramae Hospital, Seoul) were subjected to immunohistochemistry (IHC) and the results are shown in FIG.
  • ROS1 is strongly expressed in both the cytoplasmic membrane and the cytoplasm as a result of IHC on HEK293T cells transformed with a lentiviral vector encoding human ROS1 (full-length) (X400) 4
  • FIG. 4 shows the observation at x 400 in human lung cancer tissues, confirming the ROS1-positive result in the cytoplasmic membrane and the cytoplasm, and in particular, the ROS expression in the membrane was enhanced. As shown in FIG.
  • HEK293T cells transformed with the R0S1 gene used as a positive control showed strong expression of ROS1 in membrane and cytoplasm (A); Interocular Non-neoplastic lung tissue is Benign bronchial epithelia and alveolar pneum ⁇ In R0S1- negative results have appeared (B); In human lung cancer tissues, ROS expression was observed in various degrees and in 10% of cases, ROS was localized in the cytoplasmic membrane, It was also confirmed to be expressed in the cytoplasm (CF).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

ROS1에 대한 특이성이 증진된 항 R0S1 항체 및 이의 용도와 관련된 것으로, 구체적으로, 항 R0S1 항체 또는 이의 항원 결합 단편, 및 이의 암의 진단 용도가 제공된다.

Description

【명세서】
【발명의 명칭】
항- R0S1항체 및 그의 용도
【기술분야】
R0S1에 대한 특이성이 증진된 항 R0S1 항체 및 이의 용도와 관련된 것으로， 구체적으로, 항 R0S1 항체 또는 이의 항원 결합 단편, 및 이의 암의 진단용도에 관한것이다.
【배경기술】
통상적으로 단클론 항체 (hybr i d monoclonal ant ibody, mAb)는 하이브리도마 기술을 사용하여 만들어지며， 이들 단클론 항체는 공인된 세포주기탁가관에 기탁된하이브리도마세포주에 의해 특정된다.
재조합항체 기술이 개발되면서 단클론항체의 생성과동시에 이들의 서열 결정이 가능하게 되었다. 이로 인하여 돌연변이 도입에 의하여 최초 mAb 클론으로부터의 다양한 자손 항체의 개발을 가능하게 하여 보다 높은 친화성 및 보다 나은 물리 화학적 성질을 갖는 항체의 개발이 보다 용이해졌다.
그러나， mAb의 특이성이 같은방식으로강화될 수 있는지에 대해서는 거의 보고된 바가 없다. 실질적으로， 상업적으로 이용가능한 항체의 50% 이상이 불량한 특성을 갖거나 전혀 작동하지 않는다. 또한， 상업적으로 이용가능한항체들이 비특이적인표적과교차-반응성을나타낼수 있다. 한편， 본명세서에서는 orphan receptor tyros ine kinases중하나인 proto-oncogene tyros ine kinase R0S1 (R0S1)를 표적 항원으로 선택하였다. 이 단백질은 인간아교모세포종 (gl iobl astoma) 세포에서 처음분리되었다. R0S1 유전자는 인간 염색체 6q22에 위치하며 다양한 파트너와 rearrange될 수 있다. 비소세포성 폐암 (non-smal l cel l lung cancers) 및 인간 담관암종 (human chol angi ocarcinomas)을 포함하는 다양한 암에서， R0S1 단백질은 절단되고, R0S1의 30 영역이 v-ros , FIG, SLC34A2, CD74, EZR, LRIG3, 및 TPM3의 50 영역에 융합된 융합 형태로 발현된다. R0S1은 증식, 전이, 및 항-세포 사멸 (ant i-apoptot i c) 기능과 관련된 세포 신호 전달을 활성화시키는 것으로 알려져 있지만, 그 생물학적 기능은 명확히 밝혀지지 않았다.
따라서， 표적 항원과는높은친화력을나타내면서 비표적 단백질에는 친화력을 갖지 않는, 표적 항원에 대한 특이성이 강화된 R0S1에 대한 항체 및 이를이용한다양한암의 진단기술의 개발이 요구된다.
【발명의 상세한설명】
【가술적 과제】
본명세서에서, R0S1에 대한특이성을높일 수 있는 R0S1의 에피토프,
Figure imgf000004_0001
특이성이 보다증진된특징을갖는것일수 있다.
일 예는 R0S1 단백질의 N-말단부위를 특이적으로 인식하는 항- R0S1 항체 또는이의 항원 결합단편을제공한다.
R0S1단백질은 인간 R0S1（예컨대, NP_002935.2（서열번호 9） 등） 일 수 있다. R0S1 단백질의 N-말단 영역은 R0S1 단백질 （서열번호 9）의 아미노산 서열 중의 37번째부터 290번째까지의 영역 또는 이의 일부일 수 있으며， 상기 일부는, 예컨대, R0S1 단백질（서열번호 9）의 39번째부터 56번째까지의 영역， 또는 이의 일부 （예컨대， D46-L47-G48-T49 （서열번호
10）또는 L45-D46-L47-G48-T49（서열번호 11）의 아미노산）일 수 있다.
일 예에서, 상기 항- R0S1 항체 또는 이와 항원 결합 단편은 R0S1 （NP_002935.2； 서열.번호 9）의 아미노산 39-56 또는 그의 일부 （예컨대， R0S1의 D46-L47-G48-T49 （서열번호 10） 또는 L45-D46-L47-G48-T49 （서열번호 11）의 아미노산）를특이적으로인식할수 있다.
예를 들어， 항- R0S1 항체 또는 항체 유래 항원 결합 단편은 R0S1의 D46-L47-G48-T49 （서열번호 10） 또는 L45-D46-L47-G48-T49 （서열번호 11）를 포함하거나 이들 아미노산을 필수적으로 하여 이루어진 에피토프를 특이적으로인식 （및/또는결합）할수 있다.
다른 구체예에서, 본 명세서에서 제공되는 항- R0S1 항체 또는 이의 항원 결합 단편은 IDLGT（서열번호 12）로 구성된 펩타이드에 결합하지 않을 수 있다. 상기 IDLGT로구성된 펩타이드는 Heat shock protein 70 （HSP70）, HSP71, GRP75 및 GRP78 등의 HSP 계열 단백질에 존재하는 것일 수 있다. 따라서, 본 명세서에서 제공되는항- R0S1항체 또는 이의 항원 결합단편은 HSP70, HSP71, GRP75및 GRP78등의 HSP계열 단백질과 결합하지 않는 것일 수 있다.
상기 항- R0S1 항체 또는 이의 항원 결합 단편은 다음의 상보성결정영역（⑶ R）을포함하는것일수 있다: 2019/107671 1»（：1^1{2018/002655
1X^1: 5（］03¥0¥0（서열번호 1），
Figure imgf000005_0001
상기 1€ 3은서열번호 6作 附 ） 또는서열번호 13（（^ ）일 수 있으며， 특히 서열번호 6 0¾}0 犯/\）일 수 있다.
상기 항- 1¾½1 항체 또는 이의 항원 결합 단편은 다음의 가변영역을
Figure imgf000005_0002
^ 2, 및 ^抑¾3는순서대로밑줄로표시됨）.
다른 예는 상기 항-孤 항체 또는 항체 유래 항원 결합 단편을 포함하는 약학 조성물을 제공한다. 예를 들어, 상기 약학 조성물은 또는 암전단용조성물일수 있다.
다른 예는상기 항-炯射항체 또는항체유래 항원 결합단편의 암의 진단에 사용하기 위한 용도， 또는 항암제 또는 암 진단제의 제조에 사용하기 위한용도를제공한다.
다른예는,
（1） 대상으로부터 분리된 생물학적 시료에 상기 항-묘031 항체 또는 이의 항원 결합단편을접촉 （반응）시키는단계; 및
（2） 상기 단계 （1）의 반응물에서 상기 항체 또는 항원결합단편과 항원 （1於 1 단백질） 간의 항원-항체 반응 또는 항원-항체 복합체 형성을 확인하는단계
를 포함하는; 암의 진단 방법 또는 암의 진단에 정보를 제공하는 방법을제공한다.
상기 암의 진단 방법 또는 암의 진단에 정보를 제공하는 방법은, 상기 확인하는단계 （2） 이후에 ,
（3） 상기 단계 （1）의 반응물에서 항원-항체 반응이 확인되거나항원- 항체 복합체의 형성이 확인 （상기 복합체가 검출）된 경우, 상기 대상이 암에 걸리거나 암에 걸릴 위험이 있는 것으로 판단（또는 확인）하는 단계를 추가로포함할수 있다.
다른 예는 항- R0S1 항체의 R0S1에 대한 특이성을 높일 수 있는
R0S1의 에피토프를 제공한다. 상기 에피토프는 R0S1단백질의 N-말단부위 （예컨대, GenBank Access i on No. NP_002935.2 （서열번호 9）의 아미노산 서열 중의 37번째부터 290번째까지의 영역） 또는 그의 일부 （예컨대， 상기 N-말단 부위 내의 연속하는 4개 이상 또는 5개 이상 （예컨대, 4개， 5개， 6개， 7개, 8개, 9개 또는 1◦개）의 아미노산을 포함하거나 이들로 이루어진 부위）일 수 있다. 일 예에서, 상기 R0S1의 에피토프는 R0S1 단백질（서열번호 9）의 39번째부터 56번째까지의 영역, 또는 이의 일부 （예컨대, D46-L47-G48-T49 （서열번호 10） 또는 L45-D46-L47-G48-T49 （서열번호 11）의 아미노산）일 수 있다.
다른 예는
상기 R0S1의 에피토프와 후보 항체 또는 항원 결합 단편을 접촉시키는단계 ; 및
상기 R0S1의 에피토프에 결합하는 항체 또는 항원결합단편을 선별하는단계
· 를 포함하는 R0S1에 특이적으로 결합하는 항체 또는 항원결합단편을 제조하는방법을제공한다.
일 예는 중쇄 상보성결정영역 3 （HCDR3）에 점돌연변이를 도입하는 단계를포함하는, 항- R0S1항체의 특이성을 향상시키는 방법이 제공된다. 일 구체예에서, 상기 항- R0S1항체의 특이성을 향상시키는 방법은다음의 CDR을 포함하는 항체 또는 이의 항원 결합 단편의 H⑶ R3의 첫 번째 아미노산인 글리신（G）을라이신（ 으로 치환하는단계를포함할수 있다:
LCDR1： SGGSYGYG（서열번호 1）,
LCDR2： DNTNRPS（서열번호 2）, LCDR3： GSADSSSIAT（서열번호 3），
HCDR1 : GFSFSDRGMH（서열번호 4），
HCDR2 : ISGDGYITHYGAAVKG（서열번호 5）， 및
HCDR3： GGGGNIDA（서열번호 13）.
다른 예는 상기한 항 R0S1 항체의 CDR OXDR1 （서열번호 1）, LCDR2
（서열번호 2）, IXDR3 （서열번호 3）, H⑶ R1 （서열번호 4）, H⑶ R2 （서열번호 5）， 및 H⑶ R3 （서열번호 6））, 경쇄 가변영역 （서열번호 7 또는 서열번호 23）, 중쇄 가변영역 （서열번호 8또는서열번호 13）, 및 scFv（서열번호 24 또는 서열번호 26）로 이루어진 군에서 선택된 폴리펩타이드를 암호화하는 핵산분자를제공한다.
다른 예는상기 핵산분자를 포함하는 재조합 벡터를 제공한다. 일 예에서 , 상기 재조합 ·벡터는 상기 경쇄 가변영역 （서열번호 7） 및 상기 중쇄 가변영역 （서열번호 8 또는 서열번호 14）을 각각 포함하거나 함께 포함하는 것일 수 있다. 다른 예에서 상기 재조합 벡터는 상기 항- R0S1 scFv（서열번호 24또는서열번호 26）을포함하는것일 수 있다.
다른 예는상기 재조합벡터를포함하는재조합세포를제공한다. 다른 예는상기 재조합세포를 발현시키는 단계를 포함하는 항 R0S1 항체 또는이의 항원 결합단편의 제조방법을제공한다.
【기술적 해결방법】
R0S1 단백질은 ROS1 유전자에 의하여 코딩되는 proto-oncogene tyros ine kinase로서, 유전자를 재배치하여 R0S1의 C-말단 세포내 영역이 관여하는 다른 유전자들과의 융합 단백질 형성을 통하여 carc inogenes i s에 중요한 역할을 한다. 후생적 조절 （epigenet i c regul at ion）을통한야생형 R0S1 과발현 가능성이 제안되고 있다. 일 예에서, R0S1의 N-말단에 결합하는 항- R0S1 항체 （3B20）이 제공되며， 이는 암조직 （예컨대 암복수 （cancerous） 조직）에서 야생형 R0S1를 검줄하는데 사용할 수 있다. 일 실시예에서 면역블라팅 및 면역침전 등의 통상적인 분석 기술을 통하여 3B20이 heat shock proteins （예컨대， Hsp70s）과 반응할 가능성이 확인되었다. R0S1의 아미노산서열과 Hsp70s의 아미노산서열을분석하여 , 이들 서열이 아미노산 서열 을 공유함을 확인하였다. R0S1의 알라닌 치환변이 시험을 통하여, R0S1의 에피토프가 상기 서열을 포함함을 확인하였다 . 다른 실시예에서 .항- R0S 1 항체 （ 3B20）의 H⑶ R3를 구성하는 각각의 아미노산을 원래의 아미노산과 다른 아미노산으로 치환하는 무작위 돌연변이를 통하여 R0S1와 반응성 （결합력）은 유지하면서 다른 단백질 （예컨대, Hsp70s 등）과 반응하는 교차반응성은 제거된 변이체 클론 3B20- G1K를 제작하였다. 다른 실시예에서， 3B20-G1K를 사용하여 정상 조직 （예컨대， 정상 폐조직）에서는 R0S1가 관찰되지 않는 반면， 폐암 조직 （예컨대, 폐선암 （lung adenocarc inoma）을 갖는 폐조직）에서는 R0S1이 과발현되어 있음을확인하였다.
이러한사항을 기초로， 본 명세서에서는 R0S1에 대한특이성을 높일 수 있는 R0S1의 에피토프， 상기 에피토프를특이적으로 인지하는항 R0S1 항체 또는 이의 항원 결합단편, 및 상기 항체의 용도가제공된다. 상기 항 R0S1 항체 또는 이의 항원 결합 단편은 R0S1의 특정 영역을 인식함으로써， R0S1에 대한 특이성이 보다 증진된 특징을 갖는 것일 수 있다.
일 예는 R0S1 단백질의 N-말단부위를 특이적으로 인식하는 항- R0S1 항체 또는이의 항원 결합단편을제공한다.
R0S1단백질은 인간 R0S1 （예컨대， NP_002935.2（서열번호 9） 등） 일 수 있다. R0S1 단백질의 N-말단 영역은 R0S1 단백질 （서열번호 9）의 아미노산 서열 중의 37번째부터 290번째까지의 영역 또는 이의 일부일 수 있으며， 상기 일부는, 예컨대, R0S1 단백질（서열번호 9）의 39번째부터 56번째까지의 영역， 또는 이의 일부 （예컨대, D46-L47-G48-T49 （서열번호 10） 또는 L45-D46-L47-G48-T49（서열번호 11）의 아미노산）일 수 았다.
일 예에서, 상기 항- R0S1 항체 또는 이의 항원 결합 단편은 R0S1 （NP_002935.2； 서열번호 9）의 아미노산 39-56 또는 그의 일부 （예컨대, R0S1의 D46-L47-G48-T49 （서열번호 10） 또는 L45-D46-L47-G48-T49 （서열번호 11）의 아미노산）를특이적으로인식할수 있다.
예를 들어， 항- R0S1 항체 또는 항체 유래 항원 결합 단편은 R0S1의
D46-L47-G48-T49 （서열번호 10） 또는 L45-D46-L47-G48-T49 （서열번호 11）를 포함하거나 이들 아미노산을 필수적으로 하여 이루어진 에피토프를 특이적으로인식 할수 있다.
일 구체예에서, 상기 항- R0S1 항체 또는 이의 항원 결합 단편은 IDLGT（서열번호 12）로구성된 펩타이드에 결합 （및/또는 인식）하지 않을수 있다. 상기 IDLGT로 구성된 펩타이드는 Heat shock protein 70 （HSP70）， HSP71, GRP75 및 GRP78 등의 HSP 계열 단백질에 존재하는 것일 수 있다. 따라서, 본 명세서에서 제공되는항- R0S1항체 또는 이의 항원 결합단편은 2019/107671 1»（：1^1{2018/002655
此?70， 此므71, 0^75및 卵78등의此?계열 단백질과결합하지 않는 것일 수 있다.
다른 구체예에서， 상기 항-炯 항체 또는 이의 항원 결합 단편은 145-046-147-048-149 （서열번호 11） 및 1此的（서열번호 12）로 구성된 펩타이드에 결합（및/또는 인식） 가능한 것일 수 있다. 이 경우， 상기 항- 요0와 항체 또는 이의 항원 결합 단편은 炯射 및 狀 70, 此므71, 01 75 및 卵78등의 部 계열 단백질로 이루어진 군에서 선택된 1종 이상， 2종 이상, 3종 이상, 4종 이상, 또는 5종모두에 결합（및/또는 인식） 가능한 것일 수 있다.
상기 항-炯射 항체 또는 이의 항원 결합 단편은 다음의 상보성결정영역（⑶묘）을포함하는것일 수 있다:
1X^1 :
Figure imgf000009_0001
（서열번호 1）,
이썽:
Figure imgf000009_0002
（서열번호 2）,
1X^3:
Figure imgf000009_0003
（서열번호 3）,
敗에1:
Figure imgf000009_0004
（서열번호 4）,
敗예2:
Figure imgf000009_0005
（서열번호 5）, 및
1£¾ : 乂 （X는 X또는 0.
.상기
Figure imgf000009_0006
수 있으며 , 특히 서열번호 6 附 ）일 수 있다.
상기 항- 1¾｝ 항체 또는 이의 항원 결합 단편은 다음의 가변영역을 포함하는것일 수 있다:
Figure imgf000009_0007
（상기 가변영역의 아미노산서열 중， 1X^1， 1X^2， 1X^3， 敗에1 , 敗에2, 및狀0요3는순서대로밑줄로표시됨）. 일 구체예에서， 상기 항- R0S1 항체 또는 이의 항원 결합 단편은 다음과 같이 정의되는 항 R0S1 항체 또는 이의 항원 결합 단편일 수 있으며 :
(1) 다음의 상보성 결정부위 (comp lementar i ty determining regi on； CDRs)를포함하는항 R0S1항체 또는이의 항원 결합단편 :
서열번호 1 (SGGSYGYG)의 아미노산서열을포함하는 LCDR1, 서열번호 2 (DNTNRPS)의 아미노산서열을포함하는 LCDR2,
서열번호 3 (GSADSSSIAT)의 아미노산서열을포함하는 LCDR3.
서열번호 4 (GFSFSDRGMH)의 아미노산서열을포함하는 HCDR1, 서열번호 5 ( ISGDGYITHYGMVKG)의 아미노산서열을 포함하는 HCDR2 , 및
서열번호 6 (KGGGNIDA)의 아미노산서열을포함하는 HCDR3; 또는
(2) 다음의 가변영역을포함하는, 항 R0S1항체 또는이의 항원 결합 단편:
서열번호 7의 아미노산서열을포함하는경쇄 가변영역， 및
서열번호 8의 아미노산서열을포함하는중쇄 가변영역，
이 경우, 상기 항- R0S1 항체 또는 이의 항원 결합 단편은 서열번호 11 (LDLGT)에는 결합하고， 서열번호 12 (IDLGT)에는 결합하지 않는 것일 수 있으며, 아러한 특징으로 인하여 R0S1 단백질에 특이적으로 결합하는 것일 수있다.
다른 구체예에서, 상기 항- R0S1 항체 또는 이의 항원 결합 단편은 다음과 같이 정의되는 항 R0S1 항체 또는 이의 항원 결합 단편일 수 있으며 :
(1) 다음의 상보성 결정부위 (comp lementar i ty determining region； CDRs)를포함하는항 R0S1항체 또는이의 항원 결합단편:
서열번호 1 (SGGSYGYG)의 아미노산서열을포함하는 LCDR1,
서열번호 2 (DNTNRPS)의 아미노산서열을포함하는 LCDR2,
서열번호 3 (GSADSSSIAT)의 아미노산서열을포함하는 LCDR3.
서열번호 4 (GFSFSDRGMH)의 아미노산서열을포함하는 HCDR1 , 서열번호 5 ( ISGDGYITHYGMVKG)의 아미노산서열을 포함하는 HCDR2 , 및
서열번호 13 (GGGGNIDA)의 아미노산서열을포함하는 HCDR3； 또는
(2) 다음의 가변영역을포함하는, 항 R0S1항체 또는이의 항원 결합 2019/107671 1»（：1^1{2018/002655
단편:
서열번호 23의 아미노산서열을포함하는경쇄 가변영역 , 및 서열번호 14의 아미노산서열을포함하는중쇄 가변영역， 이 경우, 상기 항- 1¾ 1 항체 또는 이의 항원 결합 단편은 서열번호 5 11 （［고 江） 및 서열번호 12 （^肝）에 결합가능한 것일 수 있으며， 이러한 특징으로 인하여 요0 ， ¾?70， ¾?71， 0卵75, 및 0卵78로 이루어진 군에서 선택된 1종 이상, 2종 이상, 3종 이상, 4종 이상， 또는 5종 모두에 결합 가능한것일 수 있다.
본 명세서에 기재된 바로서, 항- 1¾） 항체의 항원 결합 단편은 10 상기한 항-요0와 항체의 6개의
Figure imgf000011_0001
포함하는 임의의 폴리펩타이드， 예를
Figure imgf000011_0002
（카파 불변영역） , 1 -（：1（람다 불변영역），
（3산 ）2， 北， 此 또는 1八北’）2일 수 있으나, 이에 한정되는것은아니다. 일 예에서, 상기 항원 결합 단편은 %1 ， 또는
Figure imgf000011_0003
면역글로불린 （예컨대, 부위와 융합된 융합
15 폴리펩타
Figure imgf000011_0004
（예컨대， 카파 또는 람다）와융합된융합폴리펩타이드（%! -（ 또는 1 -（：\）일수 있다. 상기 항-炯와 항체 또는 항체 유래 항원 결합 단편은 모031 단백질에서 030：1110용61½ 3에 중요한 역할을 하는 묘（光1 단백질의 0말단이 아닌 부위를 특이적으로 인식하고 결합할 수 있다. 따라서, 상기 20 항-묘031항체 또는항체 유래 항원 결합단편을사용하여
Figure imgf000011_0005
관여하는요에 단백질을 검출할수 있으며， 이를통하여 1¾光1의 발현（존재） 또는과발현과관련된 질병 （예컨대， 암등）의 진단에 사용할수 있다.
따라서, 본 명세서에서는 상기 항- 1¾）와 항체 또는 항체 유래 항원 결합 단편을 포함하는 약학 조성물이 제공된다. 예를 들어， 상기 약학25 조성물은암진단용조성물일 수있다.
다른예는상기 항-如와항체 또는항체 유래 항원 결합단편의 암의 진단에 사용하기 위한 용도, 또는 항암제 또는 암 진단제의 제조에 사용하기 위한용도를제공한다.
다른 예는，
30 （1） 대상（환자）으로부터 분리된 생물학적 시료에 상기 항-炯射 항체 또는 이의 항원 결합단편을접촉 （반응）시키는단계 ; 및
（2） 상기 단계 （1）의 반응물에서 상기 항체 또는 항원결합단편과 항원 （1¾炎1단백질） 간의 항원-항체 반응여부를확인하는단계 2019/107671 1»（：1^1{2018/002655
를 포함하는 암의 진단 방법 또는 암의 진단에 정보를 제공하는 방법을 제공한다. 상기 항원 항체 반응 여부를 확인하는 단계는 통상적인 방법으로 항원-항체 복합체의 형성 여부를 확인 （복합체를 검출）하는 단계에 의하여 수행될 수 있다. 상기 생물학적 시료는 대상 （예컨대， 인간 등의 포유류）으로부터 얻은 （분리된） 세포, 조직， 체액 이들의 배양물 등으로이루어진 군에서 선택된 것일수 있다.
상기 암의 진단 방법 또는 암의 진단에 정보를 제공하는 방법은， 상기 확인하는단계 （2） 이후에，
（3） 상기 단계 （1）의 반응물에서 항원-항체 반응이 확인 （예컨대， 항원-항체 복합체의 형성이 확인（복합체가검출）된 경우， 상기 대상이 암에 걸리거나 암에 걸릴 위험이 있는 것으로 판단（또는 확인）하는 단계를 추가로포함할수 있다.
다른 예는 항-敗 항체의 炯 에 대한 특이성을 높일 수 있는 敗射의 에피토프를 제공한다. 상기 에피토프는炯 단백질의 ^말단부위 （예컨대 요크:止; /\（ 633101 1）. _002935.2 （서열번호 9）의 아미노산 서열 중의 37번째부터 290번째까지의 영역） 또는 그의 일부 （예컨대， 상기 -말단 부위 내의 서열번호 10 또는서열번호 11을 포함하는 연속하는 4개 이상 또는 5개 이상의 아미노산을 포함하거나 이들로 이루어진 부위）일 수 있다. 일 예에서, 상기 潮와의 에피토프는 制 단백질（서열번호 9）의 39번째부터 56번째까지의 영역（서열번호 15）， 또는 이의 일부 （예컨대，
046-147-048-149 （서열번호 10） 또는 1名5-046斗47 48 49 （서열번호 11）의 아미노산, 또는서열번호 9내의 서열번호 10 또는서열번호 11을포함하는 연속하는 4개 이상 또는 5개 이상의 아미노산을 포함하거나 이들로 이루어진부위）일수 있다.
다른예는
상기 1¾述1의 말단 부위 （예컨대， 앞서 설명한 에피토프）와 후보 항체 또는항원 결합단편을접촉시키는단계; 및
상기 炯 의 에피토프에 결합하는 항체 또는 항원결합단편을 선별하는단계
를 포함하는如射에 특이적으로 결합하는 항체 또는 항원결합단편을 제조하는 방법을 제공한다. 일 구체예에서， 상기 에피토프가 서열번호 10 （此肝）인 경우, 상기 선별된 항체 또는 항원결합단편은 서열번호 11 （1此（江） 및 서열번호 12 （1此（汗）에 결합 가능한 것일 수 있으며, 1¾光1 , 2019/107671 1»（：1^1{2018/002655
¾?70 , ¾?71， 卵저, 및 卵78로 이루어진 군에서 선택된 1종 이상, 2종 이상, 3종 이상， 4종 이상， 또는 5종 모두에 결합 가능한 것일 수 있다. 다른 구체예에서, 상기 에피토프가 서열번호 11 （1011江）인 경우, 상기 선별된 항체 또는 항원결합단편은 서열번호 11 （1此（江）에는 결합하지만 서열번호 12 （犯 에는 결합하지 않는 것일 수 있으며, 炯射에
Figure imgf000013_0001
핵산분자를제공한다.
다른 예는상기 핵산분자를 포함하는 재조합 벡터를 제공한다. 일 예에서, 상기 재조합 벡터는 상기 경쇄 가변영역 （서열번호 7） 및 상기 중쇄 가변영역 （서열번호 8 또는 서열번호 14）을 각각 포함하거나 함께 포함하는 것일 수 있다. 다른 예에서 상기 재조합 벡터는 상기 항-炯 ｛ （서열번호 24또는서열번호 26）을포함하는 것일 수 있다.
다른예는상기 재조합벡터를포함하는재조합세포를제공한다. 다른 예는상기 재조합세포를 발현시키는 단계를 포함하는항 항체 또는이의 항원 결합단편의 제조방법을제공한다.
본 명세서에서 제공되는 항체 또는 항원결합단편의 항원으로 작용하는 요0 은 포유류 유래의 것일 수 있으며， 예컨대 인간 유래 모0射 (예컨대, GenBank accession numbers NP_002935.2 등)일 수 있다. 본 명세서에서 제공되는 항- R0S1항체는 R0S1의 N-말단 부위 (즉， 앞서 설명한 에피토프부위)를인지 및/또는결합한다.
본 명세서에서 ’’항체”라 함은， 특정 항원에 특이적으로 결합하는 단백질을 총칭하는 것으로서， 면역계 내에서 항원의 자극에 의하여 만들어지는 단백질 또는 이를 화학적 합성 또는 재조합적으로 제조한 단백질일 수 있으며， 그 종류는 특별히 제한되지 않는다. 상기 항체는 비자연적으로 생성된 것, 예컨대， 재조합적 또는 합성적으로 생성된 것일 수 있다.상기 항체는 동물 항체 (예컨대,마우스 항체 등)， 키메릭 항체， 인간화항체 또는 인간 항체일 수 있다. 상기 항체는 단클론 항체 또는 다클론항체일 수 있다.
완전한항체는 2개의 전장 (full length)경쇄 및 2개의 전장중쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 이황화 결합으로 연결되어 있다. 항체의 불변 영역은 중쇄 불변 영역과 경쇄 불변 영역으로 나뉘어지며, 중쇄 불변 영역은 감마 U)， 뮤 (U)， 알파 U)， 델타 (5) 및 엠실론 U) 타입을 가지고 , 서브클래스로 감마 l(yl), 감마 2( Y 2)， 감마 3( Y 3), 감마 4( Y 4)， 알파 1( a 1) 및 알파 2( a 2)를 가진다. 경쇄의 불변 영역은 카파 ( K)및 람다 (X)타입을가진다.
용어, "중쇄 (heavy chain)"는항원에 특아성을부여하기 위해 충분한 가변영역 서열을 갖는 아미노산 서열을 포함하는 가변영역 도메인 VH 및 3개의 불변 영역 도메인 CHI, CH2 및 CH3과 힌지 (hinge)를 포함하는 전장 중쇄 및 이의 단편을 모두 포함하는 의미로 해석된다. 또한， 용어 "경쇄 (light chain)"는 항원에 특이성을 부여하기 위한 충분한 가변영역 서열을 갖는 아미노산 서열을 포함하는 가변영역 도메인 VL 및 불변 영역 도메인 CL을 포함하는 전장 경쇄 및 이의 단편을 모두 포함하는 의미로 해석된다.
용어, "CDR(complementar ity determining region)”은 항체의 가변 부위 중에서 항원과의 결합 특이성을 부여하는 부위를 의미하는 것으로， 면역글로불린의 중쇄 및 경쇄의 고가변영역 (hypervar iable region)의 아미노산 서열을 의미한다. 중쇄 및 경쇄는 각각 3개의 CDR을 포함할 수 있다 (CDRH1， CDRH2, CDRH3및 CDRL1, ⑶ RL2, CDRL3). 상기 CDR은 항체가 항원 또는 에피토프에 결합하는 데 있어서 주요한 접촉 잔기를 제공할 수 있다. 한편， 본 명세서에 있어서, 용어, "특이적으로 결합" 또는 "특이적으로 인식”은 당업자에게 통상적으로 공지되어 있는 의미와 동일한 것으로서， 항원 및 항체가 특이적으로 상호작용하여 면역학적 반응을 하는 것을의미한다.
본 명세서에서 항체는， 특별한 언급이 없는 한, 항원 결합능을 보유하는항체의 항원결합단편을포함하는것으로이해될수 있다.
용어, 항원 결합 단편'’은 항원이 결합할 수 있는 부분 (예컨대, 본 명세서에서 정의된 6개의 ⑶ R)을 포함하는 모든 형태의 폴리펩타이드를 의미한다. 예를들어， 항체의 scFv, ( SCFV) 2 , Fab, Fab' 또는 F(ab’)2일 수 있으나, 이에 한정되지 않는다. 또한， 앞서 설명한 바와 같이， 상기 항원 결합 단편은 scFv, 또는 scFV가 면역글로불린 (예컨대, IgGl， IgG2, IgG3, IgG4 등)의 Fc 부위 또는 경쇄의 불변 영역 (예컨대， 카파 또는 람다)와 융합된융합폴리펩타이드일 수 있다.
상기 항원 결합 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변 영역 및 중쇄의 첫 번째 불변 영역 (CH1)을 가지는 구조로 1개와항원 결합부위를가진다.
Fab '는 중쇄 CHI 도메인의 C-말단에 하나 이상의 시스테인 잔기를 포함하는힌자 영역 (hinge regi on)을가진다는점에서 Fab와차이가있다.
F(ab' )2 항체는 Fab의 힌지 영역의 시스테인 잔기가 디설파이드 결합을 이루면서 생성된다. Fv는 중쇄 가변부위 및 경쇄 가변부위만을 가지고 있는 최소의 항체조각으로 Fv 단편을 생성하는 재조합 기술은 당업계에 널리 공지되어 있다.
이중쇄 Fv( two-chain Fv)는 비공유 결합으로 중쇄 가변부위와 경쇄 가변부위가 연결되어 있고 단쇄 Fv( s ingl e~chain Fv)는 일반적으로 펩타이드 링커를 통하여 중쇄의 가변영역과 단쇄의 가변영역이 공유 결합으로 연결되거나 또는 C-말단에서 바로 연결되어 있어서 이중쇄 Fv와 같이 다이머와같은구조를이룰수 있다.
상기 항원 결합 단편은 단백질 가수분해 효소를 이용해서 얻을 수 있고 (예를 들어， 전체 항체를 파파인으로 제한 절단하면 Fab를 얻을 수 있고 펩신으로 절단하면 F(ab ' )2 단편을 얻을 수 있다) , 유전자 재조합 기술을통하여 제작할수있다.
용어 "힌지 영역 (hinge regi on)"은 항체의 중쇄에 포함되어 있는 영역으로서 , CH1 및 CH2 영역 사이에 존재하며、 항체 내 항원 결합부위의 유연성 ( f l exi bi l i ty)를제공하는기능을하는영역을와미한다. 상기 항 R0S1항체는 단클론 항체일 수 있다. 단클론 항체는 당 업계에 널리 알려진 방법대로 제조될 수 있다. 예컨대, phage di sp l ay 기법을이용해서 제조될 수 있다. 또는, 항 R0S1 항체는 이용해서 통상의 방법에 의하여 마우스유래의 단클론항체로제조될 수 있다.
한편, 전형적인 ELISA (Enzyme-Li nked ImmunoSorbent Assay) 포맷을 이용하여 R0S1와의 결합능에 기초하여 개별 단클론 항체들을스크리닝할수 있다. 결합체들에 대해 분자적 상호작용을 검정하기 위한 경쟁적 EL ISA(Compet i t ive ELISA)와 같은 기능성 분석 또는 세포-기반 분석 (ce U-based assay)과 같은 기능성 분석을 통해 저해 활성에 대해 검정할 수 있다. 그런 다음 강한 저해 활성에 기초하여 선택된 단클론항체 멤버들에 대해 R0S1에 대한각각의 친화도 (Kd va lues )를검정할수 있다. 최종 선택된 항체들은 항원결합부를 제외한 나머지 부분이 인간의 면역글로블린 항체화된 항체뿐만아니라， 인간화항체로서 제조하여 사용할 수 있다. 인간화항체의 제조방법은당업계에 잘알려져 있다.
본 발명의 적용 대상 환자는 인간， 원숭이 등을 포함하는 영장류, 마우스, 래트등을포함하는설치류등을포함하는포유류일 수 있다.
상기 암은 고형암또는 혈액암일 수 있으며， 이에 제한되지 않지만， 폐암 (예컨대 소세포폐암, 비소세포폐암， 폐선암， 폐편평상피암 등) ,복막암, 피부암, 피부 또는 안구내 흑색종, 직장암, 항문부근암, 식도암， 소장암 , 내분비선암， 부갑상선암, 부신암， 연조직 육종 , 요도암， 백혈병 (예컨대, 만성 또는 급성 백혈병) , 림프종, 간세포암, 위장암, 췌장암, 교아종, 경부암, 난소암， 간암, 방광암， 간종양， 유방암， 결장암， 대장암， 자궁내막또는자궁암, 침샘암, 신장암， 간암， 전립선암, 음문암, 갑상선암， 간암， 두경부암， 뇌암, 골육종 등으로 이루어진 군에서 선택된 1종 이상일 수 있다. 상기 암은원발성 암또는전이성 암일 수 있다.
한편, 상기 항 R0S1 항체 또는 이의 항원 결합 단편은 R0S1 , 특히 R0S1의 N-말단 부위 (예컨대， 앞서 설명한 에피토프 부위)에 특이적으로 결합하므로 이를 이용하여 R0S1를 검출또는 확인할수 있다. 따라서, 본 발명의 또 다른 예는 상기 항 R0S1 항체 또는 이의 항원 결합 단편을 포함하는 R0S1의 검출용 조성물을 제공한다. 또 다른 예는 생물학적 시료에 상기 항 R0S1 항체 또는 이의 항원 결합 단편을 처리하는 단계 ; 및 항원-항체 반응 여부를 확인하는 단계를 포함하는 R0S1의 검출 방법을 제공한다. 상기 검출 방법에서, 항원-항체 반응이 확인 (항원-항체 복합체가 검출)되는 경우, 상기 생물 시료에 R0S1이 존재하는 것으로 결정 (판단)할수 있다. 따라서, 상기 검출 방법은상기 확인하는 단계 이후에, 항원-항체 반응이 탐지되는 경우， 상기 생물학적 시료에 R0S1이 존재하는 것으로 결정하는 단계를 추가로 포함할 수 있다. 상기 생물학적 시료는 포유류， 예컨대 인간 (예컨대 암환자)으로부터 얻은 (분리된) 세포， 조직， 체액, 이들의 배양물등으로 이루어진 군에서 선택된 것일 수 있다. 상기 R0S1 검출 방법에 의하여， 상기 항 R0S1 항체의 에피토프인 R0S1의 N-말단 부위뿐아니라전장 R0S1도검출가능하다.
상기 진단 방법 또는 R0S1의 검출 방법에서 , 항원-항체 반응 여부를 확인하는 단계는 당업계에 공지된 다양한 방법을 통하여 수행할 수 있다. 예컨대， 통상적인 효소 반응, 형광, 발광 및/또는 방사선 검출을 통하여 하여 측정될 수 있으며, 구체적으로， 면역크로마토그래피 (Immunochromatography) ,
면역조직화학염색 Clmmunohi stochemi stry) , 효소결합 면역톱착 분석 (enzyme l inked immunosorbent assay: ELISA) , 방사선 면역즉정법 (radi oimmunoassay: RIA) , 효소 면역분석 (enzyme immunoassay: EIA) , 형광면역분석 (Florescence immunoassay: FIA) , 발광면역분석 ( l uminescence immunoassay: LIA) , 웨스턴블라팅 (Western blot t ing) , 마이크로어레이 등으로 이루어진 군으로부터 선택된 방법에 의하여 측정될수 있으나, 이에 제한되는것은아니다.
다른 예에서， 앞서 설명한 항 R0S1 항체의 중쇄 상보성 결정 부위， 경쇄 상보성 결정 부위， 또는 이들의 조합; 또는 중쇄 가변영역 , 경쇄 가변영역, 또는 이들의 조합을 포함하는 폴리펩타이드 분자가 제공된다. 상기 폴리펩타이드 분자는 항체의 전구체로서 항체 제작에 사용될 수 있을 뿐 아니라 항체와 유사한 구조를 갖는 단백질 골격체 (protein scaf fo ld； 예컨대 펩티바디)， 이중 특이 항체, 다중 특이 항체의 구성 성분으로 포함될수 있다.
다른 예는 항 R0S1 항체의 중쇄 상보성 결정 부위, 중쇄 가변영역 또는중쇄를암호화하는핵산분자를제공한다.
다른 예는 항 R0S1 항체의 경쇄 상보성 결정 부위 , 경쇄 가변영역 또는경쇄를암호화하는핵산분자를제공한다.
다른 예는 상기 항 R0S1 항체의 중쇄 상보성 결정 부위， 중쇄 가변영역 또는 중쇄를 암호화하는 핵산 분자 및 항 R0S1 항체의 경쇄 상보성 결정 부위 , 경쇄 가변영역 또는 경쇄를 암호화하는 핵산 분자를 하나의 벡터 함께 포함하거나 각각 별개의 벡터에 포함하는 재조합 벡터를 제공한다.
다른 예는상기 재조합벡터를포함하는재조합세포를제공한다. 용어 "벡터 (vector)"는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단을 의미한다. 예를 들어, 플라스미드 벡터, 코즈미드 벡터 및 박테리오파아지 벡터, 렌티바이러스 벡터， 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터와 같은 바이러스 벡터를 포함한다. 상기 재조합 벡터로 사용될 수 있는 벡터는 당업계에서 종종사용되는 플라스미드 (예를들면， pSClOl, pGV1106, pACYC177, ColEl, PKT230, pME290, pBR322, pUC8/9 , pUC6, pBD9, pHC79 , pIJ61, pLAFRl , pHV14, pGEX시리즈, pET시리즈 및 pUC19등) , 파지 (예를들면, A gt4X B, X -Charon, 入 A zl 및 M13 등) 또는 바이러스 (예를 들명， SV40 등)를 조작하여 제작될수있다.
상기 재조합 벡터에서 상기 핵산 분자는 프로모터에 작동적으로 연결될 수 있다. 용어 "작동 가능하게 연결된 (operat ively l inked) "은 뉴클레오타이드 발현 조절 서열 (예를 들어， 프로모터 서열)과 다른 뉴클레오타이드서열 사이의 기능적인 결합을 의미한다. 상기 조절 서열은 "작동 가능하게 연결 (operat ively l inked)”됨으로써 다른 뉴클레오타이드 서열의 전사및/또는해독을조절할수 있다.
상기 재조합 벡터는, 전형적으로 클로닝을 위한 벡터 또는 발현을 위한쌕터로서 구축될 수 있다. 상기 발현용 벡터는 당업계에서 식물， 동물 또는 미생물에서 외래의 단백질을 발현하는 데 사용되는 통상의 것을 사용할 수 있다. 상기 재조합 벡터는 당업계에 공지된 다양한 방법을 통해 구축될수있다.
상기 재조합벡터는원핵세포또는진핵 세포를숙주로하여 구축될 수 있다. 예를 들어, 사용되는 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를진행시킬 수 있는강력한프로모터 (예를들어, pLA 프로모터, CMV 프로모터, trp 프로모터, lac 프로모터， tac 프로모터， T7 프로모터 등)， 해독의 개시를 위한 라이보좀 결합자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵 세포를 숙주로 하는 경우에는, 벡터에 포함되는 진핵 세포에서 작동하는 복제원점은 f l 복제원점， SV40 복제원점， pMBl복제원점, 아데노복제원점， AAV복제원점 및 BBV복제원점 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터 （예를 들어， 메탈로티오닌 프로모터） 또는 포유동물 바이러스로부터 유래된 프로모터 （예를 들어, 아데노바이러스 후기 프로모터， 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스프로모터 및 HSV의 프로모터）가 이용될 수 있으며， 전사종결서열로서 폴리아데닐화서열을일반적으로갖는다.
다른 예는상기 재조합벡터를포함하는재조합세포를제공한다. 상기 재조합 세포는 상기 재조합 벡터를 적절한 숙주 세포에 도입시킴으로써 얻어진 것일 수 있다. 상기 숙주세포는 상기 재조합 벡터를 안정되면서 연속적으로 클로닝 또는 발현시킬 수 있는 세포로서 당업계에 공지된 어떠한 숙주 세포도 이용할 수 있으며, 원핵 세포로는, 예를들어 , E. coli JM109, E. coli BL21 , E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 그리고 살모넬라 티피무리움， 세라티아 마르세슨스 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있으며， 진핵 세포에 형질 전환시키는 경우에는 숙주 세포로서, 호ᅳ:S人Saccharomyce cerevisiae） , 곤중세포， 식물세포 및 동물세포， 예를 들어， HEK293T , Sp2/0, CHOCChinese hamster ovary） K1 , CHO DG44, PER.C6, W138, BHK, COS-7, 293， HepG2, Huh7, 3T3, RIN, MDCK세포주등이 이용될 수 있으나, 이에 제한되는것은아니다.
상기 핵산분자또는 이를포함하는재조합벡터의 숙주세포내로의 운반（도입）은， 당업계에 널리 알려진 운반 방법을 사용할 수 있다. 상기 운반 방법은 예를 들어， 숙주 세포가 원핵 세포인 경우, CaCl2 방법 또는 전기 천공 방법 등을사용할수 있고， 숙주 세포가 진핵 세포인 경우에는， 미세 주입법， 칼슘 포스페이트 침전법, 전기 천공법, 리포좀-매개 형질감염법 및 유전자밤바드먼트등을사용할수 있으나, 이에 한정하지는 않는다.
상기 형질 전환된 숙주 세포를 선별하는 방법은 선택 표지에 의해 발현되는 표현형을 이용하여， 당업계에 널리 알려진 방법에 따라 용이하게 실시할수 있다. 예를 들어， 상기 선택 표지가특정 항생제 내성 유전자인 경우에는, 상기 항생제가 함유된 배지에서 형질전환체를 배양함으로써 형질전환체를용이하게 선별할수 있다.
다른 예는 상기 핵산 분자 또는 이를 포함하는 재조합 벡터를 숙주 세포에서 발현시키는 단계를 포함하는 항 R0S1 항체의 제조 방법을 제공한다. 상기 제조 방법은 상기 재조합 벡터를 포함하는 재조합 세포를 배양하는 단계， 및 임의로 배양 배지로부터 항체를 분리 및/또는 정제하는 단계를포함하는것일 수 있다.
본 명세서에서, R0S1의 N-말단 영역에 반응하는 항 rROSl 항체 또는 이의 항원결합단편이 제공되며， 이들의 에피토프가 R0S1 （NPJ302935.2; 서열번호 9）의 D46-L47-G48-T49주위에 존재함을 확인하였다. 또한 R0S1의 D46-L47-G48-T49에 결합하는 항체가 동일한 DLGT 서열을 가진 Hsp70s와 교차반응을 보일 수 있음을 확인하여， 이들 항체의 HCDR3에 존재하는 i diotopes의 잔기에 돌연변이 （예컨대, 아미노산 치환）을 도입하여 항체의 특이성을 보다 높일 수 있음을 확인하였으며, Hsp70의 IDLGT 서열로부터 R0S1의 LDLGT서열을정확하게 구별하는항체를제공한다.
【발명의 효과】
본 명세서는 R0S1 N 말단 부위에 특이적으로 결합하는 항- R0S1 항체를 제공함으로써， R0S1 （N 말단 또는 전장）의 검출을 보다 정확하고 효율적으로 할 수 있도록 하며, R0S1의 생물학적 기능의 연구 및 R0S1와 관련된 질병의 진단에 유용하게 사용될수 있다.
【도면의 간단한설명】
도 la는 R0S1에 결합된 3B20 scFv-rFc 융합 단백질 양을 보여주는 그래프이다.
도 lb는 인간 R0S1 （ful l-l ength）을 코딩하는 렌티바이러스 벡터로 형질 감염된 HEK293T 세포와 용해물을 3B20 scFv-rFc 융합 단백질을 처리하여 면역침전시키고， 이를면역블로팅으로확인한결과이다.
도 lc는 GFP （대조; C） 또는 R0S1 （R）을 코딩하는 렌티바이러스 벡터로 형질전환된 HEK293T 세포의 용해물에 3B20 항체를 처리하여 면역침전하고분리된단백질분획을 MS분석한결과를보여준다.
도 2a 내지 2c는 인간 R0S1 단백질의 Gly42 내지 Ser54 부위에서의 알라닌 치환 돌연변이 유발에 의한 3B20 에피토프의 동정 결과를 보여주는 것으로, 2a는 3B20 scFv-C K 융합 단백질, 2b는 BSA, 2c는 i rrel evant scFv-C K 융합 단백질의 알라닌 치환 돌연변이체에 대한 반응성을 각각 보여준다.
도 3a 및 3b는 3B20 및 3B20-G1K의 재조합 R0S1 （아미노산 37-290）- C K 융합 단백질에 대한 반응 특이성을 ELISA로 측정한 결과로서， 3a는 3B20의 결과이고, 3b는 3B20-G1K의 결과이다.
도 3c는 R0S1 코딩하는 렌티바이러스 벡터 (레인 R) 또는 대조군 벡터 (레인 C； GFP)로 형질전환된 HEK293T세포의 용해물에 3B20, 3B20-G1K, 또는 R0S1 항체 (Abeam사 제품번호 ab5512)를 각각 처리하여 얻어진 면역블라팅 결과를보여준다.
도 3d는 R0S1 코딩하는 렌티바이러스 벡터 (레인 R) 또는 대조군 벡터 (레인 C； GFP)로 형질전환된 HEK293T세포의 용해물을 3B20또는 3B20- G1K로면역침전시킨 결과를보여주는결과이다.
도 4는 3B20-G1K를이용한면역조직화학염색 (IHC) 결과이다.
【발명을실시하기 위한구체적인 내용】
이하에서는 실시예를 들어 본 발명을 더욱 구체적으로 설명하고자 하나, 이는 예시적인 것에 불과할 뿐 본 발명의 범위를 제한하고자 함이 아니다. 아래 기재된 실시예들은 발명의 본질적인 요지를 벗어나지 않는 범위에사변형될수 있음은당업자들에게 있어 자명하다. 참고예 1. 항- R0S1 scFv항체의 제조
keyhole limpet hemocyanin (Peptron； Daejun, S. Korea)에 접합된 합성 펩타이드 (TNLGQQLDLGTPHNL況 PGGGC (서열번호 16)； R0S1 (GenBank Accession No. NPJ302935.2)의 39번째부터 56번째까거의 아미노산 부위가
’’GGGC"와 결합된 융합 펩타이드)로 3마리의 흰색 레그혼 (White Leghorn) 닭을 면역화시키고 3회 추가접종 (boost)하였다. 닭 단쇄가변단편 (single - chain variable fragment； scFv) 항체 라이브러리를 디스플레이하는 파지를 구축하였다 [C.F. Barbas , Phage Display: a Laboratory Manual , Cold Spring Harbor Laboratory Press , Cold Spring Harbor , NY, 2001 참조]. 소혈청알부민 (BSA) 또는 난백알부민 (ovalbumin; OVA)에 접합된 상기 R0S1 합성 펩타이드 (TNLGQQLDLGTPHNL況 PGGGC)에 대하여 바이오패닝 (biopanning)을 5회 수행한 푸, 상기 scFv-디스플레이 파지에 대하여 ELISA( enzyme- 1 inked immunosorbent assay)를 수행하였다 [C.F. Barbas , Phage Display： a Laboratory Manual , Cold Spring Harbor
Laboratory Press, Cold Spring Harbor , NY, 2001； S. Park, D.H. Lee , J.G. Park, Y.T. Lee , J . Chung , A sensitive enzyme immunoassay for measuring cot inine in passive smokers , Clin. Chim. Acta 411 (2010) 1238-1242 2019/107671 1»（：1/10公018/002655
참조 ] .
Figure imgf000022_0001
16）에 결합하는 ：3산 를 선별하여 3820으로 명명하였다. 3요20의
Figure imgf000022_0002
및 가변영역의 아미노산서열을다음의 표 1에 정리하였다:
[표 1]
Figure imgf000022_0003
선별된 scFv（3B20）를 코딩하는 유전자를 변형된 pCEP4 mammalian expression vectors （V04450； Thermo Fisher Scientific, Rockford, IL, USA）에 서브클로닝하여, 상기 scFv가 토끼 항체 단편 결정화가능영역 Fc(rFc)와 융합된 융합 단백질 (scFv(3B20)-rFc 융합 단백질) [H. Kim, S. Park, H.K. Lee, J . Chung , Application of bispecific antibody against antigen and hapten for immunodetection and immunopur ificat ion, Exp. Mol . Med. 45 (2013) e43. 참조] 또는 상기 ScFv가 인간 카파 경쇄 불변 영역 (CK)과융합된 융합단백질 (scFv- C K 융합단백질) [Y. Lee, H. Kim, J . Chung , An ant i body reactive to the Gly63_Lys68 epitope of NT-proBNP exhibits 0-glycosyl at ion - independent binding, Exp . Mol . Med. 46 (2014) ell4참조]을 발현시켰다. 상기 얻어진 재조합단백질들을 정제하였다 [0.
Boussif, F. Lezoualc'h, M. A. Zanta, M.D. Mergny , D. Scherman, B. Demeneix , J.P. Behr , A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine, Proc . Natl . Acad. Sci. U. S. A. 92 (1995) 7297-7301참조] . 참고예 2. ELISA
다음문헌을 참조하여 ELISA분석을 수행하였다: [H. Kim, S. Park,
H.K. Lee, J . Chung, Application of bispecific antibody against antigen and hapten for immunodetection and immunopur ificat ion, Exp. Mol . Med. 45 (2013) e43] .
마이크로타이터 플레이트 (Costar, Cambridge, MA, USA)를 100 의 재조합 R0S1 (37-290 아미노산)- CK 융합 단백질， irrelevant protein (재조합 PSA (prostate cancer spec i f i c antigen; NP_001025218.1) )-C K 융합 단백질, 합성 펩타이드 (TNLGQQLDLGTPHNL況 PGGG -BSA 접합체， 또는 GRP75 (Enzo Life Sciences , Farmingdale , NY, USA)를 코팅 완중액 (0.1 M sodium bicarbonate , pH 8.6)에 용해시킨 코팅용액으로 코팅하였다. 블로킹 후, 3B20-rFc또는 3B20-G1K (3B20의 HCDR3의 첫 번째 아미노산 G가 K로 치환)- rFc 융합 단백질을 첨가하였다. 결합 된 항체의 양은 horseradish peroxidase (HRP)-접합된 염소 항-토끼 IgG 항체 (Abeam, Cambridge Science Park, Cambridge, UK) 및 2,20 - azinobis [3- ethylbenzothiazol ine-6-sul fonic acid]기 li ammonium salt (ABTS) 기질 용액 (Amresco LLC, Solon, OH, USA)을사용하여 상기 플레이트에 결합된 항체의 양을측정하였다. 모든실험은 3번씩 수행하였다.
3B20 scFv의 alanine scanning mutagenesis를 위하여， 마이크로타이터 플레이트 (Corning Costar)를 3B20 scFv-C K 융합 단백질 100 ng, 소혈청알부민 100 ng, 또는 irrelevant SCFV-CK 100 ng으로 4°C에서 밤새 코팅하였다. 블로킹 후, 상기 플레이트를 알라닌 치환 R0S1- 인간 항체 Fc (hFc) 융합 단백질 (R0S1의 42번째 아미노산 잔기 (이 부터 54번째 아미노산잔기 (Ser)가각각 알라닌으로 치환됨) 또는야생형 R0S1- hFc 융합 단백질과 함께 인큐베이션시켰다. 상기 플레이트에 결합된 융합 단백질의 양을 HRP-결합 토끼 항-인간 IgG Fc 항체 (Thermo Fisher
Scientific)를사용하여 측정하였다. 참고예 3. 형질도입 및 R0S1-발현세포주의 확립
pLent i 6-human R0S1-DEST구조체를제작하기 위하여， Gateway재조합 쿨로닝 기술 및 Gateway LR Clonase™ (Thermo Fisher Scientific)를 이용하여 제조자설명에 따라서， pENTR223.1-human R0S1 (Open Biosystems , Huntsville, AL, USA)을 pLent i6/V5-DEST(Thermo Fisher Scientific,
Waltham, MA， USA) 렌티바이러스 벡터에 도입시켰다. 음성 대조군 바이러스를 제조하기 위하여， 녹색형광단백질 (GFP)을 동일한 렌티바이러스 벡터에 클로닝하였다.
그 후, 다음 문헌을 참조하여 렌티바이러스를 생산하였다: [J. Yin, G. Park， T.H. Kim, J.H. Hong, Y.J. Kim, X. J in, S. Kang, J.E. Jung,
J.Y Kim , H. Yun, J.E. Lee , M. Kim, J. Chung H. Kim, I. Nakano , H.S. Gwak, H. Yoo, B.C. Yoo, J.H. Kim, E.M. Hur, J. Lee, S.H. Lee, M.J.
Park, J.B. Park, Correction: pigment epithelium-derived factor (PEDF) expression induced by EGFRvI 11 promotes self-renewal and tumor progression of glioma stem cells, PLoS Biol . 14 (2016) el002367] .
6 g/mL polybrene의 존재하에서, HEK293T 세포 (American Type Culture Collection, Manassas , VA USA)에 상기 준비된 pLent i 6-human
R0S1-DEST또는 GFP 렌티바이러스를 형질감염시켰다 described [J. Yin, G. Park, J.E. Lee, J.Y. Park, T.H. Kim, Y.J. Kim, S.H. Lee, H. Yoo, J.H. Kim, J.B. Park, CPEB1 modulates differentiation of glioma stem cel Is via down-regulation of HES1 and SIRT1 expression, Oncotarget 5 (2014) 6756ᅳ 6769] . 성가 형질감염된 세포를 10%(v/v) heat-inactivated fetal bovine serum (GIBC0, Grand Island, NY, USA) , lOOU/mL penicillin， 100 mg/mL streptomycin, 및 2 mM L-glut amine (GIBC0) 보중된 Dulbecco ' s modified Eagle ' s medium (DMEM； Wei gene, Seoul , S. Korea)에서 37 °C 및 2019/107671 1»(：1/10公018/002655
습윤 5%（：¾의 조건에서 배양하였다. 참고예 4. 면역블라팅 (Immunoblott ing)
다음 문헌을 참조하여 면역블라팅 분석을 수행하였다: [H. Kim, S.
5 Park, H.K. Lee, J. Chung , Application of bispecific antibody against antigen and hapten for immunodetection and immunopur ificat ion, Exp. Mol . Med. 45 (2013) e43] .
4-12%(w/v) Bis-Tr is sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; Thermo Fisher Scient ific)을 사용하여 세포 10 용해물을 분리하고， 니트로셀룰로오스 멤브레인 (Whatman, Maidstone， Kent , UK)으로 옮겼다 블로킹 후， 상기 멤브레인에 프로브로서 다음 물질들을 고정화시켰다: 3B20 scFv-rFc융합단백질 (200 ng/mL)， 3B20-G1K scFv-rFc 융합 단백질 (1/zg/mL)， 항- R0S1 항체 (ab5512； Abeam, 69D6； Cel 1 Signal ing Technology, Danvers , MA, USA) 또는 항-튜불린 항체 (Santa15 Cruz， Dallas, TX, USA). 세척 후， HRP-접합된 항-토끼 IgG항체 (Abeam) 또는 HRP-결합된 항-마우스 IgG항체 (Pierce Chemical Co . , Rockford， IL， USA)와 함께 배양하였다. 면역블로팅 결과는 enhanced chemi luminescence system (Thermo Fisher Scientific)을사용하여 시각화하였다.
20 참고예 5. 면역침전 (Immunoprecipitation)
다음 문헌을 참조하여 면역침전을 수행하였다: [H. Km, S. Park， H.K. Lee, J. Chung , Application of bispecific antibody against antigen and hapten for immunodetection and immunopur ificat ion, Exp. Mol . Med. 45 (2013) e43].
25 R0S1 또는 GFP를 과발현하는 HEK293T 세포주를 ImM phenylmethane sul fonyl fluoride (Merck KGaA, Darmstadt , Germany) protease inhibitor cocktail (Roche) , 및 phosphatase inhibitor cocktail (Roche)을포함하는 cold lysis buffer [1% Triton X-100, 150 mM NaCl , 50 mM Tr is (pH 80)]에서 용해시켰다. 상기 얻어진 세포 용해물을 rFc 융합 단백질 30 (5 g/mL)과 융합된 3B20 scFv 또는 3B20 scFv-GIK, 및 protein A- conj ugated agarose bead (Repl iGen, Waltham, MA, USA)와 함께 배양하였다. 세척 후， NuPAGE LDS Sample Buffer (Thermo Fisher Scient ific)에서 끓여서 비드에 결합된 단백질을 용출시키고， SDS-PAGE와 면역블로팅 (참고예 4 참조)을 수행하였다. 況 S-PAGE로 분리된 용출 단백질을 Coomassie
Brilliant Blue R250 (Merck)으로 염색하여 시각화하였다. SDS-PAGE 겔에서 약 70kDa 및 260kDa에 해당하는 단백질 밴드를 취하고, MS (Mass spectrometry) 분석을수행하였다 (참고예 9참조). 참고예 6. 알라닌-치환단백질 제조
3B20 scFv의 에피토프 맵핑을 위하여， 알라닌 스캐닝 돌연변이유발 분석 (a.lanine scanning mutagenesis assay)을 수행하였다. R0SKR0S1의 37번째부터 290번째까지의 아미노산)을 코딩하는 유전자를 주형으로 사용하고, PCR 증폭에 의하여 R0S1의 42번째 (Gly)부터 54번째 (Ser)까지의 아미노산 잔기 중 하나가 알라닌으로 치환된 아미노산 서열을 코딩하는 유전자를 준비하였다. 상기 PCR은 [Y. Lee, H. Kim, J. Chung, An antibody reactive to the Gly63-Lys68 epitope of NT - proBNP exhibits 0- glycosyl at ion- independent binding, Exp. Mol . Med. 46 (2014) ell4]를 참조하여 수행하였으며, 알라닌 치환에 사용된 프라이머와 PCR 조건은 다음과 같다. 먼저, 95 °C에서 5 분 DNA의 예비 변성 후， 95 t에서 30 초의 DNA변성, 56 °C에서 30초의 primer의 결합, 72 °C에서 30초의 신장 과정을 30사이클수행 후, 72 °C에서 5분간인큐베이션후종료하였다.
프라이머
Forward primer (5' 3’):
GGCCCAGGCGGCCTGTGTAACTAATCTG[GGC/CAG/CAG/CTT/GAC/CTT/GGC/ACA/CCA/CAT/A AT/CTG/AGTJGAACCGTGT (서열번호 17);
reverse primer (5' 3' )： GGCCGGCCTGGCCTTCCTCTTGTTGAACTGCTGA (서열번호 18)
(상기 Forward primer에 있어서， 괄호 안의 각각의 코돈 중 알라닌으로 치환되는 아미노산 잔기의 코돈은 알라닌을 코딩하는 코돈인 GCC로치환됨).
얻어진 PCR 산물을 정제하고， 변형된 pCEP4 mammalian expression vectors (V04450； Thermo Fisher Scientific)에 Sfi I (11288024001； Sigma-Aldr ich) 제한효소를 사용하여 서브클로닝하여 hFc [S. Park, D.H. Lee , J.G. Park, Y.T. Lee , J . Chung , A sensitive enzyme immunoassay for measuring cot inine in passive smokers , Clin. Chim. Acta 411 (2010) 1238-1242]와의 융합단백질 형태로발현시키고정제하였다. 참고예 7. 3B20 scFv의 site-directed HCDR3 돌연변이유발 라이브러리
HCDR3에서의 site-directed mutagenesis library를 생성하기 위하여， 3B20 scFv를 코딩하는 유전자를 PCR 증폭에 의하여 degenerate codon NNK 어는 각각 독립적으로 A, C, G, 또는 T； 는 G 또는 를 사용하여 라이브러리를 구축하기 위한 주형으로 사용하였다. 첫 번째 단편을 forward primer ( 5 ' -CTGGCTGGTTTCGCTACCGTGGCC-3’ ; 서열번호 19) 및 reverse primer ( 5’ - TCTGGTGCAGTAGTAGGTGGC-3’ ; 서열번호 20)를 사용하여 PCR 증폭시키고; 두 번째 단편을 forward primer (5'- GCCACCACTACTGCACCAGA [ GGT/GGT/GGT/GGT/AAC/ATC/GAC/GCA ] TGGGGCCAC-3’ ;
서열번호 21) 및 reverse primer ( 5， -CGGGTATGCGCCATGGTGATGGTG-31 ; 서열번호 22)를 사용하여 PCR 증폭시켰다 (참고예 6 참조). 위 실험에 사용된 PCR 조건은 다음과 같다. 95 °C에서 5 분 DNA의 예비 변성 후， 95 °C에서 30 초의 DNA 변성, 56 t에서 30 초 primer의 결합, 72 °C에서
30초의 신장 과정을 30사이클 수행 후, 72 °C에서 5분간 인큐베이션 후 종료되었다.
상기 두 번째 단편의 forward primer 서열 중 괄호안의 각 코돈은 ■로 치환하였다. 그 후， 얻어진 PCR 단편들을 정제하고 overlap extension PCR을 수행하였다. Overlap extension PCR은 각각의 100 ng 의 PCR 단편을 사용하여 , 95 °C에서 5 분■요의 예비 변성 후, 95 °C에서 30 초의 DNA 변성， 56 °C에서 30 초 primer의 결합， 72 °C에서 90 초의 신장 과정을 25 사이클 수행 후, 72 °C에서 5 분간 인큐베이션 과정 후 종료하였다. 얻어진 overlap extension PCR 산물을 정제하고, pComb3XSS phagemid vector [C.F. Barbas, Phage Display： a Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor , NY, 2001 참조] 에 Sfi I 제한효소를 사용하여 서브클로닝하고， Escherichia co//에 형질전환시켰다 [C.F. Barbas , Phage Display： a Laboratory Manual , Cold Spring Harbor Laboratory Press , Cold Spring Harbor , NY, 2001 참조]. output titer plate 로부터， 무작위로 선택된 콜로니에서 파지 (phage)를 구조 (rescue)하고, ELISA를 수행하였다 [C.F. Barbas, Phage Display： a Laboratory Manual, Cold Spring Harbor Laboratory Press , Cold Spring Harbor , NY, 2001참조]. 참고예 8. 면역조직화학법 (Immunohistochemistry; IHC)
대표적인 파라핀 왁스 블록을 4mm 두께로 절단하고, 자동화된 면역염색기 (Vent ana BenchMark XT, Tuscan, AZ, USA)를 사용하여 IHC를 수행하였다. Vent ana CC1 mild reagent로 열-유도 에피토프 회복을 적용하고, 3% ¾02를사용하여 10분 동안 내재적 퍼옥시다아제 (endogenous peroxidase)를 블로킹하였다. 슬라이드를 3B20_GlK_rFc 융합 단백질 (300 Z/g/in모 stock； 1:100 희석)과 함께 1 시간 동안 인큐베이션 하였다. di ami nobenzidine tetrachloride를사용하여 시각화하였다. 참고예 9. Mass spectrometry (MS) analysis
SDS-PAGE 젤 (참고예 5)에서 약 70 kDa 및 260 kDa의 단백질 밴드를 잘라내어 in-gel tryptic digestion을 수행하였다 [A. Shevchenko , H. Tomas , J . Havl is, J.V. Olsen, M. Mann, In-gel digestion for mass spectroraetr ic characterization of proteins and proteomes , Nat . Protoc . 1 (2006) 2856-2860 참조]. 잘라낸 단백질 밴드를 탈염색시키고
(destained) , 20mM dithiothreitol로 환원시킨 후， 55mM iodoacetamide로 알킬화시켰다. acetonitrile (ACN)로 탈수시킨 후， 단백질을 12.5 ng/M 변형 트립신 (Promega, Madison, WI， USA) (in 50mM ammonium bicarbonate)으로 37 °C에서 밤새 반응시켜 분해시켰다. 50%(v/v) ACN (in 0.1%(v/v) 포름산 (FA))를 사용하여 젤 슬라이스로부터 펩타이드를 추출하였다. 얻어진 용출물을 Centrivap concentrator (Labconco, Kansas City, M0, USA)에서 건조시켰다. 추출된 펩타이드 시료를 물에 0.1 % 포름산 (in water)에 현탁시키고， EASY-Spray C18 컬럼 (75_ x 50cm x 2_) 상에 로딩시키고, 65분동안 300 nL/min의 유속에서 0.1% 포름산 (in acetonitri le)의 2-35% 구배로 분리하였다. MS 스펙트럼은 nano-ultra- HPLC system (Easy-nLCl000； Thermo Scient i f i c)으로 인터페이스된 Q_ Exact ive hybrid quadrupole-Orbi trap mass spectrometer (Thermo Fisher Scientific)에 기록하였다. 얻어진 MS/MS raw 파일은 Trans-Proteomic Pipeline (version 4.4)을 사용하여 mzXML 파일로 변환시키고, SORCERER (Sage-N Research, Milpitas， CA, USA) platform에서 Sequest (version 27) algorithm을 사용하여 분석하였다. Intemational Protein Index human database (version 3.83， 186578 entries)를 사용하여 검색을 수행하였다. Full trypsin-sensitive specificity및 2개까지의 오류 절단부위 (missed cleavage sites)가 허용 가능하였다. precursor ions 및 fragment ions에 대한 질량 허용 오차 (Mass tolerances)는 각각 lOppm 및 IDa으로 설정하였다. 통상적인 carbamidomethyl-cysteine을 위한 fixed modification 및 메티오닌 산화를 위한 variable modi f i cat ions이 사용되었다. Scaffold (version 4.3.2； Proteome Software , Portland, OR, USA)를사용하여, 99%이상의 ProteinProphet probability (with a minimum of three peptides)를 갖고， 95% 이상의 Pept i deProphet probability를 갖는모든단백질을확인하였다. 대한 3B20항체의 반응성 및 질량분석 (MS)
Figure imgf000029_0001
complexity로 R0S1 합성 펩타이드
(TNLGQQLDLGTPHNLSEPGGGC , amino acids 39-56 of R0S1)에 대하여 면역화된 닭을 사용하여 scFv 라이브러리의 파지 디스플레이를 생성하였다. 바이오패닝을 통해, 상기 라이브러리 중에서, 재조합 N-말단 R0S1 (amino acids 37-290 )-CK 융합 단백질 및 R0S1합성 펩타이드 모두에 반응성을 보이는 클론인 3B20을 선택하였다. 재조합 3B20 scFv-rFc 융합 단백질을 제조하고,재조합 R0S1단백질에 대한반응성을 ELISA로평가하였다.
보다 구체적으로， 96-well microtiter 플레이트를 ·재조합 R0S1 (37번째부터 290번째까지의 아미노산 부위)와 카파불변영역 (CK)의 융합 단백질 또는소혈청알부민 (BSA)에 접합된 R0S1의 39번째부터 56번째까지의 아미노산에 해당하는 합성 펩타이드로 각각 코팅하고, BSA로 블로킹 후, 3B20 scFv-rFc융합단백질을 첨가하고， R0S1에 결합된 3B20 scFv-rFc융합 단백질 양을 HRP-접합된 항-토끼 IgG 항체 및 ABTS 용액을 사용하여 측정함으로써， 3B20 scFv-rFc 융합 단백질의 반응성을 평가하였다. 상기 얻어진 결과를도 la에 나타내었다.
면역침전 분석은 참고예 5를 참조하여, 인간 R0S1 (전장) 및 3B20 scFv-rFc융합단백질을코딩하는 렌티바이러스 벡터로 형질감염된 HEK293T 세포의 용해물을 사용하여 수행하였다. 면역침전된 단백질은 R0S1의 C- 말단 부위에 반응성을 갖는 시판되는 항- R0S1 항체를 사용하여 면역블로팅으로 분석하였으며, 그 결과를 도 lb에 나타내었다. .보다 구체적으로, 도 lb는 인간 R0S1 (full-length)을 코딩하는 렌티바이러스 벡터로 형질감염된 HEK293T 세포의 용해물을 3B20 scFv-rFc 융합 단백질을 2019/107671 1»(：1/10公018/002655
처리하거나 （레인 1） 처리하지 않고 （레인 2） 면역침전（ immunoprec ipi t at i on）시키고 （참고예 5 참조）， 이를 항- R0S1항체 （69D6； Ce l l Signa l ing Techno l ogy）를 사용하는 면역블로팅으로 확인한 결과이다. 도 lb에 나타난 바와 같이, 재조합 R0S1에 적합한 260kDa의 분자량에 해당하는밴드가명확하게 확인되었다.
3B20 scFv에 반응하는 단백질을 조사하기 위해， 인간 R0S1 （전장） 또는 GFP （대조군）를 코딩하는 렌티바이러스 벡터로 형질감염된 HEK293T 세포 용해물에 3B20 scFv-rFc 융합 단백질을 처리하여 면역침전을 수행하였다. 3B20 scFv단백질에 결합된 단백질을 SDS-PAGE로분리하였다. 전기 영동 후， 젤을 쿠마시블루로 염색하였다. 70 kDa 및 260 kDa에 해당하는 밴드를 젤에서 채취하고 액체크로마토그래피/ MS로 분석하였다. 얻어진 결과를 도 lc에 나타내었으며， 도 lc에서 화살표로 표시된 （A） 및 （B） 밴드에서 분석한 단백질 목록을 아래의 표 2에 나타내었다. 예상된 바와같이, ROSl （access i on number : IPI0028965； 서열번호 9）이 260 kDa의 밴드에서 검출되었다.
[표 2]
요이 引이! Transfected Transfected
Identified Proteins MW
1시니1下1匕 Control ROSl
Proto-oncogene tyrosine-protein kinase ROS 00288965 264
Figure imgf000030_0001
E3 ubiquitin-protein ligase U BR5 100026320 309 215 216
(A) Isoform 2 of filamin-A ^100302592 280 1< 80 97
Figure imgf000030_0002
Accession Transfected Transfected identified Proteins MW
Number Control ROSl
78 kDa glucose-regulated protein (G RP78) ^100003362 72 kDa 72 193
^100007765
Stress-70 protein, mitochondrial (GRP75) 74 134 127
(B) (+!)
Heat shock 70 kDa protein 1A/1B 1미00304925 70 102 105
Isoform 1 of Heat shock cognate 71 kDa protein ^100003865 71 !<□ø 83 84
Isoform 1 of Myotubularin-related protein 1
Figure imgf000030_0003
43
（표 2에서, transfected cont rol /transfected ROSl 컬럼에 기재된 수치는 LC-MS/MS데이터에서 파생된 spect ral count 의 횟수를의미한다） 표 1에 나타난 바와 같이, 약 70 kDa의 밴드는 Hsp70, Hsp71, GRP75및 GRP78을포함하는 열쇼크단백질로동정되었다.
Hsp70, Hsp71, GRP75 및 GRP78 단백질들의 아미노산 서열을 R0S1 단백질의 아미노산서열과비교한결과， 이들모두 DLGT의 아미노산서열을 공통적으로포함하는것으로 확인되었다. ROS1 ― - - - - - TNLGQQLDLGT PHNLSEPCIQ
HSP70 - MAKMMCTlWLGfT YSCTOW·
HSP71 -一一 - MSKGPAVGIDIGTTYSCVGVFQH
GRP 75 RLVSRRDYASEAIKG及 WGIDLGTTNSCVAVMEG
GRP78 SAAmiEE DKKEDVGTWGIBLGTTYS CVGVFKN
따라서 우리는 3B20 scFv의 에피토프가 R0S1에서 D46-L47-G48 -
T49라고가정하였다. 실시예 2. 알라닌 스캐닝 돌연변이유발 분석법（alanine scanning mutagenesi s assay）에 의한 3B20 scFv의 에피토프맵핑
3B20 scFv의 에피토프를 더 확인하기 위하여, R0S1 단백질의 아미노산 잔기 37-290에 상응하는 재조합 R0S1 단백질을 사용하여 알라닌 스캐닝 돌연변이 유발 분석을 수행하였다. 우선, 참고예 6에 설명된 바와 같이 재조합 R0S1 단백질의 Gly42 내지 Ser54 중의 어느 하나의 아미노산 잔기가 알라닌으로 치환된 R0S1 돌연변이를 제조하였다. 마이크로타이터 플레이트 웰을 3B20 scFv-C K 융합 단백질， BSA또는 i rre levant scFv-C K 융합단백질로 코팅한후， 플레이트를 알라닌 치환된 ROSl-hFc융합단백질 또는 야생형 ROSl-hFc융합단백질과함께 인큐베이션 하였다. 플레이트에 결합된 ROSl-hFc융합단백질의 양을 HRP-접합항- hFc항체 및 ATBS용액을 사용하여 측정하였다. 얻어진 결과를 도 2a （3B20 scFv-C K 융합 단백질코팅）, 2b （BSA 코팅） 및 2c （i rrelevant SCFV-C K 융합 단백질 코팅）에 나타내었다.
도 2a에 나타난 바와 같이 , 3B20 scFv-C K 융합 단백질은 R0S1 단백질의 L45A 돌연변이， L47A 돌연변이， 및 G48A 돌연변이와의 반응성이 현저하게 감소되는 반면, 다른 돌연변이과는 야생형 R0S1 단백질과 유사한 반응성을보였다. 또한, 도 2b 및 2c에 나타난 바와 같이, BSA또는 음성 대조군 scFv-Fc융합단백질은상기 R0S1돌연변이체들과 반응하지 않았다. 이러한 결과에 기초하여， R0S1의 Leu45, Leu47 및 Gly48의 3 개의 잔기가 3B20 scFv와의 결합특성에 중요한 역할을 한다고 결론지었다. 흥미롭게도，
Hsp70에서 R0S1의 Leu45에 상응하는 아미노산 잔기는 이소류신아었다. 이 결과로부터 3B20 항체에 돌연변이를 도입함으로싸 R0S1의 LDLGT를 Hsp70의 IDLGT 서열로부터 보다 정확하게 구별하여 R0S1에 대한 특이성이 보다 향상된 단클론 항체 클론을 제조하였다. 단클론 항체의 idi otopes가 H⑶R3을가지고 있기 때문에, HCDR3에이 돌연변이를도입하기로결정했다. 실시예 3. HCDR3 site-directed mutagenesis library로부터 특이성이 강화된 변형 scFv의 스크리닝
상기 실시예 2의 결과에 기초하여， Hsp70에 반응하지 않지만 R0S1에 반응하는 단클론 항체 클론을 생성하기 위하여, 참고예 7에 기재된 방법으로, H⑶R3 site-directed mutagenesis library를 제작하였다. 3B20 scFv의 H⑶R3 영역 (GGGGNIDA)은 8개의 아미노산으로 이루어져 있으며,
H⑶R3의 모든 아미노산 위치 각각에 NNK 어는 각각 독립적으로 A, C, G, 또는 T； 는 G또는 T) 코돈을포함하도록설계된 PCR프라이머를사용하여， 8 개의 NNK 파지 디스플레이 라이브러리를 구축하였다 (참고예 7 참조) . 각 라이브러리에서 무작위로 48 개의 클론을 선택하고 재조합 R0S1 및 GRP75에 대하여 파지 ELISA를 수행하였다. 첫 번째 아미노산 잔기 무작위 라이브러리에서 R0S1에만 반응하지만 GRP75에는 반응하지 않는 mAb클론을 발견하였다. 서열 분석 결과， 3B20 scFv의 H⑶R3 영역의 첫번째 아미노산 잔기인 글리신 (G)이 라이신 (K)으로 치환되어 있음을 확인하였다. 상기 발견된 mAb클론은 3B20-G1K토 명명하였다. 3B20-G1K의 CDR및 가변영역의 아미노산서열을다음의 표 3에 정리하였다
[표 3]
Figure imgf000032_0001
Figure imgf000033_0001
실시예 4. 3B20-G1K의 증진된특이성
3B20-G1K의 특이성을 시험하기 위하여， 재조합 3B20-G1K scFv-C K 융합 단백질을 제조하였다. 상기 제조된 융합단백질에 대하여 ELISA, 면역블라팅 및 면역침전분석을 3B20과 병행하여 수행하였다. 보다 구체적으로, 마이크로타이터 플레이트 웰을 100 ng의 재조합 R0S1
（아미노산 37-290）-C K 융합 단백질 또는 i rrel evant 단백질- C K 융합 분자로 코팅하였다. 차단 후, 3B20-rFc 융합 단백질 또는 3B20-GlK_rFc 융합 단백질을 0 내지 2000 ng/ml의 농도로 웰에 첨가하고, 웰에 결합된 융합 단백질의 양을 HRP-접합 항-토끼 IgG 항체 및 ABTS 용액을 사용하여 ELISA로 측정하였다. 얻어진 결과를 도 3a （3B20_rFc 융합 단백질） 및 3b （3B20-GlK-rFc 융합 단백질）에 각각 나타내었다. 도 3a 및 3b에 나타난 바와 같이， ELISA 분석 결과, 3B20-G1K는 2 g/mL의 고농도에서도 GRP75와 반응하지 않고 오직 R0S1에만 반응하였으나, 3B20은 50 ng/mL 이상의 농도에서 GRP75와반응하는것으로관찰되었다.
또한, R0S1 （ful l-l ength） 코딩 렌티바이러스 벡터 （레인 R） 또는 대조군 벡터（레인 C； GFP）로 형질전환된 HEK293T 세포의 용해물을 SDS- PAGE에 적용하고， 니트로셀룰로오스 멤브레인으로 옮기고 블로킹 한 후， 멤브레인을 3B20, 3B20-G1K또는 R0S1에 대한 대조 항체（ab5512; Abeam）로 프로빙하여 면역블로팅을 수행하였다. 얻어진 면역블로팅 결과를 도 3c에 나타내었다. 도 3c에 나타난 바와 같이, R0S1 유전자로 형질전환된 HEK293T 세포 용해물 （R 레인）에서는 재조합 R0S1에 해당하는 하나의 밴드만이 관찰된 반면 (화살표로표시), 대조군 벡터로 형질전환된 HEK293T 세포 용해 물 (C 레인)에서는 재조합 R0S1에 해당하는 밴드가 관찰되지 않았다.
또한,다음과같이 면역침전 분석을수행하였다. R0S1 (full-length) 코딩 렌티바이러스 벡터 (레인 R) 또는 대조군 벡터 (레인 C； GFP)로 형질전환된 HEK293T 세포를 용해시키고 3B20(scFv)-rFc 융합 단백질 및 3B20(scFv)-GlK-rFc 융합 단백질과 함께 인큐베이션시키고, protein A agarose beads와 반응시켰다. 세척 후, 비드에 결합된 단백질을 용출시키고, SDS-PAGE를 수행하였다. 비드에 결합된 단백질은 Coomassie Blue로 염색하여 가시화시켰다. 얻어진 면역침전 분석 결과를 도 3d에 나타내었다. 도 3d에 나타난 바와 같이， 3B20-G1K 면역 침전물이 로딩된 레인에서 재조합 R0S1에 상응하는 단일 밴드 (화살표로 표시)와, 3B20-G1K scFv단백질 (약 55 kDa)에 상응하는밴드가관찰되었다. 실시예 9.3B20-G1K단클론항체를이용한인간폐선암의 IHC분석 전장 야생형 R0S1의 검출에서 3B20-G1K scFv의 적용 가능성을 평가하기 위하여, 참고예 8에 기재된 방법으로， 인간 R0S1 (full-length)를 코딩하는 렌티바이러스 벡터로 형질전환된 HEK293T 세포 (양성 대조군)， 인간폐선암 (human lung adenocarcinoma)조직 (n=100) (서울특별시 보라매 병원 제공), 및 인간 Non-neoplast ic lung tissue (Benign bronchial epithelia 및 alveolar pneumocytes) (서울특별시 보라매 병원 제공)에 대하여 면역조직화학법 (IHC)을수행하고,그결과를도 4에 나타내었다.
도 4의 (시는 인간 R0S1 (full-length)를 코딩하는 렌티바이러스 벡터로 형질전환된 HEK293T 세포에 대한 IHC 결과로서, 세포질막 및 세포질에서 모두에서 R0S1이 강하게 발현함을 알수 있다 (X 400).도 4의
(B)는 인간 Non-neoplastic lung tissue (Benign bronchial epithelia 및 alveolar pneumocytes)에 대한 IHC 결과로서， R0S1의 발현이 관찰되지 않았다 (xlOO) .도 4의 (C)-(E)는 인간폐선암 (human lung adenocarcinoma) 조직에 대한 IHC 결과로서 , 각각 저배율 (C; x200) , 중배율 (D; x200) 및 고배율 (E; x400),화살표는유사분열 모습임)에서의 R0S1발현을보여준다. 도 4의 ( 는 인간 폐선암 조직에서의 x 400에서의 관찰 모습을 보여주는 것으로,세포질막과세포질에서 R0S1-양성 결과가 확인되며， 특히 막에서의 R0S1발현이 증진되어 있음을확인할수 있다. 도 4에 나타난 바와 같이， 양성 대조군으로 사용된 R0S1유전자로 형질전환된 HEK293T 세포는 막과 세포질에서 R0S1 발현이 강력하게 나타났으며 (A) ; 안간 Non-neoplastic lung tissue인 Benign bronchial epithelia와 alveolar pneum◦에서는 R0S1-음성 결과가 나타났고 (B); 인간 폐선암조직에서는다양한정도의 R0S1발현을 보였으며 약 10%의 경우에서 강한 양성 비율을 보였으며, 이 경우 R0S1는 주로 세포질 막에 위치화 ( local izat ion)하였지만, 특히 강한 양성을 보이는 경우에는 세포질에서도발현되는것으로확인되었다 (C-F) .

Claims

【청구범위】
【청구항 1]
R0S1 단백질의 39번째부터 56번째까지의 영역 (서열번호 15) 내의, 서열번호 11을포함하는 연속하는 5개 이상의 아미노산또는서열번호 10을 포함하는 연속하는 4개 이상의 아미노산으로 이루어진 부위에 결합하는 것을특징으로하는， 항 R0S1항체또는이의 항원 결합단편 .
【청구항 2]
제 1항에 있어서， 다음의 상보성 결정부위 (compl ementar i ty determining region； CDRs)를포함하는, 항 R0S1항체 또는 이의 항원 결합 단편 :
서열번호 1 (SGGSYGYG)의 아미노산서열을포함하는 LCDR1 , 서열번호 2 (DNTNRPS)의 아미노산서열을포함하는 LCDR2,
서열번호 3 (GSADSSSIAT)의 아미노산서열을포함하는 LCDR3.
서열번호 4 (GFSFSDRGMH)의 아미노산서열을포함하는 HCDR1 , 서열번호 5 (ISGDGYITHYGMVKG)의 아미노산 서열을 포함하는 HCDR2, 및
서열번호 6 (KGGGNIDA) 또는 서열번호 13 (GGGGNIDA)의 아미노산 서열을포함하는 HCDR3.
【청구항 3】
제 1항에 있어서,
서열번호 7 또는 사열번호 23의 아미노산 서열을 포함하는 경쇄 가변영역; 및
서열번호 8 또는 서열번호 14의 아미노산 서열을 포함하는 중쇄 가변영역
을포함하는， 항 R0S1항체 또는이의 항원 결합단편 .
【청구항 4】
제 1항에 있어서, 다음과같이 정의되는항 R0S1항체 또는 이의 항원 결합단편:
(1) 다음의 상보성 결정부위 (comp l ementar i ty determining region； CDRs)를포함하는항 R0S1항체 또는이의 항원 결합단편:
서열번호 1 (SGGSYGYG)의 아미노산서열을포함하는 LCDR1 , 서열번호 2 (DNTNRPS)의 아미노산서열을포함하는 LCDR2 ,
서열번호 3 (GSADSSSIAT)의 아미노산서열을포함하는 LCDR3. 2019/107671 1»（：1/10公018/002655
서열번호 4 (GFSFSDRGMH)의 아미노산서열을포함하는 HCDR1, 서열번호 5 (ISGDGYITHYGMVKG)의 아미노산서열을 포함하는 HCDR2,q.1
서열번호 6 (KGGGNIDA)의 아미노산서열을포함하는 HCDR3； 또는 (2)다음의 가변영역을포함하는， 항 R0S1항체 또는 이의 항원 결합 단편:
서열번호 7의 아미노산서열을포함하는경쇄 가변영역 ; 및
서열번호 8의 아미노산서열을포함하는중쇄 가변영역 .
【청구항 5】
제 4항에 있어서， 상기 항 R0S1 항체 또는 이의 항원 결합 단편은 서열번호 11 (LDLGT)에는 결합하고 서열번호 12 (IDLGT)에는 결합하지 않는것을특징으로하는것인， 항 R0S1항체 또는이의 항원 결합단편.
【청구항 6】
제 4항에 있어서， 상기 항 R0S1 항체 또는 이의 항원 결합 단편은 R0S1 단백질에 특이적으로 결합하는 것인， 항 R0S1 항체 또는 이의 항원 결합단편.
【청구항 7】
제 1항에 있어서 , 다음과같이 정의되는항 R0S1항체 또는이의 항원 결합단편:
(1) 다음의 상보성 결정부위 (complementarity determining region；
CDRs)를포함하는항 R0S1항체 또는이의 항원 결합단편:
서열번호 1 (SGGSYGYG)의 아미노산서열을포함하는 LCDR1, 서열번호 2 (DNTNRPS)의 아미노산서열을포함하는 LCDR2
서열번호 3 (GSADSSSIAT)의 아미노산서열을포함하는 LCDR3.
서열번호 4 (GFSF況RGMH)의 아미노산서열을포함하는 HCDR1, 서열번호 5 (ISGDGYITHYGMVKG)의 아미노산서열을 포함하는 HCDR2, 및
서열번호 13 (GGGGNIDA)의 아미노산서열을포함하는 HCDR3； 또는 (2) 다음의 가변영역을포함하는， 항 R0S1항체 또는이의 항원 결합 단편:
서열번호 23의 아미노산서열을포함하는경쇄 가변영역 ; 및
서열번호 14의 아미노산서열을포함하는중쇄 가변영역.
【청구항 8】 2019/107671 1»（：1^1{2018/002655
Figure imgf000038_0001
하는것인， 항炯 항체 또는이의 항원 결합단편.
【청구항 9】
5 제 8항에 있어서, 상기 항 1¾)31 항체 또는 이의 항원 결합 단편은 敗射 단백질， ¾?70， ¾?71 , 0卵75， 및 。卵78로 이루어진 군에서 선택된 1종이상에 결합가능한것인, 항炯 항체 또는이의 항원 결합단편.
【청구항 10]
제 1항 내지 제 9항 중 어느 한 항에 있어서， 상기 항 ^31 항체는 10 동물 항체， 키메릭 항체, 또는 인간화 항체인， 항 潮射 항체 또는 이의 항원 결합단편.
【청구항 11】
제 1항 내지 제 9항 중 어느 한 항에 있어서， 상기 항원 결합 단편은
Figure imgf000038_0002
단편.
【청구항 12】
제 1항 내지 제 9항 중 어느 한 항의 항 1¾光1 항체 또는 이의 항원 20 결합단편을포함하는, 암진단용약학조성물.
【청구항 13】
제 12항에 있어서， 상기 암은폐암인， 조성물.
【청구항 14】
다음의 아미노산서열을암호화하는핵산:
25 서열번호 1， 2， 3, 4, 5, 6, 및 13로 이루어진 군에서 선택된 하나 아상의 아미노산서열，
서열번호 7， 8, 23, 및 14로 이루어진 군에서 선택된 하나 이상의 아미노산서열， 또는
서열번호 24또는서열번호 26의 아미노산서열.
30
【청구항 15】
제 14항의 핵산을포함하는 재조합벡터.
【청구항 16】
제 15항의 재조합벡터를포함하는 재조합세포. 2019/107671 1»（：1^1{2018/002655
【청구항 17】
제 16항의 재조합 세포를 배양하는 단계를 포함하는， 항 敗射 항체 또는이의 항원 결합단편의 제조방법 .
【청구항 18]
(1) 환자로부터 분리된 생물학적 시료에 제 1항 내지 제 9항 중 어느 한항의 항- 1¾ 1항체 또는이의 항원 결합단편을접촉시키는단계 ; 및
(2) 상기 단계 (1)의 반응물에서 항원-항체 반응 여부를 확인하는 단계
를포함하는， 암의 진단에 정보를제공하는방법.
【청구항 19】
제 18항에 있어서， 상기 암은폐암인, 방법 .
【청구항 20】
潮射의 1말단부위와후보 항체 또는 항원 결합 단편을 접촉시키는 단계; 및
상기 炯射의 에피토프에 결합하는 항체 또는 항원결합단편을 선별하는단계
를포함하고,
상기 炯 의 말단부위는 1¾光1 단백질의 39번째부터 56번째까지의 영역 (서열번호 15) 내의, 서열번호 11을 포함하는 연속하는 5개 이상의 아미노산 또는 서열번호 10을 포함하는 연속하는 4개 이상의 아미노산으로 이루어진부위인，
敗 에 특이적으로 결합하는 항체 또는 항원결합단편을 제조하는 방법.
PCT/KR2018/002655 2017-11-29 2018-03-06 항-ros1 항체 및 그의 용도 WO2019107671A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US16/767,245 US20230242670A1 (en) 2017-11-29 2018-03-06 Anti-ros1 antibody and use thereof
KR1020187006693A KR102078775B1 (ko) 2017-11-29 2018-03-06 항-ros1 항체 및 그의 용도
JP2020529420A JP7041265B2 (ja) 2017-11-29 2018-03-06 抗－ｒｏｓ１抗体およびその用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762591974P 2017-11-29 2017-11-29
US62/591,974 2017-11-29

Publications (1)

Publication Number Publication Date
WO2019107671A1 true WO2019107671A1 (ko) 2019-06-06

Family

ID=66665052

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/002655 WO2019107671A1 (ko) 2017-11-29 2018-03-06 항-ros1 항체 및 그의 용도

Country Status (4)

Country Link
US (1) US20230242670A1 (ko)
JP (1) JP7041265B2 (ko)
KR (1) KR102078775B1 (ko)
WO (1) WO2019107671A1 (ko)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022155518A1 (en) 2021-01-15 2022-07-21 Seagen Inc. Immunomodulatory antibody-drug conjugates
WO2022170002A1 (en) 2021-02-03 2022-08-11 Seagen Inc. Immunostimulatory compounds and conjugates
WO2023215740A1 (en) 2022-05-06 2023-11-09 Seagen Inc. Immunomodulatory antibody-drug conjugates
WO2024030577A1 (en) 2022-08-03 2024-02-08 Seagen Inc. Immunostimulatory anti-pd-l1-drug conjugates
EP4321522A1 (en) 2022-08-12 2024-02-14 Seagen Inc. Cytotoxic compounds and conjugates thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120237530A1 (en) * 2009-10-21 2012-09-20 Hiroshima University Integrin alpha 8-beta 1-specific monoclonal antibody
US20130336923A1 (en) * 2005-12-02 2013-12-19 Dana-Farber Cancer Institute, Inc. Carbonic Anhydrase IX (G250) Antibodies and Methods of Use Thereof
WO2014016737A1 (en) * 2012-07-24 2014-01-30 Pfizer Inc. Novel chicken monoclonal antibodies against human phosphorylated tau and uses thereof
US20140243332A1 (en) * 2013-02-27 2014-08-28 Oregon Health & Science University Methods of treating cancers characterized by aberrent ros1 activity
US20150064187A1 (en) * 2012-03-28 2015-03-05 Hiroshima University Fibrosis suppression by inhibiting integrin alpha-8 beta-1 function
WO2017037220A1 (en) * 2015-09-03 2017-03-09 Ist Austria Ros1 positive cancer treatment
KR101736420B1 (ko) * 2014-11-28 2017-05-16 에스지메디칼 주식회사 파툴린 특이적인 항체 및 이를 이용한 파툴린의 검출 방법

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110008347A1 (en) * 2006-12-01 2011-01-13 Agency For Science ,Technology And Research Cancer-related protein kinases
US9109259B2 (en) 2010-06-22 2015-08-18 Japanese Foundation For Cancer Research Detection method for novel ROS1 fusions
TWI585088B (zh) 2012-06-04 2017-06-01 第一三共股份有限公司 作爲激酶抑制劑之咪唑并［１，２－ｂ］嗒衍生物

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130336923A1 (en) * 2005-12-02 2013-12-19 Dana-Farber Cancer Institute, Inc. Carbonic Anhydrase IX (G250) Antibodies and Methods of Use Thereof
US20120237530A1 (en) * 2009-10-21 2012-09-20 Hiroshima University Integrin alpha 8-beta 1-specific monoclonal antibody
US20150064187A1 (en) * 2012-03-28 2015-03-05 Hiroshima University Fibrosis suppression by inhibiting integrin alpha-8 beta-1 function
WO2014016737A1 (en) * 2012-07-24 2014-01-30 Pfizer Inc. Novel chicken monoclonal antibodies against human phosphorylated tau and uses thereof
US20140243332A1 (en) * 2013-02-27 2014-08-28 Oregon Health & Science University Methods of treating cancers characterized by aberrent ros1 activity
KR101736420B1 (ko) * 2014-11-28 2017-05-16 에스지메디칼 주식회사 파툴린 특이적인 항체 및 이를 이용한 파툴린의 검출 방법
WO2017037220A1 (en) * 2015-09-03 2017-03-09 Ist Austria Ros1 positive cancer treatment

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LEE, HWA KYOUNG: "A point mutation in the heavy chain complementarity- determining region 3 (HCDR3) significantly enhances the specificity of an anti-ROSI antibody", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 493, 6 September 2017 (2017-09-06), pages 325 - 331, XP085230240, DOI: doi:10.1016/j.bbrc.2017.09.023 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022155518A1 (en) 2021-01-15 2022-07-21 Seagen Inc. Immunomodulatory antibody-drug conjugates
WO2022170002A1 (en) 2021-02-03 2022-08-11 Seagen Inc. Immunostimulatory compounds and conjugates
WO2023215740A1 (en) 2022-05-06 2023-11-09 Seagen Inc. Immunomodulatory antibody-drug conjugates
WO2024030577A1 (en) 2022-08-03 2024-02-08 Seagen Inc. Immunostimulatory anti-pd-l1-drug conjugates
EP4321522A1 (en) 2022-08-12 2024-02-14 Seagen Inc. Cytotoxic compounds and conjugates thereof

Also Published As

Publication number Publication date
JP2021503931A (ja) 2021-02-15
JP7041265B2 (ja) 2022-03-23
US20230242670A1 (en) 2023-08-03
KR102078775B1 (ko) 2020-02-19
KR20190087954A (ko) 2019-07-25

Similar Documents

Publication Publication Date Title
KR102078775B1 (ko) 항-ros1 항체 및 그의 용도
CN110167967B (zh) 针对抗pd-l1抗体的独特型抗体及其用途
EP2183282A1 (en) Antibodies specific for the c-terminal regulatory domain of egfr and their use
KR20110090985A (ko) 인간 ｃｘｃｌ１ 단백질의 면역학적 측정 방법
JP6324970B2 (ja) 抗ウロプラキンｉｉ抗体システムおよび方法
US10809263B2 (en) Antigenic composition for detecting auto-antibody with specific response to exosomal protein EIF3A, and method for diagnosing liver cancer using antigenic composition
KR20110040624A (ko) 항-ｆａｓｎ 자가면역 항체를 포함하는 간암 진단 마커 및 이의 항원을 포함하는 간암 진단용 조성물
JP2016510870A (ja) 補体因子ｈ関連タンパク質１検出のための剤、キットおよび方法
WO2017155355A1 (ko) Aimp2-dx2 단백질에 특이적으로 결합하는 항체
CN116410322A (zh) 抗人pcdh7蛋白的单克隆抗体及其应用
WO2018135653A1 (ja) 抗ｅｐｈａ２抗体及びこれを用いたｅｐｈａ２の免疫学的検出
AU2017219386B2 (en) Antibody against EGFRvIII and use thereof
CN111303289B (zh) 抗人Tn型糖基化MUC1抗体及其用途
KR20220055423A (ko) SARS-CoV-2 특이적 신규 항체를 이용한 SARS-CoV-2의 검출방법
KR102119783B1 (ko) 인간 상피 성장 인자 수용체 변이체 ⅲ에 결합하는 항체 및 그의 항체 단편
CN108727493B (zh) 抗Stathmin单克隆抗体及其用途
Lee et al. A point mutation in the heavy chain complementarity-determining region 3 (HCDR3) significantly enhances the specificity of an anti-ROS1 antibody
KR102172541B1 (ko) Bag2 항체를 이용한 암 진단용 조성물 및 이를 이용한 방법
ES2694296T3 (es) Anticuerpos monoclonales anti-pVHL y usos de los mismos
KR102590757B1 (ko) GKN1(Gastrokine 1) 특이적 항체 및 이의 용도
CN112724253B (zh) 抗人穹窿体蛋白的抗体及其应用
US20230194534A1 (en) Methods for diagnosing cancer using anti-bag2 antibody
KR20210067120A (ko) Cobll1 단백질 특이 항체 또는 이의 항원 결합 단편, 및 이의 용도
WO2012077643A1 (ja) ｃｏｆｉｌｉｎ１タンパク質の免疫学的測定方法
이화경 Production of an anti-ROS1 scFv antibody with enhanced specificity by a point mutation in the HCDR3

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 20187006693

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020187006693

Country of ref document: KR

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18884216

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020529420

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18884216

Country of ref document: EP

Kind code of ref document: A1