WO2019083262A1 - 혈액으로부터 암을 진단하는 방법 - Google Patents
혈액으로부터 암을 진단하는 방법Info
- Publication number
- WO2019083262A1 WO2019083262A1 PCT/KR2018/012591 KR2018012591W WO2019083262A1 WO 2019083262 A1 WO2019083262 A1 WO 2019083262A1 KR 2018012591 W KR2018012591 W KR 2018012591W WO 2019083262 A1 WO2019083262 A1 WO 2019083262A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bag2
- cancer
- polypeptide
- cathepsin
- combination
- Prior art date
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57415—Specifically defined cancers of breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
Definitions
- the present invention relates to a method for diagnosing cancer from BAG2, pro-cathepsin B, or a combination thereof, which is present in blood. More specifically, the present invention relates to a method for diagnosing triple-negative breast cancer.
- BAG co-chaperone Bcl-2-associated athanogene protein
- BAG2 The main role of BAG2 in the regulation of proteins through inhibition of CHIP activity has been linked to neurodegenerative diseases and endocrine biologic disorders through the stabilization of chaperone-related proteins such as PINK1 and CFTR (Qu et al., 2015; Arndt et al ., 2005).
- BAG2 expression increases proteasome inhibitor - induced apoptosis, and BAG2 knockdown inhibits apoptosis partially by inhibiting apoptosis when exposed to proteasome inhibitor MG132, a thyroid carcinoma cell, pro-apoptotic activity (Wang et al., 2008).
- CTSB Cathepsin B
- CTSB Cathepsin B
- mature CTSB is generally recognized to exhibit an incendiary-apoptotic role of cytoplasmic CTSB by functioning in the protein cycle as an inhibitor protease during lysosome-mediated autophagy / apoptosis, generally located in lysosomes (Stoka et al Foghsgaard et al., 2001; Bhoopathi et al., 2010).
- the modulator of this dual function of CTSB in cancer progression is not clear.
- One aspect includes contacting an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof to a sample separated from the subject; Measuring the presence or level of BAG2 in the sample from a complex formed by contacting an antibody, polypeptide, or a combination thereof specifically binding to the BAG2 polypeptide or fragment thereof; And comparing the presence or level of BAG2 measured from the sample to a BAG2 level determined from a control.
- Another aspect is the detection of BAG2 present in blood, serum, plasma, or a combination thereof, comprising an antibody, polypeptide, or combination thereof that specifically binds to said BAG2 polypeptide or fragment thereof Cancer diagnosis kit.
- One aspect includes contacting an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof to a sample separated from the subject; Measuring the presence or level of BAG2 in the sample from a complex formed by contacting an antibody, polypeptide, or a combination thereof specifically binding to the BAG2 polypeptide or fragment thereof; And comparing the presence or level of BAG2 measured from the sample to a BAG2 level determined from a control.
- the method is for providing information for diagnosing cancer, which comprises detecting the presence of cancer in an individual and diagnosing cancer present in the subject.
- An antibody, polypeptide, or a combination thereof that specifically binds to a BAG2 polypeptide or fragment thereof when BAG2 is present in a sample isolated from the subject can bind to BAG2 in the sample.
- the antibody or polypeptide may be, for example, a fluorophore, a chromophore, or an enzyme capable of converting a substrate into a chromophore to visualize the presence of BAG2 in the sample.
- the step of measuring the complex comprises the steps of: Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, FACS, protein chip, or a combination thereof, for example, as described above.
- the presence or level of BAG2 measured from the sample can be compared to the level of BAG2 measured from the control to diagnose whether the subject is cancerous.
- the control group may be a sample taken from a healthy subject, or a sample taken from an average of various types of breast cancer patients, non-metastatic breast cancer patients, or non-TNBC type breast cancer patients as needed.
- the level of BAG2 measured from the control group can be determined by measuring the BAG2 concentration in a sample taken from a healthy individual at the BAG2 level, or in a sample taken from an average of various types of breast cancer patients, non-metastatic breast cancer patients, May mean an average value.
- the sample used as the control group may be the same kind of sample collected at the same anatomical position as the sample for diagnosis.
- the control may also be blood collected from the control pulmonary vein.
- the healthy individual may not be suffering from any acute or chronic disease, and may not suffer from at least cancer, preferably not suffering from breast cancer.
- the level of BAG2 in the sample taken from the healthy subject may be substantially free of BAG2. Therefore, if the control group is set to a value obtained from a healthy individual, it can be suspected that the subject is suffering from cancer if the presence of BAG2 in the subject being diagnosed is measured or the level is measured to be significantly higher. On the other hand, as shown in the examples of the present invention, the presence of BAG2 in the blood of patients with metastatic breast cancer, especially TNBC type among breast cancer patients is highly probable and the average value is remarkably high.
- control group when the control group is set as a sample isolated from various types of breast cancer patients, non-metastatic breast cancer patients or non-TNBC type breast cancer patients, the level of BAG2 in the subject to be diagnosed is higher than that of the control group , The subject may be suspected of having metastatic breast cancer or TNBC type breast cancer.
- " As used herein, the term " polypeptide " is used interchangeably with " protein ".
- the sample is a sample separated from a subject to be diagnosed and is a cell, an organ, a cell lysate, a whole blood, a blood, a serum, a plasma, a lymphatic fluid, an extracellular fluid, a body fluid, a urine, a feces, a tissue, a marrow, a saliva, Or a combination thereof.
- the sample can be blood, serum, plasma, or a combination thereof.
- BAG2 can be secreted out of the cell and that BAG2 is actually detected in the blood of a breast cancer patient.
- the BAG2 may be soluble in blood, blood, serum, plasma, or a combination thereof.
- the diagnostic method of the present invention comprises the steps of contacting a sample, separated from said subject, with an antibody, polypeptide, or combination thereof that specifically binds to a polypeptide of cathepsin B (cathepsin B) or a fragment thereof; Measuring the presence or level of cathepsin B from a complex formed by contacting an antibody, polypeptide, or a combination thereof specifically binding to the polypeptide of cathepsin B or a fragment thereof; And comparing the presence or level of cathepsin B measured from the sample to the level of cathepsin B measured from the control.
- the diagnostic method of the present invention can further increase the accuracy of diagnosis by simultaneously detecting BAG2 and cathepsin B.
- Cathepsin B can be divided into pro-cathepsin B and a mature form, single-chain or double-chain cathepsin B.
- the inventors have found that cathepsin B, which is not matured by BAG2, Was secreted out of the cell.
- the cathepsin B may be pro-cathepsin B.
- the pro-cathepsin B may be used in the same sense as " immature cathepsin B " or " immature CTSB ".
- the step of measuring a complex formed by contacting an antibody, polypeptide, or combination thereof specifically binding to a polypeptide of cathepsin B and cathepsin B or a fragment thereof in the sample may be performed by Western blotting, Immunoassay, ELISA, radioimmunoassay, radioimmunoprecipitation, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, complement fixation assays, FACS, protein chips, or a combination thereof.
- the term " antibody" means a specific immunoglobulin directed against an antigenic site.
- the antibody refers to a polypeptide or a combination of polypeptides that specifically bind to BAG2 and pro-cathepsin B, respectively.
- the BAG2 or pro-cathepsin B gene is cloned into an expression vector to obtain a protein encoded by each gene, From the obtained BAG2 or pro-cathepsin B protein, antibodies specific for each protein can be prepared according to methods customary in the art.
- the form of the antibody includes a polyclonal antibody, a monoclonal antibody, or a recombinant antibody (e.g., ScFv fragment, diabody, single chain antibody, etc.) and includes all immunoglobulin antibodies.
- the antibody does not have the structure of a complete intact antibody with two light and two heavy chains as well as a complete form with two light and two heavy chains as well as two light and two heavy chains, But also functional fragments of antibody molecules which have specific antigen binding sites (binding domains) and which possess antigen binding function.
- the BAG2 and pro-cathepsin B polypeptides may be derived from human ( Homo sapiens ) or mouse ( Mus musculus ), respectively, and may be derived from other mammals such as monkey, cow, horse and the like.
- the amino acid sequence of BAG2 may include SEQ ID NO: 1 or 2 (GenBank Accession No. NP_004273.1 and NP_663367.1, respectively), and the amino acid sequence of pro-cathepsin B may be SEQ ID NO: 3 to 8 , GenBank Accession No. NP_001899.1, NP_680090.1, NP_680091.1, NP_680092.1, NP_680093.1, or NP_031824.1).
- the amino acid sequence which has a biologically equivalent activity can be regarded as BAG2 or pro-cathepsin B polypeptide.
- the BAG2 or pro-cathepsin B polypeptide may have 60% or more, such as 70% or more, 80% or more, 90% or more, 95% or more, more preferably 60% or more of SEQ ID NO: 1 or 2 and SEQ ID NO: , 99% or more, or 100% sequence identity.
- the BAG2 or pro-cathepsin B polypeptide may be a polypeptide having at least one amino acid, at least two amino acids, at least three amino acids, at least four amino acids , 5 or more amino acids, 6 or more amino acids, or 7 or more amino acid residues.
- the subject to be diagnosed may be a mammal such as a human, mouse, rat, cow, horse, pig, dog, sheep, goat or cat, to be.
- the cancer that can be diagnosed by the diagnostic method of the invention is selected from breast cancer, colon cancer, lung cancer, sarcoma, melanoma, head and neck cancer, cervical cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, .
- the present inventors have demonstrated that BAG2 is overexpressed in breast cancer patients, and in particular, breast cancer patients whose BAG2 levels are high have a high probability of metastatic breast cancer.
- the breast cancer that may be diagnosed by the diagnostic method of the present invention may be metastatic breast cancer.
- TNBC triple-negative breast cancer
- TNBC patients do not have three target receptors (ER, PR, and HER2) or other well-defined molecular targets, (Eg, poly ADP-ribose polymerase (PARP), epidermal growth factor receptor (EGFR), and Src tyrosine kinase).
- ER target receptor
- PR target receptor
- HER2 target receptors
- Eg poly ADP-ribose polymerase
- EGFR epidermal growth factor receptor
- Src tyrosine kinase Src tyrosine kinase
- the inventors have demonstrated that BAG2 is overexpressed in breast cancer patients, and breast cancer patients, especially those with high levels of BAG2, have a high probability of suffering from TNBC type breast cancer.
- the breast cancer that can be diagnosed by the diagnostic method of the present invention may be triple negative breast cancer (or TNBC type breast cancer).
- kits comprising an antibody, a polypeptide, or a combination thereof that specifically binds to said BAG2 polypeptide or fragment thereof.
- the kit is for detecting BAG2 present in blood, serum, plasma, or a combination thereof, wherein the sample applied to the kit provides blood, serum, plasma, or combinations thereof separated from the individual.
- the kit may further comprise an antibody, a polypeptide, or a combination thereof that specifically binds to a polypeptide of cathepsin B or a fragment thereof.
- the kit can be used to analyze the kit using the assay methods used (e.g., Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, Assay, FACS, protein chip, or a combination thereof).
- the assay methods e.g., Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, Assay, FACS, protein chip, or a combination thereof.
- it may further comprise a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate for the detection of an immune complex of BAG2 or cathepsin B in the sample with an antibody specific thereto .
- the substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a glass slide glass or the like, and peroxidase, alkaline phosphatase, Azo-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) or o-phenylenediamine (OPD) as a coloring substrate, , Tetramethylbenzidine (TMB), and the like.
- ABTS Azo-bis (3-ethylbenzothiazoline-6-sulfonic acid)
- OPD o-phenylenediamine
- the method of diagnosing cancer by measuring the presence or level of serum BAG2 polypeptide enables diagnosis of cancer more easily and more accurately than the conventional method of collecting tissue for diagnosis of cancer.
- cancer diagnostic method can be readily utilized for cancer diagnosis in various diagnostic institutions by a cancer diagnostic kit for measuring the presence or level of BAG2 polypeptide in blood from the blood.
- Figure 1 shows a volcano plot analyzing the differences in the expression levels of BAG family in resistant and TNBC cell lines using RNA sequencing.
- Figure 2 shows the amount of BAG2 mRNA expression in intact and TNBC cell lines analyzed from a volunteer plot.
- FIG. 3 is a scatter dot-plot of the amount of BAG2 expression analyzed from 52 breast cancer cell lines.
- FIG. 4 shows microarray (4A) and RNA sequencing results (4B) in which BAG2 expression levels were analyzed in normal and breast cancer cell types.
- FIG. 5 shows the results of quantitative RT-PCR analysis of the amount of BAG2 expression in the stroma and TNBC tissues.
- Figure 6 shows the effect of BAG2 on CTSB morphology and activity in terms of immunoblot (6A) and CTSB activity (6B).
- Fig. 7 shows the results of immunoblotting of BAG2 and CTSB from the conditioned medium in which TNBC was cultured.
- Fig. 8 is a graph showing the level of pro-cathepsin B detected from the conditioned medium in which TNBC was cultured.
- FIG. 9 shows the results of immunoblotting detection of BAG2 and CTSB detected from the conditioned medium in which the BAG2 overexpressing cell line was cultured.
- FIG. 10 shows the results of detecting the presence of BAG2 from the serum of healthy human and breast cancer patients.
- RNA sequencing in breast cancer cell lines To identify novel molecular targets associated with TNBC progression, we first performed transcript analysis using RNA sequencing in breast cancer cell lines. First, RNA was extracted from various breast cancer cell lines using a method well known in the art, and the genome analysis was commissioned by the company (terazene dithex). After that, the expression levels of BAG2 were compared among the breast cancer cell lines, which were classified as strong (MCF-7, T47D, ZR-75B) or TNBC (MDA-MB-231 and Hs578T).
- Example 1-1 the BAG2 expression pattern was confirmed in a wider variety of breast cancer cells.
- Breast cancer cell information was obtained from the public microarray data set (GSE41313, Riaz et al., 2013).
- BAG2 expression was significantly higher in TNBC than that in Luminal ( P ⁇ 0.0001), as shown in Fig. 3, in 52 breast cancer cell lines disclosed in Riaz et al. )
- the present inventors have used the RNA sequencing data sets and microarrays of breast cancer patients obtained from the Cancer Genome Atlas (TCGA) BAG2 expression was analyzed.
- TCGA Cancer Genome Atlas
- BAG2 expression was significantly higher in patients with TNBC compared with patients with normal, resistant A (Lum A), resistant B (Lum B), and HER2- , Respectively.
- Quantitative RT-PCR was performed in order to experimentally confirm the above trends analyzed using an open database.
- BAG2 could act as a regulator of cathepsin B regulation
- BAG2 was examined the interaction of BAG2 and cathepsin B and the changes in the activity of cathepsin B by BAG2.
- BAG2-specific shRNAs were first purchased from Mission-shRNA (Sigma) to produce BAG2-deleted cell lines.
- BAG2-specific shRNA lentivirus 293T cells were transfected with pLKO-BAG2 or a scrambled control pLKO-pGL2 with packaging plasmids encoding ⁇ 8.9 and VSV-G (the target sequence of the BAG2 shRNA used (5 '- >3'): GTACTAGGATCTAGCATATTT). The virus supernatant was collected 36-48 hours after the transfection and filtered through a 0.45 [mu] m filter.
- MDA-MB-231 (ATCC) was seeded in a 6-well plate at 1 ⁇ 10 5 cells / well and infected with virus particles and polybrene (8 ⁇ g / ml). After infection, the medium containing the virus was replaced with normal medium, and the cells were then selected as furomycin (2 / / ml).
- the prepared BAG2 deletion cell line was designated as BAG2 shRNA.
- BAG2 Myc-tag BAG2 expression vector was transfected into MDA-MB-231 (ATCC) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, and BAG2 overexpressing cells were designated BAG2 OV, BAG2 shRNA was transfected into BAG2 shRNA as BAG2 recovered BAG2 rescue.
- CTSB antibodies recognize both pro-form and mature forms of CTSB (single chain) and DC (double chain), and thus can be classified into molecular weights.
- caspase-3 cleaved in BAG2-deleted cells was expressed and Caspase-3 was found to be increased in activity, which was decreased again by the recovery of BAG2.
- short-chain (SC) cathepsin B was also increased in BAG2-deleted cells, but this decreased again by the recovery of BAG2 as in Caspase-3.
- BAG2 is involved in a mechanism that prevents the conversion of pro-cathepsin B into a mature form of short-cathepsin B from pro-cathepsin B.
- BAG2-deleted MCF10CA1a cells were prepared as in Example 3-1, and BAG2 overexpression was carried out by transfection with a BAG2 expression vector, or BAG2 expression was restored in BAG2-deleted cells.
- mature CTSB is a synthetic peptide containing Arg-Arg as a substrate
- a cell sample prepared according to the manufacturer's instructions with fluorescent-forming cathepsin B substrate (200 ⁇ M Ac-RR-AFC; Abcam) Lt; / RTI > Fluorescence measurements were performed on a Wallac 1440 Victor2 (PerkinElmer) multiple plate detector and the relative fluorescence unit was measured at 460 nm using an excitation wavelength of 355 nm.
- BAG2 and CTSB were not only present in the TNBC cells but also secreted out of the cells.
- Example 2-1 cells in which BAG2 was deleted as in Example 2-1 were prepared in Hs578T, MDA-MB-231, and MCF10ACa1 as TNBC cells, and then cells were cultured in conditioned medium DMEM (Cat. LM001-05, WELGENE) The supernatant was collected while taking care not to collect the cells, and immunoblotted as in Example 2-1. To demonstrate the total amount of protein, some were stained with Kumasi blue (ELT006, ELBIO) according to the instructions of the seller.
- Kumasi blue ELT006, ELBIO
- both BAG2 and CTSB were observed in a medium in which TNBC cells expressing BAG2 were cultured.
- CTSB showed the same tendency as BAG2 expression as pro-CTSB.
- BAG2 was confirmed to be secreted out of the cell, it was further confirmed that it could be secreted into the blood and detected in the blood.
- the P value was expressed as mean + _SD from three independent experiments using a unpaired two-tailed Student's t-test.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims (16)
- 개체로부터 분리된 시료와BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계;상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 상기 시료 중 BAG2 존재 또는 수준을 측정하는 단계; 및상기 시료로부터 측정된 BAG2 존재 또는 수준을 대조군으로부터 측정된 BAG2 수준과 비교하는 단계를 포함하는 암 진단방법.
- 청구항 1에 있어서, 상기 시료는 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합인 것인 방법.
- 청구항 1에 있어서, 상기 BAG2는 혈액, 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합에 가용성인 것인 방법.
- 청구항 1에 있어서, 상기 BAG2 폴리펩티드의 아미노산 서열은 서열번호 1 또는 2의 아미노산 서열을 갖는 것인 방법.
- 청구항 1에 있어서, 상기 방법은 상기 개체로부터 분리된 시료와 카텝신 B(cathepsin B)의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계;상기 카텝신 B의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 카텝신 B의 존재 또는 수준을 측정하는 단계; 및상기 시료로부터 측정된 카텝신 B의 존재 또는 수준과 대조군으로부터 측정된 카텝신 B의 수준과 비교하는 단계를 더 포함하는 방법.
- 청구항 5에 있어서, 상기 카텝신 B는 프로-카텝신 B(pro-cathepsin B)인 것인 방법.
- 청구항 5에 있어서, 상기 카텝신 B 폴리펩티드의 아미노산 서열은 서열번호 3 내지 8 중 선택된 어느 하나의 아미노산 서열을 갖는 것인 방법.
- 청구항 5에 있어서, 상기 시료 중 BAG2 또는 카텝신 B의 존재 또는 수준을 측정하는 단계는 웨스턴 블롯팅, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(Radioimmunoassay: RIA), 방사 면역 확산법radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), FACS, 단백질 칩(protein chip), 또는 이들의 조합에 의해 이루어지는 것인 방법.
- 청구항 1에 있어서, 상기 암은 유방암, 대장암, 폐암, 육종, 흑색종, 두경부암, 자궁경부암, 자궁암, 간암, 신장암, 췌장암, 및 신경아세포종으로부터 선택된 것인 방법.
- 청구항 9에 있어서, 상기 유방암은 전이성 유방암인 방법.
- 청구항 9에 있어서, 상기 유방암은 삼중음성 유방암(triple-negative breast cancer)인 방법.
- 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합에 존재하는 BAG2를 검출하는 것으로서,상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 포함하는 것인 암 진단용 키트.
- 청구항 12에 있어서, 상기 키트는 카텝신 B(cathepsin B)의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 더 포함하는 키트.
- 청구항 12에 있어서, 상기 암은 유방암, 대장암, 폐암, 육종, 흑색종, 두경부암, 자궁경부암, 자궁암, 간암, 신장암, 췌장암, 및 신경아세포종으로부터 선택된 것인 키트.
- 청구항 12에 있어서, 상기 유방암은 전이성 유방암인 키트.
- 청구항 12에 있어서, 상기 유방암은 삼중음성 유방암(triple-negative breast cancer)인 키트.
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES18871731T ES2936208T3 (es) | 2017-10-24 | 2018-10-24 | Método de diagnóstico del cáncer a partir de la sangre con BAG2 |
AU2018354528A AU2018354528B2 (en) | 2017-10-24 | 2018-10-24 | Method for diagnosing cancer from blood |
US16/758,928 US20200309779A1 (en) | 2017-10-24 | 2018-10-24 | Method for diagnosing cancer from blood |
CA3080263A CA3080263C (en) | 2017-10-24 | 2018-10-24 | Method for diagnosing cancer from blood |
JP2020543438A JP7110367B2 (ja) | 2017-10-24 | 2018-10-24 | 血液から癌を診断する方法 |
EP18871731.8A EP3702784B1 (en) | 2017-10-24 | 2018-10-24 | Method for diagnosing cancer from blood with bag2 |
CN201880069653.1A CN111602054A (zh) | 2017-10-24 | 2018-10-24 | 一种从血液诊断癌症的方法 |
JP2022104360A JP2022130598A (ja) | 2017-10-24 | 2022-06-29 | 血液から癌を診断する方法 |
JP2024002969A JP2024038346A (ja) | 2017-10-24 | 2024-01-12 | 血液から癌を診断する方法 |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170138455A KR102230314B1 (ko) | 2017-10-24 | 2017-10-24 | 혈액으로부터 암을 진단하는 방법 |
KR10-2017-0138455 | 2017-10-24 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2019083262A1 true WO2019083262A1 (ko) | 2019-05-02 |
Family
ID=66247606
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2018/012591 WO2019083262A1 (ko) | 2017-10-24 | 2018-10-24 | 혈액으로부터 암을 진단하는 방법 |
Country Status (9)
Country | Link |
---|---|
US (1) | US20200309779A1 (ko) |
EP (1) | EP3702784B1 (ko) |
JP (3) | JP7110367B2 (ko) |
KR (1) | KR102230314B1 (ko) |
CN (1) | CN111602054A (ko) |
AU (1) | AU2018354528B2 (ko) |
CA (1) | CA3080263C (ko) |
ES (1) | ES2936208T3 (ko) |
WO (1) | WO2019083262A1 (ko) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020165797A1 (en) * | 2019-02-12 | 2020-08-20 | Medpacto, Inc. | Methods for diagnosing cancer using anti-bag2 antibody |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20140349403A1 (en) * | 2011-12-12 | 2014-11-27 | The Children's Hospital Of Philadelphia | Large commercial scale lentiviral vector production system and vectors produced thereby |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070105133A1 (en) * | 2005-06-13 | 2007-05-10 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
US20100255470A1 (en) * | 2007-04-05 | 2010-10-07 | Source Percision Medicine, Inc. D/B/A Source Mdx | Gene Expression Profiling for Identification, Monitoring and Treatment of Breast Cancer |
KR20100112192A (ko) * | 2008-02-04 | 2010-10-18 | 바이파 사이언스 인코포레이티드 | Parp-매개된 질병을 진단 및 치료하는 방법 |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1852974A (zh) * | 2003-06-09 | 2006-10-25 | 密歇根大学董事会 | 用于治疗和诊断癌症的组合物和方法 |
WO2012103455A1 (en) * | 2011-01-28 | 2012-08-02 | Pangea Biosciences, Inc. | Biomarkers and their uses in cancer detection and therapy |
WO2013052480A1 (en) * | 2011-10-03 | 2013-04-11 | The Board Of Regents Of The University Of Texas System | Marker-based prognostic risk score in colon cancer |
-
2017
- 2017-10-24 KR KR1020170138455A patent/KR102230314B1/ko active IP Right Grant
-
2018
- 2018-10-24 US US16/758,928 patent/US20200309779A1/en active Pending
- 2018-10-24 ES ES18871731T patent/ES2936208T3/es active Active
- 2018-10-24 AU AU2018354528A patent/AU2018354528B2/en active Active
- 2018-10-24 JP JP2020543438A patent/JP7110367B2/ja active Active
- 2018-10-24 CN CN201880069653.1A patent/CN111602054A/zh active Pending
- 2018-10-24 WO PCT/KR2018/012591 patent/WO2019083262A1/ko unknown
- 2018-10-24 EP EP18871731.8A patent/EP3702784B1/en active Active
- 2018-10-24 CA CA3080263A patent/CA3080263C/en active Active
-
2022
- 2022-06-29 JP JP2022104360A patent/JP2022130598A/ja active Pending
-
2024
- 2024-01-12 JP JP2024002969A patent/JP2024038346A/ja active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070105133A1 (en) * | 2005-06-13 | 2007-05-10 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
US20100255470A1 (en) * | 2007-04-05 | 2010-10-07 | Source Percision Medicine, Inc. D/B/A Source Mdx | Gene Expression Profiling for Identification, Monitoring and Treatment of Breast Cancer |
KR20100112192A (ko) * | 2008-02-04 | 2010-10-18 | 바이파 사이언스 인코포레이티드 | Parp-매개된 질병을 진단 및 치료하는 방법 |
Non-Patent Citations (3)
Title |
---|
DATABASE PROTEIN 23 March 2015 (2015-03-23), VENTER J:C: ET AL.: "BCL2-associated athanogene 2 [Homo sapiens)", XP055595392, retrieved from NCBI Database accession no. EAX04475 * |
DATABASE PROTEIN 7 April 1994 (1994-04-07), CAO L. ET AL.: "cathepsin B [Homo sapiens", XP055595393, retrieved from NCBI Database accession no. AAC37547 * |
YANG, KYUNG-MIN: "Co-chaperone BAG2 determines the pro-oncogenic role of cathepsin B in triple-negative breast cancer cells", CELL REPORTS, vol. 21, no. 1010, 5 December 2017 (2017-12-05), pages 2952 - 2964, XP055595394, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2017.11.026 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020165797A1 (en) * | 2019-02-12 | 2020-08-20 | Medpacto, Inc. | Methods for diagnosing cancer using anti-bag2 antibody |
WO2020165794A1 (en) * | 2019-02-12 | 2020-08-20 | Medpacto, Inc. | Anti-bag2 antibody and methods of treating cancer |
EP3938788A4 (en) * | 2019-02-12 | 2023-01-04 | Medpacto, Inc. | METHOD OF DIAGNOSIS OF CANCER USING ANTI-BAG2 ANTIBODIES |
EP3924382A4 (en) * | 2019-02-12 | 2023-01-04 | Medpacto Inc. | ANTI-BAG2 ANTIBODIES AND METHODS OF TREATMENT OF CANCER |
Also Published As
Publication number | Publication date |
---|---|
EP3702784B1 (en) | 2023-01-04 |
AU2018354528B2 (en) | 2022-04-07 |
JP2021508832A (ja) | 2021-03-11 |
CN111602054A (zh) | 2020-08-28 |
EP3702784A4 (en) | 2021-05-26 |
KR102230314B1 (ko) | 2021-03-22 |
ES2936208T3 (es) | 2023-03-15 |
AU2018354528A1 (en) | 2020-08-13 |
JP2024038346A (ja) | 2024-03-19 |
KR20190045638A (ko) | 2019-05-03 |
CA3080263C (en) | 2023-03-07 |
US20200309779A1 (en) | 2020-10-01 |
JP7110367B2 (ja) | 2022-08-01 |
EP3702784A1 (en) | 2020-09-02 |
CA3080263A1 (en) | 2019-05-02 |
JP2022130598A (ja) | 2022-09-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP2006510008A (ja) | アクチビンβCのレベルの調節によって特徴付けられる状態のための診断方法、治療方法、および有用な薬剤 | |
JP2024038346A (ja) | 血液から癌を診断する方法 | |
AU2010268979B2 (en) | New tumor marker | |
US20200271673A1 (en) | Biomarker | |
WO2012112013A2 (en) | A marker comprising anti-ck8/18 complex autoantibody and its use for diagnosing cancer | |
Liang et al. | VASN promotes colorectal cancer progression by activating the YAP/TAZ and AKT signaling pathways via YAP | |
WO2011081421A9 (en) | Complement c9 as markers for the diagnosis of cancer | |
KR101680360B1 (ko) | Del-1 단백질 양성 엑소좀을 포함하는 암 진단 또는 예후 예측용 조성물 | |
WO2012141373A1 (ko) | 폐암 조기 진단용 XAGE-1a 마커 및 이의 용도 | |
KR101649591B1 (ko) | 신규 급성백혈병의 진단용 마커 | |
EP2541249A1 (en) | EpCAM detection | |
KR20200025706A (ko) | Fgf 21을 포함하는 갑상선 암 진단 또는 갑상선 암 예후 예측용 바이오마커 조성물 | |
WO2014041064A1 (en) | New biomarkers for the diagnosis and/or prognosis of clear cell renal cell carcinoma | |
WO2021118243A1 (ko) | Wasf2 자가항체를 이용한 간세포암종 조기진단용 조성물 | |
WO2015133772A1 (ko) | 신규 대장암의 바이오마커 및 그를 표적으로 하는 항암제 | |
WO2018092964A1 (ko) | Lmcd1 단백질 및 이를 코딩하는 유전자를 이용한 전이성 암 또는 탁산계 약물 저항성 암 진단방법 | |
WO2012144871A2 (ko) | 단백질의 위치 변화 확인을 통한 신경교종의 진단 및 치료 방법 | |
Zhang et al. | The ratio of SRSF1-IS1/IS2 mRNA is a marker of clinical prognosis in pediatric B-ALL and SRSF1 isoforms differentially regulate apoptosis and proliferation on leukemic cells | |
Nothnick et al. | Prefoldin-5 Expression Is Elevated in Eutopic and Ectopic Endometriotic Epithelium and Modulates Endometriotic Epithelial Cell Proliferation and Migration In Vitro | |
AU2014203702B2 (en) | New tumor marker | |
WO2017200263A1 (ko) | Lrp-1을 유효성분으로 포함하는 방사선 저항성 암 진단용 또는 방사선 치료 예후 예측용 바이오마커 조성물 | |
Alami | The role of HGF and met in Wilms tumour | |
WO2016148313A1 (ko) | Del-1 단백질 양성 엑소좀을 포함하는 암의 진단 또는 예후 예측용 바이오마커 조성물 | |
WO2014125879A1 (ja) | c-MET遺伝子増幅細胞の検出方法 | |
WO2010093066A1 (en) | Ppia marker for diagnosis of liver cancer and antibody, and screening method of compounds useful for inhibiting liver cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18871731 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 3080263 Country of ref document: CA Ref document number: 2020543438 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2018871731 Country of ref document: EP Effective date: 20200525 |
|
ENP | Entry into the national phase |
Ref document number: 2018354528 Country of ref document: AU Date of ref document: 20181024 Kind code of ref document: A |