WO2019083262A1 - 혈액으로부터 암을 진단하는 방법 - Google Patents

혈액으로부터 암을 진단하는 방법

Info

Publication number
WO2019083262A1
WO2019083262A1 PCT/KR2018/012591 KR2018012591W WO2019083262A1 WO 2019083262 A1 WO2019083262 A1 WO 2019083262A1 KR 2018012591 W KR2018012591 W KR 2018012591W WO 2019083262 A1 WO2019083262 A1 WO 2019083262A1
Authority
WO
WIPO (PCT)
Prior art keywords
bag2
cancer
polypeptide
cathepsin
combination
Prior art date
Application number
PCT/KR2018/012591
Other languages
English (en)
French (fr)
Inventor
김성진
양경민
Original Assignee
재단법인차세대융합기술연구원
주식회사 메드팩토
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인차세대융합기술연구원, 주식회사 메드팩토 filed Critical 재단법인차세대융합기술연구원
Priority to ES18871731T priority Critical patent/ES2936208T3/es
Priority to AU2018354528A priority patent/AU2018354528B2/en
Priority to US16/758,928 priority patent/US20200309779A1/en
Priority to CA3080263A priority patent/CA3080263C/en
Priority to JP2020543438A priority patent/JP7110367B2/ja
Priority to EP18871731.8A priority patent/EP3702784B1/en
Priority to CN201880069653.1A priority patent/CN111602054A/zh
Publication of WO2019083262A1 publication Critical patent/WO2019083262A1/ko
Priority to JP2022104360A priority patent/JP2022130598A/ja
Priority to JP2024002969A priority patent/JP2024038346A/ja

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures

Definitions

  • the present invention relates to a method for diagnosing cancer from BAG2, pro-cathepsin B, or a combination thereof, which is present in blood. More specifically, the present invention relates to a method for diagnosing triple-negative breast cancer.
  • BAG co-chaperone Bcl-2-associated athanogene protein
  • BAG2 The main role of BAG2 in the regulation of proteins through inhibition of CHIP activity has been linked to neurodegenerative diseases and endocrine biologic disorders through the stabilization of chaperone-related proteins such as PINK1 and CFTR (Qu et al., 2015; Arndt et al ., 2005).
  • BAG2 expression increases proteasome inhibitor - induced apoptosis, and BAG2 knockdown inhibits apoptosis partially by inhibiting apoptosis when exposed to proteasome inhibitor MG132, a thyroid carcinoma cell, pro-apoptotic activity (Wang et al., 2008).
  • CTSB Cathepsin B
  • CTSB Cathepsin B
  • mature CTSB is generally recognized to exhibit an incendiary-apoptotic role of cytoplasmic CTSB by functioning in the protein cycle as an inhibitor protease during lysosome-mediated autophagy / apoptosis, generally located in lysosomes (Stoka et al Foghsgaard et al., 2001; Bhoopathi et al., 2010).
  • the modulator of this dual function of CTSB in cancer progression is not clear.
  • One aspect includes contacting an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof to a sample separated from the subject; Measuring the presence or level of BAG2 in the sample from a complex formed by contacting an antibody, polypeptide, or a combination thereof specifically binding to the BAG2 polypeptide or fragment thereof; And comparing the presence or level of BAG2 measured from the sample to a BAG2 level determined from a control.
  • Another aspect is the detection of BAG2 present in blood, serum, plasma, or a combination thereof, comprising an antibody, polypeptide, or combination thereof that specifically binds to said BAG2 polypeptide or fragment thereof Cancer diagnosis kit.
  • One aspect includes contacting an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof to a sample separated from the subject; Measuring the presence or level of BAG2 in the sample from a complex formed by contacting an antibody, polypeptide, or a combination thereof specifically binding to the BAG2 polypeptide or fragment thereof; And comparing the presence or level of BAG2 measured from the sample to a BAG2 level determined from a control.
  • the method is for providing information for diagnosing cancer, which comprises detecting the presence of cancer in an individual and diagnosing cancer present in the subject.
  • An antibody, polypeptide, or a combination thereof that specifically binds to a BAG2 polypeptide or fragment thereof when BAG2 is present in a sample isolated from the subject can bind to BAG2 in the sample.
  • the antibody or polypeptide may be, for example, a fluorophore, a chromophore, or an enzyme capable of converting a substrate into a chromophore to visualize the presence of BAG2 in the sample.
  • the step of measuring the complex comprises the steps of: Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, FACS, protein chip, or a combination thereof, for example, as described above.
  • the presence or level of BAG2 measured from the sample can be compared to the level of BAG2 measured from the control to diagnose whether the subject is cancerous.
  • the control group may be a sample taken from a healthy subject, or a sample taken from an average of various types of breast cancer patients, non-metastatic breast cancer patients, or non-TNBC type breast cancer patients as needed.
  • the level of BAG2 measured from the control group can be determined by measuring the BAG2 concentration in a sample taken from a healthy individual at the BAG2 level, or in a sample taken from an average of various types of breast cancer patients, non-metastatic breast cancer patients, May mean an average value.
  • the sample used as the control group may be the same kind of sample collected at the same anatomical position as the sample for diagnosis.
  • the control may also be blood collected from the control pulmonary vein.
  • the healthy individual may not be suffering from any acute or chronic disease, and may not suffer from at least cancer, preferably not suffering from breast cancer.
  • the level of BAG2 in the sample taken from the healthy subject may be substantially free of BAG2. Therefore, if the control group is set to a value obtained from a healthy individual, it can be suspected that the subject is suffering from cancer if the presence of BAG2 in the subject being diagnosed is measured or the level is measured to be significantly higher. On the other hand, as shown in the examples of the present invention, the presence of BAG2 in the blood of patients with metastatic breast cancer, especially TNBC type among breast cancer patients is highly probable and the average value is remarkably high.
  • control group when the control group is set as a sample isolated from various types of breast cancer patients, non-metastatic breast cancer patients or non-TNBC type breast cancer patients, the level of BAG2 in the subject to be diagnosed is higher than that of the control group , The subject may be suspected of having metastatic breast cancer or TNBC type breast cancer.
  • &quot As used herein, the term " polypeptide " is used interchangeably with " protein ".
  • the sample is a sample separated from a subject to be diagnosed and is a cell, an organ, a cell lysate, a whole blood, a blood, a serum, a plasma, a lymphatic fluid, an extracellular fluid, a body fluid, a urine, a feces, a tissue, a marrow, a saliva, Or a combination thereof.
  • the sample can be blood, serum, plasma, or a combination thereof.
  • BAG2 can be secreted out of the cell and that BAG2 is actually detected in the blood of a breast cancer patient.
  • the BAG2 may be soluble in blood, blood, serum, plasma, or a combination thereof.
  • the diagnostic method of the present invention comprises the steps of contacting a sample, separated from said subject, with an antibody, polypeptide, or combination thereof that specifically binds to a polypeptide of cathepsin B (cathepsin B) or a fragment thereof; Measuring the presence or level of cathepsin B from a complex formed by contacting an antibody, polypeptide, or a combination thereof specifically binding to the polypeptide of cathepsin B or a fragment thereof; And comparing the presence or level of cathepsin B measured from the sample to the level of cathepsin B measured from the control.
  • the diagnostic method of the present invention can further increase the accuracy of diagnosis by simultaneously detecting BAG2 and cathepsin B.
  • Cathepsin B can be divided into pro-cathepsin B and a mature form, single-chain or double-chain cathepsin B.
  • the inventors have found that cathepsin B, which is not matured by BAG2, Was secreted out of the cell.
  • the cathepsin B may be pro-cathepsin B.
  • the pro-cathepsin B may be used in the same sense as " immature cathepsin B " or " immature CTSB ".
  • the step of measuring a complex formed by contacting an antibody, polypeptide, or combination thereof specifically binding to a polypeptide of cathepsin B and cathepsin B or a fragment thereof in the sample may be performed by Western blotting, Immunoassay, ELISA, radioimmunoassay, radioimmunoprecipitation, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, complement fixation assays, FACS, protein chips, or a combination thereof.
  • the term " antibody" means a specific immunoglobulin directed against an antigenic site.
  • the antibody refers to a polypeptide or a combination of polypeptides that specifically bind to BAG2 and pro-cathepsin B, respectively.
  • the BAG2 or pro-cathepsin B gene is cloned into an expression vector to obtain a protein encoded by each gene, From the obtained BAG2 or pro-cathepsin B protein, antibodies specific for each protein can be prepared according to methods customary in the art.
  • the form of the antibody includes a polyclonal antibody, a monoclonal antibody, or a recombinant antibody (e.g., ScFv fragment, diabody, single chain antibody, etc.) and includes all immunoglobulin antibodies.
  • the antibody does not have the structure of a complete intact antibody with two light and two heavy chains as well as a complete form with two light and two heavy chains as well as two light and two heavy chains, But also functional fragments of antibody molecules which have specific antigen binding sites (binding domains) and which possess antigen binding function.
  • the BAG2 and pro-cathepsin B polypeptides may be derived from human ( Homo sapiens ) or mouse ( Mus musculus ), respectively, and may be derived from other mammals such as monkey, cow, horse and the like.
  • the amino acid sequence of BAG2 may include SEQ ID NO: 1 or 2 (GenBank Accession No. NP_004273.1 and NP_663367.1, respectively), and the amino acid sequence of pro-cathepsin B may be SEQ ID NO: 3 to 8 , GenBank Accession No. NP_001899.1, NP_680090.1, NP_680091.1, NP_680092.1, NP_680093.1, or NP_031824.1).
  • the amino acid sequence which has a biologically equivalent activity can be regarded as BAG2 or pro-cathepsin B polypeptide.
  • the BAG2 or pro-cathepsin B polypeptide may have 60% or more, such as 70% or more, 80% or more, 90% or more, 95% or more, more preferably 60% or more of SEQ ID NO: 1 or 2 and SEQ ID NO: , 99% or more, or 100% sequence identity.
  • the BAG2 or pro-cathepsin B polypeptide may be a polypeptide having at least one amino acid, at least two amino acids, at least three amino acids, at least four amino acids , 5 or more amino acids, 6 or more amino acids, or 7 or more amino acid residues.
  • the subject to be diagnosed may be a mammal such as a human, mouse, rat, cow, horse, pig, dog, sheep, goat or cat, to be.
  • the cancer that can be diagnosed by the diagnostic method of the invention is selected from breast cancer, colon cancer, lung cancer, sarcoma, melanoma, head and neck cancer, cervical cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, .
  • the present inventors have demonstrated that BAG2 is overexpressed in breast cancer patients, and in particular, breast cancer patients whose BAG2 levels are high have a high probability of metastatic breast cancer.
  • the breast cancer that may be diagnosed by the diagnostic method of the present invention may be metastatic breast cancer.
  • TNBC triple-negative breast cancer
  • TNBC patients do not have three target receptors (ER, PR, and HER2) or other well-defined molecular targets, (Eg, poly ADP-ribose polymerase (PARP), epidermal growth factor receptor (EGFR), and Src tyrosine kinase).
  • ER target receptor
  • PR target receptor
  • HER2 target receptors
  • Eg poly ADP-ribose polymerase
  • EGFR epidermal growth factor receptor
  • Src tyrosine kinase Src tyrosine kinase
  • the inventors have demonstrated that BAG2 is overexpressed in breast cancer patients, and breast cancer patients, especially those with high levels of BAG2, have a high probability of suffering from TNBC type breast cancer.
  • the breast cancer that can be diagnosed by the diagnostic method of the present invention may be triple negative breast cancer (or TNBC type breast cancer).
  • kits comprising an antibody, a polypeptide, or a combination thereof that specifically binds to said BAG2 polypeptide or fragment thereof.
  • the kit is for detecting BAG2 present in blood, serum, plasma, or a combination thereof, wherein the sample applied to the kit provides blood, serum, plasma, or combinations thereof separated from the individual.
  • the kit may further comprise an antibody, a polypeptide, or a combination thereof that specifically binds to a polypeptide of cathepsin B or a fragment thereof.
  • the kit can be used to analyze the kit using the assay methods used (e.g., Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, Assay, FACS, protein chip, or a combination thereof).
  • the assay methods e.g., Western blotting, ELISA, radioimmunoassay, radial immunodiffusion, Ouchteroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, Assay, FACS, protein chip, or a combination thereof.
  • it may further comprise a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate for the detection of an immune complex of BAG2 or cathepsin B in the sample with an antibody specific thereto .
  • the substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a glass slide glass or the like, and peroxidase, alkaline phosphatase, Azo-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) or o-phenylenediamine (OPD) as a coloring substrate, , Tetramethylbenzidine (TMB), and the like.
  • ABTS Azo-bis (3-ethylbenzothiazoline-6-sulfonic acid)
  • OPD o-phenylenediamine
  • the method of diagnosing cancer by measuring the presence or level of serum BAG2 polypeptide enables diagnosis of cancer more easily and more accurately than the conventional method of collecting tissue for diagnosis of cancer.
  • cancer diagnostic method can be readily utilized for cancer diagnosis in various diagnostic institutions by a cancer diagnostic kit for measuring the presence or level of BAG2 polypeptide in blood from the blood.
  • Figure 1 shows a volcano plot analyzing the differences in the expression levels of BAG family in resistant and TNBC cell lines using RNA sequencing.
  • Figure 2 shows the amount of BAG2 mRNA expression in intact and TNBC cell lines analyzed from a volunteer plot.
  • FIG. 3 is a scatter dot-plot of the amount of BAG2 expression analyzed from 52 breast cancer cell lines.
  • FIG. 4 shows microarray (4A) and RNA sequencing results (4B) in which BAG2 expression levels were analyzed in normal and breast cancer cell types.
  • FIG. 5 shows the results of quantitative RT-PCR analysis of the amount of BAG2 expression in the stroma and TNBC tissues.
  • Figure 6 shows the effect of BAG2 on CTSB morphology and activity in terms of immunoblot (6A) and CTSB activity (6B).
  • Fig. 7 shows the results of immunoblotting of BAG2 and CTSB from the conditioned medium in which TNBC was cultured.
  • Fig. 8 is a graph showing the level of pro-cathepsin B detected from the conditioned medium in which TNBC was cultured.
  • FIG. 9 shows the results of immunoblotting detection of BAG2 and CTSB detected from the conditioned medium in which the BAG2 overexpressing cell line was cultured.
  • FIG. 10 shows the results of detecting the presence of BAG2 from the serum of healthy human and breast cancer patients.
  • RNA sequencing in breast cancer cell lines To identify novel molecular targets associated with TNBC progression, we first performed transcript analysis using RNA sequencing in breast cancer cell lines. First, RNA was extracted from various breast cancer cell lines using a method well known in the art, and the genome analysis was commissioned by the company (terazene dithex). After that, the expression levels of BAG2 were compared among the breast cancer cell lines, which were classified as strong (MCF-7, T47D, ZR-75B) or TNBC (MDA-MB-231 and Hs578T).
  • Example 1-1 the BAG2 expression pattern was confirmed in a wider variety of breast cancer cells.
  • Breast cancer cell information was obtained from the public microarray data set (GSE41313, Riaz et al., 2013).
  • BAG2 expression was significantly higher in TNBC than that in Luminal ( P ⁇ 0.0001), as shown in Fig. 3, in 52 breast cancer cell lines disclosed in Riaz et al. )
  • the present inventors have used the RNA sequencing data sets and microarrays of breast cancer patients obtained from the Cancer Genome Atlas (TCGA) BAG2 expression was analyzed.
  • TCGA Cancer Genome Atlas
  • BAG2 expression was significantly higher in patients with TNBC compared with patients with normal, resistant A (Lum A), resistant B (Lum B), and HER2- , Respectively.
  • Quantitative RT-PCR was performed in order to experimentally confirm the above trends analyzed using an open database.
  • BAG2 could act as a regulator of cathepsin B regulation
  • BAG2 was examined the interaction of BAG2 and cathepsin B and the changes in the activity of cathepsin B by BAG2.
  • BAG2-specific shRNAs were first purchased from Mission-shRNA (Sigma) to produce BAG2-deleted cell lines.
  • BAG2-specific shRNA lentivirus 293T cells were transfected with pLKO-BAG2 or a scrambled control pLKO-pGL2 with packaging plasmids encoding ⁇ 8.9 and VSV-G (the target sequence of the BAG2 shRNA used (5 '- >3'): GTACTAGGATCTAGCATATTT). The virus supernatant was collected 36-48 hours after the transfection and filtered through a 0.45 [mu] m filter.
  • MDA-MB-231 (ATCC) was seeded in a 6-well plate at 1 ⁇ 10 5 cells / well and infected with virus particles and polybrene (8 ⁇ g / ml). After infection, the medium containing the virus was replaced with normal medium, and the cells were then selected as furomycin (2 / / ml).
  • the prepared BAG2 deletion cell line was designated as BAG2 shRNA.
  • BAG2 Myc-tag BAG2 expression vector was transfected into MDA-MB-231 (ATCC) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, and BAG2 overexpressing cells were designated BAG2 OV, BAG2 shRNA was transfected into BAG2 shRNA as BAG2 recovered BAG2 rescue.
  • CTSB antibodies recognize both pro-form and mature forms of CTSB (single chain) and DC (double chain), and thus can be classified into molecular weights.
  • caspase-3 cleaved in BAG2-deleted cells was expressed and Caspase-3 was found to be increased in activity, which was decreased again by the recovery of BAG2.
  • short-chain (SC) cathepsin B was also increased in BAG2-deleted cells, but this decreased again by the recovery of BAG2 as in Caspase-3.
  • BAG2 is involved in a mechanism that prevents the conversion of pro-cathepsin B into a mature form of short-cathepsin B from pro-cathepsin B.
  • BAG2-deleted MCF10CA1a cells were prepared as in Example 3-1, and BAG2 overexpression was carried out by transfection with a BAG2 expression vector, or BAG2 expression was restored in BAG2-deleted cells.
  • mature CTSB is a synthetic peptide containing Arg-Arg as a substrate
  • a cell sample prepared according to the manufacturer's instructions with fluorescent-forming cathepsin B substrate (200 ⁇ M Ac-RR-AFC; Abcam) Lt; / RTI > Fluorescence measurements were performed on a Wallac 1440 Victor2 (PerkinElmer) multiple plate detector and the relative fluorescence unit was measured at 460 nm using an excitation wavelength of 355 nm.
  • BAG2 and CTSB were not only present in the TNBC cells but also secreted out of the cells.
  • Example 2-1 cells in which BAG2 was deleted as in Example 2-1 were prepared in Hs578T, MDA-MB-231, and MCF10ACa1 as TNBC cells, and then cells were cultured in conditioned medium DMEM (Cat. LM001-05, WELGENE) The supernatant was collected while taking care not to collect the cells, and immunoblotted as in Example 2-1. To demonstrate the total amount of protein, some were stained with Kumasi blue (ELT006, ELBIO) according to the instructions of the seller.
  • Kumasi blue ELT006, ELBIO
  • both BAG2 and CTSB were observed in a medium in which TNBC cells expressing BAG2 were cultured.
  • CTSB showed the same tendency as BAG2 expression as pro-CTSB.
  • BAG2 was confirmed to be secreted out of the cell, it was further confirmed that it could be secreted into the blood and detected in the blood.
  • the P value was expressed as mean + _SD from three independent experiments using a unpaired two-tailed Student's t-test.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

개체로부터 분리된 시료와 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계; 상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 상기 시료 중 BAG2 존재 또는 수준을 측정하는 단계; 및 상기 시료로부터 측정된 BAG2 존재 또는 수준을 대조군으로부터 측정된 BAG2 수준과 비교하는 단계를 포함하는 암을 진단하는 방법 및 암을 진단하기 위한 키트에 관한 것이다.

Description

혈액으로부터 암을 진단하는 방법
혈액 중에 존재하는 BAG2, 프로-카텝신 B, 또는 이들의 조합으로부터 암을 진단하는 방법에 관한 것으로서, 구체적으로 삼중음성 유방암을 진단하는 방법에 관한 것이다.
BAG (co-chaperone Bcl-2-associated athanogene) 단백질 패밀리는 세포 내 단백질 폴딩, 스트레스 반응, 신경 분화, 세포 사멸, 세포 증식 등을 포함하는 다양한 생리학적 과정을 매개하고 다양한 협력 단백질들과 기능적으로 결합한다 (Takayama and Reed., 2001; Doong et al., 2002). 이들 중 항-세포 사멸 활성을 갖는 BAG 도메인 패밀리 구성원 중 하나인 BAG2는 샤페론-관련 유비퀴틴 리가제인 CHIP (C-terminus of Hsc70-interacting protein)의 음성 조절자로서 알려져 있다 (Arndt et al., 2005; Dai et al., 2005). CHIP 활성을 억제를 통한 단백질의 조절에서 BAG2의 주 역할은 PINK1 및 CFTR과 같은 샤페론 관련 단백질의 안정화를 통해 신경퇴행성 질환 및 상염생체 열성 장애와 관련되어 있다 (Qu et al., 2015; Arndt et al., 2005). BAG2의 발현은 프로테아좀 억제자-유도된 세포사멸을 증가시키고, BAG2 녹다운은 갑상선 암종 세포를 프로테아좀 억제자인 MG132에 노출시키는 경우, 세포 사멸을 부분적으로 억제함으로써, BAG2가 향-세포사멸(pro-apoptotic) 활성을 가질 수 있음이 제시된바 있다(Wang et al., 2008). 한편, 다양한 돌연변이 K-Ras-유도된 종양에서, BAG2의 과발현이 강력한 종양 유전자인 STK33 단백질의 안정화를 촉진시켜 종양 발생을 촉진시킬 수 있음이 제시된 바 있다 (Azoitei et al., 2012). 그러나 이러한 발견들에도 불구하고, 암 진행 및 전이에서의 BAG2 역할, 특히 유방암에 있어서는 분명하게 밝혀진 바 없다.
카텝신 B (Cathepsin B; CTSB)는 내재적 및 외래적 펩티다제 활성을 갖는 리소조말 시스테인 프로테아제로서, 단백질 순환 역할을 하는 것으로 생각된다 (Mort and Buttle, 1997). CTSB는 불활성/미성숙 전-형태(pro-form) 효소 (41/43 kDa)로서 합성되어, N-말단의 62개 아미노산 전-펩티드의 단백질 가수분해 과정을 통해 활성 단쇄 형태 (31 kDa) 또는 이중쇄 형태 (중쇄(heavy chain), 25/26 kDa; 경쇄 (light chain), 5 kDa)로 전환된다. CTSB의 이상적(aberrant) 발현/활성은 종종 악성 종양과 연결되어 왔다 (Joyce et al., 2004; Withans, 2012). 그러나, 성숙한 CTSB는 일반적으로 리소좀에 위치하여 리소좀-매개된 자가포식(autophagy)/세포사멸 동안 억제자 프로테아제로서 단백질 순환에서 기능함으로써 세포질 CTSB의 향-세포사멸적 역할을 나타내는 것으로 인식된다 (Stoka et al., 2001; Foghsgaard et al., 2001; Bhoopathi et al., 2010). 한편, 암 진행에서의 이러한 CTSB의 이중적 기능의 조절자는 명확히 밝혀지지 않았다.
더욱이, 세포에서 BAG2 및 카텝신 B의 존재 위치, 분포, 세포의 기능에 따른 위치 이동 등에서 대해서는 자세히 연구된 바가 없다.
일 양상은 개체로부터 분리된 시료와 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계; 상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 상기 시료 중 BAG2 존재 또는 수준을 측정하는 단계; 및 상기 시료로부터 측정된 BAG2 존재 또는 수준을 대조군으로부터 측정된 BAG2 수준과 비교하는 단계를 포함하는 암을 진단하는 방법을 제공한다.
다른 양상은 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합에 존재하는 BAG2를 검출하는 것으로서, 상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 포함하는 것인 암 진단용 키트를 제공한다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한, 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 전체가 본 명세서에 참고로 통합된다.
일 양상은 개체로부터 분리된 시료와 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계; 상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 상기 시료 중 BAG2 존재 또는 수준을 측정하는 단계; 및 상기 시료로부터 측정된 BAG2 존재 또는 수준을 대조군으로부터 측정된 BAG2 수준과 비교하는 단계를 포함하는 암 진단방법을 제공한다.
다른 구체예에서, 상기 방법은 암을 진단하기 위한 정보를 제공하는 방법으로서, 개체에서 암의 존재를 검출하여 개체 내에 존재하는 암을 진단하기 위한 것이다.
개체로부터 분리된 시료 중에 BAG2가 존재하는 경우 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합이 상기 시료 중의 BAG2와 결합할 수 있다. 상기 항체 또는 폴리펩티드는 상기 시료 중의 BAG2의 존재를 시각화하기 위하여, 예를 들어, 형광물질(fluorophore), 발색단 (chromophore), 또는 기질을 발색단으로 전환시킬 수 있는 효소로 표지된 것일 수 있다.
상기 결합 반응으로 인하여 상기 시료 중의 BAG2가 상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합과 복합체를 형성하게 되고, 상기 복합체로부터 통상의 기술자에게 알려진 방법을 이용하여 BAG2 존재, 또는 필요에 따라 그 수준을 측정할 수 있다. 일 구체예에서 상기 복합체를 측정하는 단계는 웨스턴 블롯팅, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(Radioimmunoassay: RIA), 방사 면역 확산법radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), FACS, 단백질 칩(protein chip), 또는 이들의 조합에 의한 것일 수 있다.
상기 시료로부터 측정된 BAG2 존재 또는 수준을 대조군으로부터 측정된 BAG2 수준과 비교하여 상기 개체에 암이 존재하는지 여부를 진단할 수 있다. 상기 대조군은 건강한 개체로부터 채취된 시료, 또는 필요에 따라 다양한 유형의 유방암 환자 평균, 비전이성 유방암 환자, 또는 TNBC형이 아닌 유방암 환자로부터 채취된 시료일 수 있다. 따라서, 상기 대조군으로부터 측정된 BAG2 수준은 BAG2 수준의 건강한 개체로부터 채취된 시료, 또는 필요에 따라 다양한 유형의 유방암 환자 평균, 비전이성 유방암 환자 또는 TNBC형이 아닌 유방암 환자로부터 채취된 시료 중의 BAG2 농도의 평균 값을 의미하는 것일 수 있다. 상기 대조군으로 사용되는 시료는 상기 진단을 위한 시료와 해부학적으로 동일한 위치에서 채취한 것으로서 동일한 종류의 것일 수 있다. 예를 들어, 상기 시료가 개체의 팔오금중간정맥(Median Cubital Vein)으로부터 채취된 혈액이라면, 상기 대조군 또한 대조군의 팔오금중간정맥으로부터 채취된 혈액일 수 있다. 상기 건강한 개체는 임의의 급성 또는 만성적 질환을 앓고 있지 않은 것으로서, 적어도 암을 앓고 있지 않고, 바람직하게는 유방암을 앓고 있지 않은 것일 수 있다.
상기 건강한 개체로부터 채취된 시료 중의 BAG2 수준은 BAG2가 실질적으로 존재하지 않는 것일 수 있다. 따라서, 대조군을 건강한 개체로부터 수득된 값으로 설정하는 경우, 진단 대상이 되는 개체에서 BAG2의 존재가 측정되거나 그 수준이 현저하게 높은 것으로 측정된다면, 상기 개체는 암을 앓고 있는 것으로 의심할 수 있다. 반면, 본 발명의 실시예에서 보여주는 바와 같이, 유방암 환자 중 전이성 유방암 환자, 특히 TNBC형 환자의 혈액에서는 BAG2의 존재가 측정될 확률이 높고 평균 값이 현저하게 높다. 따라서, 대조군을 다양한 유형의 유방암 환자 평균, 비전이성 유방암 환자 또는 TNBC형이 아닌 유방암 환자로부터 분리된 시료로 설정하는 경우, 진단 대상이 되는 개체에서 BAG2의 수준이 상기 대조군의 경우 보다 높거나, 현저하게 높은 것으로 측정된다면, 상기 개체는 전이성 유방암 또는 TNBC 형 유방암을 앓고 있는 것으로 의심할 수 있다.
본 명세서에서 상기 '폴리펩티드'는 '단백질'과 상호 교환적으로 쓰인다.
상기 시료는 진단의 대상이 되는 개체로부터 분리된 것으로서 세포, 기관, 세포 용해물, 전혈, 혈액, 혈청, 혈장, 림프액, 세포 외액, 체액, 소변, 분변, 조직, 골수, 타액, 객담, 뇌척수액 또는 이들의 조합일 수 있다.
일 구체예에서, 상기 시료는 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합일 수 있다. 본 발명자들은 BAG2가 세포 밖으로 분비될 수 있고, 실제로 유방암 환자의 혈액에서 BAG2가 검출됨을 증명하였다. 따라서, 일 구체예에서, 상기 BAG2는 혈액, 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합에 가용성인 것일 수 있다.
일 구체예에서, 본 발명의 진단방법은, 상기 개체로부터 분리된 시료와 카텝신 B(cathepsin B)의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계; 상기 카텝신 B의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 카텝신 B의 존재 또는 수준을 측정하는 단계; 및 상기 시료로부터 측정된 카텝신 B의 존재 또는 수준과 대조군으로부터 측정된 카텝신 B의 수준과 비교하는 단계를 더 포함할 수 있다.
본 발명자들은 BAG2는 카텝신 B가 성숙한 형태로 전환되는 것을 방해하여 결과적으로 암세포의 세포 사멸(apoptosis)를 억제할 수 있음을 증명하였고, 이와 일치하여 BAG2 및 성숙되지 못한 형태의 카텝신 B가 모두 세포 밖으로 분비됨을 관찰하였다. 따라서, 본 발명의 진단방법은 BAG2 및 카텝신 B를 동시에 검출함으로써 진단의 정확도를 더욱 상승시킬 수 있다.
카텝신 B는 프로-카텝신 B 및 성숙한 형태인 단쇄(single-chain) 또는 이중쇄(double-chain) 카텝신 B로 구분될 수 있는데, 본 발명자들은 BAG2에 의해서 성숙되지 못한 형태의 카텝신 B가 세포 밖으로 분비됨을 증명하였다. 따라서, 일 구체예에서, 본 발명의 진단방법에서 상기 카텝신 B는 프로-카텝신 B(pro-cathepsin B)일 수 있다. 상기 프로-카텝신 B는 '미성숙 카텝신 B' 또는 '미성숙 CTSB'와 동일한 의미로 사용된 것일 수 있다.
일 구체예에서, 상기 시료 중의 카텝신 B 및 상기 카텝신 B의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체를 측정하는 단계는 웨스턴 블롯팅, ELISA, 방사선면역분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 면역침전 분석법, 보체 고정 분석법, FACS, 단백질 칩, 또는 이들의 조합에 의한 것일 수 있다.
용어 "항체"는 항원성 부위에 대하여 지시되는 특이적인 면역 글로불린을 의미한다. 상기 항체는 BAG2 및 프로-카텝신 B 각각에 특이적으로 결합하는 폴리펩티드 또는 폴리펩티드의 조합을 의미하며, BAG2 또는 프로-카텝신 B 유전자를 발현 벡터에 클로닝하여 각 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 BAG2 또는 프로-카텝신 B 단백질로부터 당업계 통상적인 방법에 따라 각 단백질에 대해 특이적인 항체를 제조할 수 있다. 상기 항체의 형태는 폴리클로날 항체, 모노클로날 항체, 또는 재조합 항체(예를 들어, ScFv 단편, 디아바디, 단쇄 항체 등)를 포함하며, 모든 면역글로불린 항체가 포함된다. 상기 항체는 2개의 전체 길이의 경쇄 및 2 개의 전체 길이의 중쇄를 갖는 완전한 형태뿐만 아니라, 2개의 경쇄 및 2개의 중쇄를 갖는 완전한 형태 온전한 항체의 구조를 갖지는 않지만, 항원성 부위에 대해 지시되는 특이적인 항원결합부위(결합 도메인)를 가져 항원 결합 기능을 보유하고 있는, 항체 분자의 기능적 단편 또한 포함한다.
상기 BAG2 및 프로-카텝신 B 폴리펩티드는 각각 인간(Homo sapiens) 또는 마우스(Mus musculus) 유래의 것일 수 있고, 원숭이, 소, 말 등의 다른 포유 동물로부터 유래된 것일 수 있다. 상기 BAG2의 아미노산 서열은 서열번호 1 또는 2(각각, GenBank Accession No. NP_004273.1 및 NP_663367.1)를 포함하는 것일 수 있고, 상기 프로-카텝신 B의 아미노산 서열은 서열번호 3 내지 8(각각, GenBank Accession No. NP_001899.1, NP_680090.1, NP_680091.1, NP_680092.1, NP_680093.1, 또는 NP_031824.1)를 포함하는 것일 수 있다. 상기 서열번호 1 내지 8의 아미노산 서열이 일부 일치하지 않더라도, 생물학적으로 동등한 활성을 갖도록 하는 아미노산 서열은 BAG2 또는 프로-카텝신 B 폴리펩티드로 간주될 수 있다. 상기 BAG2 또는 프로-카텝신 B 폴리펩티드는 각각 서열번호 1 또는 2, 및 서열번호 3 또는 8 중 어느 하나와 60% 이상, 예를 들면, 70%이상, 80%이상, 90%이상, 95%이상, 99%이상, 또는 100%의 서열 동일성을 갖는 아미노산 서열을 포함하는 것일 수 있다. 또한 상기 BAG2 또는 프로-카텝신 B 폴리펩티드는 각각 상기 서열번호 1 또는 2, 및 서열번호 3 또는 8 중 어느 하나의 서열에서 1개 이상의 아미노산, 2개 이상의 아미노산, 3개 이상의 아미노산, 4개 이상의 아미노산, 5개 이상의 아미노산, 6개 이상의 아미노산 또는 7개 이상의 아미노산 잔기가 상이한 서열을 갖는 폴리펩티드일 수 있다.
상기 진단방법의 대상이 되는 개체는 포유동물, 예를 들면, 인간, 마우스(mouse), 쥐(rat), 소, 말, 돼지, 개, 양, 염소, 또는 고양이일 수 있으며, 바람직하게는 인간이다.
일 구체예에서, 본 발명의 진단방법으로 진단할 수 있는 암은 유방암, 대장암, 폐암, 육종, 흑색종, 두경부암, 자궁경부암, 자궁암, 간암, 신장암, 췌장암, 및 신경아세포종으로부터 선택된 것일 수 있다.
본 발명자들은 BAG2가 유방암 환자에서 과발현하고, 특히 BAG2 수준이 높게 측정된 유방암 환자는 높은 확률로 전이성 유방암을 앓고 있음을 증명하였다. 따라서, 일 구체예에서, 본 발명의 진단방법으로 진단할 수 있는 유방암은 전이성 유방암일 수 있다.
유방암의 분자적 하위 유형 중, 삼중음성 유방암(triple-negative breast cancer; TNBC)은 체계적인 치료에도 불구하고 좋지 않은 예후를 보이고 높은 사망률과 관련된 매우 공격적인 유형이다. TNBC는 내강형 (luminal type) 또는 HER2-과다형(HER2-enriched type)과 비교하여 이질적인 유형이다(Foulkes et al., 2010; Dent et al., 2007; Masuda et al., 2013). 대부분의 표적 유방암 치료는 호르몬 수용체성 및 HER2 양성 유방암에 대해 호전적인 성과를 보여주는 반면, TNBC 환자는 3 가지 표적 수용체(ER, PR, 및 HER2) 또는 다른 잘 정의된 분자 표적이 부재하므로 효과적인 치료를 위해 한정된 옵션(예를 들어, 폴리 ADP-리보스 폴리머라제 (PARP), 표피 성장 인자 수용체 (epidermal growth factor receptor; EGFR), 및 Src 티로신 키나아제 등)을 가질 수 밖에 없다. 따라서, TNBC 환자들에게 불필요한 치료적 접근을 방지하고 효과적인 치료법을 선택하기 위해 다양한 유형의 유방암 환자들 중에서 TNBC 환자를 신속하고 정확하게 구별해 낼 필요가 있다.
본 발명자들은 BAG2가 유방암 환자에서 과발현하고, 특히 BAG2 수준이 높게 측정된 유방암 환자는 높은 확률로 TNBC형 유방암을 앓고 있음을 증명하였다. 따라서, 일 구체예에서, 본 발명의 진단방법으로 진단할 수 있는 유방암은 삼중음성 유방암(또는 TNBC형 유방암)일 수 있다.
다른 양상은 상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 포함하는 것인 암 진단용 키트를 제공한다. 상기 키트는 혈액, 혈청, 혈장, 또는 이들의 조합에 존재하는 BAG2를 검출하는 것으로서, 키트에 적용되는 시료는 개체로부터 분리된 혈액, 혈청, 혈장, 또는 이들의 조합을 제공한다.
일 구체예에서, 상기 키트는 카텝신 B의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 더 포함할 수 있다.
상기 키트는 그 키트가 이용하는 분석 방법(예를 들어, 웨스턴 블롯팅, ELISA, 방사선면역분석, 방사 면역 확산법, 오우크테로니 면역 확산법, 로케트 면역전기영동, 조직면역 염색, 면역침전 분석법, 보체 고정 분석법, FACS, 단백질 칩, 또는 이들의 조합)에 적합한 하나 이상의 다른 구성 성분 조성물, 용액 또는 장치를 더 포함할 수 있다. 예를 들어, 시료 중의 BAG2 또는 카텝신 B와 이들 각각에 특이적인 항체와의 면역 복합체의 검출을 위하여 기질, 적합한 완충용액, 발색 효소 또는 형광물질로 표지된 2차 항체, 발색 기질을 더 포함할 수 있다. 상기 기질은 니트로셀룰로오스 막, 폴리비닐 수지로 합성된 96 웰 플레이트, 폴리스티렌 수지로 합성된 96 웰 플레이트 및 유리 슬라이드글라스 등일 수 있고, 발색효소로서 퍼옥시다아제(peroxidase), 알칼라인 포스파타아제(alkaline phosphatase)가 이용될 수 있고, 형광물질로서 FITC, RITC 등, 발색 기질로서 2,2'-아지노-비스(3-에틸벤조티아졸린-6-설폰산)(ABTS) 또는 o-페닐렌디아민(OPD), 테트라메틸 벤지딘(TMB) 등이 사용될 수 있다.
상기 키트에서 언급된 용어 또는 요소 중 청구된 진단 방법에 대한 설명에서 언급된 것과 같은 것은, 청구된 진단 방법에 대한 설명에서 언급된 바와 같은 것으로 이해된다.
일 양상에 따른 혈중 BAG2 폴리펩티드의 존재 또는 수준을 측정하여 암을 진단하는 방법에 의하여, 암을 진단하기 위해 조직을 채취하던 기존의 방법에 비해 보다 쉽고 정확하게 암을 진단할 수 있다.
다른 양상은 혈액으로부터 혈중 BAG2 폴리펩티드의 존재 또는 수준을 측정하기 위한 암 진단용 키트에 의하여 다양한 진단기관에서 암 진단을 위해 상기 암 진단방법을 용이하게 활용할 수 있다.
도 1은 RNA 시퀀싱을 이용하여 내강형 및 TNBC 세포주에서 BAG 패밀리의 상이한 발현량 차이를 분석한 볼케노 플롯(volcano plot)을 나타낸 것이다.
도 2는 볼케노 플롯으로부터 분석된 내강형 및 TNBC 세포주에서 BAG2의 mRNA 발현량을 나타낸 것이다.
도 3은 52 개의 유방암 세포주로부터 분석된 BAG2 발현량을 스캐터 닷-플롯(scatter dot-plot)으로 나타낸 것이다.
도 4는 정상 및 각 유방암 세포 유형에서 BAG2 발현량을 분석한 마이크로어레이(4A) 및 RNA 시퀀싱 결과(4B)를 나타낸 것이다.
도 5는 내강형 및 TNBC 조직에서의 BAG2 발현량을 분석한 정량적 RT-PCR 결과를 나타낸 것이다.
도 6은 BAG2가 CTSB의 형태 및 활성에 미치는 영향을 면역블롯(6A) 및 CTSB 활성도(6B) 측면에서 분석한 것이다.
도 7은 TNBC를 배양한 조건배지로부터 BAG2 및 CTSB를 면역블롯하여 검출한 결과를 나타낸 것이다.
도 8은 TNBC를 배양한 조건배지로부터 검출된 프로-카텝신 B의 수준을 그래프로 나타낸 것이다.
도 9는 BAG2 과발현 세포주를 배양한 조건배지로부터 검출된 BAG2 및 CTSB를 면역블롯하여 검출한 결과를 나타낸 것이다.
도 10은 건강한 사람과 유방암 환자의 혈청으로부터 BAG2의 존재를 검출한 결과를 나타낸 것이다.
1. 실시예 1: 다양한 유방암 주에서 BAG2의 발현 확인
1-1. 유방암 세포주에 대한 전사체(transcriptome) 분석
TNBC 진행과 관련된 신규한 분자적 표적을 확인하기 위해, 본 발명자들은 먼저 유방암 세포 주에서 RNA 시퀀싱을 이용한 전사체 분석을 수행하였다. 먼저 다양한 유방암 세포주로부터 이 분야에 잘 알려진 방법을 이용하여 RNA를 추출하고, 업체 (테라젠이텍스)에 유전체 분석을 의뢰하였다. 그 후, 유방암 세포주들을 내강형(MCF-7, T47D, ZR-75B) 또는 TNBC (MDA-MB-231, Hs578T)로 구분하고 BAG2의 발현량을 비교하였다.
그 결과, 도 1 및 2에 나타낸 바와 같이 BAG2가 내강형 세포주와 비교하여 특이적으로 TNBC 세포주에서 과발현함을 알 수 있었다.
1-2. 52개 유방암 세포주에서의 BAG2 발현 경향 확인
실시예 1-1에서 확장하여, 보다 다양한 유방암 세포에서 BAG2 발현 경향을 확인하였다. 유방암 세포 정보는 퍼블릭 마이크로어레이 데이터세트 (GSE41313, Riaz et al., 2013)로 부터 수득하였다. Riaz et al.에 공개된 52 개의 유방암 세포주에서 BAG2 발현 경향을 확인한 결과, 도 3에 나타낸 바와 같이, BAG2가 TNBC에서 내강형(Luminal)에 비해 현저하게 높게 발현함을 알 수 있었다 (P<0.0001)
1-3. 임상적 BAG2 발현 경향 확인
세포주에서 확인한 BAG2 발현 경향을 보다 정확하게 확인하기 위해, 본 발명자들은 암 게놈 아틀라스(The Cancer Genome Atlas; TCGA) 저장소로부터 수득된 유방암 환자의 RNA 시퀀싱 데이터세트 및 마이크로어레이를 이용하여 유방암의 다양한 하위유형에서 BAG2 발현 경향을 분석하였다.
그 결과, 도 4A 및 4B에 나타낸 바와 같이, 정상, 내강형 A(Lum A), 내강형 B(Lum B), 및 HER2-과다(HER2) 환자와 비교하여 TNBC 환자에서 BAG2 발현이 현저하게 높은 수준에 있음을 알 수 있었다.
1-4. BAG2 발현 경향의 실험적 확인
공개된 데이터 베이스를 이용하여 분석된 상기의 경향성을 실험적으로 다시 확인하기 위해 정량적 RT-PCR(quantitative RT-PCR)을 수행하였다.
구체적으로, 검토위원회 (the institutional review board; IRB) 승인(IRB 승인 번호: 3-2013-0268) 후 강남 세브란스 병원으로부터 유방암 중 내강형 12개 및 TNBC 6개를 얻었다. 그 후, TRIzol 시약 (Invitrogen)을 이용하여 판매자의 지침에 따라 세포로부터 총 RNA를 단리하였다. 그런 다음 18 rRNA를 하우스키핑 유전자로 하여 BAG2 검출을 위한 프라이머를 이용하여 power SYBR Green PCR Master Mix 및 Viia 7 real-time PCR 장치 (Applied Biosystems)를 이용하여 정량적 RT-PCR을 수행하였다.
그 결과, 도 5에 나타낸 바와 같이, TNBC에서 내강형(Luminal)에 비해 BAG2가 과발현 해 있는 것을 확인할 수 있었다.
2. 실시예 3: BAG2 및 카텝신 B의 상호작용 확인
BAG2가 카텝신 B의 조절 상위 인자로서 작용할 수 있는지 확인하기 위해 BAG2 및 카텝신 B의 상호작용 여부, BAG2에 의한 카텝신 B의 활성 변화를 관찰하였다.
2-1. BAG2 및 카텝신 B의 상호작용의 단백질 수준에서 확인
BAG2-결실 세포주를 제작하기 위하여 먼저 BAG2-특이적 shRNA를 Mission-shRNA (Sigma)으로부터 구매하였다. BAG2-특이적 shRNA 렌티 바이러스 제작을 위하여, 293T 세포를 pLKO-BAG2 또는 스크램블된 대조군 pLKO-pGL2를 Δ8.9 및 VSV-G를 코딩하는 패키징 플라스미드와 함께 형질주입시켰다 (사용된 BAG2 shRNA의 표적 서열 (5'→ 3'): GTACTAGGATCTAGCATATTT). 형질 주입 후 36 내지 48 시간 후 바이러스 상등액을 수집하고 0.45 ㎛ 여과기를 통해 여과하였다. MDA-MB-231 (ATCC)을 6웰 플레이트에 1 x 105 세포/웰로 접종(seed)하고 바이러스 입자(particle) 및 폴리브렌(8㎍/ml)으로 감염시켰다. 감염 후, 상기 바이러스를 함유하는 배지를 일반 배지로 교체한 다음 상기 세포를 푸로미신 (2㎍/ml)으로 선택하였다. 제조된 BAG2 결실 세포주를 BAG2 shRNA로 하였다.
BAG2를 과발현시키기 위해서 마찬가지로 MDA-MB-231 (ATCC)에 Lipofectamine 2000 (Invitrogen)을 이용하여 판매자의 지침에 따라 Myc-tag BAG2 발현 벡터를 형질주입하여, BAG2를 과발현하는 세포를 BAG2 OV로 하고, BAG2 shRNA에 BAG2를 형질주입한 것을 BAG2 회복된 세포로서 BAG2 rescue로 하였다.
상기 각 세포들을 PBS로 세척하고, 용해시킨 후, SDS-폴리아크릴아미드 겔 전기영동을 통해 분리시키고, PVDF 막(Millipore)으로 이동시키고, 도 6에 표시된 각 항체를 이용하여 면역블롯함으로써 각 단백질을 검출하였다. 특히, CTSB 항체는 전-형태(pro-form) 및 성숙한 형태의 CTSB (SC(single chain) 및 DC(double chain))를 모두 인지하므로, 분자량으로 구분할 수 있다.
그 결과, 도 6A에 나타낸 바와 같이 BAG2-결실 세포에서는 절단된 Caspase-3가 발현하여, Caspase-3의 활성형이 증가해 있음을 알 수 있었는데, 이는 BAG2의 회복에 의해 다시 감소하였다. 또한 BAG2-결실 세포에서는 단쇄(SC) 카텝신 B도 증가한 것으로 관찰되었으나, 이는 Caspase-3와 마찬가지로 BAG2의 회복에 의해 다시 감소하였다. 따라서, BAG2가 프로-카텝신B에서 성숙한 형태인 단쇄-카텝신 B로 전환되는 것을 방해하는 기전에 관여됨을 알 수 있다.
2-2. BAG2의 CTSB 활성에 대한 영향력 확인
CTSB 조절에 대한 BAG2의 영향력을 보다 확실히 하기 위해 BAG2 존재 여부에 따른 CTSB의 활성 변화를 관찰하였다.
구체적으로, 상기 실시예 3-1에서와 같이 BAG2-결실 MCF10CA1a 세포를 제작하고, BAG2 발현 벡터를 형질주입하여 BAG2를 과발현 시키거나, 다시 BAG2-결실 세포에서 BAG2 발현을 회복시켰다. 성숙한 CTSB은 Arg-Arg를 포함하는 합성 펩티드를 기질로 하므로, 그 후 형광형성 cathepsin B 기질(200 μM Ac-RR-AFC; Abcam)과 판매자의 지침에 따라 준비된 세포 시료를 27℃에서 1시간 동안 인큐베이션하였다. 형광 측정은 다중플레이트 검출기인 Wallac 1440 Victor2 (PerkinElmer) 상에서 수행하였고 상대적인 형광 유닛을 355 nm의 여기(excitation) 파장을 이용하여 460 nm에서 측정하였다.
그 결과, 도 6B에 나타난 바와 같이, BAG2-결실 MCF10CA1a 세포에 BAG2를 다시 도입한 결과 BAG2가 부재한 CTSB 활성이 증가함이 관찰되어, BAG2가 CTSB의 성숙형으로의 변환을 억제하고, 결과적으로 CTSB의 활성을 감소시킴을 알 수 있다. 따라서, BAG2는 CTSB과 상호작용하고 CTSB의 성숙형으로의 변환을 억제하여 caspase-3 매개된 세포사멸의 저해에 관여됨을 알 수 있다.
실시예 3. 혈중 BAG2의 CTSB 존재 확인
3-1. TNBC 세포의 BAG2 및 CTSB 분비 여부 확인
BAG2 및 CTSB가 TNBC 세포 내에 존재할 뿐 아니라, 세포 밖으로 분비되기도 하는지 확인하였다.
구체적으로, TNBC 세포로 Hs578T, MDA-MB-231, 및 MCF10ACa1에 실시예 2-1과 같이 BAG2가 결실된 세포를 제작한 다음, 각 세포를 조건배지 DMEM (Cat. LM001-05, WELGENE)에 배양하고, 세포가 채취되지 않도록 주의하면서 그 상등액을 채취한 후 실시예 2-1과 같이 면역블롯하였다. 단백질 총량을 나타내기 위해 일부를 판매자의 지침에 따라 쿠마시 블루 염색(ELT006, ELBIO) 하였다.
또한, 상기 배지로부터 수득된 시료 중 일부는 프로-카텝신 B quantikine ELISA 키트 (R&D 시스템)를 이용하여 판매자의 지침에 따라 분석하였고, BAG2 과발현된 세포주인 MCF10AT1를 배양한 배지에서 BAG2 및 CTSB 존재 여부를 재확인하였다.
그 결과, 도 7 내지 9에서 알 수 있는 바와 같이, BAG2가 발현되는 TNBC 세포를 배양한 배지 중에 BAG2 및 CTSB가 모두 관찰되었다. 특히 CTSB는 프로-CTSB로서 BAG2 발현과 경향성이 동일하게 나타났다.
3-2. 혈중 BAG2 및 CTSB 분비 여부 확인
BAG2가 세포 밖으로 분비됨을 확인하였으므로, 더 나아가 혈중에 분비되어 혈액에서도 검출될 수 있을지 확인하였다.
구체적으로, 건강한 자원자(N=17)의 혈청 및 악성 유방암 환자(N=76)의 혈청을 채취하였다. 상기 수득된 혈청을 인간 BAG2 ELISA 키트 (MyBiosource)를 이용하여 판매자의 지침에 따라 분석하였다.
그 결과, 도 10에서 알 수 있는 바와 같이 유방암 환자의 혈청에서 건강한 자원자와 비교하여 BAG2가 혈중에서 현저한 정도로 검출됨을 알 수 있다.
상기 실시예에서 P 값은 수직 양측 스튜던트 t-검정(unpaired two-tailed Student's t-test)을 이용하여 3회의 독립적인 실험으로부터 평균 +_SD로 나타내었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로, 상기 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (16)

  1. 개체로부터 분리된 시료와
    BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계;
    상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 상기 시료 중 BAG2 존재 또는 수준을 측정하는 단계; 및
    상기 시료로부터 측정된 BAG2 존재 또는 수준을 대조군으로부터 측정된 BAG2 수준과 비교하는 단계를 포함하는 암 진단방법.
  2. 청구항 1에 있어서, 상기 시료는 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합인 것인 방법.
  3. 청구항 1에 있어서, 상기 BAG2는 혈액, 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합에 가용성인 것인 방법.
  4. 청구항 1에 있어서, 상기 BAG2 폴리펩티드의 아미노산 서열은 서열번호 1 또는 2의 아미노산 서열을 갖는 것인 방법.
  5. 청구항 1에 있어서, 상기 방법은 상기 개체로부터 분리된 시료와 카텝신 B(cathepsin B)의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시키는 단계;
    상기 카텝신 B의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 접촉시켜 형성되는 복합체로부터 카텝신 B의 존재 또는 수준을 측정하는 단계; 및
    상기 시료로부터 측정된 카텝신 B의 존재 또는 수준과 대조군으로부터 측정된 카텝신 B의 수준과 비교하는 단계를 더 포함하는 방법.
  6. 청구항 5에 있어서, 상기 카텝신 B는 프로-카텝신 B(pro-cathepsin B)인 것인 방법.
  7. 청구항 5에 있어서, 상기 카텝신 B 폴리펩티드의 아미노산 서열은 서열번호 3 내지 8 중 선택된 어느 하나의 아미노산 서열을 갖는 것인 방법.
  8. 청구항 5에 있어서, 상기 시료 중 BAG2 또는 카텝신 B의 존재 또는 수준을 측정하는 단계는 웨스턴 블롯팅, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(Radioimmunoassay: RIA), 방사 면역 확산법radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), FACS, 단백질 칩(protein chip), 또는 이들의 조합에 의해 이루어지는 것인 방법.
  9. 청구항 1에 있어서, 상기 암은 유방암, 대장암, 폐암, 육종, 흑색종, 두경부암, 자궁경부암, 자궁암, 간암, 신장암, 췌장암, 및 신경아세포종으로부터 선택된 것인 방법.
  10. 청구항 9에 있어서, 상기 유방암은 전이성 유방암인 방법.
  11. 청구항 9에 있어서, 상기 유방암은 삼중음성 유방암(triple-negative breast cancer)인 방법.
  12. 혈액, 혈청(serum), 혈장(plasma), 또는 이들의 조합에 존재하는 BAG2를 검출하는 것으로서,
    상기 BAG2 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 포함하는 것인 암 진단용 키트.
  13. 청구항 12에 있어서, 상기 키트는 카텝신 B(cathepsin B)의 폴리펩티드 또는 이의 단편에 특이적으로 결합하는 항체, 폴리펩티드, 또는 이들의 조합을 더 포함하는 키트.
  14. 청구항 12에 있어서, 상기 암은 유방암, 대장암, 폐암, 육종, 흑색종, 두경부암, 자궁경부암, 자궁암, 간암, 신장암, 췌장암, 및 신경아세포종으로부터 선택된 것인 키트.
  15. 청구항 12에 있어서, 상기 유방암은 전이성 유방암인 키트.
  16. 청구항 12에 있어서, 상기 유방암은 삼중음성 유방암(triple-negative breast cancer)인 키트.
PCT/KR2018/012591 2017-10-24 2018-10-24 혈액으로부터 암을 진단하는 방법 WO2019083262A1 (ko)

Priority Applications (9)

Application Number Priority Date Filing Date Title
ES18871731T ES2936208T3 (es) 2017-10-24 2018-10-24 Método de diagnóstico del cáncer a partir de la sangre con BAG2
AU2018354528A AU2018354528B2 (en) 2017-10-24 2018-10-24 Method for diagnosing cancer from blood
US16/758,928 US20200309779A1 (en) 2017-10-24 2018-10-24 Method for diagnosing cancer from blood
CA3080263A CA3080263C (en) 2017-10-24 2018-10-24 Method for diagnosing cancer from blood
JP2020543438A JP7110367B2 (ja) 2017-10-24 2018-10-24 血液から癌を診断する方法
EP18871731.8A EP3702784B1 (en) 2017-10-24 2018-10-24 Method for diagnosing cancer from blood with bag2
CN201880069653.1A CN111602054A (zh) 2017-10-24 2018-10-24 一种从血液诊断癌症的方法
JP2022104360A JP2022130598A (ja) 2017-10-24 2022-06-29 血液から癌を診断する方法
JP2024002969A JP2024038346A (ja) 2017-10-24 2024-01-12 血液から癌を診断する方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170138455A KR102230314B1 (ko) 2017-10-24 2017-10-24 혈액으로부터 암을 진단하는 방법
KR10-2017-0138455 2017-10-24

Publications (1)

Publication Number Publication Date
WO2019083262A1 true WO2019083262A1 (ko) 2019-05-02

Family

ID=66247606

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/012591 WO2019083262A1 (ko) 2017-10-24 2018-10-24 혈액으로부터 암을 진단하는 방법

Country Status (9)

Country Link
US (1) US20200309779A1 (ko)
EP (1) EP3702784B1 (ko)
JP (3) JP7110367B2 (ko)
KR (1) KR102230314B1 (ko)
CN (1) CN111602054A (ko)
AU (1) AU2018354528B2 (ko)
CA (1) CA3080263C (ko)
ES (1) ES2936208T3 (ko)
WO (1) WO2019083262A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020165797A1 (en) * 2019-02-12 2020-08-20 Medpacto, Inc. Methods for diagnosing cancer using anti-bag2 antibody

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140349403A1 (en) * 2011-12-12 2014-11-27 The Children's Hospital Of Philadelphia Large commercial scale lentiviral vector production system and vectors produced thereby

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070105133A1 (en) * 2005-06-13 2007-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
US20100255470A1 (en) * 2007-04-05 2010-10-07 Source Percision Medicine, Inc. D/B/A Source Mdx Gene Expression Profiling for Identification, Monitoring and Treatment of Breast Cancer
KR20100112192A (ko) * 2008-02-04 2010-10-18 바이파 사이언스 인코포레이티드 Ｐａｒｐ－매개된 질병을 진단 및 치료하는 방법

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1852974A (zh) * 2003-06-09 2006-10-25 密歇根大学董事会 用于治疗和诊断癌症的组合物和方法
WO2012103455A1 (en) * 2011-01-28 2012-08-02 Pangea Biosciences, Inc. Biomarkers and their uses in cancer detection and therapy
WO2013052480A1 (en) * 2011-10-03 2013-04-11 The Board Of Regents Of The University Of Texas System Marker-based prognostic risk score in colon cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070105133A1 (en) * 2005-06-13 2007-05-10 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
US20100255470A1 (en) * 2007-04-05 2010-10-07 Source Percision Medicine, Inc. D/B/A Source Mdx Gene Expression Profiling for Identification, Monitoring and Treatment of Breast Cancer
KR20100112192A (ko) * 2008-02-04 2010-10-18 바이파 사이언스 인코포레이티드 Ｐａｒｐ－매개된 질병을 진단 및 치료하는 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 23 March 2015 (2015-03-23), VENTER J:C: ET AL.: "BCL2-associated athanogene 2 [Homo sapiens)", XP055595392, retrieved from NCBI Database accession no. EAX04475 *
DATABASE PROTEIN 7 April 1994 (1994-04-07), CAO L. ET AL.: "cathepsin B [Homo sapiens", XP055595393, retrieved from NCBI Database accession no. AAC37547 *
YANG, KYUNG-MIN: "Co-chaperone BAG2 determines the pro-oncogenic role of cathepsin B in triple-negative breast cancer cells", CELL REPORTS, vol. 21, no. 1010, 5 December 2017 (2017-12-05), pages 2952 - 2964, XP055595394, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2017.11.026 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020165797A1 (en) * 2019-02-12 2020-08-20 Medpacto, Inc. Methods for diagnosing cancer using anti-bag2 antibody
WO2020165794A1 (en) * 2019-02-12 2020-08-20 Medpacto, Inc. Anti-bag2 antibody and methods of treating cancer
EP3938788A4 (en) * 2019-02-12 2023-01-04 Medpacto, Inc. METHOD OF DIAGNOSIS OF CANCER USING ANTI-BAG2 ANTIBODIES
EP3924382A4 (en) * 2019-02-12 2023-01-04 Medpacto Inc. ANTI-BAG2 ANTIBODIES AND METHODS OF TREATMENT OF CANCER

Also Published As

Publication number Publication date
EP3702784B1 (en) 2023-01-04
AU2018354528B2 (en) 2022-04-07
JP2021508832A (ja) 2021-03-11
CN111602054A (zh) 2020-08-28
EP3702784A4 (en) 2021-05-26
KR102230314B1 (ko) 2021-03-22
ES2936208T3 (es) 2023-03-15
AU2018354528A1 (en) 2020-08-13
JP2024038346A (ja) 2024-03-19
KR20190045638A (ko) 2019-05-03
CA3080263C (en) 2023-03-07
US20200309779A1 (en) 2020-10-01
JP7110367B2 (ja) 2022-08-01
EP3702784A1 (en) 2020-09-02
CA3080263A1 (en) 2019-05-02
JP2022130598A (ja) 2022-09-06

Similar Documents

Publication Publication Date Title
JP2006510008A (ja) アクチビンβＣのレベルの調節によって特徴付けられる状態のための診断方法、治療方法、および有用な薬剤
JP2024038346A (ja) 血液から癌を診断する方法
AU2010268979B2 (en) New tumor marker
US20200271673A1 (en) Biomarker
WO2012112013A2 (en) A marker comprising anti-ck8/18 complex autoantibody and its use for diagnosing cancer
Liang et al. VASN promotes colorectal cancer progression by activating the YAP/TAZ and AKT signaling pathways via YAP
WO2011081421A9 (en) Complement c9 as markers for the diagnosis of cancer
KR101680360B1 (ko) Del-1 단백질 양성 엑소좀을 포함하는 암 진단 또는 예후 예측용 조성물
WO2012141373A1 (ko) 폐암 조기 진단용 ＸＡＧＥ-1ａ 마커 및 이의 용도
KR101649591B1 (ko) 신규 급성백혈병의 진단용 마커
EP2541249A1 (en) EpCAM detection
KR20200025706A (ko) Fgf 21을 포함하는 갑상선 암 진단 또는 갑상선 암 예후 예측용 바이오마커 조성물
WO2014041064A1 (en) New biomarkers for the diagnosis and/or prognosis of clear cell renal cell carcinoma
WO2021118243A1 (ko) Wasf2 자가항체를 이용한 간세포암종 조기진단용 조성물
WO2015133772A1 (ko) 신규 대장암의 바이오마커 및 그를 표적으로 하는 항암제
WO2018092964A1 (ko) Lmcd1 단백질 및 이를 코딩하는 유전자를 이용한 전이성 암 또는 탁산계 약물 저항성 암 진단방법
WO2012144871A2 (ko) 단백질의 위치 변화 확인을 통한 신경교종의 진단 및 치료 방법
Zhang et al. The ratio of SRSF1-IS1/IS2 mRNA is a marker of clinical prognosis in pediatric B-ALL and SRSF1 isoforms differentially regulate apoptosis and proliferation on leukemic cells
Nothnick et al. Prefoldin-5 Expression Is Elevated in Eutopic and Ectopic Endometriotic Epithelium and Modulates Endometriotic Epithelial Cell Proliferation and Migration In Vitro
AU2014203702B2 (en) New tumor marker
WO2017200263A1 (ko) Lrp-1을 유효성분으로 포함하는 방사선 저항성 암 진단용 또는 방사선 치료 예후 예측용 바이오마커 조성물
Alami The role of HGF and met in Wilms tumour
WO2016148313A1 (ko) Del-1 단백질 양성 엑소좀을 포함하는 암의 진단 또는 예후 예측용 바이오마커 조성물
WO2014125879A1 (ja) ｃ－ＭＥＴ遺伝子増幅細胞の検出方法
WO2010093066A1 (en) Ppia marker for diagnosis of liver cancer and antibody, and screening method of compounds useful for inhibiting liver cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18871731

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3080263

Country of ref document: CA

Ref document number: 2020543438

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018871731

Country of ref document: EP

Effective date: 20200525

ENP Entry into the national phase

Ref document number: 2018354528

Country of ref document: AU

Date of ref document: 20181024

Kind code of ref document: A