WO2019066434A1 - 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물 - Google Patents

사포게닌과 엑소좀을 유효성분으로 포함하는 조성물 Download PDF

Info

Publication number
WO2019066434A1
WO2019066434A1 PCT/KR2018/011316 KR2018011316W WO2019066434A1 WO 2019066434 A1 WO2019066434 A1 WO 2019066434A1 KR 2018011316 W KR2018011316 W KR 2018011316W WO 2019066434 A1 WO2019066434 A1 WO 2019066434A1
Authority
WO
WIPO (PCT)
Prior art keywords
exosome
sapogenin
composition
skin
present
Prior art date
Application number
PCT/KR2018/011316
Other languages
English (en)
French (fr)
Inventor
이용원
조병성
Original Assignee
주식회사 엑소코바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180109879A external-priority patent/KR102008665B1/ko
Application filed by 주식회사 엑소코바이오 filed Critical 주식회사 엑소코바이오
Priority to JP2020518467A priority Critical patent/JP6933412B2/ja
Priority to CN201880062704.8A priority patent/CN111182886A/zh
Publication of WO2019066434A1 publication Critical patent/WO2019066434A1/ko
Priority to US16/823,582 priority patent/US11850297B2/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • A61K31/585—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin containing lactone rings, e.g. oxandrolone, bufalin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/02—Cosmetics or similar toiletry preparations characterised by special physical form
    • A61K8/14—Liposomes; Vesicles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/63—Steroids; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin

Definitions

  • the present invention relates to a composition comprising sapogenin and exosomes as an active ingredient, and more particularly to a composition containing sapogenin and exosomes as preventive, mitigating, ameliorating or restoring skin defects caused by insufficient body volume or lipid deficiency due to lack of lipids ≪ / RTI >
  • the present invention relates to a functional cosmetic composition
  • a functional cosmetic composition comprising the composition and an external preparation for skin.
  • a voluminous portion of a body defect (a so-called "complex" region) having a small volume feeling due to a lack of lipids, etc. is visually beautiful.
  • the filler can be applied locally to small body parts, such as the lips, nose, forehead, balls, chest, genitals, etc., based on the volume increase effect, giving a volume feeling to the body part.
  • the hyaluronic acid filler is decomposed in vivo with the passage of time, there is a problem that the filler should be injected into the body defect part periodically in order to maintain the volume feeling continuously. Filler injections also have problems with pain.
  • exosome which has intercellular signal transduction
  • Extracellular vesicles Cells release various membrane-type vesicles in the extracellular environment, and these release vesicles are commonly referred to as extracellular vesicles (EVs).
  • the extracellular endoplasmic reticulum is sometimes referred to as cell membrane-derived endoplasmic reticulum, ectosomes, shedding vesicles, microparticles, exosomes and, in some cases, differentiated from exosomes.
  • Exosome is an endoplasmic reticulum of several tens to several hundreds of nanometers in size, composed of double lipid membranes identical to the cell membrane structure, and contains proteins, nucleic acids (mRNA, miRNA, etc.) called exosomal cargo inside.
  • Exosomal cargo contains a wide range of signaling factors, which are known to be specific for cell types and differentially regulated by the environment of the secretory cells.
  • Exosome is an intercellular signaling mediator that is secreted by the cell, and various cell signals transmitted through it regulate cell behavior including activation, growth, migration, differentiation, de-differentiation, apoptosis, and necrosis of target cells It is known.
  • Exosomes contain specific genetic material and bioactivity factors depending on the nature and condition of the derived cells.
  • the proliferating stem cell-derived exosomes regulate cell behavior such as cell migration, proliferation and differentiation, and reflect the characteristics of stem cells involved in tissue regeneration (Nature Review Immunology 2002 (2) 569-579).
  • the present inventors have intensively studied the new application field of exosome and medical or cosmetic technology, and found that the combination of sapogenin and exosome reduces cytotoxicity by sapogenin, (Lipid uptake) and adipogenesis (lipid uptake) into adipocytes.
  • the present invention has been completed based on this finding.
  • An object of the present invention is to provide a composition for preventing, alleviating, ameliorating, or restoring skin defects due to lack of body deficiency or lipid deficiency due to lipid deficiency or the like, which comprises exosome and sapogenin as an active ingredient have.
  • the present invention provides a composition for preventing, alleviating, improving or restoring body defects or skin defects due to lipid deficiency, which composition comprises a combination of saponin and exosome as an active ingredient do.
  • exosomes refers to an endoplasmic reticulum of several tens to several hundred nanometers (preferably about 30 to 200 nm) in size, consisting of double lipid membranes identical in structure to the cell membrane The particle size of the exosome can be varied according to the cell type, the separation method and the measurement method) (Vasiliy S. Chernyshev et al., "Size and shape characterization of hydrated and desiccated exosomes", Anal Bioanal Chem, DOI 10.1007 / s00216-015-8535-3). Exosomes contain proteins called exosomal cargo (cargo), nucleic acids (mRNA, miRNA, etc.).
  • Exosomal cargo contains a wide range of signaling factors, which are known to be specific for cell types and differentially regulated by the environment of the secretory cells.
  • Exosome is an intercellular signaling mediator that is secreted by the cell, and various cell signals transmitted through it regulate cell behavior including activation, growth, migration, differentiation, de-differentiation, apoptosis, and necrosis of target cells It is known.
  • sapogenin is an aglycon of saponin, some of which are distributed in the plant system in free form. Sapogenin is a naturally occurring compound that can be extracted from various plants, and is known to smooth blood flow and to have effects such as blood circulation, genomes, diuresis, and anti-cancer.
  • sapogenin examples include, but are not limited to, but not limited to, diosgenin, hecogenin, smilagenin, epismilagenin, sarsasapogenin, isosarsasapogenin, episarsasapogenin, pariginin, tigogenin, epitigogenin, neotigogenin, , Parillin, timosaponin, xilingsaponin, filiferin, yamogenin, or yuccagenin, preferably diosgenin.
  • biological solution means a liquid solution of biogenic origin, in which the exosome is dispersed, suspended, precipitated, suspended or mixed, and includes, for example, a cell culture solution, a cell culture supernatant, Cell culture supernatant, whole blood, serum, cord blood, plasma, multiple fluid, brain and cerebrospinal fluid, placenta extract, and bone marrow aspirate.
  • a cell culture solution a cell culture supernatant, Cell culture supernatant, whole blood, serum, cord blood, plasma, multiple fluid, brain and cerebrospinal fluid, placenta extract, and bone marrow aspirate.
  • a “ biological solution” may be cultured or incubated under conditions that release and / or secrete exosomes, and may be frozen and thawed.
  • exosome is intended to mean an exosome that is secreted from cells of various animals, plants, bacteria, fungi, algae and the like, preferably stem cells, (E. G., Exosome-like vesicles) having a nano-sized bezacl structure and a composition similar to exosome.
  • the exosome used in the present invention has an effect of preventing, alleviating, ameliorating or restoring skin defects due to lack of body defects or lipid deficiency due to lipid deficiency or the like, and does not cause adverse effects on the human body. It is of course possible to use a variety of exosomes which are used or may be used in the future. Therefore, it should be understood that the exosome isolated according to the separation method of the following embodiments should be understood as an example of exosome that can be used in the present invention, and the present invention is not limited thereto.
  • body defect site or skin defect site refers to a body part having a small volume feeling due to lack of lipids, for example, a skin area lacking a small bust or genital area or subcutaneous fat.
  • the areas of the body defect or skin defect include, for example, skin defects, dented cheeks, depressed eyes, skin wrinkles (e.g., facial wrinkles, neck wrinkles, hand wrinkles, etc.), reduced skin elasticity, fine wrinkles, wrinkles, , Skin cracks, bumps, skin dryness, and the like.
  • volumizing as used in the specification of the present invention is intended to include: 1) "giving a feeling of volume to unsatisfactory body defects due to low volume due to lack of lipids," 2) To prevent, alleviate, ameliorate, or restore a skin defect ", or 3) beautify the body or skin by 1) and / or 2) above.
  • preventing, alleviating, improving or restoring skin defects due to insufficient body defects or lipid deficiency due to lipid deficiency includes preadipocyte proliferation, promoting lipid uptake into adipocytes and / or adipogenesis into adipocytes and stimulating the introduction and growth of adipocytes in the area of the skin that is indicative of lipid deficiency.
  • the introduction and growth of these adipocytes can increase the thickness of the skin in a stepwise manner, thereby creating a blooming effect, volume-up and skin-busting effect, making the skin elastic, preventing, Can be removed.
  • Preventing, alleviating, ameliorating, or restoring skin defects due to lack of body defects or lipid deficiency due to lack of lipids may include skin sagging, dented cheeks, depressed eyes, Relieving, improving or eliminating or restoring normal skin condition, such as facial wrinkles, neck wrinkles, hand wrinkles, etc.), reduced skin elasticity, fine wrinkles, wrinkles, rough and deep wrinkles, skin cracks, bumps, scars, that; Skin regeneration, fat regeneration, contour correction, soft tissue defect correction, tissue enlargement, volume-up, breast enlargement, genital enlargement, skin moisturization, and the like.
  • preventing, alleviating, improving, or recovering skin defects due to lack of body defects or lipid deficiency due to lack of lipids or the like is not limited to the above, Promoting lipid accumulation into cells and / or differentiation into adipocytes, and stimulating the introduction and growth of adipocytes in areas exhibiting lipid deficiency, thereby preventing, alleviating, ameliorating, improving or preventing body defects or skin defects, Removal, or recovery of the < / RTI >
  • composition of one embodiment of the present invention comprises a combination of exosome and sapogenin as an active ingredient.
  • the combination of sapogenin and exosome can be obtained by incubating the sapogenin with the exosomes.
  • the combination of saponin and exosome can be obtained by mixing the saponin and the exosome, and incubating a mixture of the saponin and the exosome.
  • the sapogenin may be penetrated into the exosome, or at least be associated with it.
  • composition of one embodiment of the present invention is characterized by promoting at least one of lipid progenitor cell proliferation, lipid accumulation into adipocytes, or differentiation into adipocytes.
  • composition of one embodiment of the present invention is characterized by reducing cytotoxicity by the sapogenin component.
  • the exosome can be obtained by performing the following steps: (a) adding trehalose to the biological solution, (b) adding the trehalose (C) separating the exosomes from the filtered biological solution using TFF (Tangential Flow Filtration), and (d) removing the buffer used for desalting and buffer exchange (diafiltration). , Adding trehalose to the solution, and performing desalting and buffer exchange (diafiltration) on the separated exosome using TFF (Tangential Flow Filtration) using the buffer solution to which the trehalose is added .
  • TFF Tangential Flow Filtration
  • trehalose when trehalose is added to the buffer solution used for desalting and diafiltration in step (d), exosomes having a uniform particle size distribution and high purity can be effectively obtained (FIGS. 6A to 6C) 6E).
  • trehalose is used in the pre-filtration step (step (b) before separation of exosome by TFF) and desalting by TFF and buffer exchange step ((d) It is possible to obtain an exosome having a uniform size distribution with a high yield.
  • trehalose in the present invention imparts a function of efficiently separating exosomes from impurities such as cellular debris, waste products, proteins and macromolecules.
  • the desalting and buffer exchange can be performed continuously or intermittently. Desalting and buffer exchange can be carried out using a buffer solution having a volume of at least 4 times, preferably 6 times to 10 times, more preferably 12 times the starting volume.
  • a molecular weight cutoff (MWCO) 100,000 Da (Dalton), 300,000 Da, 500,000 Da or 750,000 Da TFF filter or 0.05 ⁇ ⁇ TFF filter can be used.
  • the step (c) may further include a step of concentrating the solution to a volume of 1/100 to 1/25 using TFF (Tangential Flow Filtration).
  • the biological solution may be a stem cell culture solution.
  • the type of the stem cell is not limited, but may be a mesenchymal stem cell, for example, a fat, a bone marrow, an umbilical cord or a cord blood-derived stem cell, more preferably a fat-derived stem cell.
  • the type of the adipose-derived stem cell is not limited as long as it does not cause a risk of infection by a pathogen and does not cause an immune rejection reaction, but it may be preferably a human adipose-derived stem cell.
  • the exosome used in the present invention is not limited to the exosome obtained according to the separation method described above, and it is needless to say that various exosomes which are used in the art or can be used in the future can be used. It is to be understood that the exosome isolated according to the above separation method should be understood as an example of exosome that can be used in the composition of the present invention, and the present invention is not limited thereto.
  • composition of one embodiment of the present invention can be effectively used for preventing, alleviating, improving or restoring skin defects due to lack of body deficiency or lipid deficiency due to lipid deficiency or the like.
  • composition of one embodiment of the present invention may be a functional cosmetic composition or an external preparation for skin.
  • composition of one embodiment of the present invention is prepared with an external preparation for skin and / or a cosmetic composition
  • the components commonly used in cosmetics or external skin preparations for example, moisturizers, antioxidants , An oil component, an ultraviolet absorber, an emulsifier, a surfactant, a thickener, alcohols, a powder component, a colorant, an aqueous component, water, various skin nutrients, and the like.
  • the external preparation for skin and / or cosmetic composition according to one embodiment of the present invention can prevent, alleviate, and improve the action of skin defects due to lack of lipids Or the effect of restoration) can be mixed and used together with components exhibiting the tissue expansion or reconstruction characteristics that have been used conventionally.
  • the sapogenin and exosome constituting the composition of the present invention may be supported on or mixed with at least one of hydrogel, hyaluronic acid, hyaluronic acid salt (for example, sodium hyaluronate), or hyaluronic acid gel have.
  • the type of the hydrogel is not limited, but it is preferably a hydrogel obtained by dispersing the gel polymer in a polyhydric alcohol.
  • the gel polymer is at least one selected from the group consisting of pluronic, purified agar, agarose, gellan gum, alginic acid, carrageenan, cacao gum, xanthan gum, galactomannan, glucomannan, pectin, cellulose, guar gum and locust bean gum
  • the polyhydric alcohol may be at least one selected from the group consisting of ethylene glycol, propylene glycol, 1,3-butylene glycol, isobutylene glycol, dipropylene glycol, sorbitol, xylitol and glycerin.
  • the external preparation for skin and / or the cosmetic composition according to one embodiment of the present invention can be used in the form of, for example, patches, mask packs, mask sheets, creams, tonics, ointments, suspensions, emulsions, pastes, lotions, , Mist, foundation, powder, oil paper, and the like.
  • the external preparation for skin and / or the cosmetic composition of one embodiment of the present invention may be applied or deposited on at least one surface of the patch, mask pack, or mask sheet.
  • composition of one embodiment of the present invention is prepared with a cosmetic composition
  • cosmetic formulations can be prepared in any formulation conventionally produced in the art.
  • a lotion, a mask pack, a mask sheet, a softener a nutritional lotion, a convergent lotion, a nutritional cream, a massage cream, an eye cream, a cleansing cream, an essence, an essence, a cleansing lotion, a cleansing foam
  • the external preparation for skin and / or cosmetic composition includes components commonly used in external preparations for skin and / or cosmetics and includes conventional additives such as antioxidants, stabilizers, solubilizers, vitamins, And may include a carrier. Further, in the respective formulations for the external preparation for skin and / or cosmetic composition, the other ingredients can be mixed and selected without difficulty by the person skilled in the art depending on the kind of the external preparation for skin and / or cosmetic composition or purpose of use.
  • Another embodiment of the present invention is a cosmetic or dermatological composition for topical application to the skin of a mammal, wherein the composition is applied topically to a defective or defective area of a mammal, ≪ / RTI >
  • volume attenuation can be skin-cholesterol, volume-up, skin bloating, or skin elasticity improvement.
  • the cosmetic method of one embodiment of the present invention comprises the steps of (a) applying the composition directly to the skin of a mammal, (b) contacting the patch, mask pack or mask sheet on which the composition is applied or deposited with the skin of the mammal Or adhering, or sequentially advancing the above (a) and (b).
  • composition comprising sapogenin and exosome as an active ingredient of the present invention can promote lipid progenitor cell proliferation, lipid accumulation into adipocytes and / or differentiation into adipocytes, and decrease cytotoxicity due to sapogenin component. Accordingly, the composition of the present invention can be easily applied to skin defects due to insufficient body defect or lipid deficiency due to low volume due to lipid deficiency while reducing adverse effects on the body or skin.
  • the composition of the present invention can increase the thickness of the skin in a stepwise manner by introducing and growing adipocytes, thereby exhibiting effects of skin defect correction, bulkiness, volume-up and skin irritation. Therefore, the composition of the present invention can be usefully used as a functional cosmetic composition for stimulating adipocyte introduction and growth by promoting lipid accumulation into adipocytes and differentiation into adipocytes in a skin region showing lipid deficiency, and as an external preparation for skin.
  • FIG. 1 is a flow chart illustrating a process for separating and purifying exosomes in a method for producing exosomes from a biological solution according to one embodiment of the present invention.
  • FIG. 2 is a graph showing a result of measuring a relative amount of protein contained in a solution for each step of preparing a biological solution, for example, a stem cell culture solution, according to an embodiment of the present invention .
  • the ratio of the total amount of protein in each step was expressed by the relative ratio of total protein amount to the total biological solution.
  • the experimental results show the results obtained in two different batches, respectively.
  • FIG. 3 shows the results of measuring the productivity and purity of exosomes obtained according to one embodiment of the present invention.
  • the productivity of exosomes was calculated as "the number of particles of exosome obtained per mL of biological solution, eg, a stem cell culture (CM),” and the purity of exosome was calculated as "the number of exosomes per microgram of protein contained in the final fraction Quot; number of particles "
  • the experimental results show the results obtained in five different batches.
  • 4A to 4E show results of physical property analysis of exosomes obtained according to one embodiment of the present invention.
  • 4A shows particle size distribution and number of particles by TRPS (tunable resistive pulse sensing) analysis.
  • Figure 4B shows particle size distribution and number of particles by NTA (nanoparticle tracking analysis) analysis.
  • 4C shows particle images by transmission electron microscopy (TEM) according to magnification.
  • 4D shows the Western blot results of exosomes obtained according to one embodiment of the present invention.
  • &Quot; Figure 4E shows flow cytometric analysis results for CD63 and CD81 in marker assays for exosomes obtained according to one embodiment of the present invention.
  • Figures 5A-5C show the results of NTA analysis on particle size distribution showing that a uniform and high-purity exosome is obtained with trehalose addition. As the amount of trehalose added increases, a particle size distribution having a single peak can be obtained.
  • 6A to 6C show results of NTA analysis showing particle size distribution according to whether trehalose was added in the process of producing exosome according to one embodiment of the present invention.
  • 6A shows a case where trehalose is added throughout the production process
  • Fig. 6B shows a case where trehalose is added after the cell culture solution is stored in a frozen state
  • the results are shown without adding os.
  • 6D shows the results of comparing relative productivity and relative concentration of exosomes isolated by the methods of FIGS. 6A to 6C.
  • 6E shows the mean size of exosomes isolated by the methods of FIGS. 6A to 6C.
  • FIG. 7 shows the result of confirming the absence of cytotoxicity after treatment of exosome according to one embodiment of the present invention with HS68 cells of human skin fibroblasts.
  • FIG. 8 is an optical microscope photograph showing the increase and accumulation of fat droplets in a cell as a result of treatment with a combination of sapogenin and exosomes in one embodiment of the present invention when inducing differentiation into 3T3-L1 cells into adipocytes .
  • FIG. 9 is an optical microscope photograph of 3T3-L1 cells stained with oil red O on day 6 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 9 is an optical microscope photograph of 3T3-L1 cells stained with oil red O on day 6 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 10 is a graph showing the amount of lipid accumulation increase in 3T3-L1 cells stained with oil red O in FIG. 9 as a percentage of negative control.
  • Fig. 11 is an optical microscope photograph taken on the third day after initiation of differentiation induction by culturing 3T3-L1 cells in a differentiation medium. Fig. In Figure 11 it is shown that the dead cells lose their original shape and float off the floor.
  • FIG. 12 is a graph showing the cell survival rate obtained by performing MTT assay on the third day after initiation of differentiation induction of 3T3-L1 cells in a differentiation medium as a percentage of negative control.
  • FIG. 13 is a graph showing real-time PCR results of the PPAR-gamma gene performed on day 6 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 14 is a graph showing real-time PCR results of C / EBP- ⁇ gene performed on day 0, day 1 and day 4 after initiation of differentiation induction of 3T3-L1 cells in a differentiation medium.
  • FIG. 15 is a graph showing real-time PCR results of the FAS gene performed on day 0, day 1 and day 4 after initiation of induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 15 is a graph showing real-time PCR results of the FAS gene performed on day 0, day 1 and day 4 after initiation of induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 16 is a graph showing real-time PCR results of the ACC gene performed on day 0, day 1 and day 4 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 16 is a graph showing real-time PCR results of the ACC gene performed on day 0, day 1 and day 4 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 17 is a graph showing real-time PCR results of GDPH gene performed on day 0, day 1, and day 4 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • 18 is a graph showing real-time PCR results of GADPH gene performed on day 0, day 1 and day 4 after initiation of induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 19 is a graph showing real-time PCR results of Pref-1 gene performed on day 0, day 1 and day 4 after induction of differentiation by culturing 3T3-L1 cells in a differentiation medium.
  • FIG. 20 is a graph showing that the proliferation rate of the lipid precursor cells (preadipocyte) is higher than that of the group treated with pioglitazone, which is a positive control, when the combination of sapogenin and exosomes is treated in one embodiment of the present invention.
  • HS68 cells a human dermal fibroblast, were purchased from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum (purchased from ThermoFisher Scientific) and 1% antibiotic-antimycotics (purchased from ThermoFisher Scientific)
  • the cells were subcultured in DMEM (purchased from ThermoFisher Scientific) medium containing 5% CO 2 at 37 ° C.
  • 3T3-L1 adipose precursor cells were purchased from ATCC and subcultured in DMEM (purchased from ThermoFisher Scientific) containing 10% NBCS (New Born Calf Serum) and 1% penicillin / streptomycin at 5% CO 2 at 37 ° C .
  • adipose-derived stem cells were cultured at 5% CO 2 and 37 ° C. Then, the cells were washed with a phosphate-buffered saline (purchased from ThermoFisher Scientific), replaced with serum-free, non-phenol red medium, cultured for 1 to 10 days, and the supernatant .
  • a phosphate-buffered saline purchased from ThermoFisher Scientific
  • Trehalose was added to the culture medium in an amount of 2% by weight in order to obtain an exosome having a uniform particle size distribution and high purity in the process of separating exosome.
  • the culture was filtered with a 0.22 ⁇ m filter to remove impurities such as cellular debris, waste products and large particles.
  • the filtered cultures were immediately separated to isolate exosomes.
  • the filtered culture was stored in a refrigerator (image below 10 ° C) and used for exosome isolation.
  • the filtered culture was frozen in an ultra-low temperature freezer at -60 ° C or lower, and thawed, followed by exosome isolation. Then, the exosomes were separated from the culture medium by using Tangential Flow Filtration (TFF).
  • TMF Tangential Flow Filtration
  • Example 1 a TFF (Tangential Flow Filtration) method was used for separating, concentrating, desalting and diafiltration exosomes from a culture filtrated with a 0.22 ⁇ m filter.
  • a cartridge filter also called a hollow fiber filter (purchased from GE Healthcare) or a cassette filter (purchased from Pall or Sartorius or Merck Millipore) was used.
  • the TFF filter can be selected by a variety of molecular weight cutoffs (MWCO). Exosomes were selectively isolated and concentrated by selected MWCOs, and particles, proteins, lipids, nucleic acids, low molecular weight compounds, etc. smaller than MWCO were removed.
  • MWCO molecular weight cutoffs
  • TFF filters of MWCO 100,000 Da (Dalton), 300,000 Da, or 500,000 Da were used.
  • the culture medium was concentrated to a volume of about 1/100 to 1/25 using the TFF method, and substances smaller than MWCO were removed to separate the exosomes.
  • Separated and concentrated exosomal solutions were further desalted and buffered (diafiltration) using the TFF method.
  • the desalination and buffer exchange are performed by continuous diafiltration or discontinuous diafiltration, and at least 4 times, preferably 6 times to 10 times or more, more preferably, Was performed using a buffer solution having a volume of 12 times or more.
  • 2% by weight of trehalose dissolved in PBS was added to obtain an exosome having a uniform particle size distribution and high purity.
  • 6A to 6E show the effect of obtaining an exosome having a high purity and a uniform particle size distribution with trehalose treatment at a high yield.
  • the amount of protein in the fractions of the isolated exosome, culture medium, and TFF separation process was measured using BCA colorimetry (purchased from ThermoFisher Scientific) or FluoroProfile fluorescence (purchased from Sigma).
  • BCA colorimetry purchased from ThermoFisher Scientific
  • FluoroProfile fluorescence purchased from Sigma.
  • the extent to which the exosome was isolated and concentrated by the TFF method of the present invention and the removal of proteins, lipids, nucleic acids, and low-molecular compounds was monitored by a protein determination method, and the results are shown in FIG. As a result, it was found that the protein present in the culture solution was very effectively removed by the TFF method of one embodiment of the present invention.
  • FIG. 3 shows the results of comparing the productivity and purity in five independent batches when isolating exosomes by the TFF method of one embodiment of the present invention. As a result of analyzing the results obtained from the five independent batches, it was confirmed that the exosome can be separated very stably by the TFF method of one embodiment of the present invention.
  • 5A to 5C show results of NTA analysis of the size distribution of exosome according to whether or not trehalose was added after the exosome was separated by the TFF method.
  • concentration of trehalose was increased to 0% by weight, 1% by weight and 2% by weight (from top to bottom of FIGS. 5A to 5C) and repeated three times.
  • particles having a size of 300 nm or more were identified, while particles having a size of 300 nm or more were reduced by increasing the amount of trehalose, and the size distribution of the exosome was uniformized .
  • FIG. 4D shows the presence of CD9, CD63, CD81 and TSG101 markers as a result of performing Western blotting on isolated exosomes according to the method of one embodiment of the present invention.
  • Anti-CD9 purchased from Abcam
  • anti-CD63 purchasedd from System Biosciences
  • anti-CD81 purchasedd from System Biosciences
  • anti-TSG101 purchasedd from Abcam
  • FIG. 4E shows the presence of CD63 and CD81 markers as a result of analysis using a flow cytometer on exosomes isolated according to the method of one embodiment of the present invention.
  • Human CD63 isolation / detection kit purchased from ThermoFisher Scientific
  • PE-mouse anti-human CD63 PE-Mouse anti markers were stained using the PE-mouse CD63 (purchased from BD) and PE-mouse anti-human CD81 (purchased from BD), and analyzed using a flow cytometer (ACEA Biosciences) Respectively.
  • exosomes were treated by concentration to the cells and the proliferation rate of the cells was confirmed.
  • HS68 cells were suspended in DMEM containing 10% FBS, and the cells were mixed with 80 ⁇ 90% confluency and cultured in a 5% CO 2 incubator at 37 ° C for 24 hours. After 24 hours, the culture solution was removed, and the cell survival rate was evaluated by culturing the exosome prepared in Example 2 for each concentration and culturing for 24 to 72 hours.
  • WST-1 reagent purchased from Takara
  • MTT reagent purchased from Sigma
  • CellTiter-Glo reagent purchased from Promega
  • Aramar Blue reagent alamarBlue reagent purchased from ThermoFisher Scientific
  • a microplate reader purchased from Molecular Devices
  • the comparison group was based on the number of cells cultured in the normal cell culture medium not treated with exosome, and it was confirmed that the exosome-induced cytotoxicity did not appear within the tested concentration range (FIG. 7).
  • the combination of sapogenin and exosomes was prepared and used as follows.
  • Saponin and exosomes are mixed and reacted at room temperature, and saponin which has not penetrated into exosomes is removed ("sapogenin-exosome").
  • a size fractionation column for example a MW 3000 spin column (purchased from ThermoFisher), was used to remove unconjugated sapogenin from the exosome.
  • diosgenin was used as sapogenin.
  • both (1) and (2) above are referred to as a combination of sapogenin and exosomes.
  • Example 6 Assessment of lipid uptake upon induction of differentiation into adipocytes
  • 3T3-L1 adipose precursor cells (3T3-L1 preadipocytes) were clonally expanded to obtain a sufficient number of cells before use. Lipid accumulation effect by the combination of sapogenin and exosomes in one embodiment of the present invention was evaluated as follows when inducing differentiation into adipocytes.
  • 3T3-L1 adipose precursor cells were inoculated into each well of a 24-well plate at a density of 8 ⁇ 10 3 cells / cm 2 and cultured in a 5% CO 2 incubator at 37 ° C. for 3 to 4 days.
  • Differentiation was induced by culturing in DMEM medium (hereinafter referred to as "differentiation medium") containing 5% FBS (fetal bovine serum) and 5% penicillin-streptomycin for 2 days.
  • FBS fetal bovine serum
  • Pioglitazone an experimental group (positive control) (indicated by "P” in FIG. 10) cultured and treated with pioglitazone (purchased from Sigma; final concentration 10 ⁇ M) in addition to differentiation medium;
  • Diosgenin Experimental group treated with Diosgenin (purchased from Sigma; final concentration 10 ⁇ M) in addition to differentiation medium (denoted as “D” in FIG. 10);
  • Diosgenin and Exosome Diosgenin and Exosome (Diosgenin + Exosome): An experimental group (Diosgenin + Exosome) treated with a combination of diosgenin (final concentration 10 ⁇ M) and exosome prepared in Example 2 (final concentration 4 ⁇ g / Quot; D + Exo " in Fig. 10).
  • 3T3-L1 adipose precursor cells were cultured in differentiation medium.
  • Differentiation medium was supplemented with 10% FBS (fetal bovine serum) supplemented with 5 ⁇ g / mL insulin and 5 (Hereinafter referred to as " maturation medium ") containing 2% penicillin-streptomycin, and then cultured for 2 to 20 days to induce maturation. At this time, the maturation medium was changed once every two days.
  • FBS fetal bovine serum
  • lipid droplet formation in 3T3-L1 cells is an indicator of differentiation into adipocytes
  • adipogenesis adipogenesis in adipocytes
  • 3T3-L1 cells were cultured in differentiation medium to induce differentiation, and 3 days later, 3T3-L1 cells were stained with oil red O and photographed with an optical microscope (FIG. 9).
  • lipid dyes stained with fat droplets were eluted with isopropanol, and the absorbance at 510 nm was measured. Lipid accumulation in 3T3-L1 cells was measured in each experimental group, and the amount of lipid accumulation increase in the negative control group was evaluated as a percentage 10).
  • composition comprising the combination of sapogenin and exosome of the present invention can be used for skin defect correction, bulkiness, volume-reduction by increasing lipid accumulation when applied to a body defect site or a skin defect site due to lipid deficiency, up and skin swelling effects.
  • Example 7 Evaluation of cytoprotective effect upon induction of differentiation into adipocytes
  • Diosgenin an experimental group (denoted by “ D " in Fig. 12) treated with a high concentration of diosgenin (final concentration 30 ⁇ M) in addition to the differentiation medium;
  • Diosgenin + Exosome A combination of a high concentration of diosgenin (final concentration 30 ⁇ M) and the exosome prepared in Example 2 (final concentration 4 ⁇ g / mL) Experimental group (denoted as " D + Exo " in FIG. 12).
  • 3T3-L1 cells were cultured in a differentiation medium according to the method of Example 6, and 3T3-L1 cells were photographed by an optical microscope on the 3rd day after induction of differentiation was initiated.
  • Fig. 11 in the experimental group treated with only high concentration of sapogenin (diosgenin), there were many 3T3-L1 cells floating away from the bottom surface due to cell death due to cell death, It was observed that the cell death of 3T3-L1 cells was relatively small when the combination of high concentration of sapogenin (diosgenin) and exosome was treated.
  • MTT assay was performed to measure cell viability.
  • MTT assays were performed on day 3 using 0.5 mg / mL of thiazolyl blue tetrazolium bromide. The absorbance at 570 nm was measured, and the cell survival rate of the negative control group of each experimental group was evaluated as a percentage (FIG. 12).
  • the cell survival rate was significantly increased as compared with the group treated with high concentration of sapogenin (diose genine) alone . That is, when the combination of sapogenin and exosomes of the present invention is administered to the adipose precursor cells to induce differentiation, lipid accumulation into the cells is increased compared to the treatment with sapogenin alone, and in addition, toxicity due to high concentration of sapogenin And protects the cells.
  • the composition comprising the combination of sapogenin and exosomes of the present invention not only promotes lipid accumulation into adipocytes and differentiation into adipocytes, but also reduces cytotoxicity due to sapogenin component compared to sapogenin alone, And can exhibit skin defect correction, bulkiness, volume-up, and skin bloating effects while reducing side effects to the skin.
  • the effect of promoting differentiation into adipocytes by combination of sapogenin and exosomes in one embodiment of the present invention was evaluated as follows.
  • 3T3-L1 adipose precursor cells were suspended in DMEM medium (Dulbecco Modified Eagle Medium) supplemented with 10% NBCS (Newborn calf serum) and 1% penicillin-streptomycin (purchased from ThermoFisher Scientific) plate at a density of 8 ⁇ 10 3 cells / cm 2 , and cultured in a 5% CO 2 incubator at 37 ° C. for 72 hours.
  • DMEM medium Dulbecco Modified Eagle Medium
  • NBCS Newborn calf serum
  • penicillin-streptomycin purchasedd from ThermoFisher Scientific
  • Differentiation was induced by culturing in DMEM medium (hereinafter referred to as "differentiation medium") containing 1% fetal bovine serum (FBS) and 1% penicillin-streptomycin for 48 hours.
  • FBS fetal bovine serum
  • penicillin-streptomycin penicillin-streptomycin
  • Growth medium an experimental group in which DMEM medium was used instead of the differentiation medium;
  • Pioglitazone an experimental group (positive control) cultured and treated with pioglitazone (final concentration 10 ⁇ M) in addition to the differentiation medium;
  • Diosgenin + Exosome (Diosgenin + Exosome): Experimental group in which a combination of diosgenin (final concentration 10 ⁇ M) and exosome prepared in Example 2 (final concentration 6 ⁇ g / mL) was cultured in addition to the differentiation medium.
  • the differentiation medium was supplemented with 10% FBS (fetal bovine serum) supplemented with 5 ⁇ g / mL insulin and 1 (Hereinafter referred to as " maturation medium ”) containing 50% penicillin-streptomycin, and then cultured for 48 hours to induce maturation.
  • FBS fetal bovine serum
  • the amount of mRNA expression of the adipocyte differentiation-related markers was measured by real-time PCR in each experimental group on day 0, day 1, day 4, and day 6 after 3T3-L1 cells were cultured in differentiation medium to induce differentiation, (Diosgenin) and exosomes in one embodiment of the present invention were confirmed to promote the differentiation into adipocytes.
  • CDNAs were prepared from RNA isolated from 3T3-L1 cells in each experimental group, and PCR was performed using real-time PCR, using peroxisome proliferator-activated receptor gamma (PPAR-gamma), C / EBP-alpha (CCAAT / enhancer -binding protein alpha, FAS (fatty acid synthase), ACC (acetyl-CoA carboxylase), GDPH (glycerol-3-phosphate dehydrogenase), GADPH (glyceraldehyde-3-phosphate dehydrogenase) and Pref- mRNA expression levels were measured and compared.
  • PPIA Peptidylprolyl isomerase A gene was used as a standard gene for quantifying the above genes. The types and sequences of the primers used in the real-time PCR are shown in Table 1 below.
  • the mRNA of PPAR-y which is an adipocyte differentiation marker, compared with the differentiation medium alone treatment on the 6th day after induction of differentiation And the expression level was significantly increased (Fig. 13).
  • the mRNA expression of PPAR-y was significantly higher than that of the positive control group of pioglitazone or diosgenin on the 6th day after initiation of differentiation induction .
  • the combination of sapogenin and exosome in one embodiment of the present invention is effective in promoting differentiation into adipocytes, which is superior to pioglitazone at a certain point after induction of differentiation into adipocytes.
  • C / EBP-alpha mature adipocytes Gt; mRNA < / RTI > expression of the marker (FIG. 14).
  • mRNA expression of FAS, ACC, GDPH, and GADPH which are markers related to adipocyte differentiation, (Figs. 15 to 18).
  • the composition comprising the combination of sapogenin and exosome of the present invention has an effect of promoting the differentiation from adipose precursor cells into adipocytes. Accordingly, the composition of the present invention can be used to promote the differentiation into adipocytes and to stimulate the adipocyte introduction and growth when locally applied to a site of defective or defective skin due to lipid deficiency, It can prevent, alleviate, ameliorate, or restore physical defects or skin defects.
  • 3T3-L1 adipose precursor cells were suspended in DMEM medium (Dulbecco Modified Eagle Medium) supplemented with 10% NBCS (Newborn calf serum) and 1% penicillin-streptomycin (purchased from ThermoFisher Scientific) plate at a density of 8 ⁇ 10 3 cells / cm 2 and a combination of pioglitazone (final concentration 10 ⁇ M) or diosgenin (final concentration 10 ⁇ M) and exosome prepared in Example 2 (final concentration 6 ⁇ g / mL) And cultured in a 5% CO 2 incubator at 37 ° C for 48 hours. After 48 hours, the cells were treated with DMEM medium containing 0.5 mg / mL of Thiazolyl Blue Tetrazolium Bromide (purchased from Sigma) and cultured for 2 hours
  • the purple crystals were dissolved in dimethyl sulfoxide (purchased from AMRESCO), and the absorbance was measured at 570 nm.
  • the liposome by the combination of sapogenin (diosgenin) and exosomes in one embodiment of the present invention The cell proliferation promoting effect was confirmed. As a result, it was confirmed that when the combination of sapogenin (diosgenin) and exosomes in one embodiment of the present invention was treated, the proliferation rate of the lipid precursor cells was higher than that of the pioglitazone-treated group as the positive control (FIG. 20).
  • the composition comprising the combination of sapogenin and exosome of the present invention has an effect of promoting the proliferation of lipid precursor cells. Accordingly, the composition of the present invention can be used for the prophylactic treatment of lipid progenitor cells by increasing the number of differentiated adipocytes, and thereby, when lipoprotein is locally applied to a body defect site or a skin defect site due to lipid deficiency, It is expected to prevent, alleviate, ameliorate, or restore a defective body defect or skin defect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Birds (AREA)
  • Dispersion Chemistry (AREA)
  • Dermatology (AREA)
  • Cosmetics (AREA)

Abstract

본 발명은 엑소좀과 사포게닌을 유효성분으로 포함하는 조성물을 제공한다. 본 발명의 조성물은 지방전구세포 증식, 지방세포 내로의 지질 축적, 및/또는 지방세포로의 분화를 촉진하고 사포게닌 성분에 의한 세포독성을 감소킬 수 있다. 따라서 본 발명의 조성물은 신체나 피부에 대한 부작용을 줄이면서 지질부족 등으로 볼륨감이 작아 불만족스러운 신체 결함 부위나 지질부족에 기인한 피부 결함 부위에 간편하게 도포되어 사용될 수 있다.

Description

사포게닌과 엑소좀을 유효성분으로 포함하는 조성물
본 발명은 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물에 관한 것으로서, 보다 상세하게는 지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 조성물에 관한 것이다.
또한, 본 발명은 상기 조성물을 포함하는 기능성 화장료 조성물 및 피부외용제에 관한 것이다.
얼굴이나 신체 등의 외모에 대한 관심이 증가함에 따라 피부 상태를 개선하고 외모의 부족한 부분을 보완하고자 하는 미용 수요가 늘어나고 있다. 특히, 피부 주름이나 그 밖의 피부 외관 상태를 개선하는 것을 목적으로 하는 코스메틱 시술에 대한 관심이 높아지고 있다. 예를 들어, 보톡스나 필러를 국소적으로 피부에 주사하여 주름을 개선하는 방법이 있다.
최근에는 지질부족 등으로 볼륨감이 작은 신체 결함 부위(이른바 "콤플렉스" 부위)에 볼륨감을 주어 시각적으로 아름답게 보이게 하는 코스메틱 시술이 각광을 받고 있다. 필러는 볼륨증대 효과를 기반으로 볼륨감이 작은 신체 부위, 예를 들어 입술, 코, 이마, 볼, 가슴, 성기 등에 국소적으로 적용함으로써 해당 신체 부위에 볼륨감을 줄 수 있다. 그러나 히알루론산 필러는 시간의 경과에 따라 생체 내에서 분해되기 때문에 볼륨감을 계속적으로 유지하기 위해서는 주기적으로 신체 결함 부위에 필러를 주사해야 하는 문제가 있다. 또한 필러 주사는 통증을 수반하는 문제가 있다.
따라서 지질부족 등으로 볼륨감이 작아 불만족스러운 신체 결함 부위나 지질부족에 기인한 피부 결함 부위에 지방을 도입하여 해당 부위에 볼륨감을 주면서도 통증을 수반하지 않고 사용이 간편한 새로운 미용 소재의 개발이 필요하다. 이와 관련하여 사르사사포게닌(sarsasapogenin)을 포함한 식물추출물을 이용한 피하지방 조직 확대 방법이 제안된 바가 있다. 그러나 사르사사포게닌은 제형의 안정성, 세포독성에 의한 부작용 가능성 및 효능 강화 측면에서 개선할 필요가 있다.
한편, 최근 세포 분비물(secretome)에 세포의 행동(behavior)을 조절하는 다양한 생체활성인자가 포함되어 있다는 연구가 보고되고 있으며, 특히 세포 분비물 내에는 세포 간 신호전달 기능을 갖는 '엑소좀(exosome)'이 포함되어 있어 그 성분과 기능에 대한 연구가 활발히 진행 중에 있다.
세포는 세포외 환경에 다양한 막(membrane) 유형의 소포체를 방출하는데, 통상 이러한 방출 소포체들을 세포외 소포체(Extracellular vesicles, EV)라고 부르고 있다. 세포외 소포체는 세포막 유래 소포체, 엑토좀(ectosomes), 쉐딩 소포체(shedding vesicles), 마이크로파티클(microparticles), 엑소좀 등으로 불려지기도 하며, 경우에 따라서는 엑소좀과는 구별되어 사용되기도 한다.
엑소좀은 세포막의 구조와 동일한 이중인지질막으로 이루어진 수십 내지 수백 나노미터 크기의 소포체로서 내부에는 엑소좀 카고(cargo)라고 불리는 단백질, 핵산(mRNA, miRNA 등) 등이 포함되어 있다. 엑소좀 카고에는 광범위한 신호전달 요소들(signaling factors)이 포함되며, 이들 신호전달 요소들은 세포 타입에 특이적이고 분비세포의 환경에 따라 상이하게 조절되는 것으로 알려져 있다. 엑소좀은 세포가 분비하는 세포 간 신호전달 매개체로서 이를 통해 전달된 다양한 세포 신호는 표적 세포의 활성화, 성장, 이동, 분화, 탈분화, 사멸(apoptosis), 괴사(necrosis)를 포함한 세포 행동을 조절한다고 알려져 있다. 엑소좀은 유래된 세포의 성질 및 상태에 따라 특이적인 유전물질과 생체활성 인자들이 포함되어 있다. 증식하는 줄기세포 유래 엑소좀의 경우 세포의 이동, 증식 및 분화와 같은 세포 행동을 조절하고, 조직 재생과 관련된 줄기세포의 특성이 반영되어 있다(Nature Review Immunology 2002 (2) 569-579).
그러나 엑소좀을 이용한 특정 질환의 치료에 대한 가능성 제시 등 다양한 연구가 이루어지고 있음에도 불구하고, 엑소좀을 안정적으로 유지·보관할 수 있는 새로운 제형 개발과 엑소좀의 사용 편의성 및 효능 증대 등을 위한 다양한 의료 내지는 미용기술과의 접목은 상대적으로 주목받고 있지 못하고 있다.
본 발명자들은 엑소좀의 새로운 응용분야 및 의료 내지는 미용기술과의 접목에 대해 예의 연구를 거듭하던 중, 사포게닌과 엑소좀의 조합이 사포게닌에 의한 세포독성을 줄이면서 지방전구세포 증식, 지방세포 내로의 지질 축적(lipid uptake) 및 지방세포로의 분화(adipogenesis)를 촉진하는 것을 확인하여 본 발명을 완성하였다.
한편, 상기한 배경기술로서 설명된 사항들은 본 발명의 배경에 대한 이해 증진을 위한 것일 뿐, 본 발명의 "선행 기술"로서 이용될 수 있다는 승인으로서 인용한 것은 아님을 이해하여야 한다.
본 발명의 목적은 엑소좀과 사포게닌을 유효성분으로 포함하는 조성물로서, 지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 조성물을 제공하는데 있다.
본 발명의 다른 목적은 상기 조성물을 포함하는 기능성 화장료 조성물 및 피부외용제를 제공하는데 있다.
본 발명의 또 다른 목적은 상기 조성물을 포유동물의 신체 결함 부위나 피부 결함 부위에 국소적으로 도포함으로써 상기 조성물이 도포된 신체 결함 부위나 피부 결함 부위의 볼륨감 증대를 가져오는 치료용을 제외한 미용방법을 제공한다.
그러나, 전술한 바와 같은 본 발명의 과제는 예시적인 것으로, 이에 의해 본 발명의 범위가 제한되는 것은 아니다. 또한, 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
상기와 같은 목적을 달성하기 위하여, 본 발명은 지질부족에 기인한 신체 결함이나 피부 결함을 예방, 완화, 개선 또는 회복하는 조성물로서, 사포게닌과 엑소좀의 조합을 유효성분으로 포함하는 조성물을 제공한다.
본 명세서에서 용어, "엑소좀(exosomes)"은 세포막의 구조와 동일한 이중인지질막으로 이루어진 수십 내지 수백 나노미터(바람직하게는 대략 30~200 nm) 크기의 소포체를 의미한다(단, 분리 대상이 되는 세포 종류, 분리방법 및 측정방법에 따라 엑소좀의 입자 크기는 가변될 수 있음)(Vasiliy S. Chernyshev et al., "Size and shape characterization of hydrated and desiccated exosomes", Anal Bioanal Chem, (2015) DOI 10.1007/s00216-015-8535-3). 엑소좀에는 엑소좀 카고(cargo)라고 불리는 단백질, 핵산(mRNA, miRNA 등) 등이 포함되어 있다. 엑소좀 카고에는 광범위한 신호전달 요소들(signaling factors)이 포함되며, 이들 신호전달 요소들은 세포 타입에 특이적이고 분비세포의 환경에 따라 상이하게 조절되는 것으로 알려져 있다. 엑소좀은 세포가 분비하는 세포 간 신호전달 매개체로서 이를 통해 전달된 다양한 세포 신호는 표적 세포의 활성화, 성장, 이동, 분화, 탈분화, 사멸(apoptosis), 괴사(necrosis)를 포함한 세포 행동을 조절한다고 알려져 있다.
본 명세서에서 용어, "사포게닌(sapogenin)"은 사포닌의 아글리콘으로서 일부는 유리된 형태로 식물계에 분포한다. 사포게닌은 다양한 식물에서 추출가능한 천연유래 화합물로서, 피의 흐름을 원활하게 하고 진해, 거담, 이뇨, 항암 등의 효능이 있는 것으로서 알려져 있다. 상기 사포게닌의 종류는 제한되지 않으나, 본 발명을 한정하지 않는 하나의 예시로서, 디오스게닌(diosgenin), 헤코게닌(hecogenin), 스밀라게닌(smilagenin), 에피스밀라게닌(epismilagenin), 사르사사포게닌(sarsasapogenin), 이소사르사사포게닌(isosarsasapogenin), 에피사르사사포게닌(episarsasapogenin), 파리게닌(parigenin), 티고게닌(tigogenin), 에피티고게닌(epitigogenin), 네오티고게닌(neotigogenin), 파릴린(parillin), 티모사포닌(timosaponin), 키시링사포닌(xilingsaponin), 피리페린(filiferin), 야모게닌(yamogenin), 또는 유카게닌(yuccagenin)일 수 있고, 바람직하게는 디오스게닌일수 있다.
본 명세서에서 용어, "생물학적 용액"은 생물기원의 액체 용액으로서 엑소좀이 분산, 현탁, 침전, 부유 또는 혼합되어 있는 용액을 의미하고, 예를 들어 세포 배양액, 세포 배양 상청액, 줄기세포 배양액, 줄기세포 배양 상청액, 전혈, 혈청, 제대혈, 혈장, 복수액, 뇌 및 뇌척수액, 태반 추출액 및 골수 흡입물 등을 들 수 있다. 그러나, 본 발명은 이에 제한되는 것이 아니고 다양한 동물, 식물, 세균(bacteria), 균류(fungi), 조류(algae) 등 다양한 생물 기원의 용액을 배제하는 것이 아님은 물론이다. "생물학적 용액"은 엑소좀을 방출 및/또는 분비시키는 조건 하에서 배양 또는 인큐베이션될 수 있고, 냉동 및 해동될 수도 있다.
한편, 본 명세서에서 사용된 "엑소좀"이란 용어는 다양한 동물, 식물, 세균(bacteria), 균류(fungi), 조류(algae) 등의 세포, 바람직하게는 줄기세포에서 분비되어 세포외 공간으로 방출된 나노 크기의 베지클 구조를 갖고 있고 엑소좀과 유사한 조성을 갖는 베지클(예를 들어, 엑소좀-유사 베지클)을 모두 포함하는 것을 의미한다.
그러나 본 발명에서 사용되는 엑소좀은 지질부족 등으로 인해 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 효과가 있고 인체에 불리한 작용을 일으키지 않는 것이라면 당업계에서 사용되고 있거나 향후 사용될 수 있는 다양한 엑소좀을 사용할 수 있음은 물론이다. 따라서, 후술하는 실시예들의 분리방법에 따라 분리된 엑소좀은 본 발명에서 사용될 수 있는 엑소좀의 일례로서 이해되어야 하며, 본 발명은 이에 제한되는 것이 아님을 명백히 밝혀 둔다.
본 발명의 명세서에서 사용된 용어, "신체 결함 부위 또는 피부 결함 부위"는 지질부족 등으로 볼륨감이 작은 신체 부위, 예를 들어 작은 가슴이나 성기, 피하지방이 결여된 피부 영역 등을 의미한다. 신체 결함 부위나 피부 결함 부위는 예를 들면 피부처짐, 움푹 들어간 뺨, 패인 눈, 피부 주름 (예를 들어, 얼굴 주름, 목 주름, 손 주름 등), 피부 탄력감소, 잔주름, 주름살, 거칠고 깊은 주름, 피부 균열, 융기(bumps), 피부 건조 등의 결과를 초래할 수 있다.
또한, 본 발명의 명세서에서 사용된 용어, "볼륨감 증대(volumizing)"는 1) "지질부족 등으로 볼륨감이 작아 불만족스러운 신체 결함 부위에 볼륨감을 주는 것", 2) "지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 것", 또는 3) 상기 1) 및/또는 2)에 의해 "신체나 피부를 아름답게 하는 것"일 수 있다. 본 발명을 한정하지 않는 예시로서 "지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 것"은 지방전구세포(preadipocyte) 증식, 지방세포(adipocyte) 내로의 지질 축적(lipid uptake), 및/또는 지방세포로의 분화(adipogenesis)를 촉진하고 지질 부족을 나타내는 피부 영역에서 지방세포의 도입 및 성장을 자극하는 과정을 포함한다. 이러한 지방세포의 도입 및 성장은 피부의 두께를 단계적이면서 큰 폭으로 증가시킴으로써 풍만함, 볼륨업(volume-up) 및 피부팽만 효과를 만들어 내고, 피부를 탄력 있게 만들며 피부 결함을 예방, 완화, 개선 또는 제거할 수 있다.
예를 들어, "지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 것"은 피부처짐, 움푹 들어간 뺨, 패인 눈, 피부 주름 (예를 들어, 얼굴 주름, 목 주름, 손 주름 등), 피부 탄력감소, 잔주름, 주름살, 거칠고 깊은 주름, 피부 균열, 융기, 흉터, 튼살 등을 예방, 완화, 개선 또는 제거하는 것 또는 정상 상태로 회복시키는 것; 피부 재생, 지방 재생, 윤곽교정, 연부조직의 결함 보정, 조직확대, 볼륨업(volume-up), 유방 확대, 성기 확대, 피부 보습 등을 포함할 수 있다. 그러나, 본 발명에 있어서 "지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 것"은 전술한 것에 제한되지 않고, 지방전구세포 증식, 지방세포 내로의 지질 축적, 및/또는 지방세포로의 분화를 촉진하고 지질 부족을 나타내는 영역에서 지방세포의 도입 및 성장을 자극하여 다양한 원인으로 지질 부족을 나타내는 신체 결함이나 피부 결함을 예방, 완화, 개선, 제거 또는 회복시켜 주는 것을 포함할 수 있다.
본 발명의 일 구체예의 조성물은 엑소좀과 사포게닌의 조합을 유효성분으로 포함한다.
본 발명의 일 구체예의 조성물에 있어서, 상기 사포게닌과 엑소좀의 조합은 상기 사포게닌을 상기 엑소좀과 함께 인큐베이션시켜 수득될 수 있다.
본 발명의 일 구체예의 조성물에서 있어서, 상기 사포게닌과 엑소좀의 조합은, 상기 사포게닌과 상기 엑소좀을 혼합하고, 상기 사포게닌과 상기 엑소좀의 혼합물을 인큐베이션하여 얻을 수 있다. 상기 사포게닌과 엑소좀의 조합에서, 상기 사포게닌은 상기 엑소좀에 침투되거나 적어도 결합(association)되어 담지될 수 있다.
본 발명의 일 구체예의 조성물은 지방전구세포 증식, 지방세포 내로의 지질 축적 또는 지방세포로의 분화 중 적어도 하나를 촉진하는 것을 특징으로 한다. 추가로, 본 발명의 일 구체예의 조성물은 사포게닌 성분에 의한 세포독성을 감소시키는 것을 특징으로 한다.
본 발명을 한정하지 않는 하나의 예시로서, 상기 엑소좀은 하기의 단계들을 수행하여 수득될 수 있다: (a) 생물학적 용액에 트레할로오스를 첨가하는 단계, (b) 상기 트레할로오스가 첨가된 생물학적 용액을 여과하는 단계, (c) 상기 여과된 생물학적 용액으로부터, TFF(Tangential Flow Filtration)를 이용하여 엑소좀을 분리하는 단계, 및 (d) 탈염과 버퍼교환(diafiltration)에 사용되는 완충용액에 트레할로오스를 첨가하고, 상기 트레할로오스가 첨가된 완충용액을 이용한 TFF(Tangential Flow Filtration)를 이용하여, 상기 분리된 엑소좀에 대한 탈염과 버퍼교환(diafiltration)을 수행하는 단계.
한편, 상기 (d) 단계에서 탈염과 버퍼교환(diafiltration)에 사용되는 완충용액에 트레할로오스를 첨가하면, 입자크기 분포가 균일하고 순도가 높은 엑소좀을 효과적으로 수득할 수 있다(도 6A 내지 도 6E 참조). 본 발명에서는 TFF에 의한 엑소좀 분리 전의 사전 여과 과정((b) 단계)과 엑소좀 분리 후 TFF에 의한 탈염 및 버퍼교환 과정((d) 단계)에서 트레할로우스를 사용하는 것에 의해 고순도의 입자크기 분포가 균일한 엑소좀을 높은 수율로 수득할 수 있다. 한편, 본 발명에 있어서 트레할로오스는 세포 잔해물, 노폐물, 단백질 및 거대 입자와 같은 불순물에 대해 엑소좀을 효율적으로 분별할 수 있는 기능을 부여한다.
상기 탈염과 버퍼교환은 연속적으로 수행하거나 단속적으로 수행할 수 있다. 시작 부피(starting volume)에 대하여 적어도 4배, 바람직하게는 6배 내지는 10배 이상, 보다 바람직하게는 12배 이상의 부피를 갖는 완충용액을 이용하여 탈염과 버퍼교환을 수행할 수 있다. 또한, TFF를 위해 MWCO(molecular weight cutoff) 100,000 Da(Dalton), 300,000 Da, 500,000 Da 또는 750,000 Da의 TFF 필터, 또는 0.05 ㎛ TFF 필터를 사용할 수 있다. 상기 (c) 단계는 TFF(Tangential Flow Filtration)를 이용하여 1/100 내지 1/25의 부피까지 농축하는 과정을 더 포함할 수 있다.
본 발명을 한정하지 않는 하나의 예시로서, 상기 생물학적 용액은 줄기세포 배양액일 수 있다. 상기 줄기세포의 종류는 제한되지 않으나, 바람직하게는 중간엽 줄기세포, 예를 들어 지방, 골수, 제대 또는 제대혈 유래 줄기세포일 수 있으며, 보다 바람직하게는 지방 유래 줄기세포일 수 있다. 상기 지방 유래 줄기세포의 종류는 병원체에 의한 감염의 위험이 없고 면역 거부 반응을 일으키지 않는 것이라면 제한되지 않으나, 바람직하게는 인간지방 유래 줄기세포일 수 있다.
그러나 본 발명에서 사용되는 엑소좀은 전술한 바와 같은 분리방법에 따라 수득된 엑소좀에 제한되는 것이 아니며, 당업계에서 사용되고 있거나 향후 사용될 수 있는 다양한 엑소좀을 사용할 수 있음은 물론이다. 상기 분리방법에 따라 분리된 엑소좀은 본 발명의 조성물에 사용될 수 있는 엑소좀의 일례로서 이해되어야 하며, 본 발명은 이에 제한되는 것이 아님을 명백히 밝혀 둔다.
본 발명의 일 구체예의 조성물은 지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는데 효과적으로 이용될 수 있다.
본 발명의 일 구체예의 조성물은 기능성 화장료 조성물이거나 피부외용제일 수 있다.
한편, 본 발명의 일 구체예의 조성물이 피부외용제 및/또는 화장료 조성물로 제조되는 경우, 본 발명의 효과를 손상하지 않는 범위내에서 통상 화장품이나 피부외용제에 이용되는 성분, 예를 들면 보습제, 산화방지제, 유성성분, 자외선 흡수제, 유화제, 계면활성제, 증점제, 알콜류, 분말성분, 색재, 수성성분, 물, 각종 피부영양제 등을 필요에 따라 적절히 배합할 수 있다.
또한, 본 발명의 일 구체예의 피부외용제 및/또는 화장료 조성물은 사포게닌과 엑소좀 외에, 그 작용(지질부족 등으로 볼륨감이 작은 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 효과 등)을 손상시키지 않는 한도에서 종래부터 사용되어 오던 조직 확대 또는 재건 특성을 나타내는 성분을 함께 혼합하여 사용할 수 있다. 예를 들어, 본 발명의 조성물을 구성하는 사포게닌과 엑소좀은 하이드로겔, 히알루론산, 히알루론산 염(예를 들어 히알루론산 나트륨 등), 또는 히알루론산 겔 중 적어도 1종에 담지되거나 혼합될 수 있다. 본 발명의 일 구체예의 피부외용제 및/또는 화장료 조성물에서, 상기 하이드로겔의 종류는 제한되지 않으나, 바람직하게는 겔화 고분자를 다가 알코올에 분산시켜 얻은 하이드로겔일 수 있다. 상기 겔화 고분자는 플루로닉, 정제한천, 아가로오스, 젤란검, 알긴산, 카라기난, 카시아검, 잔탄검, 갈락토만난, 글루코만난, 펙틴, 셀룰로오스, 구아검 및 로커스트빈검으로 이루어진 군으로부터 선택된 적어도 1종일 수 있고, 상기 다가 알코올은 에틸렌글리콜, 프로필렌글리콜, 1,3-부틸렌글리콜, 이소부틸렌글리콜, 디프로필렌글리콜, 소르비톨, 자일리톨 및 글리세린으로 이루어진 군으로부터 선택된 적어도 1종일 수 있다.
본 발명의 일 구체예의 피부외용제 및/또는 화장료 조성물은 예를 들면, 패취, 마스크팩, 마스크시트, 크림, 토닉, 연고, 현탁액, 유탁액, 페이스트, 로션, 젤, 오일, 팩, 스프레이, 에어졸, 미스트, 파운데이션, 파우더, 기름 종이 등의 다양한 형태에 적용할 수 있다. 예들 들어, 본 발명의 일 구체예의 피부외용제 및/또는 화장료 조성물은 패취, 마스크팩 또는 마스크시트의 적어도 일면(一面)에 도포되거나 침적될 수 있다.
본 발명의 일 구체예의 조성물이 화장료 조성물로 제조되는 경우, 지질부족 등으로 볼륨감이 작아 불만족스러운 신체 결함이나 지질부족에 기인한 피부 결함을 예방, 완화, 개선 또는 회복하는 효과를 부여할 목적으로 사용되며, 화장품 제형은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있다. 예를 들어 패취, 마스크팩, 마스크시트, 유연화장수, 영양화장수, 수렴화장수, 영양크림, 마사지크림, 아이크림, 클렌징크림, 에센스, 아이에센스, 클렌징로션, 클렌징폼, 클렌징워터, 선스크린, 립스틱, 비누, 샴푸, 계면활성제-함유 클렌징, 입욕제, 바디로션, 바디크림, 바디오일, 바디에센스, 바디세정제, 염모제, 헤어토닉 등으로 제형화할 수 있으나 이에 한정되는 것은 아니다.
본 발명의 일 구체예의 피부외용제 및/또는 화장료 조성물은 피부외용제 및/또는 화장품에 통상적으로 이용되는 성분들을 포함하며, 예컨대 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 그리고 담체를 포함할 수 있다. 또한, 피부외용제 및/또는 화장료 조성물에 대한 각각의 제형에 있어서, 다른 성분들은 피부외용제 및/또는 화장료 조성물의 종류 또는 사용목적 등에 따라 당업자가 어려움 없이 적의 선정하여 배합할 수 있다.
본 발명의 다른 구체예는 상기 조성물을 포유동물의 신체 결함 부위나 피부 결함 부위에 국소적으로 도포함으로써 상기 조성물이 도포된 신체 결함 부위나 피부 결함 부위의 볼륨감 증대를 가져오는 치료용을 제외한 미용방법을 제공한다. 예를 들어, 볼륨감 증대란 피부 풍만함, 볼륨업(volume-up), 피부팽만 또는 피부탄력 개선일 수 있다.
본 발명의 일 구체예의 미용방법은, (a) 상기 조성물을 포유동물의 피부에 직접 도포하는 것, (b) 상기 조성물이 도포되거나 침적된 패취, 마스크팩 또는 마스크시트를 포유동물의 피부에 접촉 또는 부착하는 것, 또는 상기 (a) 및 (b)를 순차적으로 진행하는 것을 포함한다.
본 발명의 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물은 지방전구세포 증식, 지방세포 내로의 지질 축적 및/또는 지방세포로의 분화를 촉진하고 사포게닌 성분에 의한 세포독성을 감소킬 수 있다. 따라서 본 발명의 조성물은 신체나 피부에 대한 부작용을 줄이면서 지질부족 등으로 볼륨감이 작아 불만족스러운 신체 결함 부위나 지질부족에 기인한 피부 결함 부위에 간편하게 도포되어 사용될 수 있다.
또한, 본 발명의 조성물은 지방세포의 도입 및 성장에 의해 피부의 두께를 단계적이면서 큰 폭으로 증가시킴으로써 피부결함 보정, 풍만함, 볼륨업(volume-up) 및 피부팽만 효과를 나타낼 수 있다. 따라서 본 발명의 조성물은 지질부족을 나타내는 피부 영역에서 지방세포 내로의 지질 축적 및 지방세포로의 분화를 촉진하여 지방세포의 도입 및 성장을 자극하기 위한 기능성 화장료 조성물 및 피부외용제로서 유용하게 사용될 수 있다.
한편, 전술한 바와 같은 효과들에 의해 본 발명의 범위가 제한되는 것은 아니다.
도 1은 본 발명의 일 구체예에 따라 생물학적 용액으로부터 엑소좀을 제조하는 방법에 있어서 엑소좀을 분리 및 정제하는 과정을 설명하는 플로우챠트이다.
도 2는 본 발명의 일 구체예에 따라 생물학적 용액, 예를 들어 줄기세포 배양액으로부터 엑소좀을 제조하는 단계(step)별로 용액 내에 포함되어 있는 단백질의 총량 비율(Relative amount of protein)을 측정한 결과를 나타낸다. 각 단계별 단백질 총량의 비율은 생물학적 용액 전체에 대한 단백질 총량의 상대적 비율로 나타내었다. 실험 결과는 2개의 서로 다른 배치에서 얻어진 결과를 각각 도시하였다.
도 3은 본 발명의 일 구체예에 따라 얻어진 엑소좀의 생산성(productivity)과 순도(purity)를 측정한 결과를 도시한 것이다. 엑소좀의 생산성은 "생물학적 용액, 예를 들어 줄기세포 배양액(CM) 단위 mL 당 얻어진 엑소좀의 입자수"로 계산하였고, 엑소좀의 순도는 "최종 분획물에 포함되어 있는 단백질 단위 μg 당 엑소좀의 입자수"로 계산하였다. 실험 결과는 5개의 서로 다른 배치(batch)에서 얻어진 결과를 도시하였다.
도 4A 내지 도 4E는 본 발명의 일 구체예에 따라 얻어진 엑소좀의 물리적 특성 분석 결과를 도시한 것이다. "도 4A"는 TRPS(tunable resistive pulse sensing) 분석에 의한 입자 크기 분포와 입자수를 나타낸다. "도 4B"는 NTA(nanoparticle tracking analysis) 분석에 의한 입자 크기 분포와 입자수를 나타낸다. "도 4C"는 TEM(transmitted electron microscopy) 분석에 의한 입자 이미지를 배율에 따라 도시하였다. "도 4D"는 본 발명의 일 구체예에 따라 얻어진 엑소좀의 웨스턴 블랏 결과를 나타낸다. "도 4E"는 본 발명의 일 구체예에 따라 얻어진 엑소좀에 대한 마커 분석에 있어서 CD63 및 CD81에 대한 유세포분석 결과를 나타낸다.
도 5A 내지 도 5C는 트레할로오스 첨가에 따라 입자크기 분포가 균일하고 순도가 높은 엑소좀이 수득되는 것을 보여주는 입자 크기 분포에 관한 NTA 분석 결과를 도시한다. 첨가된 트레할로오스의 양이 증가함에 따라 단일한 피크를 갖는 입자 크기 분포 결과를 얻을 수 있다.
도 6A 내지 도 6C는 본 발명의 일 구체예에 따른 엑소좀의 제조과정에서 트레할로오스 첨가 여부에 따른 입자 크기 분포를 나타내는 NTA 분석 결과를 도시한다. "도 6A"는 제조 과정 전과정에서 트레할로오스를 첨가한 경우, "도 6B"는 세포 배양액을 동결 보관하였다가 해동한 후 트레할로오스를 첨가한 경우, "도 6C"는 트레할로오스를 첨가하지 않고 제조한 결과를 나타낸다. "도 6D"에는 도 6A 내지 도 6C 방법에 의하여 분리한 엑소좀의 상대적인 생산성(Relative productivity)과 상대 농도(Relative concentration)를 비교한 결과를 도시하였다. "도 6E"에는 도 6A 내지 도 6C 방법에 의하여 분리한 엑소좀의 평균 입자크기(Mean size)를 도시하였다.
도 7은 인체 피부섬유아세포인 HS68 세포에 본 발명의 일 구체예에 따른 엑소좀을 처리한 후 세포 독성이 없음을 확인한 결과를 도시한다.
도 8은 3T3-L1 세포에 대한 지방세포로의 분화 유도 시, 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합을 처리한 결과, 세포 내의 지방방울의 축적량과 크기가 증가한 것을 보여주는 광학현미경 사진이다.
도 9는 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 6일째에 3T3-L1 세포를 오일 레드 O로 염색한 후 촬영한 광학현미경 사진이다.
도 10은 도 9에서 오일 레드 O로 염색된 3T3-L1 세포 내의 지질축적 증가량을 음성대조군에 대한 백분율로 나타낸 그래프이다.
도 11은 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 3일째에 촬영한 광학현미경 사진이다. 도 11에는 죽은 세포들이 본래의 형태를 잃고 바닥면에서 떨어져 부유되어 있는 것이 나타나 있다.
도 12는 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 3일째에 MTT 어세이를 수행하여 얻은 세포생존율 결과를 음성대조군에 대한 백분율로 나타낸 그래프이다.
도 13은 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 6일째에 수행한 PPAR-γ 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 14는 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째 및 4일째에 수행한 C/EBP-α 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 15는 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째 및 4일째에 수행한 FAS 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 16은 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째 및 4일째에 수행한 ACC 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 17은 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째 및 4일째에 수행한 GDPH 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 18은 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째 및 4일째에 수행한 GADPH 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 19는 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째 및 4일째에 수행한 Pref-1 유전자에 대한 리얼타임 PCR 결과 그래프이다.
도 20은 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합을 처리한 경우, 양성대조군인 피오글리타존 처리군에 비해 지방전구세포(preadipocyte)의 증식률이 높은 것을 보여주는 그래프이다.
이하 본 발명을 하기 실시예에서 보다 상세하게 기술한다. 다만, 하기 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아니다. 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 통상의 기술자가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. 본 발명에 인용된 참고문헌들은 본 발명에 참고로서 통합된다.
명세서 전체에서, 어떤 부분이 어떤 구성 요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성 요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다.
실시예
실시예 1: 세포의 배양
인체 피부 섬유아세포(human dermal fibroblast)인 HS68 세포는 ATCC에서 구입하여, 10% 우태아 혈청 (fetal bovine serum: ThermoFisher Scientific에서 구입) 및 1% 항생제-항진균제 (antibiotics-antimycotics: ThermoFisher Scientific에서 구입)가 함유된 DMEM (ThermoFisher Scientific에서 구입) 배지에 5% CO2, 37℃ 조건에서 계대 배양하였다. 3T3-L1 지방전구세포는 ATCC에서 구입하여, 10% NBCS(New Born Calf Serum) 및 1% 페니실린/스트렙토마이신 함유 DMEM (ThermoFisher Scientific에서 구입) 배지에 5% CO2, 37℃ 조건에서 계대 배양하였다.
당해 발명이 속하는 기술분야에 알려진 세포배양 방법에 따라 5% CO2, 37℃ 조건에서 지방 유래 줄기세포를 배양하였다. 그 다음, 인산염 완충용액(phosphate-buffered saline)(ThermoFisher Scientific에서 구입)으로 세척 후, 무혈청, 무페놀레드 배지로 교체하여 1일 내지 10일간 배양하고 그 상층액(이하, 배양액)을 회수하였다.
엑소좀의 분리 과정에서 입자크기 분포가 균일하고 순도가 높은 엑소좀을 수득하기 위하여 배양액에 트레할로오스를 2 중량% 첨가하였다. 트레할로오스를 첨가한 후 배양액을 0.22 μm 필터로 여과하여 세포 잔해물, 노폐물 및 거대 입자 등의 불순물을 제거해 주었다. 여과된 배양액은 즉시 분리 과정을 통해 엑소좀을 분리하였다. 또한, 여과된 배양액은 냉장고(영상 10℃ 이하)에서 보관한 후 엑소좀 분리에 사용하였다. 또한, 여과된 배양액은 -60℃ 이하의 초저온 냉동고에서 동결 보관하였다가 해동시킨 후 엑소좀 분리를 수행하였다. 이후, 배양액으로부터 접선흐름여과장치(Tangential Flow Filtration; TFF)를 이용하여 엑소좀을 분리하였다.
실시예 2: TFF 방법에 의한 엑소좀의 분리 및 정제
실시예 1에서 0.22 μm 필터로 여과된 배양액으로부터 엑소좀을 분리, 농축, 탈염과 버퍼교환(diafiltration)을 위해 TFF(Tangential Flow Filtration) 방법을 사용하였다. TFF 방법을 위한 필터로는 카트리지 필터(cartridge filter, 일명 hollow fiber filter; GE Healthcare에서 구입) 또는 카세트 필터(cassette filter; Pall 또는 Sartorius 또는 Merck Millipore에서 구입)를 사용하였다. TFF 필터는 다양한 분자량 차단(molecular weight cutoff; MWCO)에 의해 선택될 수 있다. 선택된 MWCO에 의해 선별적으로 엑소좀을 분리, 농축하였고, MWCO보다 작은 입자나 단백질, 지질, 핵산, 저분자 화합물 등은 제거하였다.
엑소좀을 분리, 농축하기 위하여 MWCO 100,000 Da(Dalton), 300,000 Da, 또는 500,000 Da의 TFF 필터를 사용하였다. 배양액을 TFF 방법을 이용하여 1/100 내지 1/25 정도의 부피가 될 때까지 농축하면서, MWCO보다 작은 물질들은 제거하여 엑소좀을 분리하였다.
분리, 농축된 엑소좀 용액은 TFF 방법을 이용하여 추가로 탈염과 버퍼교환(diafiltration)을 수행하였다. 이때, 탈염과 버퍼교환은 연속적으로 수행(continuous diafiltration)하거나 단속적으로 수행(discontinuous diafiltration)하였으며, 시작 부피(starting volume)에 대하여 적어도 4배, 바람직하게는 6배 내지는 10배 이상, 보다 바람직하게는 12배 이상의 부피를 갖는 완충용액을 이용하여 수행하였다. 완충용액에는 입자크기 분포가 균일하고 순도가 높은 엑소좀을 수득하기 위하여 PBS에 녹인 2 중량%의 트레할로오스를 첨가하였다. 트레할로오스 처리에 따라 고순도이면서 입자크기 분포가 균일한 엑소좀을 높은 수율로 수득할 수 있는 효과를 확인한 결과는 도 6A 내지 도 6E에 도시하였다.
실시예 3: 분리된 엑소좀의 특성 분석
분리된 엑소좀, 배양액, 및 TFF 분리과정의 분획물에서 단백질의 양은 BCA 발색법(ThermoFisher Scientific에서 구입) 또는 플루오로프로파일(FluoroProfile) 형광법(Sigma에서 구입)을 이용하여 측정하였다. 본 발명의 일 구체예의 TFF 방법에 의해 엑소좀이 분리, 농축되고 단백질, 지질, 핵산, 저분자 화합물 등이 제거되는 정도는 단백질 정량법에 의하여 모니터링하여 그 결과를 도 2에 도시하였다. 그 결과 본 발명의 일 구체예의 TFF 방법에 의하여 매우 효과적으로 배양액에 존재하는 단백질이 제거됨을 알 수 있었다.
본 발명의 일 구체예의 TFF 방법에 의해 엑소좀을 분리하는 경우 생산성과 순도를 독립적인 다섯 배치에서 비교한 결과를 도 3에 도시하였다. 독립적인 다섯 배치로부터 얻어진 결과를 분석한 결과, 본 발명의 일 구체예의 TFF 방법에 의하여 매우 안정적으로 엑소좀을 분리할 수 있음을 확인하였다.
분리된 엑소좀은 나노입자 트랙킹 분석(nanoparticle tracking analysis:　NTA; Malvern에서 구입) 또는 가변 저항펄스 감지(tunable resistive pulse sensing: TRPS; Izon Science에서 구입)에 의해 입자의 크기와 농도를 측정하였다. 분리된 엑소좀의 균일도와 크기는 투과전자현미경(transmitted electron microscopy: TEM)을 이용하여 분석하였다. 본 발명의 일 구체예에 따라 분리된 엑소좀의 TRPS, NTA, TEM 분석 결과는 도 4A 내지 도 4C에 도시하였다.
TFF 방법으로 엑소좀을 분리한 후, 트레할로오스의 첨가 여부에 따른 엑소좀의 크기 분포를 NTA 분석한 결과를 도 5A 내지 도 5C에 도시하였다. 트레할로오스 농도를 0 중량%, 1 중량% 및 2 중량%로 증가시켰고(도 5A 내지 도 5C의 위에서부터 아래), 3회 반복하여 실험하였다. 트레할로오스가 존재하지 않은 경우 300 nm 이상의 크기를 갖는 입자가 확인되는 반면, 트레할로오스의 첨가량을 늘려주면 300 nm 이상의 크기를 갖는 입자가 줄어들고 엑소좀의 크기 분포가 균일해지는 것을 확인하였다.
TFF 방법으로 엑소좀을 분리하는 과정에 트레할로오스의 첨가에 따른 효과를 추가로 조사하였다. 도 6A 내지 도 6C에서 보는 바와 같이 엑소좀의 제조과정 전과정에 PBS에 녹인 2 중량%의 트레할로오스를 첨가한 경우, 균일한 크기 분포를 갖는 엑소좀을 얻을 수 있었다(도 6A). 반면 트레할로오스를 첨가하지 않고 동결 보관하였던 배양액을 사용하되, 탈염과 버퍼교환 과정에서만 트레할로오스를 첨가하여 TFF 과정을 진행한 경우나, 트레할로오스를 전혀 첨가하지 않고 TFF 과정을 진행한 경우, 크기가 큰 입자가 많이 포함된 불균일한 엑소좀을 얻었다(도 6B 및 도 6C).
분리된 엑소좀의 상대적인 생산성과 농도를 비교한 결과, 엑소좀의 제조과정 전과정에 트레할로오스를 첨가한 경우 매우 높은 생산성으로 엑소좀을 얻을 수 있었으며, 얻어진 엑소좀의 농도도 5배 이상 높았다(도 6D). NTA 분석 결과에서 나타난 바와 같이, 분리된 엑소좀의 평균 크기도 엑소좀의 제조과정 전과정에 트레할로오스를 첨가한 경우 200 nm로 균일하게 확인되었다(도 6E).
도 4D는 본 발명의 일 구체예의 방법에 따라 분리된 엑소좀에 대해 웨스턴 블랏을 수행한 결과로서, CD9, CD63, CD81 및 TSG101 마커의 존재를 확인하였다. 각 마커에 대한 항체로는 각각 항-CD9 (Abcam에서 구입), 항-CD63 (System Biosciences에서 구입), 항-CD81 (System Biosciences에서 구입), 및 항-TSG101 (Abcam에서 구입)을 사용하였다.
도 4E는 본 발명의 일 구체예의 방법에 따라 분리된 엑소좀에 대해 유세포분석기를 이용하여 분석한 결과로서 CD63 및 CD81 마커의 존재를 확인하였다. CD63에 대해 양성(positive)인 엑소좀을 분리하기 위하여 엑소좀-휴먼 CD63 분리/검출 키트(ThermoFisher Scientific에서 구입)를 제조사의 방법에 따라 사용하였고, PE-마우스 항-인간 CD63 (PE-Mouse anti-human CD63)(BD에서 구입) 및 PE-마우스 항-인간 CD81 (PE-mouse anti-human CD81)(BD에서 구입)을 사용하여 마커를 염색한 후, 유세포분석기 (ACEA Biosciences)를 이용하여 분석하였다.
상기 결과들을 종합하면, 본 발명은 접선흐름여과를 이용한 제조과정에서 트레할로오스를 첨가하여 고순도이면서 입자크기 분포가 균일한 엑소좀을 높은 수율로 경제적이면서 효율적으로 분리 및 정제할 수 있음을 확인할 수 있었다. 또한, 본 발명의 일 구체예의 분리방법의 공정들은 스케일-업이 가능하고 GMP에도 적합함을 알 수 있었다.
실시예 4: 엑소좀 처리에 따른 세포 독성 측정
인체 피부 섬유아세포인 HS68 세포에서 본 발명의 일 구체예의 분리 방법에 따라 수득된 엑소좀의 독성을 평가하기 위해 세포에 농도별로 엑소좀을 처리하고 세포의 증식률을 확인하였다. HS68 세포를 10% FBS를 포함한 DMEM에 현탁시킨 후 80 내지 90%의 밀집도(confluency)를 갖도록 분주하고 37℃, 5% CO2 인큐베이터에서 24시간 배양하였다. 24시간 후, 배양액을 제거하고 실시예 2에서 준비된 엑소좀을 농도 별로 처리하여 24 내지 72시간 동안 배양하면서 세포 생존율을 평가하였다. 세포 생존율을 WST-1 시약(WST-1 reagent)(Takara에서 구입), MTT 시약(Sigma에서 구입), 셀타이터-글로 시약(CellTiter-Glo reagent)(Promega에서 구입), 또는 아라마르 블루 시약(alamarBlue reagent)(ThermoFisher Scientific에서 구입)과 마이크로플레이트 리더(microplate reader)(Molecular Devices에서 구입)를 이용하여 측정하였다.
비교군은 엑소좀이 처리되지 않은 일반 세포배양배지에서 배양된 세포수를 기준으로 하였고, 시험된 농도 범위 내에서 본 발명의 엑소좀에 의한 세포 독성이 나타나지 않음을 확인하였다(도 7).
실시예 5: 사포게닌과 엑소좀의 조합 제조
사포게닌과 엑소좀의 조합은 다음과 같이 제조하여 사용하였다.
(1) 사포게닌과 엑소좀을 혼합하여 상온에서 반응시킨 후 반응액을 그대로 사용("사포게닌-엑소좀 혼합액")
(2) 사포게닌과 엑소좀을 혼합하여 상온에서 반응시키고 엑소좀에 침투하지 않은 사포게닌을 제거한 후 사용("사포게닌-엑소좀"). 엑소좀에 결합(association)되지 않은 사포게닌을 제거하기 위하여 크기분별컬럼, 예를 들어 MW3000 스핀 칼럼(spin column)(ThermoFisher에서 구입)을 사용하였다.
본 발명을 한정하지 않는 일례로서, 사포게닌으로 디오스게닌을 사용하였다.
이하에서는 상기 (1)과 (2) 모두 사포게닌과 엑소좀의 조합이라고 칭한다.
실시예 6: 지방세포로의 분화 유도시 지질 축적(lipid uptake) 평가
3T3-L1 지방전구세포(3T3-L1 preadipocytes)를 클론 확장(clonal expansion)하여 충분한 수의 세포를 확보한 후 사용하였다. 지방세포로의 분화 유도시 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합에 의한 지질축적 효과를 다음과 같이 평가하였다.
3T3-L1 지방전구세포를 8×103 세포/cm2의 밀도로 24 웰플레이트의 각 웰에 접종한 후 37℃, 5% CO2 배양기에서 3~4일 동안 배양하였다. 이후, 3T3-L1 세포를 0.5 mM IBMX (Sigma에서 구입), 0.5 μM 덱사메타손 (Sigma에서 구입) 및 5 μg/mL의 인슐린 (Sigma에서 구입)(이하, "분화 칵테일"이라 함)이 보충된 10% FBS (fetal bovine serum) 및 5%의 페니실린-스트렙토마이신 함유 DMEM 배지(이하, "분화배지"라 함)에서 2일간 배양하여 분화를 유도하였다. 분화유도 시 분화조건에 따라 실험군을 다음과 같이 분류하였다:
(1) 음성대조군 (Control): 분화배지만 사용하여 배양한 실험군;
(2) 피오글리타존(Pioglitazone): 분화배지 외에 피오글리타존(Sigma에서 구입; 최종 농도 10μM)을 처리하여 배양한 실험군 (양성 대조군) (도 10에서 "P"로 표시);
(3) 디오스게닌(Diosgenin): 분화배지 외에 디오스게닌(Sigma에서 구입; 최종 농도 10μM)을 처리하여 배양한 실험군 (도 10에서 "D"로 표시);
(4) 디오스게닌과 엑소좀의 조합(Diosgenin + Exosome): 분화배지 외에 디오스게닌(최종 농도 10μM)과 실시예 2에서 준비된 엑소좀(최종 농도 4μg/mL)의 조합을 처리하여 배양한 실험군 (도 10에서 "D + Exo"로 표시).
3T3-L1 지방전구세포를 분화배지에서 배양하여 분화 유도를 개시한 후 2일이 경과한 시점에서 각 실험군 마다 분화배지를 5 μg/mL의 인슐린이 보충된 10% FBS (fetal bovine serum) 및 5%의 페니실린-스트렙토마이신 함유 DMEM 배지(이하, "성숙배지"라 함)로 교체한 다음, 2~20일간 배양하여 성숙(maturation)을 유도하였다. 이때 2일에 한번씩 성숙배지를 교체하였다.
성숙된 3T3-L1 세포에 대해 세척 및 고정 과정을 거친 후 오일 레드 O 염색(Oil Red O staining)을 수행하였으며, 이미지 분석을 통해 세포내 지질 축적을 정량하였다. 또한, 세포질 내에 축적된 지방방울(lipid droplet)을 핵과 구별하기 위해 핵을 헤마톡실린으로 염색하였고 광학현미경 사진을 촬영하였다. 세포질 내에 축적된 지방방울은 오일 레드 O 염색에 의해 붉은색으로 염색되었고, 핵은 헤마톡실린 염색에 의해 보라색으로 염색되었다(도 8).
도 8에 도시된 바와 같이, 3T3-L1 세포에 대한 지방세포로의 분화 유도 시, 분화배지로만 처리한 음성대조군에 비해, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우에 훨씬 많은 수의 지방방울들이 축적되었고 지방방울들의 크기도 큰 것을 알 수 있었다.
한편, 3T3-L1 세포 내의 지방방울 형성은 지방세포로의 분화를 나타내는 지표(marker)이므로, 특정 시험물질의 처리에 따른 3T3-L1 세포 내 지방방울의 축적량을 측정하면 해당 시험물질이 지질축적을 자극하고 지방세포로의 분화(adipogenesis)를 촉진하는 효능을 갖는지 여부를 객관적으로 평가할 수 있다. 이를 위해, 각 실험군 마다 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 6일째에 3T3-L1 세포를 오일 레드 O로 염색하였고 광학현미경 사진을 촬영하였다(도 9). 또한, 지방방울에 염색되어 있는 오일레드 염료를 이소프로판올로 용출시킨 후 510nm에서 흡광도를 측정하여, 각 실험군 마다 3T3-L1 세포 내의 지질축적량을 측정하였고 음성대조군에 대한 지질축적 증가량을 백분율로 평가하였다(도 10).
그 결과, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우 음성대조군에 비해 지질축적량이 현저히 증가하였고, 사포게닌(디오스게닌) 만을 단독 처리한 경우에 비해서도 지질축적량이 유의적으로 증가하는 것이 확인되었다. 이러한 결과로부터, 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합을 지방전구세포에 처리하여 분화를 유도하면 사포게닌 단독 처리에 비해 지질축적량이 유의적으로 증가하고 지방세포로의 분화가 촉진된다는 것을 알 수 있었다.
따라서, 본 발명의 사포게닌과 엑소좀의 조합을 포함하는 조성물은, 지질부족에 기인한 신체 결함 부위나 피부 결함 부위에 적용될 경우, 지질 축적량을 증가시킴으로써 피부결함 보정, 풍만함, 볼륨업(volume-up) 및 피부팽만 효과를 나타낼 수 있다.
실시예 7: 지방세포로의 분화 유도시 세포보호 효과 평가
고농도의 사포게닌은 세포 사멸을 유발할 수 있음이 알려져 있다. 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합에 의한 세포보호 효과를 평가하기 위해, 상기 실시예 6과 동일한 방법으로 3T3-L1 지방전구세포에 대한 분화를 유도하고 세포 생존율을 평가하였다. 분화유도 시 분화조건에 따라 실험군을 다음과 같이 분류하였다:
(1) 음성대조군 (Control): 분화배지만 사용하여 배양한 실험군;
(2) 디오스게닌(Diosgenin): 분화배지 외에 고농도의 디오스게닌(최종 농도 30μM)을 처리하여 배양한 실험군 (도 12에서 "D"로 표시);
(3) 디오스게닌과 엑소좀의 조합(Diosgenin + Exosome): 분화배지 외에 고농도의 디오스게닌(최종 농도 30μM)과 실시예 2에서 준비된 엑소좀(최종 농도 4μg/mL)의 조합을 처리하여 배양한 실험군 (도 12에서 "D + Exo"로 표시).
상기 실시예 6에 따른 방법에 따라 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 3일째에 각 실험군 마다 3T3-L1 세포를 광학현미경으로 촬영하였다. 도 11에 도시된 바와 같이, 고농도의 사포게닌(디오스게닌) 만을 처리한 실험군에서는 세포사가 일어나 본래의 형태를 잃고 바닥면에서 떨어져 부유되어 있는 3T3-L1 세포들이 많은 반면에, 본 발명의 일 구체예의 고농도의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우에는 3T3-L1 세포의 세포사가 상대적으로 적은 것으로 관찰되었다. 또한, 상기 관찰 결과를 정량적으로 평가하기 위해, MTT 어세이를 수행하여 세포 생존율(cell viability)을 측정하였다. 각 실험군 마다 3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 3일째에 0.5 mg/mL의 티아졸릴 블루 테트라졸륨 브로마이드(thiazolyl blue tetrazolium bromide)를 이용한 MTT 어세이를 수행하였다. 570nm에서 흡광도를 측정하여 각 실험군의 음성대조군에 대한 세포 생존율을 백분율로 평가하였다(도 12).
그 결과, 본 발명의 일 구체예의 고농도의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우 고농도의 사포게닌(디오스게닌) 단독 처리군에 비해 세포생존율이 유의적으로 증가하는 것이 확인되었다. 즉, 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합을 지방전구세포에 처리하여 분화를 유도하면 사포게닌 단독 처리에 비해 세포 내로의 지질축적량이 증가할 뿐만 아니라 고농도의 사포게닌에 의한 독성으로부터 세포를 보호하는 것을 알 수 있었다.
따라서, 본 발명의 사포게닌과 엑소좀의 조합을 포함하는 조성물은 사포게닌 단독 성분에 비해 지방세포 내로의 지질 축적 및 지방세포로의 분화를 촉진할 뿐만 아니라 사포게닌 성분에 의한 세포독성을 감소시켜 피부에 대한 부작용을 줄이면서 피부결함 보정, 풍만함, 볼륨업(volume-up) 및 피부팽만 효과를 나타낼 수 있다.
실시예 8: 지방세포분화 마커들의 발현량 측정을 통한 지방세포로의 분화 촉진 효능 평가
본 발명의 일 구체예의 사포게닌과 엑소좀의 조합에 의한 지방세포로의 분화 촉진 효능을 다음과 같이 평가하였다.
3T3-L1 지방전구세포를 10% NBCS(Newborn calf serum) 및 1%의 페니실린-스트렙토마이신이 보충된 DMEM 배지(Dulbecco Modified Eagle Medium)(ThermoFisher Scientific에서 구입)에 현탁시킨 후 12웰 플레이트(12 well plate)에 8×103 세포/cm2의 밀도로 접종한 후 37℃, 5% CO2 배양기에서 72시간 배양하였다. 이후, 3T3-L1 세포를 0.5 mM IBMX (Sigma에서 구입), 0.5 μM 덱사메타손 (Sigma에서 구입) 및 5 μg/mL의 인슐린 (Sigma에서 구입)(이하, "분화 칵테일"이라 함)이 보충된 10% FBS (fetal bovine serum) 및 1%의 페니실린-스트렙토마이신 함유 DMEM 배지(이하, "분화배지"라 함)에서 48시간 동안 배양하여 분화를 유도하였다. 분화유도 시 분화조건에 따라 실험군을 다음과 같이 분류하였다:
(1) 생장배지 (Growth media): 분화배지 대신에 DMEM 배지를 사용하여 배양한 실험군;
(2) 분화배지 (Differentiation media): 분화배지를 사용하여 배양한 실험군;
(3) 피오글리타존(Pioglitazone): 분화배지 외에 피오글리타존(최종 농도 10μM)을 처리하여 배양한 실험군 (양성 대조군);
(4) 디오스게닌과 엑소좀의 조합(Diosgenin + Exosome): 분화배지 외에 디오스게닌(최종 농도 10μM)과 실시예 2에서 준비된 엑소좀(최종 농도 6μg/mL)의 조합을 처리하여 배양한 실험군.
3T3-L1 지방전구세포를 분화배지에서 배양하여 분화 유도를 개시한 후 48시간이 경과한 시점에서 각 실험군 마다 분화배지를 5 μg/mL의 인슐린이 보충된 10% FBS (fetal bovine serum) 및 1%의 페니실린-스트렙토마이신 함유 DMEM 배지(이하, "성숙배지"라 함)로 교체한 다음, 48시간 동안 배양하여 성숙(maturation)을 유도하였다.
3T3-L1 세포를 분화배지에서 배양하여 분화 유도를 개시한 후 0일째, 1일째, 4일째 및 6일째에 각 실험군 마다 지방세포분화 관련 마커들의 mRNA 발현량을 리얼타임 PCR을 통해 측정하여 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합에 의한 지방세포로의 분화 촉진 효능을 확인하였다. 각 실험군의 3T3-L1 세포로부터 분리한 RNA로부터 cDNA를 제조하고 리얼타임 PCR 방법을 이용하여 지방세포분화 관련 마커인 PPAR-γ(Peroxisome proliferator-activated receptor gamma), C/EBP-α(CCAAT/enhancer-binding protein alpha), FAS(fatty acid synthase), ACC(acetyl-CoA carboxylase), GDPH(glycerol-3-phosphate dehydrogenase), GADPH(glyceraldehyde-3-phosphate dehydrogenase) 및 Pref-1(Preadipocyte factor 1)의 mRNA 발현량을 측정하여 비교하였다. 상기 유전자들을 정량하기 위한 표준 유전자로서 PPIA(Peptidylprolyl isomerase A) 유전자를 사용하였다. 리얼타임 PCR에 사용한 프라이머의 종류와 서열은 하기 표 1과 같다.
리얼타임 PCR에 사용된 프라이머 종류 및 염기서열
유전자 서열
정방향 프라이머 (5'→ 3') 역방향 프라이머 (5'→ 3')
Pref-1 TGCACACTGGGTTCTCTGG (서열번호 1) ATCGTAGCCGCAACCAACAG (서열번호 2)
PPAR-γ GGAGCCTAAGTTTGAGTTTGCTGTG (서열번호 3) TGCAGCAGGTTGTCTTGGATG (서열번호 4)
C/EBP-α CAGCTTACAACAGGCCAGGTTTC (서열번호 5) GCTGGCGACATACAGTACACACAA (서열번호 6)
FAS TTGCTGGCACTACAGAATGC (서열번호 7) AACAGCCTCAGAGCGACAAT (서열번호 8)
ACC GCGTCGGGTAGATCCAGTT (서열번호 9) CTCAGTGGGGCTTAGCTCTG (서열번호 10)
GPDH GGCAAGATCTGTGACCAGCT (서열번호 11) ATCAGCACGCTCATGGGAAT (서열번호 12)
GAPDH CTTTGGTATCGTGGAAGGACTC (서열번호 13) GTAGAGGCAGGGATGATGTTCT (서열번호 14)
PPIA ATCTTGTCCATGGCAAATGCTG (서열번호 15) AAACGCTCCATGGCTTCCAC (서열번호 16)
그 결과, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우, 분화 유도를 개시한 후 6일째에 분화배지 단독 처리에 비해 지방세포분화 마커인 PPAR-γ의 mRNA 발현량을 유의적으로 증가시켰다(도 13). 특히, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우, 분화 유도를 개시한 후 6일째에 양성대조군인 피오글리타존 또는 디오스게닌 단독 처리군 보다도 PPAR-γ의 mRNA 발현량이 증가하였다. 따라서, 본 발명의 일 구체예의 사포게닌과 엑소좀의 조합을 지방전구세포에 처리하면 지방세포로의 분화 유도 후 일정 시점에서 피오글리타존 보다도 우수한 지방세포로의 분화 촉진 효능을 나타내는 것을 확인할 수 있었다.
또한, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우, 분화 유도를 개시한 후 4일째에 분화배지 단독 처리에 비해 C/EBP-α(성숙된 지방세포에 존재하는 마커)의 mRNA 발현량을 유의적으로 증가시켰다(도 14). 그리고 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리하면, 분화 유도 개시 후 시간의 경과에 따라 지방세포분화와 관련이 있는 마커들인 FAS, ACC, GDPH 및 GADPH의 mRNA 발현량을 증가시켰다(도 15 내지 도 18).
한편, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리하면, 지방전구세포 마커인 Pref-1(Preadipocyte factor 1)의 mRNA 발현량을 유의적으로 감소시키는 것을 확인하였다(도 19).
상기 실험결과로부터, 본 발명의 사포게닌과 엑소좀의 조합을 포함하는 조성물은 지방전구세포로부터 지방세포로의 분화를 촉진하는 효능이 있다는 것을 알 수 있다. 따라서, 본 발명의 조성물은, 지질부족에 기인한 신체 결함 부위나 피부 결함 부위에 국소적으로 적용될 경우, 지방세포로의 분화를 촉진하고 지방세포의 도입 및 성장을 자극하여 다양한 원인으로 지질부족을 나타내는 신체 결함이나 피부 결함을 예방, 완화, 개선 또는 회복시킬 수 있다.
실시예 9: 지방전구세포 증식률 평가
본 발명의 일 구체예의 사포게닌과 엑소좀의 조합이 3T3-L1 지방전구세포의 증식을 촉진하는지를 아래와 같이 실험을 진행하여 확인하였다. 3T3-L1 지방전구세포를 10% NBCS (Newborn calf serum) 및 1%의 페니실린-스트렙토마이신이 보충된 DMEM 배지(Dulbecco Modified Eagle Medium)(ThermoFisher Scientific에서 구입)에 현탁시킨 후 96웰 플레이트 (96 well plate)에 8×103 세포/cm2의 밀도로 접종하고, 피오글리타존(최종 농도 10μM), 또는 디오스게닌(최종 농도 10μM)과 실시예 2에서 준비된 엑소좀(최종 농도 6μg/mL)의 조합을 처리한 후 37℃, 5% CO2 배양기에서 48시간 배양하였다. 48시간이 지난 후 0.5 mg/mL의 티아졸릴 블루 테트라졸륨 브로마이드(Thiazolyl Blue Tetrazolium Bromide)(Sigma에서 구입)를 포함한 DMEM 배지를 처리하여 2시간 배양하였다.
배지 제거 후 디메틸 설폭시드(Dimethyl Sulfoxide)(AMRESCO에서 구입)로 보라색 결정을 용해시켜 570 nm에서 흡광도를 측정하였고, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합에 의한 지방전구세포 증식촉진 효과를 확인하였다. 그 결과, 본 발명의 일 구체예의 사포게닌(디오스게닌)과 엑소좀의 조합을 처리한 경우, 양성대조군인 피오글리타존 처리군 보다 지방전구세포의 증식률이 높은 것을 확인하였다(도 20).
상기 실험결과로부터, 본 발명의 사포게닌과 엑소좀의 조합을 포함하는 조성물은 지방전구세포의 증식을 촉진하는 효능이 있다는 것을 알 수 있다. 따라서, 본 발명의 조성물은, 지질부족에 기인한 신체 결함 부위나 피부 결함 부위에 국소적으로 적용될 경우, 지방전구세포의 증식을 촉진하고, 이에 따라 분화된 지방세포의 수도 증가시킴으로써 다양한 원인으로 지질부족을 나타내는 신체 결함이나 피부 결함을 예방, 완화, 개선 또는 회복시킬 수 있을 것으로 기대된다.
이상, 본 발명을 상기 실시예를 들어 설명하였으나, 본 발명은 이에 제한되는 것이 아니다. 당업자라면 본 발명의 취지 및 범위를 벗어나지 않고 수정, 변경을 할 수 있으며 이러한 수정과 변경 또한 본 발명에 속하는 것임을 알 수 있을 것이다.

Claims (12)

  1. 지질부족에 기인한 신체 결함이나 피부 결함을 예방, 완화, 개선 또는 회복하는 조성물로서, 사포게닌과 엑소좀의 조합을 유효성분으로 포함하는 조성물.
  2. 제1항에 있어서,
    상기 사포게닌과 엑소좀의 조합은 상기 사포게닌을 상기 엑소좀과 함께 인큐베이션시켜 수득되는, 조성물.
  3. 제2항에 있어서,
    상기 사포게닌과 엑소좀의 조합은, 상기 사포게닌과 상기 엑소좀을 혼합하고, 상기 사포게닌과 상기 엑소좀의 혼합물을 인큐베이션하여 수득되는, 조성물.
  4. 제3항에 있어서,
    상기 사포게닌과 엑소좀의 조합에서 상기 사포게닌은 상기 엑소좀에 침투되거나 적어도 결합(association)되어 담지되는 것을 특징으로 하는, 조성물.
  5. 제1항 내지 제4항 중 어느 한 항에 있어서,
    지방전구세포 증식, 지방세포 내로의 지질 축적 또는 지방세포로의 분화 중 적어도 하나를 촉진하는 것을 특징으로 하는, 조성물.
  6. 제5항에 있어서,
    사포게닌 성분에 의한 세포독성을 감소시키는 것을 특징으로 하는 조성물.
  7. 제1항 내지 제4항 중 어느 한 항에 있어서,
    기능성 화장료 조성물 또는 피부외용제인, 조성물.
  8. 제7항에 있어서,
    패취, 마스크팩, 마스크시트, 크림, 토닉, 연고, 현탁액, 유탁액, 페이스트, 로션, 젤, 오일, 팩, 스프레이, 에어졸, 미스트, 파운데이션, 파우더 및 기름 종이로 구성된 군으로부터 선택된 적어도 1종의 형태에 적용하는 것을 특징으로 하는, 조성물.
  9. 제8항에 있어서,
    패취, 마스크팩 또는 마스크시트의 적어도 일면(一面)에 도포되거나 침적되는 것을 특징으로 하는, 조성물.
  10. 제1항 내지 제4항 중 어느 한 항에 있어서,
    상기 사포게닌은 디오스게닌(diosgenin), 헤코게닌(hecogenin), 스밀라게닌(smilagenin), 에피스밀라게닌(epismilagenin), 사르사사포게닌(sarsasapogenin), 이소사르사사포게닌(isosarsasapogenin), 에피사르사사포게닌(episarsasapogenin), 파리게닌(parigenin), 티고게닌(tigogenin), 에피티고게닌(epitigogenin), 네오티고게닌(neotigogenin), 파릴린(parillin), 티모사포닌(timosaponin), 키시링사포닌(xilingsaponin), 피리페린(filiferin), 야모게닌(yamogenin) 및 유카게닌(yuccagenin)으로 구성된 군으로부터 선택된 적어도 1종인, 조성물.
  11. 제1항 내지 제4항 중 어느 한 항에 기재된 조성물을 포유동물의 신체 결함 부위나 피부 결함 부위에 국소적으로 도포함으로써 상기 조성물이 도포된 신체 결함 부위나 피부 결함 부위의 볼륨감 증대를 가져오는, 치료용을 제외한 미용방법.
  12. 제11항에 있어서,
    (a) 상기 조성물을 포유동물의 피부에 직접 도포하는 것, (b) 상기 조성물이 도포되거나 침적된 패취, 마스크팩 또는 마스크시트를 포유동물의 피부에 접촉 또는 부착하는 것, 또는 상기 (a) 및 (b)를 순차적으로 진행하는 것을 포함하는, 치료용을 제외한 미용방법.
PCT/KR2018/011316 2017-09-30 2018-09-21 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물 WO2019066434A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2020518467A JP6933412B2 (ja) 2017-09-30 2018-09-21 サポゲニンとエキソソームを有効成分として含む組成物
CN201880062704.8A CN111182886A (zh) 2017-09-30 2018-09-21 包含皂苷元和外排体作为有效成分的组合物
US16/823,582 US11850297B2 (en) 2017-09-30 2020-03-19 Composition comprising sapogenin and exosome as effective ingredient

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20170128463 2017-09-30
KR10-2017-0128463 2017-09-30
KR1020180109879A KR102008665B1 (ko) 2017-09-30 2018-09-13 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물
KR10-2018-0109879 2018-09-13

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/823,582 Continuation US11850297B2 (en) 2017-09-30 2020-03-19 Composition comprising sapogenin and exosome as effective ingredient

Publications (1)

Publication Number Publication Date
WO2019066434A1 true WO2019066434A1 (ko) 2019-04-04

Family

ID=65903260

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/011316 WO2019066434A1 (ko) 2017-09-30 2018-09-21 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물

Country Status (1)

Country Link
WO (1) WO2019066434A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113209135A (zh) * 2021-04-23 2021-08-06 奥启(深圳)创投科技有限公司 一种用于延缓皮肤衰老的间充质干细胞外泌体制剂

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040098878A (ko) * 2003-05-16 2004-11-26 나드리화장품주식회사 액정좀으로 안정화된 트라넥삼산 함유 화장료 조성물
JP2009545582A (ja) * 2006-08-03 2009-12-24 セダーマ サルササポゲニン含有組成物
KR20160076654A (ko) * 2014-12-23 2016-07-01 영남대학교 산학협력단 엑소솜을 유효성분으로 함유하는 세포 노화 예방 또는 치료용 약학조성물
KR20160110410A (ko) * 2014-01-21 2016-09-21 안자리움 바이오사이언시스 아게 하이브리도좀, 이를 포함하는 조성물, 이의 제조 방법 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040098878A (ko) * 2003-05-16 2004-11-26 나드리화장품주식회사 액정좀으로 안정화된 트라넥삼산 함유 화장료 조성물
JP2009545582A (ja) * 2006-08-03 2009-12-24 セダーマ サルササポゲニン含有組成物
KR20160110410A (ko) * 2014-01-21 2016-09-21 안자리움 바이오사이언시스 아게 하이브리도좀, 이를 포함하는 조성물, 이의 제조 방법 및 이의 용도
KR20160076654A (ko) * 2014-12-23 2016-07-01 영남대학교 산학협력단 엑소솜을 유효성분으로 함유하는 세포 노화 예방 또는 치료용 약학조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HA, D. ET AL.: "Exosomes as Therapeutic Drug Carriers and Delivery Vehicles across Biological Membranes: Current Perspectives and Future Challenges", ACTA PHARMACEUTICA SINICA B, vol. 6, no. 4, 2016, pages 287 - 296, XP055303644, DOI: doi:10.1016/j.apsb.2016.02.001 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113209135A (zh) * 2021-04-23 2021-08-06 奥启(深圳)创投科技有限公司 一种用于延缓皮肤衰老的间充质干细胞外泌体制剂
CN113209135B (zh) * 2021-04-23 2023-06-13 奥启(深圳)生物科技有限公司 一种用于延缓皮肤衰老的间充质干细胞外泌体制剂

Similar Documents

Publication Publication Date Title
JP6970459B2 (ja) 脂肪由来幹細胞由来のエキソソームを有効成分として含む組成物の皮膚炎の改善の用途
WO2019088656A1 (ko) 안정화된 엑소좀의 필러 조성물
WO2019004757A9 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 가려움증 억제 또는 개선 용도
KR101895916B1 (ko) 엑소좀 및/또는 세포외 소포체 및 이를 포함하는 조성물의 제조 방법
WO2020027466A1 (ko) 엑소좀의 동결건조 방법
KR102646145B1 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 모공 축소용 조성물
KR102045188B1 (ko) 지방줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부염 개선 용도
WO2021020726A1 (ko) 새로운 엑소좀의 생산방법 및 이의 응용
KR20190069277A (ko) 줄기세포 유래의 엑소좀 및/또는 세포외 소포체를 유효성분으로 포함하는 조성물의 민감성 피부 예방, 억제, 완화 또는 개선 용도
KR20190003399A (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부 섬유증 개선 용도
KR101964992B1 (ko) 피부 보습 및 소양감 개선을 위한 화장료 조성물
EP3695830A1 (en) Use of composition comprising stem cell-derived exosome as effective ingredient in reinforcement and functional improvement of skin barrier
WO2019004738A2 (ko) 지방줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부염 개선 용도
KR101998103B1 (ko) 중간엽 줄기세포 유래 나노베지클을 포함한 탈모 방지 또는 발모 촉진용 조성물
KR20150088374A (ko) 인체 지방-유래 줄기세포를 이용한 주요 세포성장인자를 포함하는 줄기세포 배양액 및 아토피 개선 화장료 조성물
WO2019066434A1 (ko) 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물
KR102039302B1 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부장벽 강화 내지 기능 개선 용도
EP4257674A1 (en) Method for isolating and culturing cord blood stem cells expressing gdf-3 at high level, and use of gdf-3
KR102008665B1 (ko) 사포게닌과 엑소좀을 유효성분으로 포함하는 조성물
WO2019231134A1 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 안면 홍조 개선용 조성물
WO2022177104A1 (ko) 생리활성이 강화된 엑소좀의 생산방법 및 이의 응용
WO2019231133A1 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 모공 축소용 조성물
WO2019103381A1 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부장벽 강화 내지 기능 개선 용도
WO2019190093A1 (ko) 피부에 대한 ｒｆ 에너지 인가와 줄기세포 유래의 엑소좀 처리를 병용한 피부 미용방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18860889

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2020518467

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18860889

Country of ref document: EP

Kind code of ref document: A1