WO2019055245A1 - IMPROVED METHOD AND COMPOSITION FOR THE TREATMENT OF TRITERPENE SENSITIVE CONDITIONS, DISEASES OR DISORDERS - Google Patents
IMPROVED METHOD AND COMPOSITION FOR THE TREATMENT OF TRITERPENE SENSITIVE CONDITIONS, DISEASES OR DISORDERS Download PDFInfo
- Publication number
- WO2019055245A1 WO2019055245A1 PCT/US2018/049358 US2018049358W WO2019055245A1 WO 2019055245 A1 WO2019055245 A1 WO 2019055245A1 US 2018049358 W US2018049358 W US 2018049358W WO 2019055245 A1 WO2019055245 A1 WO 2019055245A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- disease
- triterpene
- composition
- disorder
- acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/192—Carboxylic acids, e.g. valproic acid having aromatic groups, e.g. sulindac, 2-aryl-propionic acids, ethacrynic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
Definitions
- the present invention concerns a method of treating triterpene-responsive conditions, disease or disorders with an improved composition comprising a combination of triterpenes present at a molar ratio as described herein.
- the invention concerns a method of treatment by administration of a triterpene-based composition to a subject in need thereof.
- the invention also includes pharmaceutical compositions containing the improved composition.
- Huntington's disease is an inherited disease of the brain that affects the nervous system. It is caused by a defective gene that is passed from parent to child. The HD gene interferes with the manufacture of a particular protein known as 'Huntington' which appears to be crucial for proper brain development.
- the classic signs of HD include emotional, cognitive and motor disturbances. Huntington's is characterized by jerky involuntary movements (chorea), but sometimes causes rigidity without abnormal movements, changes in using the limbs (apraxia), loss of control of bodily functions and dementia, including a progressive deterioration of memory, speed of thought, judgment, and lack of awareness of problems and planning. There is no known cure for Huntington's disease.
- Huntington's disease has been recognized as a disease with a general membrane abnormality. A significantly elevated level and activity (10 fold increase) of Na,K-ATPase has been observed in membranes of erythrocytes and basal ganglia of Huntington's patients compared to that of normal (Butterfield DA, Oeswein JQ, Prunty ME, Hisle KC, Markesbery WR). Increased sodium, potassium adenosine triphosphatase activity in erythrocyte membranes in Huntington's disease.
- fibroblast membranes obtained from the skin of Huntington's disease patients (Schroeder F, Goetz IE, Roberts E, Membrane anomalies in Huntington's disease fibroblasts. J. Neurochem. 43: 526-539, 1984).
- Alzheimer's disease is a form of dementia— a neurodegenerative disease that damages the brain's intellectual functions (memory, orientation, calculation, etc.), but usually preserves its motor functions.
- the mind gradually deteriorates, causing memory loss, confusion, disorientation, impaired judgment and other problems that may affect a person's ability to perform normal daily activities.
- the type, severity, sequence and progression of mental changes vary greatly. There is no known cure for Alzheimer's disease and no known way to slow its progression. For some people in the early or middle stages of the disease, medication such as tacrine may alleviate some cognitive symptoms.
- Aricept donepezil
- Exelon rivastigmine
- cholinesterase inhibitors work by increasing the brain's levels of the neurotransmitter acetylcholine, helping to restore communication between brain cells.
- Some medications may help control behavioral symptoms such as sleeplessness, agitation, wandering, anxiety, and depression. These treatments are aimed at making the patient more comfortable.
- no medication is known to cure Alzheimer's disease, cholinesterase inhibitors may improve performance of daily activities, or lessen behavioral problems.
- Medications for the treatment of Alzheimer's disease currently being tested include estrogens, nonsteroidal anti-inflammatory agents, vitamin E, selegiline (Carbex, Eldepryl) and the botanical product gingko biloba.
- Triterpenes are known to possess a wide variety of therapeutic activities. Some of the known triterpenes include oleanolic acid, ursolic acid, betulinic acid, bardoxolone, maslinic acid, and others. The therapeutic activity of the triterpenes has primarily been evaluated individually rather than as combinations of triterpenes.
- Oleanolic acid is in a class of triterpenoids typified by compounds such as bardoxolone which have been shown to be potent activators of the innate cellular phase 2 detoxifying pathway, in which activation of the transcription factor Nrf2 leads to transcriptional increases in programs of downstream antioxidant genes containing the antioxidant transcriptional response element (ARE).
- Bardoxolone itself has been extensively investigated in clinical trials in inflammatory conditions; however, a Phase 3 clinical trial in chronic kidney disease was terminated due to adverse events that may have been related to known cellular toxicities of certain triterpenoids including bardoxolone at elevated concentrations.
- compositions containing triterpenes in combination with other therapeutic components are found as plant extracts.
- Fumiko et al. (Biol. Pharm. Bull (2002), 25(11), 1485-1487) discloses the evaluation of a methanolic extract of Rosmarimus officinalis L. for treating trypanosomiasis.
- Addington et al. (US 8481086, US 9220778, US 9358293, US 20160243143 Al) disclose a supercritical fluid extract (SCF; PBI-05204) of Nerium oleander containing oleandrin and triterpenes for the treatment of neurological conditions.
- SCF supercritical fluid extract
- Oleanolic acid (O or OA), ursolic acid (U or UA) and betulinic acid (B or BA) are the three major triterpene components found in PBI-05204 (PBI-23; a supercritical fluid extract of Nerium oleander) and PBI-04711 (a triterpene-containing fraction 0-4 of PBI- 05204).
- PBI-23 a supercritical fluid extract of Nerium oleander
- PBI-04711 a triterpene-containing fraction 0-4 of PBI- 05204.
- Nrf2 nuclear factor erythroid 2 related factor
- PBI-04711 increased expression of canonical target ARE genes (glutamate-cysteine ligase, catalytic subunit (Gclc); NAD(P)H:quinone oxidoreductase 1 (Nqol); sulfiredoxin antioxidant protein (Srx); and heme oxygenase 1 (Hmoxl)) via activation of the transcription factor NRF2 that mediates the cellular antioxidant defense pathway.
- Gclc canonical target ARE genes
- NAD(P)H quinone oxidoreductase 1
- Srx sulfiredoxin antioxidant protein
- Hmoxl heme oxygenase 1
- US 8481086, US 922078, US 9358293, and US 2016-0243143 Al disclose the use of PBI-05204 for the treatment of neurological conditions.
- US 9011937 and US 2015- 0283191 Al disclose the use of PBI-04711 for the treatment of neurological conditions.
- compositions containing plural triterpenes in certain molar ratios have been reported to be undesirable.
- Compositions comprising ursolic acid and oleanolic acid were evaluated to determine their impact upon platelet aggregation.
- Kim et el. (“Enhancement of platelet aggregation by ursolic acid and oleanolic acid” in Biomol. Therap. (2014), 22(3), 254-259) reported that the triterpenes potentiated platelet aggregation and "need to be used with caution, especially in the population with a predisposition to cardiovascular events".
- compositions containing two or more triterpenes, salts thereof, derivatives thereof and/or prodrugs thereof can be improved to reduce adverse events and improve efficacy. Said improvement is achieved by controlling the molar ratio of the triterpenes relative to one another.
- the invention provides an improved composition comprising a combination of two or more triterpenes or three or more triterpenes, wherein the molar ratio of the triterpenes is as described herein.
- the instant triterpene-based composition exhibits reduced cellular toxicity and increased efficacy as compared to the respective individual triterpenes on a total-triterpene equimolar basis.
- It is an object of the invention to provide an improved triterpene-based composition comprising plural triterpenes as the active ingredients thereof, wherein the composition provides increased ARE gene expression, and reduced cellular toxicity as compared to other closely related triterpene-based compositions on an equimolar basis.
- the improved composition provides a broader therapeutic window, meaning a wider dosing range along with lower toxicity especially at the upper limits of the dosing range, as compared to other closely related triterpene-based compositions on an equimolar basis.
- the composition of the invention provides a greater than additive clinical benefit, meaning a synergistic clinical benefit, e.g. synergistic efficacy, as compared to the individual triterpenes.
- the invention provides an improved method of treating a condition, disease or disorder that is therapeutically responsive to triterpene (free base thereof, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof) and/or metabohte(s) thereof, the method comprising administering to a subject in need thereof a composition comprising at least three triterpenes, wherein the molar ratio of the triterpenes is as described herein.
- Said condition, disease or disorder can be identified according to the methods described herein or according to methods known in the art for determining, modeling or predicting therapeutic responsiveness.
- the invention also includes methods of preventing said condition, disease or disorder.
- the invention excludes conditions, diseases or disorders that are not therapeutically responsive to said triterpenes or metabolite(s) thereof.
- An important clinical benefit provided by the improved composition is a substantially expanded therapeutic window as compared to the individual triterpenes administered on a total-triterpene equimolar basis.
- composition Another important clinical benefit provided by the improved composition is substantially improved efficacy as compared to the individual triterpenes administered on a total-triterpene equimolar basis.
- Another important clinical benefit provided by the improved composition is substantially reduced adverse events as compared to the individual triterpenes administered on a total-triterpene equimolar basis.
- Embodiments of the invention includes those wherein the condition, disease or disorder is selected from the group consisting of: a) autoimmune condition, disease or disorder; b) neurological condition, disease or disorder; c) anti-inflammatory response- related condition, disease or disorder; d) microbial infection; e) viral infection; f) bacterial infection; g) musculoskeletal condition, disease or disorder; h) excessive cell proliferation related condition, disease or disorder; i) protozoal infection; j) oxidative stress-related condition, disease or disorder; k) gastrointestinal condition, disease or disorder; 1) angiogenesis-related condition, disease or disorder; m) cyclooxygenase-related condition, disease or disorder; n) cardiovascular condition, disease or disorder; o) hepatic condition, disease or disorder; p) age-related condition, disease or disorder; q) bone-related condition, disease or disorder; r) dermatological condition, disease or disorder; s) parasitic infection; t) renal condition, disease or disorder;
- Embodiments of the invention includes those wherein: a) the autoimmune condition, disease or disorder is selected from the group consisting of alopecia . areata, celiac disease, diabetes mellitus type 1, Graves ' disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, and systemic lupus eiy hematosus; b) the neurological condition, disease or disorder as defined herein; c) the viral infection is selected from the group consisting of HSV-1 strain 1C, influenza A H7N1, ECHO 6, HIV-1, HEP C, HCV H strain NS5B, HSV-1, HSV-2, ADV-3, ADV-8, ADV-11, HEP B, ENTV CVB1, ENTV EV71, viral hemorrhagic fever (VHF), Arenaviridae infection, Bunyaviridae infection, Filovindae infection, Flaviviridae infection, Paramyx
- the neurological condition is selected from the group consisting of neurological disease, neurological disorder, tauopathy, and stroke.
- the neurological disease is a neurodegenerative disease.
- the neurodegenerative disease is selected from the group consisting of Huntington's disease, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, bovine spongiform encephalopathy, multiple sclerosis, diabetic neuropathy, autism and juvenile neuronal ceroid lipofuscinosis.
- stroke is stroke- mediated ischemic injury .
- the neurological condition is a tauopathy, which is a neurodegenerative disease having an etiology associated with an imbalance in the Tau3R/Tau4R ratio in a subject.
- Tauopathies are a class of neurodegenerative diseases resulting from the pathological aggregation of tau proteins in the human brain.
- the tauopathy is Down's syndrome, Pick's disease, corticobasal degeneration, some variants of prions disease, Alzheimer's disease, progressive supranuclear palsy or frontotemporal dementia.
- the individual steps of the methods of the invention can be conducted at separate facilities or within the same facility.
- the invention provides an improved method of treating a triterpene-responsive condition, disease or disorder comprising administering to a subject in need thereof an improved composition comprising (consisting essentially of) at least three triterpenes.
- the molar ratio of triterpenes has been found to impact efficacy and toxicity/safety of the composition(s).
- Embodiments of the invention include those wherein the molar ratio of triterpenes is as described herein.
- the molar ratio of triterpenes in the improved composition is different than and improved over that found in PBI-05204 and PBI-04711.
- the composition contains triterpenes as the sole pharmacologically active ingredients (agents).
- the composition can exclude steroid, cardiac glycoside, biologically/pharmacologically active polysaccharide, and/or non- cardiac glycoside steroid.
- the invention provides a method of treating, in a subject in need thereof, a triterpene-responsive condition, disease or disorder with a composition comprising at least two or at least three triterpenes present at a molar ratio as described herein, the method comprising:
- determining that the subject has a triterpene-responsive condition, disease or disorder determining that the subject has a triterpene-responsive condition, disease or disorder; and indicating administration of a therapeutically effective amount of said composition to the subject.
- the invention also provides a method of treating, in a subject in need thereof, a condition, disease or disorder that is therapeutically responsive to triterpene and/or metabolite thereof with a triterpene-based composition, the method comprising administering to the subject a therapeutically effective amount of said triterpene-based composition, wherein the molar ratio of triterpenes in said composition are as described herein.
- the invention provides a method of treating, in a subject in need thereof, a neurological condition, disease or disorder with a neuroprotective composition comprising at least two or at least three triterpenes, the method comprising:
- the invention also provides a method of treating, in a subject in need thereof, a neurological disease or disorder with a neuroprotective composition, the method comprising administering to the subject a therapeutically effective amount of the neuroprotective composition.
- Some embodiments of the invention include those wherein: 1) the subject is prescribed and administered a therapeutically relevant dose of the composition; 2) the subject is administered the composition according to a prescribed dosing regimen; 3) the composition excludes cardiac glycoside; 4) the composition excludes a therapeutically effective amount of cardiac glycoside; 5) the composition excludes oleandrin; 6) the composition excludes a neriifolin; 7) the composition excludes a pharmacologically active polysaccharide obtained from Nerium species or Thevetia species; 8) the composition comprises a synthetic mixture of at least two or at least three triterpenes present at a molar ratio as described herein; or 9) a combination of any two or more of the above.
- the invention also provides a method of treating a neurological condition in a subject in need thereof comprising:
- the neurological condition in the subject is Alzheimer's disease
- Huntington's disease, stroke, Parkinson's disease or other neurological condition indicating administration of a neuroprotective composition
- the invention also provides a method of preventing or reducing the incidence of occurrence of a triterpene-responsive condition, disease or disorder in a population of subjects at risk thereof, the method comprising: administering an effective dose of a triterpene-based composition on a recurring basis for an extended period of time to one or more subjects in said population of subjects, thereby preventing or reducing the incidence of said condition, disease or disorder in the population; wherein
- the composition comprises at least two or at least three triterpenes selected from the group consisting of oleanolic acid, ursolic acid, and betulinic acid, each of said triterpenes being present in a form which is independently selected upon each occurrence from the group consisting of free acid form, salt form, derivative form and prodrug form, and the molar ratio of said triterpenes being as described herein.
- the invention also provides a method of preventing or reducing the incidence of occurrence of a neurological condition in a population of subjects at risk thereof, the method comprising:
- a neurological condition such as Alzheimer's disease, Huntington's disease, Parkinson's disease, stroke or other neurological condition
- said neuroprotective composition comprises at least two or at least three triterpenes selected from the group consisting of oleanolic acid, ursolic acid, and betulinic acid, each of said triterpenes being present in a form which is independently selected upon each occurrence from the group consisting of free acid form, salt form, derivative form and/or prodrug form, and the molar ratio of said triterpenes being as described herein.
- the invention also includes embodiments wherein: a) the method further comprises indicating administration of the neuroprotective composition to the one or more subjects; b) the method further comprises administering an effective dose of the neuroprotective composition to the subject according to a prescribed dosing regimen for a period of time; c) the method further comprises periodically determining the adequacy of one or more subject's clinical response and/or therapeutic response to treatment with the neuroprotective composition; d) if the subject's clinical response and/or therapeutic response is adequate, then the method further comprises continuing treatment with the neuroprotective composition as needed until the desired clinical endpoint is achieved; e) if the subject's clinical response and/or therapeutic response are inadequate at the initial dose and initial dosing regimen, then the method further comprises escalating or deescalating the dose of neuroprotective composition until the desired clinical response and/or therapeutic response in the subject is achieved; f) the neuroprotective composition is administered to plural subjects in a population; g) the recurring basis is daily, every other day, every second
- the invention also provides a time-delayed method of treating stroke in a subj ect comprising:
- administering within a delay period after a subject has suffered the stroke, administering an initial dose of neuroprotective composition according to an initial dosing regimen;
- Some embodiments of the invention include those wherein: 1) the delay period is 10 hours or less, 8 hours or less, 6 hours or less, 4 hours or less, 3 hours or less, 2 hours or less, 1 hour or less, 45 minutes or less, 30 minutes or less, 20 minutes or less or 10 min or less; 2) determining the adequacy of a subject's clinical and/or therapeutic response is done by assessments of any weakness of the face, arm and/or leg on one side of the body, numbness in the face, arm, and/or leg on one side of the body, inability to understand spoken language, inability to speak or speak clearly, inability to write, vertigo and/or gait imbalance, double vision and an unusually severe headache; or 3) a combination thereof
- the invention also provides use of a triterpene-based composition in the manufacture of a medicament for the treatment of a triterpene-responsive condition, disease or disorder in a subject.
- the manufacture of such a medicament comprises: providing said composition; including a dose of said composition in a pharmaceutical dosage form; and packaging the pharmaceutical dosage form.
- the invention also provides a pharmaceutical composition comprising said composition for the treatment of a condition, disease or disorder in a subject.
- the manufacture can also include one or more additional steps such as: delivering the packaged dosage form to a vendor (retailer, wholesaler and/or distributor); selling or otherwise providing the packaged dosage form to a subject having a neurological condition; including with the medicament a label and a package insert, which provides instructions on use, dosing regimen, administration, content and toxicology profile of the dosage form.
- the treatment of a triterpene-responsive condition, disease or disorder comprises: determining that a subject has a triterpene-responsive condition, disease or disorder; indicating administration of said composition to the subject according to a dosing regimen; administering to the subject one or more pharmaceutical dosage forms containing said composition, wherein the one or more pharmaceutical dosage forms is administered according to the dosing regimen.
- the subject having a neurological condition i.e. the subject in need thereof, is part of a population of such subjects.
- the invention provides a method for improving the clinical status of a statistically significant number of subjects of in a population of subjects having a neurological condition, the method comprising: administering to the population of subjects a neuroprotective composition as described herein; and determining the clinical status of the subjects.
- the statistically significant number is at least 5% of the population.
- the neurological condition is Alzheimer's disease, Huntington's disease, stroke, Parkinson's disease, a tauopathy or other neurological condition, such as described herein.
- Treatment of the subject with said composition is continued as needed.
- the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint(s) such as a reduction or alleviation of specific symptoms associated with the condition, disease or disorder being treated. Determination of the adequacy of clinical response and/or therapeutic response can be conducted by a clinician familiar with the condition, disease or disorder being treated.
- Embodiments of the invention also include a triterpene-based improved composition comprising at least two or at least three triterpenes, wherein: said triterpenes are present at a molar ratio as described herein; and said triterpenes are selected from the group consisting of oleanolic acid, ursolic acid, and betulinic acid, each of said triterpenes being present in a form which is independently selected upon each occurrence from the group consisting of free acid form, salt form, derivative form, and prodrug form.
- the invention provides a triterpene-based improved composition exhibiting therapeutic activit as described herein when administered to a subject.
- the methods of the invention employ said composition as described herein.
- a triterpene is independently upon each occurrence present in native form (unmodified free acid, unmodified salt or combination thereof form), derivative form, prodrug form, or a combination of two or more of said forms.
- a triterpene can be present as a mixture of free acid form and salt form, or a mixture of free acid form and derivative form, or a mixture of free acid form and prodrug form, or a mixture of two or more forms, or a mixture of three or more forms.
- trimterpene refers to each form or any of said forms or any mixture of said forms. The table below specifies various combinations of triterpene forms.
- Embodiments of the invention include those wherein the triterpene-based improved composition is a neuroprotective composition comprising (consisting essentially of) at least two triterpenes present at a molar ratio as described herein.
- the neuroprotective composition of the invention comprises (consists essentially of) at least three triterpenes present at a molar ratio as described herein.
- the composition of the invention comprises (consists essentially of) oleanolic acid (free acid, salt, derivative, and/or prodrug thereof) and ursolic acid (free acid, salt, derivative, and/or prodrug thereof) and optionally at least one other triterpene, wherein the molar ratio of triterpenes is as described herein.
- the composition can further comprise betulinic acid (free acid, salt, derivative, and/or prodrug thereof) or at least one other triterpene.
- the composition of the invention comprises (consists essentially of) oleanolic acid (free acid, salt, derivative, and/or prodrug thereof) and betulinic acid (free acid, salt, derivative, and/or prodrug thereof) and optionally at least one other triterpene, wherein the molar ratio of triterpenes is as described herein.
- the composition can further comprise ursolic acid (free acid, salt, derivative, and/or prodrug thereof) or at least one other triterpene.
- compositions comprising (consisting essentially of) at least oleanolic acid (free acid, salt, derivative, and/or prodrug thereof), betulinic acid (free acid, salt, derivative, and/or prodrug thereof), and ursolic acid (free acid, salt, derivative, and/or prodrug thereof), wherein the molar ratio of said triterpenes is as described herein.
- Some embodiments of the invention provide an improved composition comprising (consisting essentially of) at least: oleanolic acid (present as free acid and/or salt thereof), betulinic acid (present as free acid and/or salt thereof), and ursolic acid (present as free acid and/or salt thereof), wherein the molar ratio of said compounds is as described herein.
- a pharmaceutical dosage form comprises the composition and one or more pharmaceutically acceptable excipients.
- the composition comprises (consists essentially of) the triterpenes oleanolic acid, ursolic acid, and betulinic acid, wherein the molar ratio of triterpenes is as described herein.
- the composition is included in a pharmaceutical composition further comprising at least one pharmaceutically acceptable excipient.
- the majority of pharmacologically active component in the composition is oleanolic acid.
- Oleanolic acid can be present in molar excess over ursolic acid and/or over betulinic acid.
- Oleanolic acid can be present in molar excess over the combined total moles of ursolic acid and betulinic acid.
- Oleanolic acid and ursolic acid can together (sum total) or individually be present in molar excess over betulinic acid.
- Oleanolic acid and betulinic acid can together (sum total) or individually be present in molar excess over ursolic acid.
- Ursolic acid and betulinic acid can be present at about the same content.
- Ursolic acid can be present in molar excess over betulinic acid.
- Betulinic acid can be present in molar excess over ursolic acid.
- Embodiments of the invention include those wherein: a) oleanolic acid is present in molar excess over the combined total moles of ursolic acid and betulinic acid, and ursolic acid and betulinic acid are present at about the same molar content; b) oleanolic acid is present in molar excess over the combined total moles of ursolic acid and betulinic acid, and ursolic acid is present in molar excess over betulinic acid; c) oleanolic acid is present in molar excess over the combined total moles of ursolic acid and betulinic acid, and betulinic acid is present in molar excess over ursolic acid; d) oleanolic acid is present in molar excess over ursolic acid, and ursolic acid is present in molar excess over betulinic acid; or e) oleanolic acid is present in molar excess over betulinic acid
- the molar ratio of oleanolic acid (0): ursolic acid (U): betulinic acid (B) is about 10 : about 1 : about 1, about 9-11 : about 0.5-1.5 : about 0.5-1.5, about 9.5-10.5 : about 0.75-1.25 : about 0.75- 1.25, about 9.5-10.5 : about 0.8-1.2 : about 0.8-1.2, about 9.75-10.5 : about 0.9-1.1 : about 0.9-1.1, about 9-12 : about 0.15-2.5 : about 0.15-2.5, about 9-12 : about 0.2-2.5 : about 0.2- 2.5, about 9-12 : about 0.25-2.5:
- the molar ratio of oleanolic acid: ursolic acid is about 9-12 : about 0.33-5, about 9-12 : about 0.4-5, about 9-12 : about 0.5-5, about 9-12 : about 0.7-5, about 9-12 : about 0.9-5, about 9-12 : about 1-5, about 9-12 : about 0.33-4, about 9-12 : about 0.4-4, about 9-12 : about 0.5-4, about 9-12 : about 0.7-4, about 9-12 : about 0.9-4, about 9-12 : about 1-4, about 9-12 : about 0.33-3, about 9-12 : about 0.4-3, about 9-12 : about 0.5-3, about 9-12 : about 0.7-3, about 9-12 : about 0.9-3, about 9-12 : :
- the molar ratio of oleanolic acid: betulinic acid is about 9-12 : about 0.33- 5, about 9-12 : about 0.4-5, about 9-12 : about 0.5-5, about 9-12 : about 0.7-5, about 9-12 : about 0.9-5, about 9-12 : about 1-5, about 9-12 : about 0.33-4, about 9-12 : about 0.4-4, about 9-12 : about 0.5-4, about 9-12 : about 0.7-4, about 9-12 : about 0.9-4, about 9-12 : about 1-4, about 9-12 : about 0.33-3, about 9-12 : about 0.4-3, about 9-12 : about 0.5-3, about 9-12 : about 0.7-3, about 9-12 : about 0.9-3, about 9-12 : :
- the invention includes all combinations of the aspects, embodiments and sub-embodiments of the invention disclosed herein.
- FIG. 1 depicts the results of the comparative evaluation of PBI-05204 (PBI) and PBI-04711 (Fraction 0-4 of PBI-05204) in a brain slice oxygen-glucose deprivation (OGD) assay.
- PBI PBI-05204
- PBI-04711 Fraction 0-4 of PBI-05204
- OGD brain slice oxygen-glucose deprivation
- the first 3 bars in the graph show: control brain slices not subjected to OGD ("Control”); negative-control brain slices subjected to OGD and treated with DMSO carrier only (“OGD”); and positive-control brain slices subjected to OGD and treated with 23 &' ⁇ of the full PBI-05204 extract (“PBI 23").
- the fraction was tested at the concentrations indicated in units of ⁇ g/ml. Fraction 0-4 provided significant neuroprotection at the concentrations tested (concentrations of Fraction 0-3 of 10 ⁇ and above exhibited toxicity; data not shown).
- FIGS. 2A-2D depict the results of ARE gene expression assays for Fraction 0-4 (PBI-04711): a) Gclc expression (FIG. 2A); b) Nqol expression (FIG. 2B); c) Srx expression (FIG. 2C); and d) Hmoxl expression (FIG. 2D).
- Primary mouse corticostriatal co-cultures were treated with Fraction 0-4 at the concentrations indicated for 6h, then harvested and processed for qPCR analysis of the ARE target genes shown.
- Quantitative RNA values are normalized to the GAPDH reference control and fold-expression changes are expressed relative to the DMSO-carrier only condition ("0") set to a value of 1.
- FIG. 3 depicts the results of ARE gene expression assays for Fraction 0-4 and the individual triterpenes oleanolic acid, ursolic acid, betulinic acid and uvaol (also referred to as uvalol).
- X symbols denote concentrations of compounds which induced toxicity and for which recovery of residual mRNA was insufficient to support qPCR analysis.
- Rat primary corticostriatal co-cultures were treated for 6 h with Fraction 0-4 (in ⁇ / ⁇ 1) or oleanolic acid, ursolic acid, betulinic acid, or uvaol (all in ⁇ ) at the concentrations indicated, then harvested and processed for qPCR analysis of the ARE target genes shown.
- Quantitative RNA values were normalized to the GAPDH reference control and fold-expression changes are expressed relative to the DMSO-carrier only condition ("--") set to a value of 1. Dark bars denote statistically significant differences with respect to the DMSO-carrier only control by a Student's /-test at p ⁇ 0.05.
- FIG. 4 depicts the results of expression assays for Fraction 0-4 and the individual triterpenes ursolic acid and betulinic acid at more closely-spaced concentration ranges.
- Rat primary corticostriatal co-cultures were treated for 6 h with Fraction 0-4 (in / ⁇ 1) or ursolic acid and betulinic acid (in ⁇ ) at the concentrations indicated, then harvested and processed for qPCR analysis of the ARE target genes shown.
- Quantitative RNA values were normalized to the GAPDH reference control and fold-expression changes are expressed relative to the DMSO-carrier only condition ("--") set to a value of 1.
- Betulinic acid like ursolic acid, is also able to induce clear upregulation of Srx and Hmoxl despite its toxicity at higher concentrations.
- FIG. 5 depicts the results of comparative evaluation in a neuroprotection OGD assay of oleanolic acid (OA), ursolic acid (UA), betulinic acid (BA) and uvaol (Uva). Concentration- response relations for UA, BA, and Uva (all in ⁇ &' ⁇ ) in the brain slice OGD assay are shown. Averages for 2 independent experiments are included for each compound, with the OGD negative-control condition scaled to 100% and data plotted on the same axes for ease of comparison. The positive control was 4 ⁇ g/ml oleanolic acid (0).
- FIGS. 6A, 6B, 7 A, 7B, 8 A, and 8B depict the results of comparative cellular toxicities of the triterpenes to primary corticalstriatal neuronal co-cultures containing glia evaluated according to the example below: ursolic acid (FIGS. 6A, 6B), betulinic acid (FIGS. 7A, 7B) and oleanolic acid (FIGS. 8A, 8B).
- ursolic acid FIGS. 6A, 6B
- betulinic acid FIGS. 7A, 7B
- oleanolic acid oleanolic acid
- FIGS. 6A, 7A and 8A propidium iodide was added for one hour then the numbers of Pi-positive cells were scored under automated high-content analysis on the Cellomics ArrayScan VTI.
- MTS substrate was added for two hours then co-culture wells were measured for absorbance at 450 nm using a multi-well plate reader.
- FIGS. 9A-9C depict the results of comparative neuroprotection of triterpene mixtures (Composition I: molar ratio of 0:U:B is 3:2.2: 1 as in PBI-04711 (Fxn 0-4; FIG. 9A); Composition II: molar ratio of 0:U:B is 7.8:7.4: 1 as in PBI-05204 (FIG 9B); and Composition III: molar ratio of 0:U:B is about 10: 1 : 1 as per the improved composition of the invention (PBI-01011; FIG. 9C)) determined in a brain slice assay for ischemic stroke according to Example 3.
- Composition I molar ratio of 0:U:B is 3:2.2: 1 as in PBI-04711 (Fxn 0-4; FIG. 9A)
- Composition II molar ratio of 0:U:B is 7.8:7.4: 1 as in PBI-05204 (FIG 9B)
- Composition III molar ratio
- Numbers of healthy cortical pyramidal neurons per brain slice are shown relative to the negative control condition set to 100% (second bar in each graph) of brain slices exposed to oxygen-glucose deprivation (OGD) and vehicle (DMSO) only. Values for positive control brain slices not exposed to OGD are shown in the first bar of each graph. Mean values + SEM are shown averaged over 3-5 independent runs for each triterpene mixture; light blue bars denote statistically significant differences with respect to the OGD negative control by ANOVA followed by Dunnett's post hoc comparison test at p ⁇ 0.05.
- FIGS. 1 OA and 10B depict the results of comparative Srx (FIG 10A) and Hmoxl (FIG. 10B) expression assays for PBI-05204, PBI-04711 (also referred to as Fxn 0-4), oleanolic acid (0), ursolic acid (U), betulinic acid (B) and combinations of the triterpenes present at the specified molar ratios.
- Quantitative RNA values were normalized to the GAPDH reference control and fold-expression changes are shown relative to the DMSO- carrier only condition set to a value of 1. Dark blue bars denote statistically significant differences with respect to the DMSO-carrier only control by a Student's f-test at p ⁇ 0.05. Striped, red bars denote conditions which induced excessive levels of ARE gene expression, namely, by more than 10-fold.
- the individually named triterpenes can independently be selected upon each occurrence in their native (unmodified) free acid form, native salt form, derivative form, prodrug form, or a combination thereof.
- Compositions containing and methods employing deuterated forms of the triterpenes are also within the scope of the invention.
- the total moles of a triterpene present in a composition is the sum total of the moles of each form of said triterpene.
- the total moles of "oleanolic acid" present in a composition is the sum total of moles of native free acid form + native salt form(s) + derivative form(s) + prodrug form(s).
- Oleanolic acid derivatives, prodrugs and salts are disclosed in US 20150011627 Al to Gribble et al. which published Jan. 8, 2015, US 20140343108 Al to Rong et al which published Nov. 20, 2014, US 20140343064 Al to Xu et al. which published Nov. 20, 2014, US 20140179928 Al to Anderson et al. which published June 26, 2014, US 20140100227 Al to Bender et al. which published Apnl 10, 2014, US 20140088188 Al to Jiang et al. which published Mar. 27, 2014, US 20140088163 Al to Jiang et al. which published Mar. 27, 2014, US 20140066408 Al to Jiang et al. which published Mar.
- Ursolic acid derivatives, prodrugs and salts are disclosed in US 20150011627 Al to Gribble et al. which published Jan. 8, 2015, US 20130303607 Al to Gribble et al. which published Nov. 14, 2013, US 20150218206 Al to Yoon et al. which published Aug. 6, 2015, US 6824811 to Fritsche et al. which issued Nov. 30, 2004, US 7718635 to Ochiai et al. which issued May 8, 2010, US 8729055 to Lin et al. which issued May 20, 2014, and US 9120839 to Yoon et al. which issued Sep. 1, 2015, the entire disclosures of which are hereby incorporated by reference.
- Betulinic acid derivatives, prodrugs and salts are disclosed in US 20150011627 Al to Gribble et al. which published Jan. 8, 2015, US 20130303607 Al to Gribble et al. which published Nov. 14, 2013, US 20120237629 Al to Shode et al. which published Sept. 20, 2012, US 20170204133 Al to Regueiro-Ren et al. which published July 20, 2017, US 20170096446 Al to Nitz et al. which published April 6, 2017, US 20150337004 Al to Parthasaradhi Reddy et al. which published Nov. 26, 2015, US 20150119373 Al to Parthasaradhi Reddy et al.
- a derivative or prodrug of a triterpene when used, the moles of each is determined according to the molar equivalents of the parent free acid triterpene. For example, one mole of the methyl ester derivative of oleanolic acid (methyl oleanolate) is the molar equivalent of one mole of oleanolic acid and vice versa.
- the invention provides a method of treating a triterpene-responsive condition, disease or disorder by administration of an effective dose (therapeutically effective dose) of a triterpene-based composition of the invention to a subject in need thereof.
- the composition is administered according to a dosing regimen best suited for the subject, the suitability of the dose and dosing regimen to be determined clinically according to conventional clinical practices and clinical treatment endpoints for the condition, disease or disorder being treated.
- the neurodegenerative disorder or neurological condition being treated has an etiology associated with an over-expression of tau proteins and/or an imbalance in the Tau3R/Tau4R ratio in a subject.
- a tauopathy Such a condition is termed a tauopathy.
- Exemplary tauopathies include Down's syndrome, Pick's disease, some variants of prions disease, Alzheimer's disease, progressive supranuclear palsy or frontotemporal dementia, corticobasal degeneration, Guam parkinsonism dementia complex, dementia with argyrophilic grains, Niemann-Pick disease Type C, and dementia pugilistic.
- the neurodegenerative disorder or neurological condition being treated has an etiology associated with abnormal or atypical proteolysis of amyloid beta precursor protein, accumulation of amyloid beta protein in the synapses of the neurons, formation of amyloid fibrils in the synapses of the neurons, or formation of amyloid plaques in the synapses of the neurons.
- exemplary of such disorders or conditions is Alzheimer's disease.
- a subject treated according to the invention will exhibit a therapeutic response.
- a subject suffering from the disease or disorder will enjoy at least one of the following clinical benefits as a result of treatment with the triterpene-based composition: amelioration of the disease or disorder, reduction in the occurrence of symptoms associated with the disease or disorder, partial remission of the disease or disorder, full remission of the disease or disorder, or increased time to progression.
- the therapeutic response can be a full or partial therapeutic response.
- a triterpene-responsive condition, disease or disorder is one against which the triterpene-based composition will provide or exhibit a therapeutic response in a subject.
- a therapeutic response can also be described as one in which the quality of life of the patient afflicted with the condition, disease or disorder is improved. Improvement in quality of life may occur, for example, through a reduction in occurrence, frequency or severity of symptoms associated with the condition, disease or disorder. For example, for a neurological condition, improvement in quality of life may be reduced tremors, reduced involuntary muscle movements, reversal of loss or partial loss of nerve-muscle coordination, increased memory retention, etc.
- the methods of the invention include methods of treating as well as prophylactic methods of preventing.
- Methods of treating are those methods wherein the subject receiving the composition of the invention is already suffering from a specified condition, disease or disorder.
- Methods of preventing are those methods wherein the subject receiving the composition of the invention is not yet suffering from a specified condition, disease or disorder.
- Preventing occurrence of a condition, disease or disorder in a population of subjects at risk means that said condition, disease or disorder will not occur during a predetermined time period in a demographically predetermined population of subjects that are at risk of suffering from the same. The prevention during the predetermined time period occurs as a result of subjects in that population having been administered a composition according to the invention.
- a composition of the invention can be administered prophylactically to prevent any of the conditions, diseases or disorders disclosed herein as well as etiologically-related conditions, diseases or disorders.
- a neuroprotective composition when administered for a predetermined time period to subjects in a population of subjects at risk of suffering from stroke, stroke will not occur in those subjects during the predetermined time period.
- a neuroprotective composition is chronically administered over a period of one year to a population of subjects at risk of suffering from Alzheimer's disease or any of the tauopathology related diseases, and the subjects in that population do not exhibit symptoms associated with Alzheimer's during that one-year period.
- time to progression is the period, length or duration of time after a disease is diagnosed (or treated) until the disease begins to worsen. It is the period of time during which the level of a disease is maintained without further progression of the disease, and the period of time ends when the disease begins to progress again. Progression of a disease is determined by "staging" a subject suffering from a condition prior to or at initiation of therapy.
- the subject's neurological health is determined prior to or at initiation of therapy.
- the subject is then treated with the neuroprotective composition, and the neurological health monitored periodically.
- the symptoms of the neurological condition may worsen, thus marking progression of the disease and the end of the "time to progression".
- the period of time during which the disease did not progress or during which the level or severity of the disease did not worsen is the "time to progression”.
- a dosing regimen includes a therapeutically relevant dose (or therapeutically effective dose) of tnterpene-based composition administered according to a dosing schedule.
- a therapeutically relevant dose therefore, is a therapeutic dose at which a therapeutic response of the condition, disease or disorder to treatment with said composition is observed and at which a subject can be administered said composition without an excessive amount of unwanted or deleterious side effects.
- a therapeutically relevant dose is non-lethal to a subject, even though it may cause some side effects (adverse events) in the patient. It is a dose at which the level of clinical benefit to a subject being administered said composition exceeds the level of deleterious side effects experienced by the subject due to administration of said composition.
- a therapeutically relevant dose will vary from subject to subject according to a variety of established pharmacologic, pharmacodynamic and pharmacokinetic principles. However, a therapeutically relevant dose will typically be in the range of 0.1 to 100 micrograms of said composition, being in either solid, liquid or semisolid form. It is known in the art that the actual amount of a pharmacologically active component/agent required to provide a target therapeutic result in a subject may vary from subject to subject according to the basic principles of pharmacy.
- a therapeutically relevant (effective) dose can be administered according to any dosing regimen typically used in the treatment of conditions, diseases or disorders disclosed herein.
- a therapeutically relevant dose can be administered once, twice, thrice or more daily dosing schedule. It can be administered ever other day, every third day, every fourth day, every fifth day, semiweekly, weekly, biweekly, every three weeks, every four weeks, monthly, bimonthly, semimonthly, every three months, every four months, semiannually, annually, or according to a combination of any of the above to arrive at a suitable dosing schedule.
- a therapeutically relevant dose can be administered once daily for one or more weeks.
- Example 7 details a method of treating Alzheimer's disease with a neuroprotective composition or a combination of neuroprotective composition with one or more other therapeutic agents.
- Example 8 details a method of treating Huntington's disease with a neuroprotective composition or a combination of neuroprotective composition with one or more other therapeutic agents.
- Example 9 details a method of treating stroke- mediated and non-stroke mediated ischemic brain injury with a neuroprotective composition or a combination of neuroprotectiv e composition with one or more other therapeutic agents.
- Example 10 details a method of Parkinson's disease with a neuroprotective composition or a combination of neuroprotective composition with one or more other therapeutic agents.
- a subject having a neurological condition is treated as follows.
- a subject presenting with a neurological condition is evaluated to determine whether or not the neurological condition is Alzheimer's disease, Huntington's disease, stroke, Parkinson's disease or other neurological condition. If the subject has a positive diagnosis, administration of the neuroprotective composition is indicated.
- Initial doses of the composition are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's clinical response and level of therapeutic response are determined periodically. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermine dose escalation schedule until the desired level of therapeutic response in the subject is achieved.
- the dose is deescalated until the desired balance of level of therapeutic response versus side effect profile in the subject is achieved. Treatment of the subject with the neuroprotective composition is continued as needed.
- the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint(s) such as cessation of the disease itself, reduction in disease associated symptoms, and/or a reduction in the progression of the disease process.
- Example 3 provides a detailed description of an in vitro assay used to evaluate the efficacy of the neuroprotective composition for the treatment of stroke-mediated ischemic neuronal injury.
- the assay is a brain slice-based assay for oxygen and glucose deprivation (OGD) used to induce > 50% loss of healthy cortical neurons by 24 hours.
- OGD oxygen and glucose deprivation
- the sample vehicle is used as a positive control.
- compositions were tested in OGD treated brain slices (stroke model) and non-OGD treated (i.e. control) brain slices (non-stroke model).
- Data (FIGS. 9A-9C) were obtained for Composition I (triterpene molar ratio similar to PBI-04711), Composition II (triterpene molar ratio similar to PBI-05204) and Composition III (triterpene molar ratio similar to PBI-01011).
- the data indicate that each of the compositions provide neuroprotection, but the improved neuroprotective composition (Composition III) provides neuroprotection across a wider dosing range (wider concentration range).
- Composition I provides neuroprotection at 10 ⁇ but does not provide neuroprotection at a concentration of 1 ⁇ or less.
- Composition II provides neuroprotection at 1 ⁇ and 10 ⁇ but does not provide neuroprotection at a concentration of 0.1 ⁇ or less.
- Composition III provides neuroprotection at 0.1 ⁇ (100 Nm), 1 ⁇ and 10 ⁇ .
- the improved neuroprotective composition provides a wider dosing range or wider dose response than other triterpene-based compositions on a total equimolar basis.
- the improved composition allows for administration of higher doses of the combination of triterpenes without substantially increasing the undesired adverse events (side effects) that might be caused by the individual triterpenes.
- a clinician can administer high or low doses of the triterpene mixture and still expect low occurrence of triterpene-related adverse events.
- the invention provides a method of protecting neurons against loss of activity caused by oxygen depletion or oxygen-glucose depletion by exposing the oxygen depleted and/or glucose-depleted neurons to an effective amount of improved triterpene-based neuroprotective composition to minimize loss of activity, reduce the rate of loss of activity, stop the loss of activity, slow down onset of loss of activity, and'or protect the function of neurons caused by exposing the oxygen depleted and/or glucose-depleted conditions.
- Compositions I and II were determined whether the reduced neuroprotective activity of Compositions I and II might be due to cellular toxicity of one or more of the individual triterpenes.
- OA oleanolic acid
- U ursolic acid
- BA betulinic acid
- PI propidium iodide
- PI enters cells with damaged membranes and stains DNA, thereby detecting dead/dying cells using image-based high-content assays on the Cellomics Arrayscan VTI.
- the MTS assay is a well-based assay in which cleavage of a tetrazolium reporter by mitochondrial enzymes produces colorimetric readout and reports relative numbers of healthy cells.
- the data (FIGS. 6 A and 6B for UA, FIGS. 7 A and 7B for BA; FIGS. 8 A and 8B for OA) confirmed that UA and BA can be highly toxic compounds on a dose dependent manner, each leading to 50% loss of metabolic activity in the 5-15 ⁇ range, whereas no significant reduction in MTS activity was observed for OA through 75 ⁇ , the highest concentration of OA tested.
- Efficacy of the improved composition of the invention in treating a range of conditions, diseases or disorders can be established by employing known respective prognostic assays (in vitro, in vivo or ex vivo), performing animal studies, and/or performing clinical studies in humans.
- Examples 16-34 provide exemplary literature methods suitable for establishing the therapeutic efficacy provided by the improved composition of the invention.
- the individual triterpenes (oleanolic acid, ursolic acid and betulinic acid) are used as control samples to establish baseline activity thereof. Combinations of two or more of the triterpenes are then evaluated.
- Generalized (molar ratios unspecified) exemplary sample compositions for each assay are set forth in the table below.
- Examples 1 and 2 provide detailed exemplar)' compositions with the molar ratio(s) of the triterpenes as specified therein.
- the composition of the invention comprises at least two triterpenes (free acid, salt(s), derivative(s), and/or prodrug(s) thereof).
- the invention provides a composition comprising a combination of at least ursolic acid and oleanolic acid or a combination of at least betulinic acid and oleanolic acid, wherein oleanolic acid is present in substantial molar excess over ursolic acid and betulinic acid, respectively.
- the composition of the invention comprises at least three triterpenes (free acid, salt(s), derivative(s), and/or prodrug(s) thereof).
- the neuroprotective composition of the invention comprises oleanolic acid, ursolic acid and at least one other triterpene.
- the composition can further comprise betulinic acid or at least one other triterpene.
- the composition can exclude cardiac glycoside, pharmacologically active polysaccharide, and steroid.
- the neuroprotective composition excludes oleandrin, neriifolin or pharmacologically active polysaccharide obtained from Nerium species plant.
- the molar ratio of 0 : U can be varied and can range from about 9-12 : about 0.33-5, about 9-12 : about 0.4-5, about 9-12 : about 0.5-5, about 9- 12 : about 0.7-5, about 9-12 : about 0.9-5, about 9-12 : about 1-5, about 9-12 : about 0.33- 4, about 9-12 : about 0.4-4, about 9-12 : about 0.5-4, about 9-12 : about 0.7-4, about 9-12 : about 0.9-4, about 9-12 : about 1-4, about 9-12 : about 0.33-3, about 9-12 : about 0.4-3, about 9-12 : about 0.5-3, about 9-12 : about 0.7-3, about 9-12 : about 0.9-3,
- the molar ratio of 0 : B can be varied and can range from about 9-12 : about 0.33-5, about 9-12 : about 0.4-5, about 9-12 : about 0.5- 5, about 9-12 : about 0.7-5, about 9-12 : about 0.9-5, about 9-12 : about 1-5, about 9-12 : about 0.33-4, about 9-12 : about 0.4-4, about 9-12 : about 0.5-4, about 9-12 : about 0.7-4, about 9-12 : about 0.9-4, about 9-12 : about 1-4, about 9-12 : about 0.33-3, about 9-12 : about 0.4-3, about 9-12 : about 0.5-3, about 9-12 : about 0.7-3, about 9-12 : about 0.9-3, about 9-12 : about 0.4-3, about 9-12 : about 0.5-3, about 9-12 : about 0.7-3, about 9-12 : about 0.9-3, about 9-12 : about 0.9-3,
- the molar ratio oleanolic acid: ursolic acid: betulinic acid is about 10 : about 1 : about 1, about 9-11 : about 0.5-1.5 : about 0.5-1.5, about 9.5-10.5 : about 0.75- 1.25 : about 0.75-1.25, about 9.5-10.5 : about 0.8-1.2 : about 0.8-1.2, about 9.75-10.5 : about 0.9-1.1 : about 0.9-1.
- Example 11 provides a detailed description of an in vitro assay used to evaluate the efficacy of the neuroprotective composition for the treatment of Alzheimer's disease.
- the assay is a brain slice-based assay for ⁇ / ⁇ -induced (APP: amyloid precursor protein) degeneration of cortical pyramidal neurons. Upon cleavage by a secretase enzyme, the APP is reduced to ⁇ peptides which are believed to be a causative factor in beta- amyloid plaque formation. ⁇ proteins are associated with beta-amyloid plaque formation and are believed to be a hallmark if not etiologic factor in Alzheimer's disease.
- APP amyloid precursor protein
- Biolistic transfection is used to introduce vital markers such as YFP (a marker yellow fluorescent protein) and to introduce disease gene constructs into the same neuronal populations in the brain slices.
- YFP is co-transfected with APP isoforms leading to the progressive degeneration of cortical pyramidal neurons over the course of three to four days after brain slice preparation and transfection.
- the data indicate that the neuroprotective composition provides a concentration-dependent neuroprotection to APP-transfected brain slices.
- Composition III (0:U:B molar ratio of about 10: 1: 1 as in PBI-01011) provides greater neuroprotection than Composition II (0:U:B molar ratio of about 7.8:7.4: 1 as in PBI-05204) and greater neuroprotection than Composition I (0:U:B molar ratio of about 3:2.2: 1 as in PBI-04711).
- the data are of significance in that few compounds or therapeutic strategies in the literature have shown any significant protection of neurons in this in vitro assay representative of Alzheimer disease.
- composition of the invention also provides strong neuroprotection in two additional brain slice models in which cortical neuronal degeneration is driven by biolistic transfection of expression constructs for genes implicated in CNS neurodegeneration, namely, amyloid precursor protein (APP) and tau.
- APP and tau transfection induces progressive neurodegeneration of cortical neurons over the course of 3-4 days, in contrast to the neuronal injury and death caused by OGD which occurs over a 24 h period in the brain slice model.
- composition provides neuroprotection in this assay, even though it does not contain any cardiac glycosides.
- the neuroprotective composition provides significant concentration-dependent neuroprotection in both the APP and tau brain slice neurodegeneration models.
- the composition is evaluated with the tau4R brain slice-based Alzheimer' s assay similar to the APP assay except that the Tau construct is used (Example 11). The number of healthy cortical neurons is determined. Efficacy in this assay is defined as or based upon the relative total number of healthy versus unhealthy number and percentage of degraded neurons in the presence of varying amounts of neuroprotective composition.
- the negative control in these experiments consisted of brain slices that were not exposed to OGD while brain slices exposed to OGD but not treated with neuroprotective composition served as the internal positive control.
- the neuroprotective composition provides neuroprotection in this assay.
- the invention provides a method of protecting neurons against loss of activity caused by Alzheimer's disease, the method comprising: exposing the neurons exhibiting characteristics of Alzheimer's disease to an effective amount of triterpene-based neuroprotective composition to minimize loss of activity, reduce the rate of loss of activity, stop the loss of activity, slow down onset of loss of activity, and/or critical functioning of the neurons caused by Alzheimer's disease.
- the method employs an effective amount of neuroprotective composition.
- Example 6 provides a detailed description of an assay used to evaluate the efficacy of the neuroprotective composition for the treatment of Huntington's disease.
- Mutant htt protein is introduced via electroporation into high-density, mixed co-cultures of cortical neurons, striatal neurons, and glia.
- the striatal and cortical neurons are transfected with different color fluorescent proteins thereby facilitating the separate identification of the different types of neurons in the co-culture.
- the color fluorescent proteins are fluorescent and 'emit' color upon activation with a light source of appropriate wavelength. The data indicate that the neuroprotective composition can be used to treat Huntington's disease.
- the invention provides a method of protecting neurons against loss of activity caused by Huntington's disease, the method comprising: exposing the neurons exhibiting characteristics of Huntington's disease to an effective amount of neuroprotective composition to minimize loss of activity , reduce the rate of loss of activity, stop the loss of activity, slow down onset of loss of activity, and/or normal function of the neurons caused by Huntington's disease.
- Examples 3, 4 and 12 detail an exemplary brain-slice assay that can be used to evaluate the efficacy of neuroprotective composition in the treatment of stroke in a subject following completion of a delay period after the stroke.
- the brain-slice assay with oxygen glucose deprivation is conducted as described herein; however, rather than treating the brain slices prophylactically with the composition, they are treated with the composition after delay periods of 0, 1 , 2, 4, and 6 hours.
- the data should demonstrate that the neuroprotective composition is effective at providing significant neuroprotection for delay periods of up to 1, up to 2, up to 3, up to 4, up to 5, up to about 6 hours after the stroke.
- the invention provides a time-delayed method of treating stroke in a subject by administration of a dose of neuroprotective composition to a subject after the subject has suffered a stroke.
- an initial dose of the neuroprotective composition is administered according to an initial dosing regimen.
- adequacy of the subject's clinical response and'or therapeutic response to treatment with the composition is determined. If the subject's clinical response and/or therapeutic response is adequate, then treatment with the composition is continued as needed until the desired clinical endpoint is achieved.
- the dose is escalated or deescalated until the desired clinical response and/or therapeutic response in the subject is achieved.
- Dose escalation or de-escalation can be performed in conjunction with a change in the dosing regimen, such as a change in dosing frequency or overall period of dose administration.
- brain slice assays herein are conducted under conditions wherein the brain tissue is treated with the neuroprotective composition prior to OGD. Under those conditions, the data establishes the utility of the neuroprotective composition at prophylactically providing neuroprotection against damage caused by stroke.
- composition of the invention provides neuroprotection mediated through antioxidant transcriptional response elements (AREs) with triterpene(s).
- AREs antioxidant transcriptional response elements
- the triterpene(s) also induces nuclear factor erythroid 2 related factor 2 (Nrf2)-dependent antioxidant genes to provide neuroprotection.
- Nrf2 nuclear factor erythroid 2 related factor 2
- the composition provides neuroprotection via at least a two-fold mechanism.
- the neuroprotective composition is administered to a subject in need thereof, the composition provides neuroprotection at least through ARE up-regulation.
- the present method invention comprises: administering to the subject in need thereof a therapeutically relevant dose of triterpene-based composition and a therapeutically relevant dose of said one or more other therapeutic agents, wherein the triterpene-based composition is administered according to a first dosing regimen and the one or more other therapeutic agents is administered according to a second dosing regimen.
- the first and second dosing regimens are the same. In some embodiments, the first and second dosing regimens are different.
- the one or more other therapeutic agents can be selected from the group consisting of B ACE inhibitors or acetylcholinesterase inhibitors.
- the one or more other therapeutic agents can be selected from the group consisting of NamendaTM (memantine HC1), AriceptTM (donepezil), RazadyneTM (galantamine), ExelonTM (rivastigmine), and CognexTM (tacrine).
- the one or more other therapeutic agents can be selected from the group consisting of natural products, anticonvulsants, NMDA (n-methyl d-aspartate) receptor antagonists, and sodium channel blockers.
- exemplary agents include Vitamin E, Baclofen (a derivative of CoQIO), Lamotrigine (an anticonvulsant), remacemide (an anesthetic which is a low affinity NMDA antagonist), and riluzole (Na channel blocker). The efficacy of each of these agents is considered to be low (Mestre T.
- the neurological condition being treated is stroke-mediated ischemic brain injury (ischemic stroke)
- the therapeutic treatments disclosed in the literature e.g. intravenous thrombolysis
- the one or more other therapeutic agents can be selected from the group consisting of drugs such as Alteplase (a thrombolytic agent).
- the one or more other therapeutic agents include a combination of carbidopa and levodopa, rasagiline, pramipexole, ropinrole, amantadine, memantine, entacapone, rotigotine, benztropine, selegiline, biperiden, a combination of carbidopa and levodopa and entacapone, trihexylphenidyl, rivastigmine, apomorphine, levodopa, carbidopa, bromocriptine, belladonna, tolcapone, or a combination thereof.
- the one or more other therapeutic agents can be selected from the group consisting of BACE (beta-secretase 1; beta-site amyloid precursor protein cleaving enzyme
- beta-site APP cleaving enzyme 1, membrane-associated aspartic protease 2, memapsin-
- a search for suitable antiviral compounds in the Drugs.com database resulted in identification of adamantane-based antiviral agent, interferon-based antiviral agent, chemokine receptor antagonist, integrase strand transfer inhibitor, neuraminidase inhibitor, non-nucleoside reverse transcriptase inhibitor, NS5A inhibitor, nucleoside reverse transcriptase inhibitor, protease inhibitor, purine nucleoside, or a combination thereof.
- One or more of those antiviral compounds can be coadministered or used as cotherapy or used adjunctivelv with the triterpene-based composition.
- the one or more other therapeutic agents that are approved for human use are listed, searchable and viewable in the databases of the U.S. Food and Drug Administration (U.S.F.D.A.), World Health Organization (W.H.O), European Medicines Agency (E.M.E.A.), Therapeutic Goods Administration (TGA, Australia), Pan American Health Organization (PAHO), Medicines and Medical Devices Safety Authority (Medsafe, New Zealand) or the various agencies of Health worldwide, the entire disclosures of which are hereby incorporated by reference.
- U.S. Food and Drug Administration U.S.F.D.A.
- W.H.O World Health Organization
- E.M.E.A. European Medicines Agency
- Therapeutic Goods Administration TGA, Australia
- Pan American Health Organization PAHO
- Medicines and Medical Devices Safety Authority Medsafe, New Zealand
- the one or more other therapeutic agents can be administered at doses and according to dosing regimens that are clinician-recognized as being therapeutically effective or at doses that are clinician-recognized as being sub-therapeutically effective.
- the clinical benefit and/or therapeutic effect provided by administration of a combination of the triterpene-based composition and one or more other therapeutic can be additive or synergistic, such level of benefit or effect being determined by comparison of administration of the combination to administration of the individual triterpene-based composition and one or more other therapeutic agents.
- the one or more other therapeutic agents can be administered at doses and according to dosing regimens as suggested or described by the U.S.
- a triterpene-based composition of the invention can be prepared by mixing the individual components thereof into a mixture (Examples 1-2).
- the triterpene- based composition can be prepared by mixing at least oleanolic acid and ursolic acid, and optionally betulinic acid, according to the molar ratios described herein.
- the triterpene-based composition can be prepared by mixing at least oleanolic acid and betulinic acid, and optionally ursolic acid, according to the molar ratios described herein.
- the triterpene-based composition can also be prepared by mixing at least oleanolic acid, ursolic acid, and betulinic acid, according to the molar ratios described herein.
- compositions of the invention can be improved by employing compositions possessing suitable molar ratios of 0:U or of 0:U:B or of 0:B. Solutions containing the following molar ratios of triterpene(s) were prepared (Examples 1-2) and evaluated for neuroprotective activity and ARE gene induction activity as described herein.
- an improved triterpene-based composition comprises at least oleanolic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof) and ursolic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof) present at a molar ratio of OA to UA as described herein, wherein OA is present in large molar excess over UA.
- an improved triterpene-based composition comprises at least oleanolic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof) and betulinic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof) present at a molar ratio of OA to BA as described herein, wherein OA is present in large molar excess over BA.
- an improved triterpene-based composition comprises at least oleanolic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof), ursolic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof), and betulinic acid (free acid, salt(s) thereof, derivative(s) thereof, and/or prodrug(s) thereof) present at a molar ratio of OA to UA to BA as described herein, wherein OA is present in large molar excess over both UA and BA.
- An improved triterpene-based composition provides a wider dose response curve than the respective triterpenes individually and provides reduced cellular toxicity when compared on a total equimolar basis, especially when compared at the higher end of the dosing range.
- the triterpene-based composition can be formulated in any suitable pharmaceutically acceptable dosage form.
- Parenteral, otic, ophthalmic, nasal, inhalable, buccal, sublingual, enteral, topical, oral peroral, and injectable dosage forms are particularly useful.
- Particular dosage forms include a solid or liquid dosage forms.
- Exemplary suitable dosage forms include tablet, capsule, osmotic device, pill, caplet, troche, sache, solution, suspension, dispersion, vial, bag, bottle, injectable liquid, i.v. (intravenous), i.m. (intramuscular) or i.p. (intraperitoneal) administrable liquid and other such dosage forms known to the artisan of ordinary skill in the pharmaceutical sciences.
- Suitable dosage forms containing the triterpene-based composition can be prepared by mixing the said composition with pharmaceutically acceptable excipients as described herein or as described in Pi et al. ("Ursolic acid nanocrystals for dissolution rate and bioavailability enhancement: influence of different particle size” in Curr. Drug Deliv. (Mar 2016), 13(8), 1358-1366), Yang et al. ("Self-microemulsifying drug delivery system for improved oral bioavailability of oleanolic acid: design and evaluation" in Int. J. Nanomed. (2013), 8(1), 2917-2926), Li et al.
- Suitable dosage forms can also be made according to US 8187644 B2 to Addington, which issued May 29, 2012, US 7402325 B2 to Addington, which issued July 22, 2008, US 8394434 B2 to Addington et al, which issued Mar. 12, 2013, the entire disclosures of which are hereby incorporated by reference. Suitable dosage forms can also be made as described in Examples 13-15.
- the desired dose for oral administration is up to 5 dosage forms although as few as one and as many as ten dosage forms may be administered as a single dose.
- Exemplary dosage forms contain 0.01-5 or 0.01-10 mg of the triterpene-based composition per dosage form, for a total 0.1 to 500 mg (1 to 10 dose levels) per dose.
- Doses will be administered according to dosing regimens that may be predetermined and/or tailored to achieve specific therapeutic response or clinical benefit in a subject.
- Some embodiments of the dosage form are not enteric coated and release their charge of triterpene-based composition within a period of 0.5 to 1 hours or less. Some embodiments of the dosage form are enteric coated and release their charge of triterpene- based composition downstream of the stomach, such as from the jejunum, ileum, small intestine, and/or large intestine (colon). Enterically coated dosage forms will release said composition into the systemic circulation within 1-10 hr after oral administration.
- the triterpene-based composition can be included in a rapid release, immediate release, controlled release, sustained release, prolonged release, extended release, burst release, continuous release, slow release, or pulsed release dosage form or in a dosage form that exhibits two or more of those types of release.
- the release profile of triterpene from the dosage form can be a zero order, pseudo-zero, first order, pseudo-first order or sigmoidal release profile.
- the plasma concentration profile for triterpene in a subject to which the neuroprotective composition is administered can exhibit one or more maxima.
- the amount of triterpene-based composition incorporated in a dose will be in at least one or more dosage forms and can be selected according to known principles of pharmacy.
- An effective amount or therapeutically relevant amount of therapeutic compound is specifically contemplated.
- a pharmaceutically effective amount is the amount or quantity of active ingredient which is enough for the required or desired therapeutic response, or in other words, the amount, which is sufficient to elicit an appreciable biological response when, administered to a patient.
- the appreciable biological response may occur as a result of administration of single or multiple doses of an active substance.
- a dose may comprise one or more dosage forms. It will be understood that the specific dose level for any patient will depend upon a variety of factors including the indication being treated, severity of the indication, patient health, age, gender, weight, diet, pharmacological response, the specific dosage form employed, and other such factors.
- the triterpene-based composition can be administered at low to high dose due to the improved combination of triterpenes present and the molar ratio at which they are present.
- a therapeutically effective dose for humans is approximately 100-1000 mg of triterpene-based composition per Kg of body weight. Such a dose can be administered up to 10 times in a 24-hour period.
- a compound herein might possess one or more functions in the formulation of the invention.
- a compound might serve as both a surfactant and a water miscible solvent or as both a surfactant and a water immiscible solvent.
- a liquid composition can comprise one or more pharmaceutically acceptable liquid carriers.
- the liquid carrier can be an aqueous, non-aqueous, polar, non-polar, and/or organic carrier.
- Liquid carriers include, by way of example and without limitation, a water miscible solvent, water immiscible solvent, water, buffer and mixtures thereof.
- water soluble solvent or “water miscible solvent”, which terms are used interchangeably, refer to an organic liquid which does not form a biphasic mixture with water or is sufficiently soluble in water to provide an aqueous solvent mixture containing at least five percent of solvent without separation of liquid phases.
- the solvent is suitable for administration to humans or animals.
- Exemplary water soluble solvents include, by way of example and without limitation, PEG (poly(ethylene glycol)), PEG 400 (poly(ethylene glycol having an approximate molecular weight of about 400), ethanol, acetone, alkanol, alcohol, ether, propylene glycol, glycerin, triacetin, poly(propylene glycol), PVP (polyvinyl pyrrolidone)), dimethylsulfoxide, N,N- dimethylformamide, formamide, ⁇ , ⁇ -dimethylacetamide, pyridine, propanol, N- methylacetamide, butanol, soluphor (2-pyrrolidone), pharmasolve (N-methyl-2- pyrrolidone).
- PEG poly(ethylene glycol)
- PEG 400 poly(ethylene glycol having an approximate molecular weight of about 400
- ethanol acetone
- alkanol alcohol
- ether propylene glycol
- glycerin triacetin
- water insoluble solvent or “water immiscible solvent”, which terms are used interchangeably, refer to an organic liquid which forms a biphasic mixture with water or provides a phase separation when the concentration of solvent in water exceeds five percent.
- the solvent is suitable for administration to humans or animals.
- Exemplary water insoluble solvents include, by way of example and without limitation, medium/long chain triglycerides, oil, castor oil, corn oil, vitamin E, vitamin E derivative, oleic acid, fatty acid, olive oil, softisan 645 (Diglyceryl Caprylate / Caprate / Stearate / Hydroxy stearate adipate), miglyol, captex (Captex 350: Glyceryl Tricaprylate/ Caprate/ Laurate triglyceride; Captex 355: Glyceryl Tricaprylate/ Caprate triglyceride; Captex 355 EP / NF: Glyceryl Tricaprylate/ Caprate medium chain triglyceride).
- Suitable solvents are listed in the "International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) guidance for industry Q3C Impurities: Residual Solvents " (1997), which makes recommendations as to what amounts of residual solvents are considered safe in pharmaceuticals.
- Exemplary solvents are listed as class 2 or class 3 solvents.
- Class 3 solvents include, for example, acetic acid, acetone, anisole, 1 -butanol, 2-butanol, butyl acetate, tert-butlymethyl ether, cumene, ethanol, ethyl ether, ethyl acetate, ethyl formate, formic acid, heptane, isobutyl acetate, isopropyl acetate, methyl acetate, methyl- 1 -butanol, methylethyl ketone, methylisobutyl ketone, 2-methyl-l -propanol, pentane, 1-pentanol, 1- propanol, 2-propanol, or propyl acetate.
- Captex 100 Propylene Glycol Dicaprate
- Captex 200 Propylene Glycol Dicaprylate/ Dicaprate
- Captex 200 P Propylene Glycol Dicaprylate/ Dicaprate
- Captex 300 Glyceryl Tricaprylate/ Caprate
- Captex 300 EP / NF Glyceryl Tricaprylate/ Caprate Medium Chain Triglycerides
- Captex 350 Glyceryl Tricaprylate/ Caprate/ Laurate
- Captex 355 Glyceryl Tricaprylate/ Caprate
- Captex 355 EP / NF Glyceryl Tricaprylate/ Caprate Medium Chain Triglycerides
- Captex 500 Triacetin
- Captex 500 P Triacetin (Pharmaceutical Grade)
- Captex 800 Propylene Glycol Di (2- Ethythexanoate)
- Captex 810 D Glyceryl Tricaprylate/ Caprate
- a surfactant refers to a compound that comprises polar or charged hydrophilic moieties as well as non-polar hydrophobic (lipophilic) moieties; i.e., a surfactant is amphiphilic.
- the term surfactant may refer to one or a mixture of compounds.
- a surfactant can be a solubilizing agent, an emulsifying agent or a dispersing agent.
- a surfactant can be hydrophilic or hydrophobic.
- the hydrophilic surfactant can be any hydrophilic surfactant suitable for use in pharmaceutical compositions.
- Such surfactants can be anionic, cationic, zwitterionic or non- ionic, although non-ionic hydrophilic surfactants are presently preferred. As discussed above, these non-ionic hydrophilic surfactants will generally have HLB values greater than about 10. Mixtures of hydrophilic surfactants are also within the scope of the invention.
- the hydrophobic surfactant can be any hydrophobic surfactant suitable for use in pharmaceutical compositions.
- suitable hydrophobic surfactants will have an HLB value less than about 10. Mixtures of hydrophobic surfactants are also within the scope of the invention.
- Examples of additional suitable solubilizer include: alcohols and polyols, such as ethanol, isopropanol, butanol, benzyl alcohol, ethylene glycol, propylene glycol, butanediols and isomers thereof, glycerol, pentaerythritol, sorbitol, mannitol, transcutol, dimethyl isosorbide, polyethylene glycol, polypropylene glycol, polyvinylalcohol, hydroxypropyl methylcellulose and other cellulose derivatives, cyclodextrins and cyclodextrin derivatives; ethers of polyethylene glycols having an average molecular weight of about 200 to about 6000, such as tetrahydrofurfuryl alcohol PEG ether (glycofurol, available commercially from BASF under the trade name Tetraglycol) or methoxy PEG (Union Carbide); amides, such as 2-pyrrolidone, 2-piperidon
- the clear liquid composition is visually clear to the unaided eye, as it will contain less than 5%, less than 3% or less than 1% by wt. of suspended solids based upon the total weight of the composition.
- composition or kit of the present invention may include a chelating agent, preservative, antioxidant, adsorbents, acidifying agent, alkalizing agent, antifoaming agent, buffering agent, colorant, electrolyte, salt, stabilizer, tonicity modifier, diluent, other pharmaceutical excipient, or a combination thereof.
- antioxidant is intended to mean an agent that inhibits oxidation and is thus used to prevent the deterioration of preparations by the oxidative process.
- Such compounds include, by way of example and without limitation, ascorbic acid, ascorbic palmitate, Vitamin E, Vitamin E derivative, butylated hydroxyanisole, butylated hydroxy toluene, hypophosphorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metalbisulfite and other such materials known to those of ordinary skill in the art.
- chelating agent is intended to mean a compound that chelates metal ions in solution.
- exemplary ⁇ ' chelating agents include EDTA (tetrasodium ethylenediaminetetraacetate), DTPA (pentasodium diethylenetriaminepentaacetate), HEDTA (trisodium salt of N-(hydroxyethyl)-ethylene-diaminetriacetic acid), NTA (trisodium nitrilotriacetate), disodium ethanoldiglycine (Na2EDG), sodium diethanolglycine (DEGNa), citric acid, and other compounds known to those of ordinary skill in the art.
- the term "adsorbent” is intended to mean an agent capable of holding other molecules onto its surface by physical or chemical (chemisorption) means.
- Such compounds include, by way of example and without limitation, powdered and activated charcoal and other materials known to one of ordinary skill in the art.
- alkalizing agent is intended to mean a compound used to provide an alkaline medium.
- Such compounds include, by way of example and without limitation, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, and trolamine and others known to those of ordinary skill in the art.
- the term "acidifying agent” is intended to mean a compound used to provide an acidic medium.
- Such compounds include, by way of example and without limitation, acetic acid, amino acid, citric acid, fumaric acid and other alpha-hydroxy acids, hydrochloric acid, ascorbic acid, and nitric acid and others known to those of ordinary skill in the art.
- antifoaming agent is intended to mean a compound or compounds that prevents or reduces the amount of foaming that forms on the surface of the fill composition.
- Suitable antifoaming agents include by way of example and without limitation, dimethicone, SIMETHICONE, octoxynol and others known to those of ordinary skill in the art.
- buffering agent is intended to mean a compound used to resist a change in pH upon dilution or addition of acid or alkali.
- Such compounds include, by way of example and without limitation, potassium metaphosphate, potassium phosphate, monobasic sodium acetate and sodium citrate anhydrous and dehydrate and other such materials known to those of ordinary skill in the art.
- the term "diluent” or “filler” is intended to mean inert substances used as fillers to create the desired bulk, flow properties, and compression characteristics in the preparation of tablets and capsules.
- Such compounds include, by way of example and without limitation, dibasic calcium phosphate, kaolin, lactose, sucrose, mannitol, microcrystalline cellulose, powdered cellulose, precipitated calcium carbonate, sorbitol, and starch and other materials known to one of ordinary skill in the art.
- the term "preservative" is intended to mean a compound used to prevent the growth of microorganisms.
- Such compounds include, by way of example and without limitation, benzalkonium chloride, benzethonium chloride, benzoic acid, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate, phenylmercuric acetate, thimerosal, metacresol, myristylgamma picolinium chloride, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, sorbic acid, thymol, and methyl, ethyl, propyl, or butyl parabens and others known to those of ordinary skill in the art.
- colorant is intended to mean a compound used to impart color to pharmaceutical preparations.
- Such compounds include, by way of example and without limitation, FD&C Red No. 3, FD&C Red No. 20, FD&C Yellow No. 6, FD&C Blue No. 2, FD&C Green No. 5, FD&C Orange No. 5, FD&C Red No. 8, caramel, and iron oxide (black, red, yellow), other FD&C dyes and natural coloring agents such as grape skin extract, beet red powder, beta-carotene, annate, carmine, turmeric, paprika, combinations thereof and other such materials known to those of ordinary skill in the art.
- stabilizer is intended to mean a compound used to stabilize an active agent against physical, chemical, or biochemical processes that would otherwise reduce the therapeutic activity of the agent.
- Suitable stabilizers include, by way of example and without limitation, albumin, sialic acid, creatinine, glycine and other amino acids, niacinamide, sodium acetyltryptophonate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycols, sodium caprylate and sodium saccharin and others known to those of ordinary skill in the art.
- the term "tonicity modifier” is intended to mean a compound or compounds that can be used to adjust the tonicity of the liquid formulation. Suitable tonicity modifiers include glycerin, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose and others known to those or ordinary skill in the art.
- composition of the invention can also include oils such as fixed oils, peanut oil, sesame oil, cottonseed oil, corn oil and olive oil; fatty acids such as oleic acid, stearic acid and isostearic acid; and fatty acid esters such as ethyl oleate, isopropyl myristate, fatty acid glycerides and acetylated fatty acid glycerides.
- oils such as fixed oils, peanut oil, sesame oil, cottonseed oil, corn oil and olive oil
- fatty acids such as oleic acid, stearic acid and isostearic acid
- fatty acid esters such as ethyl oleate, isopropyl myristate, fatty acid glycerides and acetylated fatty acid glycerides.
- the composition can also include alcohol such as ethanol, isopropanol, hexadecyl alcohol, glycerol and propylene glycol; glycerol ketals such as 2,2-dimethyl-l,3-dioxolane-4-methanol; ethers such as poly(ethylene glycol) 450; petroleum hydrocarbons such as mineral oil and petrolatum; water; a pharmaceutically suitable surfactant, suspending agent or emulsifying agent; or mixtures thereof.
- alcohol such as ethanol, isopropanol, hexadecyl alcohol, glycerol and propylene glycol
- glycerol ketals such as 2,2-dimethyl-l,3-dioxolane-4-methanol
- ethers such as poly(ethylene glycol) 450
- petroleum hydrocarbons such as mineral oil and petrolatum
- water a pharmaceutically suitable surfactant, suspending agent or emulsifying agent; or mixtures thereof.
- One or more of the components of the formulation can be present in its free base or pharmaceutically or analytically acceptable salt form.
- pharmaceutically or analytically acceptable salt refers to a compound that has been modified by reacting it with an acid or base as needed to form an ionically bound pair.
- acceptable salts include conventional non-toxic salts formed, for example, from non-toxic inorganic or organic acids. Suitable non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfonic, sulfamic, phosphoric, nitric and others known to those of ordinary skill in the art.
- the salts prepared from organic acids such as amino acids, acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2- acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and others known to those of ordinary skill in the art. Lists of other suitable salts are found in Remington ' s Pharmaceutical Sciences, 17 th . ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the relevant disclosure of which is hereby incorporated by reference.
- phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with tissues of human beings and animals and without excessive toxicity, irritation, allergic response, or any other problem or complication, commensurate with a reasonable benefit/risk ratio.
- a dosage form can be made by any conventional means known in the pharmaceutical industry.
- a liquid dosage form can be prepared by providing at least one liquid carrier and said improved composition in a container. One or more other excipients can be included in the liquid dosage form.
- a solid dosage form can be prepared by providing at least one solid carrier and said improved composition. One or more other excipients can be included in the solid dosage form.
- a dosage form can be packaged using conventional packaging equipment and materials. It can be included in a pack, bottle, via, bag, syringe, envelope, packet, blister pack, box, ampoule, or other such container.
- the invention includes a method for improving the clinical status of a statistically significant number of subjects of in a population of subjects having a neurological condition, the method comprising: administering to the population of subjects a neuroprotective composition; and determining the clinical status of the subjects to establish the improved clinical status.
- the statistically significant number is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%. at least 80% or at least 90% of the population.
- the neuroprotective composition comprises one or more other pharmacologically active compounds.
- a “derivative” is: a) a chemical substance that is related structurally to a first chemical substance and theoretically derivable from it; b) a compound that is formed from a similar first compound or a compound that can be imagined to arise from another first compound, if one atom of the first compound is replaced with another atom or group of atoms; c) a compound derived or obtained from a parent compound and containing essential elements of the parent compound; or d) a chemical compound that may be produced from first compound of similar structure in one or more steps.
- a derivative may include a deuterated form, oxidized form, dehydrated, unsaturated, polymer conjugated or glycosilated form thereof or may include an ester, amide, lactone, homolog, ether, thioether, cyano, amino, alkylamino, sulfhydryl, heterocyclic, heterocyclic ring- fused, polymerized, pegylated, benzylidenyl, triazolyl, piperazinyl or deuterated form thereof.
- the triterpenes can be purchased from Sigma Chemical Co. (St. Louis, MO).
- Triterpene Mixtures [00178] The following compositions were made by mixing the specified triterpenes in the approximate molar ratios indicated. No specific order of mixing is required.
- the triterpenes can be mixed in any form in the presence or absence of liquid.
- V-C (9) 0.75 0.75 7.5
- Improved compositions can be prepared by mixing the individual triterpene components thereof to form a mixture.
- the triterpene mixtures prepared above that provided efficacy were formulated into improved pharmaceutical compositions.
- oleanolic acid and ursolic acid were mixed according to a predetermined molar ratio of the components as defined herein.
- the components were mixed in solid form or were mixed in solvent(s), e.g. methanol, ethanol, chloroform, acetone, propanol, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMAC), N-methylpyrrolidone (NMP), water or mixtures thereof.
- the resultant mixture contained the components in the relative molar ratios as described herein.
- a pharmaceutically acceptable improved composition at least one pharmaceutically acceptable excipient was mixed in with the pharmacologically active agents.
- An improved composition is formulated for administration to a mammal.
- Known amounts of oleanolic acid and betulinic acid were mixed according to a predetermined molar ratio of the components as defined herein.
- the components were mixed in solid form or were mixed in solvent(s), e.g. methanol, ethanol, chloroform, acetone, propanol, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMAC), N-methylpyrrolidone (NMP), water or mixtures thereof.
- solvent(s) e.g. methanol, ethanol, chloroform, acetone, propanol, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMAC), N-methylpyrrolidone (NMP), water or mixtures thereof.
- DMSO dimethyl sulfoxide
- DMF dimethylformamide
- DMAC dimethylacetamide
- NMP N-methylpyrrolidone
- a pharmaceutically acceptable improved composition at least one pharmaceutically acceptable excipient was mixed in with the pharmacologically active agents.
- An improved composition is formulated for administration to a mammal.
- oleanolic acid ursolic acid and betulinic acid were mixed according to a predetermined molar ratio of the components as defined herein.
- the components were mixed in solid form or were mixed in solvent(s), e.g. methanol, ethanol, chloroform, acetone, propanol, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMAC), N-methylpyrrolidone (NMP), water or mixtures thereof.
- solvent(s) e.g. methanol, ethanol, chloroform, acetone, propanol, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dimethylacetamide (DMAC), N-methylpyrrolidone (NMP), water or mixtures thereof.
- DMSO dimethyl sulfoxide
- DMF dimethylformamide
- DMAC dimethylacetamide
- NMP N-methylpyrrolidone
- a pharmaceutically acceptable improved composition at least one pharmaceutically acceptable excipient was mixed in with the pharmacologically active agents.
- An improved composition is formulated for administration to a mammal.
- Coronal brain slices (250 ⁇ thick) were prepared from postnatal day 10 Sprague-Dawley rat pups of either gender (Charles River) and established in organotypic culture. Animals were sacrificed in accordance with NIH guidelines and under Duke IACUC approval and oversight.
- brain tissue slices were cut in ice-cold artificial cerebrospinal fluid (ACSF) and plated in interface configuration on top of culture medium (Neurobasal A medium supplemented with 15% heat-inactivated horse serum, 10 mM KC1, 10 mM HEPES, 100 U/ml penicillin/streptomycin, 1 mM sodium pyruvate, and 1 mM L- glutamine) set in 0.5% reagent-grade agarose.
- culture medium Neurosporesal A medium supplemented with 15% heat-inactivated horse serum, 10 mM KC1, 10 mM HEPES, 100 U/ml penicillin/streptomycin, 1 mM sodium pyruvate, and 1 mM L- glutamine
- OGD oxygen-glucose deprivation
- YFP yellow fluorescent protein
- brain slices were co-transfected with YFP together with an expression construct to WT amyloid precursor protein (APP), or with YFP together with a cDNA constructed in house encoded human Tau4R0N (identical to NCBI Reference Sequence NM_016834), respectively.
- APP WT amyloid precursor protein
- YFP cDNA constructed in house encoded human Tau4R0N (identical to NCBI Reference Sequence NM_016834), respectively.
- Brain slice explants were then incubated for 24 h under 5% C0 2 at 37 °C for OGD assays; or for 3 d for APP- and tau4R0N-induced neurodegeneration assays.
- Compositions were added at the indicated concentrations to culture medium at the time of brain slice explanation.
- Healthy cortical pyramidal neurons were deemed as those 1) presenting a stout and brightly labeled cell body located within the pyramidal neuronal layers of the cortex; 2) retaining a clear apical dendrite extending radially towards the pial surface the slice; 3) expressing >2 clear basal dendrites >2 cell body diameters long directly from the neuronal soma; and 4) showing clear and continuous cytoplasmic labeling with the YFP visual marker in the soma and throughout all neuronal processes.
- Example 5 This assay was conducted according to Example 3 except that the following changes were made. A specified length of time was allowed between OGD and introduction of a composition being evaluated. The ability of the composition to provide neuroprotection to brain slices if treatment was delayed relative to the timing of the OGD treatment was determined. Example 5
- the Cignal Antioxidant Response Reporter kit (Qiagen) was used.
- the 5xARE luciferase reporter mixture at 40: 1 luciferase:ite «z7/a plasmid was transfected into cortical and striatal neurons separately using an Amaxa electroporation device (Lonza). After electroporation, neurons were pooled and immediately plated into 96-well plates containing mature glial cultures.
- compositions were added at the indicated concentrations for 7 or 24 h prior to harvesting using Dual-Glo Luciferase Assay System protocol and reagents (Promega). Dual-wavelength luminescence was detected using a SpectraMax L microplate reader (Molecular Devices). Luciferase values were normalized to the internal Renilla control and fold-expression over the DMSO-only treatment control was calculated. At least 3 independent experiments were done using 4-6 biological replicates.
- ARE target gene expression levels cortical and striatal neurons were plated onto 96-well plates containing mature glial cultures and cultured for 96 h. Composition was added to cultures at the indicated concentrations for 6 h. At the end of the treatment period, cells were lysed and total RNA was isolated using Absolutely RNA mini-prep kits (Agilent Technologies/Stratagene). cDNA was generated using oligo dT primers and Superscript II reverse transcriptase (Invitrogen).
- cDNA was used for quantitative PCR of gene transcripts using SYBR Green Real-Time PCR Master Mix (Life Technologies) and the following mouse primers, for: Gclc (forward-5' TGGCCACTATCTGCCCAATT-3 ' and reverse-5'- GTCTGACACGTAGCCTCGGTAA- 3'), Nqol (forward-5'- GCCCGCATGCAGATCCT-3' and reverse 5'- GGTCTCCTCCCAGACGGTTT3 '), Srx (forward-5'- GCTTCCTCTCGGGAGTCCTT-3 ' and reverse-5'- CAGCAACAGCGACTACGAAGTAA-3'), and Hmoxl (forward-5'- CCTC ACTGGC AGGAAATC ATC-3 ' and reverse-5 ' -
- mutant htt is introduced via electroporation into high-density, mixed co-cultures of cortical neurons, striatal neurons, and glia arrayed in 96-well plates.
- the goal of this assay platform is to combine the biological/clinical relevance of a complex primary culture system that recapitulates key aspects of the interconnectivity of disease-relevant neuronal populations in vivo, with the ability to conduct large-scale fully automated screening campaigns.
- transfected mutant htt constructs induce the progressive degeneration of both striatal and cortical neurons that are subsequently quantified using automated image acquisition and object detection algorithms on the Cellomics Arrayscan VTI platform.
- Each data point was drawn from 6 wells with 16 images in each well automatically captured, processed, and analyzed on the Cellomics Arrayscan using protocols developed during a large-scale screening campaign being conducted in association with the Cure Huntington's Disease Initiative. In a full run, some 25,000 images are collected and analyzed in each cycle, 4 cycles per week.
- glial cultures are prepared in advance of neuronal plating to establish 96- well plates with confluent glial beds. Cortical and striatal tissue are then dissociated separately and "nucleofected" with appropriate DNA constructs and are distinguishable later by the expression of different fluorescent proteins such as YFP, CFP, and mCherry. These separately transfected cortical and striatal neurons are then mixed thoroughly and plated into the 96-well plates containing the previously plated glial monolayers. Compositions are tested in this cortico-striatal co-culture platform.
- Example 7 Example 7
- Treatment of neurological condition including but not limited to Alzheimer ' s disease.
- a subject presenting with Alzheimer's disease is prescribed neuroprotective composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved.
- Treatment of the subject with the neuroprotective composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- Method B Combination therapy: Neuroprotective composition and another therapeutic agent
- Method A is followed except that the subject is prescribed and administered neuroprotective composition in combination with one or more other therapeutic agents for the treatment of Alzheimer's disease, or symptoms thereof. Then one or more other therapeutic agents can be administered before, after or with the neuroprotective composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done. Suitable one or more other therapeutic agents include NamendaTM (memantine HQ), AriceptTM (donepezil), RazadyneTM (galantamine), ExelonTM (rivastigmine), CognexTM (tacrine), and amantadine.
- NamendaTM memantine HQ
- AriceptTM donepezil
- RazadyneTM galantamine
- ExelonTM rivastigmine
- CognexTM tacrine
- amantadine amantadine.
- Treatment of neurological condition including but not limited to Huntington's disease.
- a subj ect presenting with Huntington' s disease is prescribed the neuroprotective composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved.
- Treatment of the subject with neuroprotective composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- the doses administered can be similar to those described herein.
- Method B Combination therapy: neuroprotective composition and another therapeutic agent
- Method A is followed except that the subject is prescribed and administered neuroprotective composition in combination with one or more other therapeutic agents for the treatment of Huntington's disease, or symptoms thereof.
- the one or more other therapeutic agents can be administered before, after or with the neuroprotective composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done.
- Suitable one or more other therapeutic agents include Vitamin E, Baclofen (a derivative of CoQIO), Lamotrigine (an anticonvulsant), remacemide (an anesthetic which is alow affinity NMDA antagonist), and riluzole (Na channel blocker).
- Treatment of neurological condition including but not limited to ischemic stroke.
- a subject presenting with ischemic stroke is prescribed the neuroprotective composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved.
- Treatment of the subject with the neuroprotective composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- the doses administered can be similar to those described herein.
- Method B Combination therapy: neuroprotective composition and another therapeutic agent
- Method A is followed except that the subject is prescribed and administered neuroprotective composition in combination with one or more other therapeutic agents for the treatment of ischemic stroke, or symptoms thereof.
- the one or more other therapeutic agents can be administered before, after or with the neuroprotective composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done.
- Treatment of neurological condition including but not limited to Parkinson's disease.
- a subject presenting with Parkinson's disease is prescribed the neuroprotective composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved.
- Treatment of the subject with neuroprotective composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- the doses administered can be similar to those described herein.
- Method B Combination therapy: neuroprotective composition and another therapeutic agent
- Method A is followed except that the subject is prescribed and administered neuroprotective composition in combination with one or more other therapeutic agents for the treatment of Parkinson's disease, or symptoms thereof.
- the one or more other therapeutic agents can be administered before, after or with the neuroprotective composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done.
- Suitable one or more other therapeutic agents include a combination of carbidopa and levodopa, rasagiline, pramipexole, ropinrole, amantadine, memantine, entacapone, rotigotine, benztropine, selegiline, biperiden, a combination of carbidopa and levodopa and entacapone, trihexylphenidyl, rivastigmine, apomorphine, levodopa, carbidopa, bromocriptine, belladonna, tolcapone, or a combination thereof.
- biolistic transfection is used not only to introduce vital markers such as YFP, but also to introduce disease gene constructs into the same neuronal populations in the brain slices.
- the ⁇ / ⁇ brain slice model co-transfects YFP with APP isoforms, leading to the progressive degeneration of cortical pyramidal neurons over the course of 3- 4 days after brain slice preparation and transfection.
- the data demonstrate that the neuroprotective composition is to provide concentration-dependent neuroprotection to APP- transfected brain slices.
- Neocortical brain slices were prepared from PND 7 Sprague-Dawley rat pups.
- the cerebral cortex was dissected, cut into 400 ⁇ -thick slices and transferred into a container containing cold artificial cerebrospinal fluid with 1 ⁇ MK-801 before plating; MK-801 was not included in any subsequent procedures.
- OGD transient oxygen-glucose deprivation
- OGD slices were then plated side-by-side with control slices from the contralateral hemisphere on nitrocellulose or Millicell (Millipore) permeable membranes, which were prepared identically except for no OGD.
- the brain slice pairs were transfected, transferred to 24-well plates, and incubated at 37°C under 5% CO2 in humidified chambers.
- OGD oxygen-glucose deprivation
- compositions were tested on "nonstroked" brain slices; that is, ones that were sliced and transfected with YFP but not subjected to additional trauma via OGD. See experimental procedure outlined above.
- Step I Preparation of enteric coated capsules Step I: Preparation of liquid-filled capsule [00216] Hard gelatin capsules (50 counts, 00 size) are filled with a liquid composition of Example 13. These capsules are filled with 800 mg of the formulation and then sealed by hand with a 50% ethanol/ 50% water solution. The capsules are then banded by hand with 22% gelatin solution containing the following ingredients in the amounts indicated.
- a coating dispersion is prepared from the ingredients listed in the table below.
- the dispersion is applied to the capsules to a 20.0 mg/cm 2 coating level.
- the following conditions are used to coat the capsules. Parameters Set-up
- Spray nozzle was set such that both the nozzle and spray path were under the flow path of inlet air.
- Syloid 244FP is a colloidal silicon dioxide manufactured by Grace Davison. Colloidal silicon dioxide is commonly used to provide several functions, such as an adsorbant, glidant, and tablet disintegrant. Syloid 244FP was chosen for its ability to adsorb 3 times its weight in oil and for its 5.5 micron particle size.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- compositions of the invention are evaluated for treating cell proliferation condition, disease or disorder according to any of the methods of Newman et al. (US8187644B2, US8394434B2, US7402325B2, US9494589B2, US9846156B2, US8367363B2, the entire disclosures of which are hereby incorporated by reference) or of Cauni et al. ("Effects of ursolic and oleanolic acid on SK-MEL-2 melanoma cells: in vitro and in vivo assays", in Inter. J. Oncol. (2017), 51, 1651-1660, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes and excluding cardiac glycoside are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- compositions of the invention are evaluated for treating viral infections listed above according to the methods of Newman et al. (WO 2018/053123A1, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes and excluding cardiac glycoside are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- compositions of the invention are evaluated for treating bacterial infections listed above according to the methods of Kim et al. ("Antimicrobial action of oleanolic acid on Listeria monocytogenes, Enterococcus faecium, and Enterococcus faecalis" in PLOS ONE, DOI: 10.1371/Journal.pone.Ol 18800, (2015), 1-11, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- compositions of the invention are evaluated for treating diabetes and related conditions according to the methods of Lo et al. ("Development of betulinic acid as an agonist of TGR5 receptor using a new in vitro assay" in Drug Des. Dvlp. Ther. (2016), 10, 2669-2676, the entire disclosure of which is hereby incorporated by reference) or the methods of Yin ("Inhibitory effects and actions of pentacychc triterpenes upon gly cation” in Biomedicine (2015), 5(3), 1-8, the entire disclosure of which is hereby incorporated by reference), except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- compositions of the invention are evaluated for treating musculoskeletal condition, disease or disorder, in particular age-related loss of muscle mass, according to the methods of Ebert et al. ("Identification and Small Molecule Inhibition of an Activating Transcription Factor 4 (ATF4)-dependent Pathway to Age-related Skeletal Muscle Weakness and Atrophy” in J. Biol. Chem. (2015), 290(42), 25497-25511, the entire disclosure of which is hereby incorporated by reference) or the methods of Kunkel et al. (“mRNA expression signatures of human skeletal muscle atrophy identify a natural compound that increases muscle mass” in Cell Metab. (2011), 13(6), 627-638, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- ATF4 Activating Transcription Factor 4
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.33-5 : 0.33-5.
- compositions of the invention are evaluated for treating parasitic infection according to the methods of Lopez et al. ("Phytochemical composition, antiparasitic and alpha-glucosidase inhibition activities from Pelliciera rhizophorae" in Chem. Cent. J. (2015), 9:53, 1-11, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating protozoal according to the methods of Yamamoto et al. ("The effect of ursolic acid on Leishmania amazonensis is related to programmed cell death and presents therapeutic potential in experimental cutaneous leishmaniasis" in PLOS ONE DOI: 10.1371/journal.pone.0144946, (2015), 1-19, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating oxidative stress-related condition, disease or disorder according to the methods of Madlala et al. ("Changes in renal and oxidative status associated with hypotensive effects of oleanolic acid and related synthetic derivatives in experimental animals" in PLOS ONE DOI: 10.1371/journal.pone.0128192, (2015), 1-20, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating gastrointestinal condition, disease or disorder according to the methods of Dinh et al. ("Bardoxolone methyl prevents high-fat diet-induced colon inflammation in mice” in J. Histochem. Cytochem. (2016), 64(4), 237-255, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- Triterpene-based Compositions Determining Efficacy of Triterpene-based Compositions in Treating angiogenesis-related condition, disease or disorder
- compositions of the invention are evaluated for treating angiogenesis-related condition, disease or disorder according to the methods of Saraswati et al. ("Ursolic acid inhibits tumor angiogenesis and induces apoptosis through mitochondrial-dependent pathway in Ehrlich ascites carcinoma tumor” in Chem. Biol. Interact. (2013), 206(2), 153- 165, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating cardiovascular condition, disease or disorder, in particular hypertension, according to the methods of Steinkamp-Fenske et al. ("Reciprocal upregulation of endothelial nitric-oxide synthase and NADPH oxidase by betulinic acid in human endothelial cells" in J. Pharmacol. Exper. Therap. (2007), 322(2), 836-842, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating hepatic condition, disease or disorder according to the methods of Yi et al. ("Betulinic acid prevents alcohol- induced liver damage by improving the antioxidant system in mice” in J. Vet. Sci. (2014), 15(1), 141-148, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating bone-related condition, disease or disorder according to the methods of Choi et al. ("Betuhnic acid synergistically enhances BMP2-induced bone formation via stimulating Smad 1/5/8 and p38 pathways" in J. Biomed. Sci. (2016), 23:45, 1-9, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betuhnic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating dermatological condition, disease or disorder according to the methods of Ebeling et al. ("From a traditional medicinal plant to a rational drug: understanding the clinically proven wound healing efficacy of birch bark extract" in PLOS ONE (2014), 9(1), e86147, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betuhnic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating renal condition, disease or disorder according to the methods of Madlala et al. ("Changes in renal and oxidative status associated with hypotensive effects of oleanolic acid and related synthetic derivatives in experimental animals" in PLOS ONE DOI:10.1371/journal.pone.0128192, (2015), 1-20, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating metabolic condition, disease or disorder according to the methods of Kunkel et al. ("mRNA expression signatures of human skeletal muscle atrophy identify a natural compound that increases muscle mass" in Cell Metab. (2011), 13(6), 627-638, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary triterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating pulmonary condition, disease or disorder according to the methods of Feng et al. ("Inhibition of human neutrophil elastase by pentacyclic triterpenes" in PLOS ONE (2013), 8(12), e82794, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions of the invention are evaluated for treating viral infection, in particular Flaviviriade infection, Togaviridae infection, Paramyxoviridae infection, and Filoviridae infection, according to the methods of Phoenix Biotechnology, Inc. (WO 2018/053123A1, the entire disclosure of which is hereby incorporated by reference) except that compositions of the invention comprising at least two or at least three triterpenes and excluding cardiac glycoside are evaluated.
- Triterpene-based compositions containing oleanolic acid as the primary tnterpene and ursolic acid and betulinic acid as secondary triterpenes may be found to be active.
- a composition comprising the three triterpenes at the following molar ratio(s) may be found to be active: OA:UA:BA is 9-12 : 0.15-2.5 : 0.15-2.5.
- a composition comprising two triterpenes at the following molar ratio(s) may be found to be active: OA:UA is 9-12 : 0.33-5 or OA:BA is 9-12 : 0.33-5.
- compositions are made by mixing the specified forms of a triterpene. No specific order of mixing is required.
- the forms can be mixed in any form in the presence or absence of liquid.
- Triterpene Form Present (Y/N) Y/N
- Each form of triterpene to be included in a combination is provided.
- the forms are then mixed to provide the respective combination-based triterpene.
- triterpene free acid form and triterpene salt form(s) are mixed.
- triterpene free acid form and triterpene derivative form(s) are mixed.
- triterpene free acid form and triterpene prodrug form(s) are mixed.
- a subject presenting with Zika virus infection is prescribed antiviral composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically.
- the level of therapeutic response can be determined by determining the subject's Zika virus titre in blood or plasma. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved. Treatment of the subject with antiviral composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- Method B Combination therapy: antiviral composition with another agent
- Method A is followed except that the subject is prescribed and administered one or more other therapeutic agents for the treatment of Zika virus infection or symptoms thereof. Then one or more other therapeutic agents can be administered before, after or with the antiviral composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done.
- Vero E6 cells (aso known as Vero C1008 cells, ATTC No. CRL-1586; were infected with ZIKV (Zika virus strain PRVABC59; ATCC VR-1843; httj3 ⁇ 4j/3 ⁇ 4 ,fe at an MOI (multiplicity of infection) of 0.2 in the presence of cardiac glycoside. Cells were incubated with virus and compound for 1 hr, after which the inoculum and compound were discarded. Cells were given fresh medium and incubated for 48hr, after which they were fixed with formalin and stained for ZIKV infection. Other compounds are evaluated under the same conditions and exhibit very varying levels of antiviral activity against Zika virus.
- Method B Compound in Extract Form
- An extract containing a target compound being tested is evaluated as detailed in Method A, except that the amount of extract is normalized to the amount of target compound in the extract.
- an extract containing 2% wt of oleandrin contains 20 microg of oleandrin per 1 mg of extract. Accordingly, if the intended amount of oleandrin for evaluation is 20 microg, then 1 mg of extract would be used in the assay.
- Exemplary Filovirus infections include Ebolavirus and Marburgvirus.
- a subj ect presenting with Filovirus infection is prescribed antiviral composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically.
- the level of therapeutic response can be determined by determining the subject's Filovirus titre in blood or plasma. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved. Treatment of the subject with antiviral composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- Method B Combination therapy: antiviral composition with another agent
- Method A above, is followed except that the subject is prescribed and administered one or more other therapeutic agents for the treatment of Filov irus infection or symptoms thereof. Then one or more other therapeutic agents can be administered before, after or with the antiviral composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done.
- Exemplary Flavivirus infections include Yellow Fever, Dengue Fever, Japanese Enchephalitis, West Nile Viruses, Zikavirus, Tick-borne Encephalitis, Kyasanur Forest Disease, Alkhurma Disease, Chikungunya virus, Omsk Hemorrhagic Fever, Powassan virus infection.
- a subject presenting with Flavivirus infection is prescribed antiviral composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically.
- the level of therapeutic response can be determined by determining the subject's Flavivirus titre in blood or plasma. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved. Treatment of the subject with antiviral composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- Method B Combination therapy: antiviral composition with another agent
- Method A above, is followed except that the subject is prescribed and administered one or more other therapeutic agents for the treatment of Flavivirus infection or symptoms thereof. Then one or more other therapeutic agents can be administered before, after or with the antiviral composition. Dose escalation (or de-escalation) of the one or more other therapeutic agents can also be done.
- a CPE-based antiviral assay was performed by infecting target cells in the presence or absence of test compositions, at a range of concentrations. Infection of target cells by results in cytopathic effects and cell death. In this type of assay, reduction of CPE in the presence of test composition, and the corresponding increase in cell viability, is used as an indicator of antiviral activity.
- cell viability was determined with a neutral red readout. Viable cells incorporate neutral red in their lysosomes. Uptake of neutral red relies on the ability of live cells to maintain a lower pH inside their lysosomes than in the cytoplasm, and this active process requires ATP.
- the neutral red dye becomes charged and is retained intracellularly. After a 3-hour incubation with neutral red (0.033%), the extracellular dye was removed, cells were washed with PBS, and the intracellular neutral red was solubilized with a solution of 50% ethanol + 1% acetic acid. The amount of neutral red in solution was quantified by reading the absorbance (optical density) of each well at 490 nm
- Adherent cell lines were used to evaluate the antiviral activity of compositions against a panel of viruses. Compositions were pre-incubated with the target cells for 30 min before the addition of virus to the cells. The compositions were present in the cell culture medium for the duration of the infection incubation period. For each infection assay, a viability assay was set up in parallel using the same concentrations of compositions (duplicates) to determine cytotoxicity effects of the compositions in the absence of virus.
- test compositions were determined by comparing infection levels (for immunostaining-based assay) or viability (for CPE-based assays) of cells under test conditions to the infection level or viability of uninfected cells. Cytotoxic effects were evaluated in uninfected cells by comparing viability in the presence of inhibitors to the viability of mock-treated cells. Cytotoxicity was determined by an XTT viability assay, which was conducted at the same timepoint as the readout for the corresponding infection assay.
- Test compositions were dissolved in 100% methanol. Eight concentrations of the compositions were generated (in duplicate) by performing 8-fold dilutions, starting with 50 ⁇ as the highest concentration tested. The highest test concentration of composition (50 ⁇ ) resulted in a 0.25% final concentration of methanol (v/v%) in the culture medium. An 8-fold dilution series of methanol vehicle was included in each assay plate, with concentrations mirroring the final concentration of methanol in each composition test condition. When possible, the EC50 and CC50 of the composition was determined for each assay using GraphPad Prism software.
- Antiviral activity was evaluated by the degree of protection against virus- induced cytopathic effects (CPE).
- CPE virus- induced cytopathic effects
- CPE DENV2-induced cytopathic effect
- Neutral Red readout For the DENV2 antiviral assay, the 08-10381 Montserrat strain was used. Viral stocks were generated in C6/36 insect cells. Vero cells (epithelial kidney cells derived from Cercopithecus aethiops) were maintained in MEM with 5% FBS (MEM5). For both the infection and the viability assays, cells were seeded at 10,000 cells per well in 96-well clear flat bottom plates and maintained in MEM5 at 37°C for 24 hours. The day of infection, samples were diluted 8-fold in U-bottom plates using MEM with 1% bovine serum albumin (BS A).
- BS A bovine serum albumin
- Test material dilutions were prepared at 1.25X the final concentration and 40 ⁇ 1 were incubated with the target cells at 37°C for 30 minutes. Following the test material preincubation, ⁇ of virus dilutions prepared in MEM with 1% BSA was added to each well (50 ⁇ 1 final volume per well) and plates were incubated at 37°C in a humidified incubator with 5% C02 for 3 hours. The volume of virus used in the assay was previously determined to produce a signal in the linear range inhibited by Ribavirin and compound A3, known inhibitors of DENV2. After the infection incubation, cells were washed with PBS, then MEM containing 2% FBS (MEM2) to remove unbound virus.
- MEM2 MEM containing 2% FBS
- Controls included cells incubated with no virus ("mock-infected"), infected cells incubated with medium alone, or infected cells in the presence of Ribavirin (0.5 ⁇ ) or A3 (0.5 ⁇ ).
- a full duplicate inhibition curve with methanol vehicle only was included on the same assay plate.
- Test material dilutions were prepared at 1.25X the final concentration and 40 ⁇ 1 were incubated with the target cells at 37°C for 30 minutes. Following the test material pre-incubation, ⁇ of virus dilutions prepared in MEM with 1% BSA was added to each well (50 ⁇ 1 final volume per well) and plates were incubated at 37°C in a humidified incubator with 5% C02 for 3 hours. After the infection incubation, cells were washed with PBS, then MEM containing 2% FBS (MEM2) to remove unbound virus. Subsequently, 50 ⁇ 1 of medium containing inhibitor dilutions prepared at a IX concentration in MEM2 was added to each well.
- the plate was incubated at 37°C in the incubator (5% C02) for 6 days. Controls with no virus ("mock-infected'), infected cells incubated with medium alone, infected cells incubated with vehicle alone (methanol), and wells without cells (to determine background) were included in the assay plate. After 6 days of infection, cells were stained with neutral red to monitor cell viability. Test materials were evaluated in duplicates using serial 8-fold dilutions in infection medium. Controls included cells incubated with no virus ("mock-infected"), infected cells incubated with medium alone, or infected cells in the presence of A3 (0.5 ⁇ ). A full duplicate inhibition curve with methanol vehicle only was included on the same assay plate.
- CPE-based viability data for the neutral red assays, cell viability was determined by monitoring the absorbance at 490 nm. The average signal obtained in wells with no cells was subtracted from all samples. Then, all data points were calculated as a percentage of the average signal observed in the 8 wells of mock (uninfected) cells on the same assay plate. Infected cells treated with medium alone reduced the signal to an average of 4.2% (for HRV), 26.9% (for DENV), and 5.1% (for ZIKV) of that observed in uninfected cells.
- the signal-to-background (S/B) for this assay was 2.9 (for DENV), and 7.2 (for ZIKV), determined as the viability percentage in "mock-infected" cells compared to that of infected cells treated with vehicle only.
- Viability assay to assess compound-induced cytotoxicity: Mock-infected cells were incubated with inhibitor dilutions (or medium only) using the same experimental setup and inhibitor concentrations as was used in the corresponding infection assay. The incubation temperature and duration of the incubation period mirrored the conditions of the corresponding infection assay. Cell viability was evaluated with an XTT method.
- the XTT assay measures mitochondrial activity and is based on the cleavage of y ellow tetrazolium salt (XTT), which forms an orange formazan dye. The reaction only occurs in viable cells with active mitochondria. The formazan dye is directly quantified using a scanning multi- well spectrophotometer.
- Vero E6 cells were infected with EBOV (A,B) or MARV (C,D). At 2hr postinfection (A,C) or 24hr post-infection (B,D), oleandrin or PBI-05204 was added to cells for lhr, then discarded and cells were returned to culture medium. At 48hr post-infection, infected cells were analyzed.
- Vero E6 cells were infected with EBOV or MARV in the presence of oleandrin or PBI-05204 and incubated for 48hr. Supernatants from infected cell cultures were passaged onto fresh Vero E6 cells, incubated for lhr, then discarded (as depicted in A). Cells containing passaged supernatant were incubated for 48hr. Cells infected with EBOV (B) or MARV (C) were detected as described previously. Control infection rates were 66% for EBOV and 67% for MARV.
- Exemplary Paramyxoviridae family viral infections include Henipavirus genus infection, Nipah virus infection, or Hendra virus infection.
- a subject presenting with Paramyxoviridae family infection is prescribed antiviral composition, and therapeutically relevant doses are administered to the subject according to a prescribed dosing regimen for a period of time.
- the subject's level of therapeutic response is determined periodically.
- the level of therapeutic response can be determined by determining the subject's virus titre in blood or plasma. If the level of therapeutic response is too low at one dose, then the dose is escalated according to a predetermined dose escalation schedule until the desired level of therapeutic response in the subject is achieved. Treatment of the subject with antiviral composition is continued as needed and the dose or dosing regimen can be adjusted as needed until the patient reaches the desired clinical endpoint.
- Method B Combination therapy: antiviral composition with another agent
- Method A is followed except that the subject is prescribed and administered one or more other therapeutic agents for the treatment of Paramyxoviridae family infection or symptoms thereof. Then one or more other therapeutic agents can be administered before, after or with the antiviral composition. Dose escalation (or de- escalation) of the one or more other therapeutic agents can also be done.
- the term “about” or “approximately” are taken to mean ⁇ 10%, ⁇ 5%, ⁇ 2.5% or ⁇ 1% of a specified valued.
- the term “substantially” is taken to mean “to a large degree”, “at least a maj ority of, greater than 70%, greater than 85%, greater than 90%, greater than 95%, greater than 98% or greater than 99%.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Cardiology (AREA)
- Urology & Nephrology (AREA)
- Heart & Thoracic Surgery (AREA)
- Psychology (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physical Education & Sports Medicine (AREA)
- Pulmonology (AREA)
- Molecular Biology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Obesity (AREA)
- Dermatology (AREA)
- Gastroenterology & Hepatology (AREA)
- Vascular Medicine (AREA)
- Medical Informatics (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2020002884A MX2020002884A (es) | 2017-09-14 | 2018-09-04 | Método y composición neuroprotectora mejorada para tratar afecciones neurológicas. |
| CA3075023A CA3075023A1 (en) | 2017-09-14 | 2018-09-04 | Method and improved neuroprotective composition for treating neurological conditions |
| KR1020207007410A KR20200083969A (ko) | 2017-09-14 | 2018-09-04 | 신경학적 상태를 치료하기 위한 방법 및 개선된 신경보호 조성물 |
| CN201880062070.6A CN111417384A (zh) | 2017-09-14 | 2018-09-04 | 用于治疗神经系统病况的方法和改进的神经保护性组合物 |
| AU2018334467A AU2018334467B2 (en) | 2017-09-14 | 2018-09-04 | Method and improved neuroprotective composition for treating neurological conditions |
| EP18855856.3A EP3681477A4 (en) | 2017-09-14 | 2018-09-04 | PROCEDURES AND IMPROVED COMPOSITION FOR TREATMENT OF TREITERPEN RESPONSIBLE CONDITIONS, DISEASES, OR DISORDERS |
| RU2020113349A RU2758376C2 (ru) | 2017-09-14 | 2018-09-04 | Способ и улучшенная нейропротекторная композиция для лечения неврологических патологических состояний |
| JP2020515978A JP7370966B2 (ja) | 2017-09-14 | 2018-09-04 | 神経学的状態を治療するための方法および改善された神経保護組成物 |
| US16/184,628 US10722482B2 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
| PCT/US2018/059818 WO2020050865A1 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
| IL273161A IL273161A (en) | 2017-09-14 | 2020-03-09 | An improved neuroprotective method and preparation for the treatment of neurological conditions |
| US16/895,152 US10973785B2 (en) | 2017-09-14 | 2020-06-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
| US17/194,975 US11331291B2 (en) | 2017-09-14 | 2021-03-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762558631P | 2017-09-14 | 2017-09-14 | |
| US62/558,631 | 2017-09-14 | ||
| US16/184,628 US10722482B2 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/049358 Continuation-In-Part WO2019055245A1 (en) | 2017-09-14 | 2018-10-02 | IMPROVED METHOD AND COMPOSITION FOR THE TREATMENT OF TRITERPENE SENSITIVE CONDITIONS, DISEASES OR DISORDERS |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/049358 Continuation-In-Part WO2019055245A1 (en) | 2017-09-14 | 2018-10-02 | IMPROVED METHOD AND COMPOSITION FOR THE TREATMENT OF TRITERPENE SENSITIVE CONDITIONS, DISEASES OR DISORDERS |
| PCT/US2018/059818 Continuation-In-Part WO2020050865A1 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
| US16/184,628 Continuation-In-Part US10722482B2 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2019055245A1 true WO2019055245A1 (en) | 2019-03-21 |
| WO2019055245A9 WO2019055245A9 (en) | 2019-09-26 |
Family
ID=65630104
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/049358 Ceased WO2019055245A1 (en) | 2017-09-14 | 2018-10-02 | IMPROVED METHOD AND COMPOSITION FOR THE TREATMENT OF TRITERPENE SENSITIVE CONDITIONS, DISEASES OR DISORDERS |
| PCT/US2018/059818 Ceased WO2020050865A1 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/059818 Ceased WO2020050865A1 (en) | 2017-09-14 | 2018-11-08 | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
Country Status (11)
| Country | Link |
|---|---|
| US (2) | US10722482B2 (https=) |
| EP (1) | EP3681477A4 (https=) |
| JP (1) | JP7370966B2 (https=) |
| KR (1) | KR20200083969A (https=) |
| CN (1) | CN111417384A (https=) |
| AU (1) | AU2018334467B2 (https=) |
| CA (1) | CA3075023A1 (https=) |
| IL (1) | IL273161A (https=) |
| MX (1) | MX2020002884A (https=) |
| RU (1) | RU2758376C2 (https=) |
| WO (2) | WO2019055245A1 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10596186B2 (en) | 2016-09-14 | 2020-03-24 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infections |
| US10702567B2 (en) | 2016-09-14 | 2020-07-07 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US10729735B1 (en) | 2016-09-14 | 2020-08-04 | Phoenix Biotechnology, Inc. | Method and compostitions for treating coronavirus infection |
| US11806359B2 (en) | 2020-03-31 | 2023-11-07 | Phoenix Biotechnology, Inc. | Method and compositions for treating Coronavirus infection |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11331291B2 (en) * | 2017-09-14 | 2022-05-17 | Phoenix Biotechnology, Inc. | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders |
| MX2020002884A (es) * | 2017-09-14 | 2020-10-05 | Phoenix Biotechnology Inc | Método y composición neuroprotectora mejorada para tratar afecciones neurológicas. |
| WO2021202547A1 (en) * | 2020-04-01 | 2021-10-07 | Triterpenoid Therapeutics, Inc. | Methods and compositions for treating and preventing viral infection |
| CN111888367A (zh) * | 2020-07-31 | 2020-11-06 | 兰州大学 | 一种萜类化合物在制备增强蛋白酶体活性药物中的应用 |
| US12357641B2 (en) * | 2022-10-13 | 2025-07-15 | Hong Kong Baptist University | Identification of oleanolic acid and plant extract for glucose-6-phosphate dehydrogenase-related disorders including Bag3opathy |
Citations (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US922078A (en) | 1909-03-01 | 1909-05-18 | Charles Burwell Benson | Tongue-depressor. |
| US20020068098A1 (en) | 2000-08-01 | 2002-06-06 | Ashni Naturaceuticals, Inc. | Combinations of diterpene triepoxide lactones and ditepene lactones or triterpenes for synergistic inhibition of cyclooxygenase-2 |
| US6824811B2 (en) | 2001-04-09 | 2004-11-30 | Loders Croklaan Usa Llc | Concentrate of triterpenes |
| US20060025274A1 (en) | 2004-07-28 | 2006-02-02 | Usoro Patrick B | Planetary transmissions having three interconnected gear members and clutched input members |
| US20060073222A1 (en) | 1998-05-19 | 2006-04-06 | Arntzen Charles J | Triterpene compositions and methods for use thereof |
| US20060252733A1 (en) | 2005-04-07 | 2006-11-09 | Novelix Pharmaceuticals, Inc. | Betulin, betulin derivatives, betulinic acid and betulinic acid derivatives as novel therapeutics in the treatment of disease of lipid and/or glucose metabolism |
| US20070072835A1 (en) | 2000-08-18 | 2007-03-29 | The Board Of Trustees Of The University Of Illinois | Method of preparing and use of prodrugs of betulinic acid derivatives |
| US20070249711A1 (en) | 2003-10-10 | 2007-10-25 | Wonrack Choi | Triterpene Compounds which are Effective on Improvement of Brain Function |
| US7402325B2 (en) | 2005-07-28 | 2008-07-22 | Phoenix Biotechnology, Inc. | Supercritical carbon dioxide extract of pharmacologically active components from Nerium oleander |
| US20080293682A1 (en) | 2005-02-09 | 2008-11-27 | Rama Mukherjee | Novel Betulinic Acid Derivatives |
| US20090068257A1 (en) | 2006-03-07 | 2009-03-12 | Jean-Claude Leunis | Betulonic and betulinic acid derivatives |
| US20090076290A1 (en) | 2005-03-29 | 2009-03-19 | Regents Of The University Of Minnesota | Selective oxidation of triterpenes employing tempo |
| US20090131714A1 (en) | 2005-06-08 | 2009-05-21 | Krasutsky Pavel A | Synthesis of betulonic and betulinic aldehydes |
| US20090203661A1 (en) | 2006-10-12 | 2009-08-13 | Safe Stephen H | Betulinic acid, derivatives and analogs thereof and uses therefor |
| US20100048911A1 (en) | 2008-04-18 | 2010-02-25 | Xin Jiang | Antioxidant inflammation modulators: novel derivatives of oleanolic acid |
| US7718635B2 (en) | 2005-06-10 | 2010-05-18 | Pola Chemical Industries Inc. | Triterpenic acid derivative and preparation for external application for skin comprising the same |
| EP2260851A1 (en) | 2008-03-28 | 2010-12-15 | Consejo Superior De Investigaciones Científicas | Use of pentacyclic triterpene for the preparation of a pharmaceutical compound intended for the treatment of multiple sclerosis |
| US20110091398A1 (en) | 2007-08-07 | 2011-04-21 | Muhammed Majeed | Oleanoyl peptide composition and a method of treating skin aging |
| US20110218204A1 (en) | 2009-07-14 | 2011-09-08 | Hetero Research Foundation, Hetero Drugs Limited | Pharmaceutically acceptable salts of novel betulinic acid derivatives |
| US20110224159A1 (en) | 2008-09-10 | 2011-09-15 | Universite du Quebec a Chicoutime | Bidesmosidic betulin and betulinic acid derivatives and uses thereof as antitumor agents |
| US20110224182A1 (en) | 2007-01-19 | 2011-09-15 | Myriad Pharmaceuticals, Incorporated | Salts of (3-0-(3',3'-dimethylsuccinyl) betulinic acid and solid state forms thereof |
| US20110313191A1 (en) | 2005-12-16 | 2011-12-22 | Myrexis, Inc. | Preparation of Pharmaceutical Salts of 3-0-(3',3'-Dimethylsuccinyl) Betulinic Acid |
| US20120101149A1 (en) | 2008-11-04 | 2012-04-26 | Tadashi Honda | Betulinic Acid Derivatives and Methods of Use Thereof |
| US20120128798A1 (en) | 2010-11-22 | 2012-05-24 | Phoenix Biotechnology, Inc. | Method of Treating Neurological Conditions with Extract of Nerium Species or Thevetia Species |
| US20120165279A1 (en) | 2010-12-22 | 2012-06-28 | Industrial Technology Research Institute | Pharmaceutical composition and method for preventing or treating hepatitis c |
| US20120214775A1 (en) | 2004-03-17 | 2012-08-23 | Myrexis, Inc. | Pharmaceutical Salts of 3-O-(3',3'-Dimethylsuccinyl) Betulinic Acid |
| US20120214814A1 (en) | 2008-04-18 | 2012-08-23 | Eric Anderson | Antioxidant inflammation modulators: oleanolic acid derivatives with amino acid and other modifications at c-17 |
| US20120237629A1 (en) | 2009-11-30 | 2012-09-20 | University of Zwazulu-Natal | In vitro anti-sickling activity of betulinic acid, oleanolic acid and their derivatives |
| US20120245374A1 (en) | 2008-04-18 | 2012-09-27 | Reata Pharmaceuticals, Inc. | Antioxidant Inflammation Modulators: Oleanolic Acid Derivatives with Saturation in the C-Ring |
| US20120302530A1 (en) | 2009-11-23 | 2012-11-29 | Suzhou Maidixian Pharmaceutical Inc. | 23-hydroxy-betulinic acid derivatives, preparation methods and uses thereof |
| US20130029954A1 (en) | 2011-01-31 | 2013-01-31 | Bristol-Myers Squibb Company | C-28 amines of c-3 modified betulinic acid derivatives as hiv maturation inhibitors |
| US20130065868A1 (en) | 2001-05-11 | 2013-03-14 | University Of Ottawa | Anxioytic marcgraviaceae compositions containing betulinic acid, betulinic acid derivatives, and methods |
| US8481086B2 (en) | 2010-01-11 | 2013-07-09 | Phoenix Biotechnology, Inc. | Method of treating neurological conditions with cardiac glycoside |
| US20130303607A1 (en) | 2012-05-08 | 2013-11-14 | Trustees Of Dartmouth College | Triterpenoids and Compositions Containing the Same |
| US20140066408A1 (en) | 2008-04-18 | 2014-03-06 | Reata Pharmaceuticals, Inc. | Antioxidant inflammation modulators: c-17 homologated oleanolic acid derivatives |
| US20140088163A1 (en) | 2012-09-10 | 2014-03-27 | Reata Pharmaceuticals, Inc. | C17-heteroaryl derivatives of oleanolic acid and methods of use thereof |
| US20140088188A1 (en) | 2012-09-10 | 2014-03-27 | Reata Pharmaceuticals, Inc. | C13-hydroxy derivatives of oleanolic acid and methods of use thereof |
| US20140100227A1 (en) | 2012-09-10 | 2014-04-10 | Reata Pharmaceuticals, Inc. | C17-alkanediyl and alkenediyl derivatives of oleanolic acid and methods of use thereof |
| US8729055B2 (en) | 2010-02-02 | 2014-05-20 | Kaohsiung Medical University | Ursolic acid derivative and pharmaceutical composition thereof |
| US20140221328A1 (en) | 2011-01-10 | 2014-08-07 | Bandi Parthasaradhi Reddy | Pharmaceutically acceptable salts of novel betulinic acid derivatives |
| US20140243298A1 (en) | 2013-02-25 | 2014-08-28 | Bristol-Myers Squibb Company | C-3 alkyl and alkenyl modified betulinic acid derivatives |
| US20140296546A1 (en) | 2011-11-18 | 2014-10-02 | Wenzhou University | Method for producing 30-halogenated betulinic acid |
| US20140343064A1 (en) | 2011-12-01 | 2014-11-20 | Hanghzhou Bensheng Pharmaceutical Co., Ltd | 2-substituted oleanolic acid derivative, method preparing for same, and application thereof |
| US20140343108A1 (en) | 2011-12-01 | 2014-11-20 | Hangzhou Bensheng Pharmaceutical Co., Ltd. | Oleanolic acid amidate derivatives, preparation methods and uses thereof |
| US20150119373A1 (en) | 2012-04-24 | 2015-04-30 | Hetero Research Foundation | Novel betulinic acid derivatives as hiv inhibitors |
| EP1852105B1 (de) * | 2006-05-03 | 2015-08-05 | Birken AG | Verfahren zur Herstellung einer triterpensäurehaltigen wässrigen Lösung, triterpensäurehaltige wässrige Lösung und deren Verwendung |
| US20150218206A1 (en) | 2012-08-14 | 2015-08-06 | Nexoligo Co., Ltd. | Novel ursolic acid derivative and method for preparing same |
| US20150337004A1 (en) | 2012-12-31 | 2015-11-26 | Hetero Research Foundation | Novel betulinic acid proline derivatives as hiv inhibitors |
| US20170096446A1 (en) | 2006-11-03 | 2017-04-06 | Myrexis, Inc. | Extended Triterpene Derivatives |
| US20170204133A1 (en) | 2014-06-19 | 2017-07-20 | VIIV Healthcare UK (No.5) Limited | Betulinic acid derivatives with hiv maturation inhibitory activity |
Family Cites Families (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK166650B1 (da) | 1991-03-15 | 1993-06-28 | Aarhus Oliefabrik As | Fedtbaser samt anvendelse af disse i kosmetiske og farmaceutiske emulsionsprodukter |
| US5977174A (en) | 1997-11-26 | 1999-11-02 | Neuromedica, Inc. | Cholinergic compositions and uses thereof |
| US5985936A (en) | 1997-12-18 | 1999-11-16 | Forbes Medi-Tech, Inc. | Method of preventing and delaying onset of Alzheimer's disease and composition therefor |
| DE60039232D1 (de) | 1999-04-27 | 2008-07-31 | Forbes Medi Tech Inc | Verfahren zur Herstellung einer Phytosterolzusammensetzung |
| CN1129613C (zh) | 1999-12-24 | 2003-12-03 | 中国科学院上海药物研究所 | 夹竹桃花多糖及其制备方法和应用 |
| US20020077350A1 (en) | 2000-08-01 | 2002-06-20 | Ashni Naturaceuticals, Inc. | Compositions exhibiting synergistic inhibition of the expression and/or activity of clyclooxygenase-2 |
| WO2003099011A1 (en) | 2002-05-28 | 2003-12-04 | Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Cardiac glycosides to treat cystic fibrosis and other il-8 dependent disorders |
| DE602004014974D1 (de) * | 2003-12-19 | 2008-08-21 | Lipid Nutrition Bv | Verwendung von zusammensetzungen mit oleansäure und ursolsäure zur herstellung eines medikaments zur behandlung von überempfindlichkeit und hyperreaktivität |
| EP1812010A2 (en) | 2004-10-18 | 2007-08-01 | BTG International Limited | Use of na+/ k+-atpase inhibitors and antagonists thereof |
| EP1803461A1 (en) | 2005-12-27 | 2007-07-04 | Heinz-Herbert Fiebig | Therapeutic use of an extract from the leaves of Nerium oleander |
| CA2705272C (en) | 2007-11-13 | 2020-05-12 | Phoenix Biotechnology Inc. | Method of determining the probability of a therapeutic response in cancer chemotherapy with cardiac glycoside |
| TW201104501A (en) | 2009-07-24 | 2011-02-01 | Asustek Comp Inc | Device and method for inputting Chinese character |
| KR101742852B1 (ko) * | 2010-11-22 | 2017-06-15 | 피닉스 바이오테크놀러지 인코포레이티드. | 네리움 종 또는 테베티아 종의 추출물로 신경학적 병태를 치료하는 방법 |
| EP2813221A1 (en) * | 2013-06-13 | 2014-12-17 | Natac Biotech, S.L. | Combination of pentacyclic triterpenes and hydroxytyrosol and derivatives thereof |
| WO2015183794A1 (en) * | 2014-05-27 | 2015-12-03 | City Of Hope | Tgr5 agonist complexes for treating diabetes and cancer |
| WO2018053123A1 (en) * | 2016-09-14 | 2018-03-22 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| MX2020002884A (es) * | 2017-09-14 | 2020-10-05 | Phoenix Biotechnology Inc | Método y composición neuroprotectora mejorada para tratar afecciones neurológicas. |
-
2018
- 2018-09-04 MX MX2020002884A patent/MX2020002884A/es unknown
- 2018-09-04 KR KR1020207007410A patent/KR20200083969A/ko not_active Abandoned
- 2018-09-04 RU RU2020113349A patent/RU2758376C2/ru active
- 2018-09-04 AU AU2018334467A patent/AU2018334467B2/en not_active Ceased
- 2018-09-04 CA CA3075023A patent/CA3075023A1/en active Pending
- 2018-09-04 EP EP18855856.3A patent/EP3681477A4/en not_active Withdrawn
- 2018-09-04 JP JP2020515978A patent/JP7370966B2/ja active Active
- 2018-09-04 CN CN201880062070.6A patent/CN111417384A/zh active Pending
- 2018-10-02 WO PCT/US2018/049358 patent/WO2019055245A1/en not_active Ceased
- 2018-11-08 WO PCT/US2018/059818 patent/WO2020050865A1/en not_active Ceased
- 2018-11-08 US US16/184,628 patent/US10722482B2/en not_active Expired - Fee Related
-
2020
- 2020-03-09 IL IL273161A patent/IL273161A/en unknown
- 2020-06-08 US US16/895,152 patent/US10973785B2/en not_active Expired - Fee Related
Patent Citations (65)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US922078A (en) | 1909-03-01 | 1909-05-18 | Charles Burwell Benson | Tongue-depressor. |
| US20110294752A1 (en) | 1998-05-19 | 2011-12-01 | Research Development Foundation | Triterpene compositions and methods for use thereof |
| US20060073222A1 (en) | 1998-05-19 | 2006-04-06 | Arntzen Charles J | Triterpene compositions and methods for use thereof |
| US20100189824A1 (en) | 1998-05-19 | 2010-07-29 | Arntzen Charles J | Triterpene compositions and methods for use thereof |
| US20020068098A1 (en) | 2000-08-01 | 2002-06-06 | Ashni Naturaceuticals, Inc. | Combinations of diterpene triepoxide lactones and ditepene lactones or triterpenes for synergistic inhibition of cyclooxygenase-2 |
| US20070072835A1 (en) | 2000-08-18 | 2007-03-29 | The Board Of Trustees Of The University Of Illinois | Method of preparing and use of prodrugs of betulinic acid derivatives |
| US6824811B2 (en) | 2001-04-09 | 2004-11-30 | Loders Croklaan Usa Llc | Concentrate of triterpenes |
| US20130065868A1 (en) | 2001-05-11 | 2013-03-14 | University Of Ottawa | Anxioytic marcgraviaceae compositions containing betulinic acid, betulinic acid derivatives, and methods |
| US20070249711A1 (en) | 2003-10-10 | 2007-10-25 | Wonrack Choi | Triterpene Compounds which are Effective on Improvement of Brain Function |
| US20120214775A1 (en) | 2004-03-17 | 2012-08-23 | Myrexis, Inc. | Pharmaceutical Salts of 3-O-(3',3'-Dimethylsuccinyl) Betulinic Acid |
| US20060025274A1 (en) | 2004-07-28 | 2006-02-02 | Usoro Patrick B | Planetary transmissions having three interconnected gear members and clutched input members |
| US20080293682A1 (en) | 2005-02-09 | 2008-11-27 | Rama Mukherjee | Novel Betulinic Acid Derivatives |
| US20090076290A1 (en) | 2005-03-29 | 2009-03-19 | Regents Of The University Of Minnesota | Selective oxidation of triterpenes employing tempo |
| US20060252733A1 (en) | 2005-04-07 | 2006-11-09 | Novelix Pharmaceuticals, Inc. | Betulin, betulin derivatives, betulinic acid and betulinic acid derivatives as novel therapeutics in the treatment of disease of lipid and/or glucose metabolism |
| US20090131714A1 (en) | 2005-06-08 | 2009-05-21 | Krasutsky Pavel A | Synthesis of betulonic and betulinic aldehydes |
| US7718635B2 (en) | 2005-06-10 | 2010-05-18 | Pola Chemical Industries Inc. | Triterpenic acid derivative and preparation for external application for skin comprising the same |
| US8394434B2 (en) | 2005-07-28 | 2013-03-12 | Phoenix Biotechnology, Inc. | SCF extract containing cardiac glycoside |
| US7402325B2 (en) | 2005-07-28 | 2008-07-22 | Phoenix Biotechnology, Inc. | Supercritical carbon dioxide extract of pharmacologically active components from Nerium oleander |
| US8187644B2 (en) | 2005-07-28 | 2012-05-29 | Phoenix Biotechnology Inc. | SCF extract containing cardiac glycoside |
| US20110313191A1 (en) | 2005-12-16 | 2011-12-22 | Myrexis, Inc. | Preparation of Pharmaceutical Salts of 3-0-(3',3'-Dimethylsuccinyl) Betulinic Acid |
| US20140066416A1 (en) | 2006-03-07 | 2014-03-06 | Jean-Claude Leunis | Betulonic and betulinic acid derivatives |
| US20090068257A1 (en) | 2006-03-07 | 2009-03-12 | Jean-Claude Leunis | Betulonic and betulinic acid derivatives |
| EP1852105B1 (de) * | 2006-05-03 | 2015-08-05 | Birken AG | Verfahren zur Herstellung einer triterpensäurehaltigen wässrigen Lösung, triterpensäurehaltige wässrige Lösung und deren Verwendung |
| US20090203661A1 (en) | 2006-10-12 | 2009-08-13 | Safe Stephen H | Betulinic acid, derivatives and analogs thereof and uses therefor |
| US20170096446A1 (en) | 2006-11-03 | 2017-04-06 | Myrexis, Inc. | Extended Triterpene Derivatives |
| US20110224182A1 (en) | 2007-01-19 | 2011-09-15 | Myriad Pharmaceuticals, Incorporated | Salts of (3-0-(3',3'-dimethylsuccinyl) betulinic acid and solid state forms thereof |
| US20110091398A1 (en) | 2007-08-07 | 2011-04-21 | Muhammed Majeed | Oleanoyl peptide composition and a method of treating skin aging |
| EP2260851A1 (en) | 2008-03-28 | 2010-12-15 | Consejo Superior De Investigaciones Científicas | Use of pentacyclic triterpene for the preparation of a pharmaceutical compound intended for the treatment of multiple sclerosis |
| US20120245374A1 (en) | 2008-04-18 | 2012-09-27 | Reata Pharmaceuticals, Inc. | Antioxidant Inflammation Modulators: Oleanolic Acid Derivatives with Saturation in the C-Ring |
| US20120214814A1 (en) | 2008-04-18 | 2012-08-23 | Eric Anderson | Antioxidant inflammation modulators: oleanolic acid derivatives with amino acid and other modifications at c-17 |
| US20120238767A1 (en) | 2008-04-18 | 2012-09-20 | Xin Jiang | Antioxidant inflammation modulators: novel derivatives of oleanolic acid |
| US20140179928A1 (en) | 2008-04-18 | 2014-06-26 | Reata Pharmaceuticals, Inc. | Antioxidant inflammation modulators: oleanolic acid derivatives with saturation in the c-ring |
| US20130317007A1 (en) | 2008-04-18 | 2013-11-28 | Reata Pharmaceuticals, Inc. | Antioxidant inflammation modulators: oleanolic acid derivatives with amino and other modifications at c-17 |
| US20100048911A1 (en) | 2008-04-18 | 2010-02-25 | Xin Jiang | Antioxidant inflammation modulators: novel derivatives of oleanolic acid |
| US20140066408A1 (en) | 2008-04-18 | 2014-03-06 | Reata Pharmaceuticals, Inc. | Antioxidant inflammation modulators: c-17 homologated oleanolic acid derivatives |
| US20110224159A1 (en) | 2008-09-10 | 2011-09-15 | Universite du Quebec a Chicoutime | Bidesmosidic betulin and betulinic acid derivatives and uses thereof as antitumor agents |
| US20120101149A1 (en) | 2008-11-04 | 2012-04-26 | Tadashi Honda | Betulinic Acid Derivatives and Methods of Use Thereof |
| US20110218204A1 (en) | 2009-07-14 | 2011-09-08 | Hetero Research Foundation, Hetero Drugs Limited | Pharmaceutically acceptable salts of novel betulinic acid derivatives |
| US20120302530A1 (en) | 2009-11-23 | 2012-11-29 | Suzhou Maidixian Pharmaceutical Inc. | 23-hydroxy-betulinic acid derivatives, preparation methods and uses thereof |
| US20120237629A1 (en) | 2009-11-30 | 2012-09-20 | University of Zwazulu-Natal | In vitro anti-sickling activity of betulinic acid, oleanolic acid and their derivatives |
| US8481086B2 (en) | 2010-01-11 | 2013-07-09 | Phoenix Biotechnology, Inc. | Method of treating neurological conditions with cardiac glycoside |
| US20150283191A1 (en) | 2010-01-11 | 2015-10-08 | Phoenix Biotechnology, Inc. | Method of Treating Neurological Conditions with Extract of Nerium Species or Thevetia Species |
| US9220778B2 (en) | 2010-01-11 | 2015-12-29 | Phoenix Biotechnology, Inc. | Method of treating neurological conditions with oleandrin-containing extract |
| US20160243143A1 (en) | 2010-01-11 | 2016-08-25 | Phoenix Biotechnology, Inc. | Method of Treating Neurological Conditions with Oleandrin |
| US9358293B2 (en) | 2010-01-11 | 2016-06-07 | Phoenix Biotechnology, Inc. | Method of treating neurological conditions with oleandrin |
| US8729055B2 (en) | 2010-02-02 | 2014-05-20 | Kaohsiung Medical University | Ursolic acid derivative and pharmaceutical composition thereof |
| US9011937B2 (en) | 2010-11-22 | 2015-04-21 | Phoenix Biotechnology, Inc. | Method of treating neurological conditions with extract of Nerium species or Thevetia species |
| US20120128798A1 (en) | 2010-11-22 | 2012-05-24 | Phoenix Biotechnology, Inc. | Method of Treating Neurological Conditions with Extract of Nerium Species or Thevetia Species |
| US20120165279A1 (en) | 2010-12-22 | 2012-06-28 | Industrial Technology Research Institute | Pharmaceutical composition and method for preventing or treating hepatitis c |
| US20140221328A1 (en) | 2011-01-10 | 2014-08-07 | Bandi Parthasaradhi Reddy | Pharmaceutically acceptable salts of novel betulinic acid derivatives |
| US20130029954A1 (en) | 2011-01-31 | 2013-01-31 | Bristol-Myers Squibb Company | C-28 amines of c-3 modified betulinic acid derivatives as hiv maturation inhibitors |
| US20140296546A1 (en) | 2011-11-18 | 2014-10-02 | Wenzhou University | Method for producing 30-halogenated betulinic acid |
| US20140343108A1 (en) | 2011-12-01 | 2014-11-20 | Hangzhou Bensheng Pharmaceutical Co., Ltd. | Oleanolic acid amidate derivatives, preparation methods and uses thereof |
| US20140343064A1 (en) | 2011-12-01 | 2014-11-20 | Hanghzhou Bensheng Pharmaceutical Co., Ltd | 2-substituted oleanolic acid derivative, method preparing for same, and application thereof |
| US20150119373A1 (en) | 2012-04-24 | 2015-04-30 | Hetero Research Foundation | Novel betulinic acid derivatives as hiv inhibitors |
| US20150011627A1 (en) | 2012-05-08 | 2015-01-08 | Trustees Of Dartmouth College | Triterpenoids and compositions containing the same |
| US20130303607A1 (en) | 2012-05-08 | 2013-11-14 | Trustees Of Dartmouth College | Triterpenoids and Compositions Containing the Same |
| US20150218206A1 (en) | 2012-08-14 | 2015-08-06 | Nexoligo Co., Ltd. | Novel ursolic acid derivative and method for preparing same |
| US9120839B2 (en) | 2012-08-14 | 2015-09-01 | Nexoligo Co., Ltd. | Ursolic acid derivative and method for preparing same |
| US20140100227A1 (en) | 2012-09-10 | 2014-04-10 | Reata Pharmaceuticals, Inc. | C17-alkanediyl and alkenediyl derivatives of oleanolic acid and methods of use thereof |
| US20140088188A1 (en) | 2012-09-10 | 2014-03-27 | Reata Pharmaceuticals, Inc. | C13-hydroxy derivatives of oleanolic acid and methods of use thereof |
| US20140088163A1 (en) | 2012-09-10 | 2014-03-27 | Reata Pharmaceuticals, Inc. | C17-heteroaryl derivatives of oleanolic acid and methods of use thereof |
| US20150337004A1 (en) | 2012-12-31 | 2015-11-26 | Hetero Research Foundation | Novel betulinic acid proline derivatives as hiv inhibitors |
| US20140243298A1 (en) | 2013-02-25 | 2014-08-28 | Bristol-Myers Squibb Company | C-3 alkyl and alkenyl modified betulinic acid derivatives |
| US20170204133A1 (en) | 2014-06-19 | 2017-07-20 | VIIV Healthcare UK (No.5) Limited | Betulinic acid derivatives with hiv maturation inhibitory activity |
Non-Patent Citations (45)
| Title |
|---|
| "NCBI", Database accession no. NM_016834 |
| "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY, pages: 1418 |
| AYATOLLAHI ET AL., IRAN. J. PHARM. RES., vol. 10, no. 2, 2011, pages 287 - 294 |
| BUTTERFIELD DAOESWEIN JQPRUNTY MEHISLE KCMARKESBERY WR: "Increased sodium, potassium adenosine triphosphatase activity in erythrocyte membranes in Huntington's disease", ANN NEUROLOGY, vol. 4, 1978, pages 60 - 62 |
| CAO ET AL.: "Ethylene glycol-linked amino acid diester prodrugs of oleanolic acid for PEPT1-mediated transport: synthesis, intestinal permeability and pharmacokinetics", MOL. PHARM., vol. 9, no. 8, August 2012 (2012-08-01), pages 2127 - 2135 |
| CHEN ET AL.: "Oleanolic acid nanosuspensions: preparation, in-vitro characterization and enhanced hepatoprotective effect", J. PHARM. PHARMACOL., vol. 57, no. 2, February 2005 (2005-02-01), pages 259 - 264, XP055503197, DOI: 10.1211/0022357055407 |
| CHUNG ET AL., MOL. CELLS, vol. 11, no. 2, April 2001 (2001-04-01), pages 137 - 143 |
| FUMIKO ET AL., BIOL. PHARM. BULL, vol. 25, no. 11, 2002, pages 1485 - 1487 |
| GARCIA-MORALES ET AL., ARCH. PHARM. RES., vol. 38, no. 7, July 2015 (2015-07-01), pages 1369 - 1379 |
| GODUGU: "Approaches to improve the oral bioavailability and effects of novel anticancer drugs berberine and betulinic acid", PLOS ONE, vol. 9, no. 3, March 2014 (2014-03-01), pages e89919 |
| GUTIERREZ M. ET AL.: "Cerebral protection, brain repair, plasticity and cell therapy in ischemic stroke", CEREBROVASC. DIS., 2009, pages 177 - 186 |
| HEO ET AL., MOL. CELLS, vol. 13, no. 1, February 2002 (2002-02-01), pages 5 - 11 |
| JAGER ET AL., MOLECULES, vol. 14, 2009, pages 2016 - 2031 |
| LEE ET AL., BIOL. PHARM. BULL, vol. 33, no. 2, 2010, pages 330 |
| LI ET AL., BRAIN RES., vol. 1497, February 2013 (2013-02-01), pages 32 - 39 |
| LI ET AL.: "Development and evaluation of optimized sucrose ester stabilized oleanolic acid nanosuspensions prepared by wet ball milling with design of experiments", BIOL. PHARM. BULL., vol. 37, no. 6, 2014, pages 926 - 937, XP055503198, DOI: 10.1248/bpb.b13-00864 |
| LI ET AL.: "Formulation, biological and pharmacokinetic studies of sucrose ester-stabilized nanosuspensions of oleanolic acid", PHARM. RES., vol. 28, no. 8, August 2011 (2011-08-01), pages 2020 - 2033, XP019921760, DOI: 10.1007/s11095-011-0428-3 |
| LI LITAO ET AL., BRAIN RESEARCH, vol. 1497, 2013, pages 32 - 39 |
| MESTRE T. ET AL., CHOCHRANE DATABASE SYSTEMATIC REVIEWS, vol. 8, no. 3, 8 July 2009 (2009-07-08), pages CD006455 |
| METHOD B., COMBINATION THERAPY: NEUROPROTECTIVE COMPOSITION AND ANOTHER THERAPEUTIC AGENT |
| MISHRA ET AL., PLOS ONE 2016 25, vol. 11, no. 7, 25 July 2016 (2016-07-25), pages e0159430 |
| PI ET AL.: "Ursolic acid nanocrystals for dissolution rate and bioavailability enhancement: influence of different particle size", CURR. DRUG DELIV., vol. 13, no. 8, March 2016 (2016-03-01), pages 1358 - 1366 |
| PLANCHARD MATTHEWS S. ET AL., ACS CHEMICAL NEUROSCIENCE, 2012 |
| QIAN ET AL., EUR. J. PHARMACOL., vol. 670, no. 1, 2011, pages 148 - 153 |
| RONG ET AL., PHARM. BIOL., vol. 49, no. 1, January 2011 (2011-01-01), pages 78 - 85 |
| RONG ZHI-TAO ET AL., PHARMACEUTICAL BIOLOGY, 2011 |
| ROON-MOM, W. M. ET AL.: "Mutant huntingtin activates Nrf2-responsive genes and impairs dopamine synthesis in a PC 12 model of Huntington's disease", BMC MOLECULAR BIOLOGY, vol. 9, 2008, pages 1 - 13 |
| RUI ET AL., INT. J. MOL. SCI., vol. 13, 2012, pages 7648 - 7662 |
| SCHROEDER FGOETZ IEROBERTS E: "Membrane anomalies in Huntington's disease fibroblasts", J. NEUROCHEM., vol. 43, 1984, pages 526 - 539 |
| See also references of EP3681477A4 |
| SILVA, MOLECULES, vol. 17, 2012, pages 12197 |
| SO ET AL., ARCH. PHARM. RES., vol. 32, no. 6, June 2009 (2009-06-01), pages 923 - 932 |
| STACK ET AL.: "Triterpenoids CDDO-Ethyl Amide and CDDO-Trifluoroethyl Amide improve the Behavioral Phenotype and Brain Pathology in a Transgenic Mouse Model of Huntington's Disease", FREE RADIC BIOL MED., vol. 49, no. 2, 15 July 2010 (2010-07-15), pages 147 - 158, XP027079106, DOI: doi:10.1016/j.freeradbiomed.2010.03.017 * |
| TONG: "Spray freeze drying with polyvinylpyrrolidone and sodium caprate for improved dissolution and oral bioavailablity of oleanolic acid, a BCS Class IV compound", INT. J. PHARM., vol. 404, no. 1-2, February 2011 (2011-02-01), pages 148 - 158, XP027575240 |
| VAN KANEGAN ET AL., NATURE SCIENTIFIC REPORTS, vol. 6, May 2016 (2016-05-01), pages 25626 |
| WANG DONGWEI ET AL., BIOMEDICINE AND PHARMACOTHERAPY |
| WANG ET AL., MOLECULES, vol. 21, 2016, pages 139 |
| WU, MOLECULES, vol. 16, 2011, pages 1 - 15 |
| XI ET AL.: "Formulation development and bioavailability evaluation of a self-nanoemulsified drug delivery system of oleanolic acid", AAPS PHARMSCITECH, vol. 10, no. 1, 2009, pages 172 - 182, XP055127812, DOI: 10.1208/s12249-009-9190-9 |
| YANG ET AL.: "Physicochemical properties and oral bioavailability of ursolic acid nanoparticles using supercritical anti-solvent (SAS) process", FOOD CHEM., vol. 132, no. 1, May 2012 (2012-05-01), pages 319 - 325, XP028344727, DOI: 10.1016/j.foodchem.2011.10.083 |
| YANG ET AL.: "Self-microemulsifying drug delivery system for improved oral bioavailability of oleanolic acid: design and evaluation", INT. J. NANOMED., vol. 8, no. 1, 2013, pages 2917 - 2926 |
| YOO ET AL., MOLECULES, vol. 17, no. 3, May 2012 (2012-05-01), pages 3524 - 38 |
| ZHANG ET AL., NEUROSCIENCE LETTERS, vol. 579, 2014, pages 12 - 17 |
| ZHANG ET AL.: "Enhancement of oral bioavailability of triterpene through lipid nanospheres: preparation, characterization, and absorption evaluation", J. PHARM. SCI., vol. 103, no. 6, June 2014 (2014-06-01), pages 1711 - 1719 |
| ZHAO ET AL.: "Preparation and characterization of betulin nanoparticles for oral hypoglycemic drug by antisolvent precipitation", DRUG DELIV., vol. 21, no. 6, September 2014 (2014-09-01), pages 467 - 479 |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10596186B2 (en) | 2016-09-14 | 2020-03-24 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infections |
| US10702567B2 (en) | 2016-09-14 | 2020-07-07 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US10729735B1 (en) | 2016-09-14 | 2020-08-04 | Phoenix Biotechnology, Inc. | Method and compostitions for treating coronavirus infection |
| US10874704B2 (en) | 2016-09-14 | 2020-12-29 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US10980852B2 (en) | 2016-09-14 | 2021-04-20 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US11007239B2 (en) | 2016-09-14 | 2021-05-18 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US11013776B2 (en) | 2016-09-14 | 2021-05-25 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US11123387B2 (en) | 2016-09-14 | 2021-09-21 | Phoenix Biotechnology, Inc. | Method and compositions for treating viral infection |
| US11324789B2 (en) | 2016-09-14 | 2022-05-10 | Phoenix Biotechnology, Inc. | Method and compositions for treating equine encephalitis |
| US11806359B2 (en) | 2020-03-31 | 2023-11-07 | Phoenix Biotechnology, Inc. | Method and compositions for treating Coronavirus infection |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3075023A1 (en) | 2019-03-21 |
| EP3681477A1 (en) | 2020-07-22 |
| RU2020113349A3 (https=) | 2021-10-14 |
| RU2758376C2 (ru) | 2021-10-28 |
| CN111417384A (zh) | 2020-07-14 |
| US20190076381A1 (en) | 2019-03-14 |
| EP3681477A4 (en) | 2021-06-09 |
| WO2019055245A9 (en) | 2019-09-26 |
| WO2020050865A1 (en) | 2020-03-12 |
| AU2018334467B2 (en) | 2022-10-20 |
| US10973785B2 (en) | 2021-04-13 |
| RU2020113349A (ru) | 2021-10-14 |
| US10722482B2 (en) | 2020-07-28 |
| IL273161A (en) | 2020-04-30 |
| AU2018334467A1 (en) | 2020-04-16 |
| US20210008017A1 (en) | 2021-01-14 |
| JP7370966B2 (ja) | 2023-10-30 |
| KR20200083969A (ko) | 2020-07-09 |
| JP2020534299A (ja) | 2020-11-26 |
| MX2020002884A (es) | 2020-10-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10973785B2 (en) | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders | |
| EP3512524B1 (en) | Method and compositions for treating viral infection | |
| US10383886B2 (en) | Method of treating neurological conditions with oleandrin | |
| US10596186B2 (en) | Method and compositions for treating viral infections | |
| US11324789B2 (en) | Method and compositions for treating equine encephalitis | |
| WO2019055119A1 (en) | METHOD AND COMPOSITION FOR TREATING VIRAL INFECTION | |
| US11331291B2 (en) | Method of and improved composition for treating triterpene-responsive conditions, diseases or disorders | |
| US20220047616A1 (en) | Method and Compositions for Treating HTLV-1 Virus Infection | |
| HK40034649A (en) | Method and improved neuroprotective composition for treating neurological conditions | |
| HK40012419B (en) | Method and compositions for treating viral infection | |
| HK40012419A (en) | Method and compositions for treating viral infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18855856 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 3075023 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020515978 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018334467 Country of ref document: AU Date of ref document: 20180904 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018855856 Country of ref document: EP Effective date: 20200414 |