WO2019051255A1 - CLOSED-ENDED DNA (CEDNA) MODIFIED - Google Patents
CLOSED-ENDED DNA (CEDNA) MODIFIED Download PDFInfo
- Publication number
- WO2019051255A1 WO2019051255A1 PCT/US2018/049996 US2018049996W WO2019051255A1 WO 2019051255 A1 WO2019051255 A1 WO 2019051255A1 US 2018049996 W US2018049996 W US 2018049996W WO 2019051255 A1 WO2019051255 A1 WO 2019051255A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- itr
- cedna
- cedna vector
- seq
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
- C12N2710/14141—Use of virus, viral particle or viral elements as a vector
- C12N2710/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/60—Vectors comprising a special translation-regulating system from viruses
Definitions
- the present invention relates to the field of gene therapy, including the delivery of exogenous DNA sequences to a target cell, tissue, organ or organism.
- Gene therapy aims to improve clinical outcomes for patients suffering from either genetic mutations or acquired diseases caused by an aberration in the gene expression profile.
- Gene therapy includes the treatment or prevention of medical conditions resulting from defective genes or abnormal regulation or expression, e.g. underexpression or overexpression, that can result in a disorder, disease, malignancy, etc.
- a disease or disorder caused by a defective gene might be treated, prevented or ameliorated by delivery of a corrective genetic material to a patient resulting in the therapeutic expression of the genetic material within the patient.
- the basis of gene therapy is to supply a transcription cassette with an active gene product (sometimes referred to as a transgene), e.g., that can result in a positive gain-of-function effect, a negative loss-of-function effect, or another outcome, such as, e.g., an oncolytic effect.
- Gene therapy can also be used to treat a disease or malignancy caused by other factors.
- Human monogenic disorders can be treated by the delivery and expression of a normal gene to the target cells. Delivery and expression of a corrective gene in the patient's target cells can be carried out via numerous methods, including the use of engineered viruses and viral gene delivery vectors.
- recombinant adeno- associated virus rAAV
- rAAV recombinant adeno- associated virus
- Adeno-associated viruses belong to the parvoviridae family and more specifically constitute the dependoparvovirus genus.
- the AAV genome is composed of a linear single-stranded DNA molecule which contains approximately 4.7 kilobases (kb) and consists of two major open reading frames (ORFs) encoding the non-structural Rep (replication) and structural Cap (capsid) proteins.
- ORFs major open reading frames
- a second ORF within the cap gene was identified that encodes the assembly-activating protein (AAP).
- the DNAs flanking the AAV coding regions are two cis-acting inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can be folded into energetically-stable hairpin structures that function as primers of DNA replication.
- ITR sequences In addition to their role in DNA replication, the ITR sequences have been shown to be involved in viral DNA integration into the cellular genome, rescue from the host genome or plasmid, and encapsidation of viral nucleic acid into mature virions (Muzyczka, (1992) Curr. Top. Micro. Immunol. 158:97-129).
- Vectors derived from AAV are attractive for delivering genetic material because (i) they are able to infect (transduce) a wide variety of non- dividing and dividing cell types including myocytes and neurons; (ii) they are devoid of the virus structural genes, thereby diminishing the host cell responses to virus infection, e.g.
- wild-type viruses are considered non-pathologic in humans;
- replication-deficient AAV vectors lack the rep gene and generally persist as episomes, thus limiting the risk of insertional mutagenesis or genotoxicity; and
- AAV vectors are generally considered to be relatively poor immunogens and therefore do not trigger a significant immune response (see ii), thus gaining persistence of the vector DNA and potentially, long-term expression of the therapeutic transgenes.
- AAV vectors can also be produced and formulated at high titer and delivered via intra-arterial, intra- venous, or intra-peritoneal injections allowing vector distribution and gene transfer to significant muscle regions through a single injection in rodents (Goyenvalle et al., 2004; Fougerousse et al., 2007; Koppanati et al., 2010; Wang et al., 2009) and dogs.
- rodents Goyenvalle et al., 2004; Fougerousse et al., 2007; Koppanati et al., 2010; Wang et al., 2009
- AAV vectors were delivered systemically with the intention of targeting the brain resulting in apparent clinical improvements.
- AAV particles as a gene delivery vector.
- One major drawback associated with rAAV is its limited viral packaging capacity of about 4.5 kb of heterologous DNA (Dong et al., 1996; Athanasopoulos et al, 2004; Lai et al, 2010).
- use of AAV vectors has been limited to less than 150,000 Da protein coding capacity.
- the second drawback is that as a result of the prevalence of wild-type AAV infection in the population, candidates for rAAV gene therapy have to be screened for the presence of neutralizing antibodies that eliminate the vector from the patient.
- a third drawback is related to the capsid immunogenicity that prevents re-administration to patients that were not excluded from an initial treatment.
- the immune system in the patient can respond to the vector which effectively acts as a "booster" shot to stimulate the immune system generating high titer anti-AAV antibodies that preclude future treatments.
- Some recent reports indicate concerns with immunogenicity in high dose situations.
- Another notable drawback is that the onset of AAV-mediated gene expression is relatively slow, given that single- stranded AAV DNA must be converted to double -stranded DNA prior to heterologous gene expression.
- AAV virions with capsids are produced by introducing a plasmid or plasmids containing the AAV genome, rep genes, and cap genes (Grimm et al., 1998). Upon introduction of these helper plasmids in trans, the AAV genome is "rescued” (i.e. , released and subsequently amplified) from the host genome, and is further encapsidated (viral capsids) to produce biologically active AAV vectors.
- viral capsids viral capsids
- AAV adeno-associated virus
- use of adeno-associated virus (AAV) vectors for gene therapy is limited due to the single administration to patients (owing to the patient immune response), the limited range of transgene genetic material suitable for delivery in AAV vectors due to minimal viral packaging capacity (about 4.5kb) of the associated AAV capsid, as well as the slow AAV-mediated gene expression.
- the applications for rAAV clinical gene therapies are further encumbered by patient-to- patient variability not predicted by dose response in syngeneic mouse models or in other model species.
- Recombinant capsid-free AAV vectors can be obtained as an isolated linear nucleic acid molecule comprising an expressible transgene and promoter regions flanked by two wild-type AAV inverted terminal repeat sequences (ITRs) including the Rep binding and terminal resolution sites.
- ITRs inverted terminal repeat sequences
- These recombinant AAV vectors are devoid of AAV capsid protein encoding sequences, and can be single -stranded, double -stranded or duplex with one or both ends covalently linked through the two wild-type ITR palindrome sequences (e.g., WO2012/123430, U.S. Patent 9,598,703).
- the invention described herein is a non-viral capsid-free DNA vector with covalently- closed ends (referred to herein as a "closed-ended DNA vector” or a "ceDNA vector”).
- the ceDNA vectors described herein are capsid-free, linear duplex DNA molecules formed from a continuous strand of complementary DNA with covalently-closed ends (linear, continuous and non-encapsidated structure), which comprise a 5' inverted terminal repeat (ITR) sequence and a 3' ITR sequence that are different, or asymmetrical with respect to each other.
- ITR inverted terminal repeat
- the technology described herein relates to a ceDNA vector containing at least one modified AAV inverted terminal repeat sequence (ITR) and an expressible transgene.
- ITR inverted terminal repeat sequence
- the ceDNA vectors disclosed herein can be produced in eukaryotic cells, thus devoid of prokaryotic DNA modifications and bacterial endotoxin contamination in insect cells.
- non-viral capsid-free DNA vectors with covalently-closed ends are preferably linear duplex molecules, and are obtainable from a vector polynucleotide that encodes a heterologous nucleic acid operatively positioned between two different inverted terminal repeat sequences (ITRs) (e.g. AAV ITRs), wherein at least one of the ITRs comprises a terminal resolution site and a replication protein binding site (RPS) (sometimes referred to as a replicative protein binding site), e.g. a Rep binding site, and one of the ITRs comprises a deletion, insertion, or substitution with respect to the other ITR. That is, one of the ITRs is asymmetrical relative to the other ITR.
- ITRs inverted terminal repeat sequences
- RPS replication protein binding site
- Rep binding site e.g. a Rep binding site
- At least one of the ITRs is an AAV ITR, e.g. a wild type AAV ITR or modified AAV ITR. In one embodiment, at least one of the ITRs is a modified ITR relative to the other ITR - that is, the ceDNA comprises ITRs that are asymmetric relative to each other. In one embodiment, at least one of the ITRs is a non-functional ITR.
- the ceDNA vector comprises: (1) an expression cassette comprising a cis-regulatory element, a promoter and at least one transgene; or (2) a promoter operably linked to at least one transgene, and (3) two self-complementary sequences, e.g., ITRs, flanking said expression cassette, wherein the ceDNA vector is not associated with a capsid protein.
- the ceDNA vector comprises two self-complementary sequences found in an AAV genome, where at least one comprises an operative Rep-binding element (RBE) (also sometimes referred to herein as “RBS”) and a terminal resolution site (trs) of AAV or a functional variant of the RBE, and one or more cis-regulatory elements operatively linked to a transgene.
- RBE Rep-binding element
- trs terminal resolution site of AAV or a functional variant of the RBE
- the ceDNA vector comprises additional components to regulate expression of the transgene, for example, regulatory switches, which are described herein in the section entitled "Regulatory Switches" for controlling and regulating the expression of the transgene, and can include a regulatory switch, e.g., a kill switch to enable controlled cell death of a cell comprising a ceDNA vector.
- the two self-complementary sequences can be ITR sequences from any known parvovirus, for example a dependovirus such as AAV (e.g., AAV 1 -AAV 12).
- AAV e.g., AAV 1 -AAV 12
- Any AAV serotype can be used, including but not limited to a modifed AAV2 ITR sequence, that retains a Rep- binding site (RBS) such as 5 -GCGCGCTCGCTCGCTC-3 ' (SEQ ID NO: 531) and a terminal resolution site (trs) in addition to a variable palindromic sequence allowing for hairpin secondary structure formation.
- RBS Rep- binding site
- trs terminal resolution site
- the ITR is a synthetic ITR sequence that retains a functional Rep-binding site (RBS) such as 5 '-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531) and a terminal resolution site (TRS) in addition to a variable palindromic sequence allowing for hairpin secondary structure formation.
- RBS functional Rep-binding site
- TRS terminal resolution site
- a modified ITR sequence retains the sequence of the RBS, trs and the structure and position of a Rep binding element forming the terminal loop portion of one of the ITR hairpin secondary structure from the corresponding sequence of the wild-type AAV2 ITR.
- Exemplary ITR sequences for use in the ceDNA vectors are disclosed in any one or more of Tables 2-10A and 10B, or SEQ ID NO: 2, 52, 101-499 and 545-547 or the partial ITR sequences shown in FIG. 26A-26B.
- the ceDNA vectors do not have an ITR that comprises any sequence selected from SEQ ID NOs: 500-529.
- a ceDNA vector can comprise an ITR with a modification in the ITR corresponding to any of the modifications in ITR sequences or ITR partial sequences shown in any one or more of Tables 2, 3, 4, 5, 6, 7, 8, 9, 10A and 10B herein.
- the present disclosure provides a closed-ended DNA vector comprising a promoter operably linked to a transgene, where the ceDNA is devoid of capsid proteins and is: (a) produced from a ceDNA-plasmid (e.g., see Examples 1-2 and/or FIGS.
- the technology described herein further relates to a ceDNA vector that can deliver and encode one or more transgenes in a target cell, for example, where the ceDNA vector comprises a multicistronic sequence, or where the transgene and its native genomic context (e.g., transgene, introns and endogenous untranslated regions) are together incorporated into the ceDNA vector.
- the transgenes can be protein encoding transcripts, non-coding transcripts, or both.
- the ceDNA vector can comprise multiple coding sequences, and a non-canonical translation initiation site or more than one promoter to express protein encoding transcripts, non-coding transcripts, or both.
- the transgene can comprise a sequence encoding more than one proteins, or can be a sequence of a non-coding transcript.
- the expression cassette can comprise, e.g., more than 4000 nucleotides, 5000 nucleotides, 10,000 nucleotides or 20,000 nucleotides, or 30,000 nucleotides, or 40,000 nucleotides or 50,000 nucleotides, or any range between about 4000-10,000 nucleotides or 10,000-50,000 nucleotides, or more than 50,000 nucleotides.
- the ceDNA vectors do not have the size limitations of encapsidated AAV vectors, thus enable delivery of a large-size expression cassette to provide efficient expression of transgenes.
- the ceDNA vector is devoid of prokaryote-specific methylation.
- the expression cassette can also comprise an internal ribosome entry site (IRES) and/or a 2A element.
- the cis-regulatory elements include, but are not limited to, a promoter, a riboswitch, an insulator, a mir-regulatable element, a post-transcriptional regulatory element, a tissue- and cell type- specific promoter and an enhancer.
- the ITR can act as the promoter for the transgene.
- the ceDNA vector comprises additional components to regulate expression of the transgene.
- the additional regulatory component can be a regulator switch as disclosed herein, including but not limited to a kill switch, which can kill the ceDNA infected cell, if necessary, and other inducible and/or repressible elements.
- the technology described herein further provides novel methods of delivering and efficiently and selectively expressing one or more transgenes using the ceDNA vectors.
- a ceDNA vector has the capacity to be taken up into host cells, as well as to be transported into the nucleus in the absence of the AAV capsid.
- the ceDNA vectors described herein lack a capsid and thus avoid the immune response that can arise in response to capsid-containing vectors.
- the capsid free non-viral DNA vector is obtained from a plasmid (referred to herein as a "ceDNA-plasmid") comprising a polynucleotide expression construct template comprising in this order: a first 5' inverted terminal repeat (e.g. AAV ITR); an expression cassette; and a 3' ITR (e.g. AAV ITR), where at least one of the 5' and 3' ITR is a modified ITR, or where when both the 5 ' and 3 ' ITRs are modified, they have different modifications from one another and are not the same sequence.
- a plasmid referred to herein as a "ceDNA-plasmid”
- a polynucleotide expression construct template comprising in this order: a first 5' inverted terminal repeat (e.g. AAV ITR); an expression cassette; and a 3' ITR (e.g. AAV ITR), where at least one of the 5' and 3' ITR is a modified ITR, or where
- ceDNA vector disclosed herein is obtainable by a number of means that would be known to the ordinarily skilled artisan after reading this disclosure.
- a polynucleotide expression construct template used for generating the ceDNA vectors of the present invention can be a ceDNA-plasmid (e.g. see Table 12 or FIG. 10B), a ceDNA-bacmid, and/or a ceDNA-baculovirus.
- the ceDNA-plasmid comprises a restriction cloning site (e.g.
- ceDNA vectors are produced from a polynucleotide template (e.g., ceDNA- plasmid, ceDNA-bacmid, ceDNA-baculovirus) containing an ITR modified as compared to the corresponding flanking AAV3 ITR or wild-type AAV2 ITR sequence, where the modification is any one or more of deletion, insertion, and/or substitution.
- a polynucleotide template e.g., ceDNA- plasmid, ceDNA-bacmid, ceDNA-baculovirus
- the polynucleotide template having at least one modified ITR replicates to produce ceDNA vectors.
- ceDNA vector production undergoes two steps: first, excision ("rescue") of template from the template backbone (e.g. ceDNA-plasmid, ceDNA-bacmid, ceDNA-baculovirus genome etc.) via Rep proteins, and second, Rep mediated replication of the excised ceDNA vector.
- Rep proteins and Rep binding sites of the various AAV serotypes are well known to those of ordinary skill in the art.
- One of ordinary skill understands to choose a Rep protein from a serotype that binds to and replicates the nucleic acid sequence based upon at least one functional ITR.
- the covalently-closed ended ceDNA vector continues to accumulate in permissive cells and ceDNA vector is preferably sufficiently stable over time in the presence of Rep protein under standard replication conditions, e.g. to accumulate in an amount that is at least 1 pg/cell, preferably at least 2 pg/cell, preferably at least 3 pg/cell, more preferably at least 4 pg/cell, even more preferably at least 5 pg/cell.
- one aspect of the invention relates to a process comprising the steps of: a) incubating a population of host cells (e.g. insect cells) harboring the polynucleotide expression construct template (e.g., a ceDNA-plasmid, a ceDNA-bacmid, and/or a ceDNA-baculovirus), which is devoid of viral capsid coding sequences, in the presence of a Rep protein under conditions effective and for a time sufficient to induce production of the ceDNA vector within the host cells, and wherein the host cells do not comprise viral capsid coding sequences; and b) harvesting and isolating the ceDNA vector from the host cells.
- host cells e.g. insect cells
- the polynucleotide expression construct template e.g., a ceDNA-plasmid, a ceDNA-bacmid, and/or a ceDNA-baculovirus
- Rep protein induces replication of the vector polynucleotide with a modified ITR to produce the ceDNA vector in a host cell.
- no viral particles e.g. AAV virions
- the presence of the ceDNA vector isolated from the host cells can be confirmed by digesting DNA isolated from the host cell with a restriction enzyme having a single recognition site on the ceDNA vector and analyzing the digested DNA material on denaturing and non-denaturing gels to confirm the presence of characteristic bands of linear and continuous DNA as compared to linear and non-continuous DNA.
- the present application may be defined in any of the following paragraphs:
- ceDNA vector A non-viral capsid-free DNA vector with covalently -closed ends
- the ceDNA vector comprises at least one heterologous nucleotide sequence operably positioned between asymmetric inverted terminal repeat sequences (asymmetric ITRs), wherein at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep binding site.
- asymmetric ITRs asymmetric inverted terminal repeat sequences
- restriction enzyme having a single recognition site on the ceDNA vector and analyzed by both native and denaturing gel electrophoresis displays characteristic bands of linear and continuous DNA as compared to linear and non-continuous DNA controls.
- sequences are from a virus selected from a parvovirus, a dependovirus, and an adeno- associated virus (AAV).
- AAV adeno- associated virus
- ceDNA vector of paragraph 4 wherein the one or more asymmetric ITRs are from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, and AAV 12.
- ITRs is modified by a deletion, insertion, and/or substitution in at least one of the ITR regions selected from A, A', B, B', C, C, D, and D' .
- one or both of the asymmetric ITRs can have a deletion, insertion, and/or substitution in any combination of B,
- one or both of the asymmetric ITRs can have a deletion, insertion, and/or substitution in the B region, and/or B' region, and/or C region, and/or C region. In some embodiments, one or both of the asymmetric ITRs can have one or more deletions, insertions, and/or substitutions in the A region and/or A' region, and/or B region, and/or B' region, and/or C region, and/or C region, and/or D region and/or D' region.
- a modified ITR can have the removal or deletion of all of a particular arm, e.g., all or part of the A-A' arm, or all or part of the B-B' arm or all or part of the C-C arm, or alternatively, the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs forming the stem of the loop so long as the final loop capping the stem (e.g., single arm) is still present (e.g., see ITR-6).
- a modified ITR can comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B-B' arm.
- a modified ITR can comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C-C arm. In some embodiments, a modified ITR can comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C-C arm and the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B-B' arm. Any combination of removal of base pairs is envisioned. In some embodiments, a modified ITR lacks a B-B' arm. In some embodiments, a modified ITR lacks the C-C arm.
- the ceDNA vector of paragraph 8 wherein the deletion, insertion, and/or substitution results in the deletion of all or part of a stem-loop structure normally formed by the A, A', B, B' C, or C regions.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each of the C portion and the C portion of the C-C arm such that the C-C arm is truncated
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each of the B portion and the B' portion of the B-B' arm, such that the C-C arm and/or B'-B arm is truncated.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each of the B portion and the B' portion of the B-B' arm, such that the C-C arm and/or B'-B arm is truncated.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C portion of the C-C arm such that only C portion of the arm remains.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C portion of the C-C arm such that only C portion of the arm remains.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the B portion of the B-B' arm such that only B' portion of the arm remains.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the B' portion of the B-B' arm such that only B portion of the arm remains.
- any deletion in the C region, C region, B region or B' region still preserves the terminal loop of the stem -loop.
- the terminal loop is at least three amino acids.
- the terminal loop of a C-C arm, and/or B-B' arm has at least three sequential TTTs or three sequential AAAs.
- ceDNA vector of paragraph 8 or paragraph 9 wherein one or both of the asymmetric ITRs is modified by a deletion, insertion, and/or substitution that results in the deletion of all or part of a stem-loop structure normally formed by the B and B' regions.
- the ceDNA vector of paragraph 13 wherein one or both of the asymmetric ITRs comprises a single stem and two loops in the region that normally comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C regions.
- the ceDNA vector of paragraph 13 or paragraph 14 wherein one or both of the asymmetric ITRs comprises a single stem and a single loop in the region that normally comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C regions.
- the 3' ITR comprises a sequence selected from SEQ ID NO: 2, 64, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128,130, 132, 134, 469-483 and 546, and ITR sequences shown in FIG. 26A, and sequences having at least 95% sequence identity to any of the foregoing sequences.
- the ceDNA vector of paragraph 1 comprising at least two asymmetric ITRs selected from: (a) SEQ ID NO: 1 and SEQ ID NO:52; and (b) SEQ ID NO: 2 and SEQ ID NO: 51.
- the ceDNA vector of paragraph 1 comprising a pair of asymmetric ITRs selected from: (a) SEQ ID NO: 1 and SEQ ID NO:52; and (b) SEQ ID NO:2 and SEQ ID NO:51.
- a regulatory switch serves to fine tune expression of the heterologous nucleotide sequence, for example, a transgene, and can serve, in some embodiments as a biocontainment function of the ceDNA vector.
- a regulatory switch is an "ON/OFF" switch.
- an “ON/OFF” switch is designed to start or stop (i.e., shut down) expression of the heterologous nucleotide sequence or transgene expressed from the the ceDNA vector in a controllable and regulatable fashion.
- the regulatory switch is a "kill switch” that can instruct the cell comprising the ceDNA vector to undergo cell programmed death once the switch is activated.
- the regulatory switch is selected from any of: a binary switch (e.g., inducible promoters, co-factors or exogenous agents de- repress transcription), a small molecule regulatory switch (e.g., drug -induced or pro-drugs activate or stop transcription), a "passcode” regulatory switch (e.g., a combination of conditions need to be present for transgene expression and/or repression to occur), a nucleic- acid based regulatory switch (e.g., a nucleic-acid based mechanism to control expression and/or repression), a post-translation and/or post-transcriptional regulatory switch (e.g., transgenes expressed with sihnal response elements (SRE )or destabilizing domains (DD) preventing functional transgenes until post-translation modification has occurred) or a
- a binary switch
- ceDNA vector of any one of paragraphs 1-25, wherein the vector is in a nanocarrier.
- LNP lipid nanoparticle
- ceDNA vector of paragraph 28, wherein the ceDNA expression construct is selected from a ceDNA plasmid, a ceDNA bacmid, and a ceDNA baculovirus.
- AAV adeno-associated virus
- the ceDNA vector of paragraph 31 wherein at least one Rep protein is from an AAV serotype selected from AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, and AAV12.
- the ceDNA expression construct of paragraph 33 which is a ceDNA plasmid, ceDNA bacmid, or ceDNA baculovirus.
- a host cell comprising the ceDNA expression construct of paragraph 33 or paragraph 34.
- the host cell of paragraph 35 which expresses at least one Rep protein.
- the host cell of paragraph 36 wherein at least one Rep protein is from a virus selected from a parvovirus, a dependovirus, and an adeno-associated virus (AAV).
- the host cell of paragraph 37, wherein at least one Rep protein is from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl l, and AAV12.
- the host cell of any one of paragraphs 35 to 38 which is an insect cell.
- the host cell of paragraph 39 which is an Sf9 cell.
- a method of producing a ceDNA vector comprising: (a) incubating the host cell of any one of paragraphs 35-40 under conditions effective and for time sufficient to induce production of the ceDNA vector; and (b) isolating the ceDNA from the host cells.
- a method for treating, preventing, ameliorating, monitoring, or diagnosing a disease or disorder in a subject comprising: administering to a subject in need thereof, a composition comprising the ceDNA vector of any one of paragraphs 1-25, wherein the at least one heterologous nucleotide sequence is selected to treat, prevent, ameliorate, diagnose, or monitor the disease or disorder.
- the at least one heterologous nucleotide sequence encodes or comprises an nucleotide molecule selected from an RNAi, an siRNA, an miRNA, an IncRNA, and an antisense oligo- or polynucleotide.
- the at least one heterologous nucleotide sequence encodes a marker protein (e.g., a reporter protein).
- the at least one heterologous nucleotide sequence encodes an antibody.
- the disease or disorder is selected from: a metabolic disease or disorder, a CNS disease or disorder, an ocular disease or disorder, a blood disease or disorder, a liver disease or disorder, an immune disease or disorder, an infectious disease, a muscular disease or disorder, cancer, and a disease or disorder based on an abnormal level and/or function of a gene product.
- the metabolic disease or disorder is selected from diabetes, a lysosomal storage disorder, a mucopolysaccharide disorder, a urea cycle disease or disorder, and a glycogen storage disease or disorder.
- the lysosomal storage disorder is selected from
- Gaucher' s disease Pompe disease, metachromatic leukodystrophy (MLD), phenylketonuria (PKU), and Fabry disease.
- MLD metachromatic leukodystrophy
- PKU phenylketonuria
- Fabry disease a chronic myelogenous leukemia
- the urea cycle disease or disorder is ornithine transcarbamylase (OTC) deficiency.
- OTC ornithine transcarbamylase
- mucopolysaccharide disorder is selected from Sly syndrome, Hurler Syndrome, Scheie Syndrome, Hurler-Scheie Syndrome, Hunter's
- the ocular disease or disorder is selected from ophthalmic disorders involving the retina, posterior tract, and/or optic nerve.
- the ophthalmic disorder involving the retina, posterior tract, and/or optic nerve are selected from diabetic retinopathy, macular degeneration including age-related macular degeneration, geographic atrophy and vascular or "wet" macular degeneration, glaucoma, uveitis, retinitis pigmentosa, Stargardt, Leber Congenital Amaurosis (LCA), Usher syndrome, pseudoxanthoma elasticum (PXE), x-linked retinitis pigmentosa (XLRP), x-linked retinoschisis (XLRS), Choroideremia, Leber hereditary optic neuropathy (LHON), Archomatopsia, cone-rod dystrophy, Fuchs endothelial corneal dystrophy, diabetic macular edema and ocular cancer and tumors.
- the blood disease or disorder is selected from hemophilia A, hemophilia B, thalassemia, anemia, and
- liver disease or disorder is selected from progressive familial intrahepatic cholestasis (PFIC) and liver cancer and tumors.
- PFIC progressive familial intrahepatic cholestasis
- liver cancer and tumors liver cancer and tumors.
- the disease or disorder is cystic fibrosis.
- a method for delivering a therapeutic protein to a subject comprising administering to a subject a composition comprising the ceDNA vector of any of paragraphs 1-25, wherein at least one heterologous nucleotide sequence encodes a therapeutic protein.
- the therapeutic protein is selected from an enzyme, erythropoietin, angiostatin, endostatin, superoxide dismutase, globin, leptin, catalase, tyrosine hydroxylase, a cytokine, cystic fibrosis transmembrane conductance regulator (CFTR), a peptide growth factor, and a hormone.
- an enzyme erythropoietin, angiostatin, endostatin, superoxide dismutase, globin, leptin, catalase, tyrosine hydroxylase, a cytokine, cystic fibrosis transmembrane conductance regulator (CFTR), a peptide growth factor, and a hormone.
- a kit comprising a ceDNA vector of any of paragraphs 1-25, and a nanocarrier, packaged in a container with a packet insert.
- kits for producing a ceDNA vector comprising an expression construct comprising at least one restriction site for insertion of at least one heterologous nucleotide sequence, or regulatory switch, or both, the at least one restriction site operatively positioned between asymmetric inverted terminal repeat sequences (asymmetric ITRs), wherein at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep binding site.
- asymmetric ITRs asymmetric inverted terminal repeat sequences
- the kit of paragraph 66 which is suitable for producing the ceDNA vector of any one of paragraphs 1-25.
- kit of paragraph 66 or paragraph 67 further comprising a population of insect cells which is devoid of viral capsid coding sequences, that in the presence of Rep protein can induce production of the ceDNA vector.
- one aspect of the technology described herein relates to a non- viral capsid-free DNA vector with covalently-closed ends (ceDNA vector), wherein the ceDNA vector comprises at least one heterologous nucleotide sequence, operably positioned between asymmetric inverted terminal repeat sequences (asymmetric ITRs), wherein at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep binding site, and optionally the heterologous nucleic acid sequence encodes a transgene, and wherein the vector is not in a viral capsid.
- ceDNA vector non- viral capsid-free DNA vector with covalently-closed ends
- the ceDNA vector comprises at least one heterologous nucleotide sequence, operably positioned between asymmetric inverted terminal repeat sequences (asymmetric ITRs), wherein at least one of the asymmetric ITRs comprises a functional terminal resolution site and a Rep binding site, and optionally the heterologous nucleic acid sequence encodes a transgene, and wherein the
- FIG. 1A illustrates an exemplary structure of a ceDNA vector.
- the exemplary ceDNA vector comprises an expression cassette containing CAG promoter, WPRE, and BGHpA.
- An open reading frame (ORF) encoding a luciferase transgene is inserted into the cloning site (R3/R4) between the CAG promoter and WPRE.
- the expression cassette is flanked by two inverted terminal repeats (ITRs) - the wild-type AAV2 ITR on the upstream (5 '-end) and the modified ITR on the downstream (3 '-end) of the expression cassette, therefore the two ITRs flanking the expression cassette are asymmetric with respect to each other.
- ITRs inverted terminal repeats
- FIG. IB illustrates an exemplary structure of a ceDNA vector with an expression cassette containing CAG promoter, WPRE, and BGHpA.
- An open reading frame (ORF) encoding Luciferase transgene is inserted into the cloning site between CAG promoter and WPRE.
- the expression cassette is flanked by two inverted terminal repeats (ITRs) - a modified ITR on the upstream (5 '-end) and a wild-type ITR on the downstream (3 '-end) of the expression cassette.
- ITRs inverted terminal repeats
- FIG. 1C illustrates an exemplary structure of a ceDNA vector with an expression cassette containing an enhancer/promoter, an open reading frame (ORF) for insertion of a transgene, a post transcriptional element (WPRE), and a polyA signal.
- ORF open reading frame
- An open reading frame (ORF) allows insertion of a transgene into the cloning site between CAG promoter and WPRE.
- the expression cassette is flanked by two inverted terminal repeats (ITRs) that are asymmetrical with respect to each other; a modified ITR on the upstream (5 '-end) and a modified ITR on the downstream (3 '-end) of the expression cassette, where the 5 ' ITR and the 3 'ITR are both modified ITRs but have different modifications (i.e., they do not have the same modifiations).
- ITRs inverted terminal repeats
- FIG. 2A provides the T-shaped stem-loop structure of a wild-type left ITR of AAV2 (SEQ ID NO: 538) with identification of A-A' arm, B-B' arm, C-C arm, two Rep binding sites (RBE and RBE') and also shows the terminal resolution site (trs).
- the RBE contains a series of 4 duplex tetramers that are believed to interact with either Rep 78 or Rep 68.
- the RBE' is also believed to interact with Rep complex assembled on the wild-type ITR or mutated ITR in the construct.
- the D and D' regions contain transcription factor binding sites and other conserved structure.
- 2B shows proposed Rep-catalyzed nicking and ligating activities in a wild-type left ITR (SEQ ID NO: 539), including the T-shaped stem-loop structure of the wild-type left ITR of AAV2 with identification of A-A' arm, B-B' arm, C-C arm, two Rep Binding sites (RBE and RBE') and also shows the terminal resolution site (trs), and the D and D' region comprising several transcription factor binding sites and other conserved structure.
- FIG. 3A provides the primary structure (polynucleotide sequence) (left) and the secondary structure (right) of the RBE-containing portions of the A-A' arm, and the C-C and B-B' arm of the wild type left AAV2 ITR (SEQ ID NO: 540).
- FIG. 3B shows an exemplary mutated ITR (also referred to as a modified ITR) sequence for the left ITR. Shown is the primary structure (left) and the predicted secondary structure (right) of the RBE portion of the A-A' arm, the C arm and B-B' arm of an exemplary mutated left ITR (ITR-1, left) (SEQ ID NO: 1 13).
- FIG. 3C shows the primary structure (left) and the secondary structure (right) of the RBE-containing portion of the A-A' loop, and the B- B' and C-C arms of wild type right AAV2 ITR (SEQ ID NO: 541).
- FIG. 3D shows an exemplary right modified ITR. Shown is the primary structure (left) and the predicted secondary structure (right) of the RBE containing portion of the A-A' arm, the B-B' and the C arm of an exemplary mutant right ITR (ITR- 1, right) (SEQ ID NO: 1 14).
- Any combination of left and right ITR e.g., AAV2 ITRs or other viral serotype or synthetic ITRs
- left ITR is asymmetric or different from the right ITR.
- FIGS. 3A-3D polynucleotide sequences refer to the sequence used in the plasmid or bacmid/baculovirus genome used to produce the ceDNA as described herein. Also included in each of FIGS. 3A-3D are corresponding ceDNA secondary structures inferred from the ceDNA vector configurations in the plasmid or bacmid/baculovirus genome and the predicted Gibbs free energy values.
- FIG. 4A is a schematic illustrating an upstream process for making baculovirus infected insect cells (BIICs) that are useful in the production of ceDNA in the process described in the schematic in FIG. 4B.
- FIG. 4B is a schematic of an exemplary method of ceDNA production and
- FIG. 4C illustrates a biochemical method and process to confirm ceDNA vector production.
- FIG. 4D and FIG. 4E are schematic illustrations describing a process for identifying the presence of ceDNA in DNA harvested from cell pellets obtained during the ceDNA production processes in FIG. 4B.
- FIG. 4E shows DNA having a non-continuous structure.
- the ceDNA can be cut by a restriction endonuclease, having a single recognition site on the ceDNA vector, and generate two DNA fragments with different sizes ( lkb and 2kb) in both neutral and denaturing conditions.
- FIG. 4E also shows a ceDNA having a linear and continuous structure.
- the ceDNA vector can be cut by the restriction endonuclease, and generate two DNA fragments that migrate as lkb and 2kb in neutral conditions, but in denaturing conditions, the stands remain connected and produce single strands that migrate as 2kb and 4kb.
- 4D shows schematic expected bands for an exemplary ceDNA either left uncut or digested with a restriction endonuclease and then subjected to electrophoresis on either a native gel or a denaturing gel.
- the leftmost schematic is a native gel, and shows multiple bands suggesting that in its duplex and uncut form ceDNA exists in at least monomelic and dimeric states, visible as a faster-migrating smaller monomer and a slower-migrating dimer that is twice the size of the monomer.
- the schematic second from the left shows that when ceDNA is cut with a restriction endonuclease, the original bands are gone and faster-migrating (e.g., smaller) bands appear, corresponding to the expected fragment sizes remaining after the cleavage.
- the original duplex DNA is single-stranded and migrates as a species twice as large as observed on native gel because the complementary strands are covalently linked.
- the digested ceDNA shows a similar banding distribution to that observed on native gel, but the bands migrate as fragments twice the size of their native gel counterparts.
- the rightmost schematic shows that uncut ceDNA under denaturing conditions migrates as a single- stranded open circle, and thus the observed bands are twice the size of those observed under native conditions where the circle is not open.
- kb is used to indicate relative size of nucleotide molecules based, depending on context, on either nucleotide chain length (e.g., for the single stranded molecules observed in denaturing conditions) or number of basepairs (e.g., for the double -stranded molecules observed in native conditions).
- FIG. 5 is an exemplary picture of a denaturing gel running examples of ceDNA vectors with (+) or without (-) digestion with endonucleases (EcoRI for ceDNA construct 1 and 2; BamHl for ceDNA construct 3 and 4; Spel for ceDNA construct 5 and 6; and Xhol for ceDNA construct 7 and 8). Sizes of bands highlighted with an asterisk were determined and provided on the bottom of the picture.
- FIG. 6A shows results from an in vitro protein expression assay measuring Luciferase activity (y-axis, RQ (Luc)) in HEK293 cells 48 hours after transfection of 400 ng (black), 200 ng (gray), or 100 ng (white) of the constructs identified on the x-axis (construct- 1, construct-3, construct- 5, construct-7 (Table 12).
- FIG. 6B shows Luciferase activity (y-axis, RQ (Luc)) measured in HEK293 cells 48 hours after transfection of 400 ng (black), 200 ng (gray), or 100 ng (white) of the constructs identified on the x-axis (construct -2, construct -4, construct -6, construct-8) (Table 12). Luciferase activities measured in HEK293 cells treated with Fugene without any plasmids ("Fugene”), or in untreated HEK293 cells (“Untreated”) are also provided.
- Fugene Fugene without any plasmids
- FIG. 7A shows viability of HEK293 cells (y-axis) 48 hours after transfection of 400 ng (black), 200 ng (gray), or 100 ng (white) of the constructs identified on the x-axis (construct- 1, construct-3, construct-5, construct-7).
- FIG. 7B shows viability of HEK293 cells (y-axis) 48 hours after transfection of 400 ng (black), 200 ng (gray), or 100 ng (white) of the constructs identified on the x-axis (construct-2, construct-4, construct-6, construct-8).
- FIG. 8A is an exemplary Rep-bacmid in the pFBDLSR plasmid comprising the nucleic acid sequences for Rep proteins Rep52 and Rep78.
- This exemplary Rep-bacmid comprises: IE1 promoter fragment (SEQ ID NO:66); Rep78 nucleotide sequence, including Kozak sequence (SEQ ID NO:67), polyhedron promoter sequence for Rep52 (SEQ ID NO:68) and Rep58 nucleotide sequence, starting with Kozak sequence gccgccacc) (SEQ ID NO:69).
- FIG. 8B is a schematic of an exemplary ceDNA- plasmid-1, with the wt-L ITR, CAG promoter, luciferase transgene, WPRE and polyadenylation sequence, and mod-R ITR.
- FIG. 9A shows the predicted lowest energy structure of the RBE containing portion of the A- A' arm and the C-C arm of an exemplary modified left ITR ("ITR-2 (Left)" SEQ ID NO: 101) and FIG. 9B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm of an exemplary a modified right ITR ("ITR-2 (Right)" SEQ ID NO: 102). They are predicted to form a structure with a single arm (C-C) and a single unpaired loop. Their Gibbs free energies of unfolding are predicted to be -72.6 kcal/mol.
- FIG. 10A shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the B-B' arm of an exemplary modified left ITR ("ITR-3 (Left)" SEQ ID NO: 103) and FIG. 10B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the B-B' arm of an exemplary modified right ITR ("ITR-3 (Right)" SEQ ID NO: 104).
- ITR-3 (Left) SEQ ID NO: 103
- FIG. 10B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the B-B' arm of an exemplary modified right ITR ("ITR-3 (Right)" SEQ ID NO: 104).
- ITR-3 (Left) modified left ITR
- FIG. 10B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the B-B' arm of an exemplary modified right ITR ("ITR-3 (Right)" SEQ
- FIG. 11A shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the C-C arm of an exemplary modified left ITR ("ITR-4 (Left)" SEQ ID NO: 105) and FIG. 11B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm of an exemplary modified right ITR ("ITR-4 (Right)" SEQ ID NO: 106).
- ITR-4 (Left) SEQ ID NO: 105
- FIG. 11B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm of an exemplary modified right ITR ("ITR-4 (Right)" SEQ ID NO: 106).
- ITR-4 (Left) modified left ITR
- FIG. 11B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm of an exemplary modified right ITR ("ITR-4 (Right)" SEQ ID NO:
- FIG. 12A shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the C-C and B-B' portions of an exemplary modified left ITR, showing
- FIG. 12B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the B-B' and C-C portions of an exemplary modified right ITR, showing complementary base pairing of the B-C and B'-C portions ("ITR-10 (Right)" SEQ ID NO: 108).
- They are predicted to form a structure with a single arm (a portion of C'-B and C-B' or a portion of B'-C and B-C) and a single unpaired loop.
- Their Gibbs free energies of unfolding are predicted to be -83.7 kcal/mol.
- FIG. 13A shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the C-C and B-B' portions of an exemplary modified left ITR ("ITR-17 (Left)" SEQ ID NO: 109) and FIG. 13B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the C-C and B-B' portions of an exemplary modified right ITR ("ITR- 17 (Right)" SEQ ID NO: 110).
- Both ITR-17 (left) and ITR-17 (right) are predicted to form a structure with a single arm ( ⁇ - ⁇ ') and a single unpaired loop. Their Gibbs free energies of unfolding are predicted to be -73.3 kcal/mol.
- FIG. 14A shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm of an exemplary modified ITR ("ITR-6 (Left)" SEQ ID NO: 111) and FIG. 14B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm of an exemplary modified ITR ("ITR-6 (Right)" SEQ ID NO: 112).
- ITR-6 (left) and ITR-6 (right) are predicted to form a structure with a single arm. Their Gibbs free energies of unfolding are predicted to be -54.4 kcal/mol.
- FIG. 15A shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the C arm and B-B' arm of an exemplary a modified left ITR ("ITR-1 (Left)" SEQ ID NO: 113) and FIG. 15B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C arm and B-B' arm of an exemplary modified right ITR ("ITR-1 (Right)" SEQ ID NO: 114).
- Both ITR-1 (left) and ITR-1 (right) are predicted to form a structure with two arms, one of which is truncated. Their Gibbs free energies of unfolding are predicted to be -74.7 kcal/mol.
- FIG. 16A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C arm and B-B' arm of an exemplary modified left ITR ("ITR-5 (Left)" SEQ ID NO: 545) and FIG. 16B shows the predicted lowest energy structure of the RBE containing portion of the A-A' arm and the B-B' arm and C arm of an exemplary modified right ITR ("ITR-5 (Right)" SEQ ID NO: 116).
- Both ITR-5 (left) and ITR-5 (right) are predicted to form a structure with two arms, one of which is (e.g., the C arm) truncated. Their Gibbs free energies of unfolding are predicted to be -73.4 kcal/mol.
- FIG. 17A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-7 (Left)" SEQ ID NO: 117) and FIG. 17B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR-7 (Right)" SEQ ID NO: 118).
- Both ITR-17 (left) and ITR-17 (right) are predicted to form a structure with two arms, one of which (e.g., B-B' arm) is truncated. Their Gibbs free energies of unfolding are predicted to be -89.6 kcal/mol.
- FIG. 18A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-8 (Left)" SEQ ID NO: 119) and FIG. 18B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR-8 (Right)" SEQ ID NO: 120).
- Both ITR-8 (left) and ITR-8 (right) are predicted to form a structure with two arms, one of which is truncated. Their Gibbs free energies of unfolding are predicted to be -86.9 kcal/mol.
- FIG. 19A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-9 (Left)" SEQ ID NO: 121) and FIG. 19B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR-9 (Right)" SEQ ID NO: 122).
- Both ITR-9 (left) and ITR-9 (right) are predicted to form a structure with two arms, one of which is truncated. Their Gibbs free energies of unfolding are predicted to be -85.0 kcal/mol.
- FIG. 20A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-11 (Left)" SEQ ID NO: 123) and FIG. 20B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR- 11 (Right)" SEQ ID NO: 124).
- Both ITR-11 (left) and ITR-11 (right) are predicted to form a structure with two arms, one of which is truncated. Their Gibbs free energies of unfolding are predicted to be - 89.5 kcal/mol.
- FIG. 21A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-12 (Left)" SEQ ID NO: 125) and FIG. 21B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR- 12 (Right)" SEQ ID NO: 126).
- Both ITR-12 (left) and ITR-12 (right) They are predicted to form a structure with two arms, one of which is truncated. Their Gibbs free energies of unfolding are predicted to be -86.2 kcal/mol.
- FIG. 22A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-13 (Left)" SEQ ID NO: 127) and FIG. 22B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary a modified right ITR ("ITR- 13 (Right)" SEQ ID NO: 128).
- Both ITR-13 (left) and ITR-13 (right) are predicted to form a structure with two arms, one of which (e.g., C-C arm) is truncated. Their Gibbs free energies of unfolding are predicted to be -82.9 kcal/mol.
- FIG. 23A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-B' arm of an exemplary modified left ITR ("ITR-14 (Left)" SEQ ID NO: 129) and FIG. 23B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR- 14 (Right)" SEQ ID NO: 130).
- Both ITR-14 (left) and ITR-14 (right) are predicted to form a structure with two arms, one of which (e.g., C-C arm) is truncated. Their Gibbs free energies of unfolding are predicted to be -80.5 kcal/mol.
- FIG. 24A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-C arm of an exemplary modified left ITR ("ITR-15 (Left)" SEQ ID NO: 131) and FIG. 24B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary modified right ITR ("ITR- 15 (Right)" SEQ ID NO: 132).
- Both ITR-15 (left) and ITR-15 (right) are predicted to form a structure with two arms, one of which (e.g., the C-C arm) is truncated. Their Gibbs free energies of unfolding are predicted to be -77.2 kcal/mol.
- FIG. 25A shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the C-C arm and B-C arm of an exemplary modified left ITR ("ITR-16 (Left) SEQ ID NO: 133) and FIG. 25B shows the predicted lowest energy structure of the RBE-containing portion of the A-A' arm and the B-B' arm and C-C arm of an exemplary a modified right ITR ("ITR-16 (Right)" SEQ ID NO: 134).
- Both ITR-16 (left) and ITR-16 (right) are predicted to form a structure with two arms, one of which (e.g., C-C arm) is truncated. Their Gibbs free energies of unfolding are predicted to be -73.9 kcal/mol.
- FIG. 26A shows predicted structures of the RBE-containing portion of the A-A' arm and modified B-B' arm and/or modified C-C arm of exemplary modified right ITRs listed in Table 10A.
- FIG. 26B shows predicted structures of the RBE-containing portion of the A-A' arm and modified C-C arm and/or modified B-B' arm of exemplary modified left ITRs listed in Table 10B.
- the structures shown are the predicted lowest free energy structure.
- FIG. 27 shows luciferase activity of Sf9 GlycoBac insect cells transfected with selected asymmetric ITR mutant variants from Table 10A and 10B.
- the ceDNA vector had a luciferase gene flanked by a wt ITR and a modified asymmetric ITR selected from Table 10A or 10B.
- ITR-50 R no rep is the known rescuable mutant without co-infection of Rep containing baculovirus.
- “Mock” conditions are transfection reagents only, without donor DNA.
- FIG. 28 shows a native agarose gel (1% agarose, lx TAE buffer) of representative crude ceDNA extracts from Sf9 insect cell cultures transfected with ceDNA-plasmids comprising a Left wt- ITR with the other ITR selected from various mutant Right ITRs disclosed in Table 10A. 2ug of total extract was loaded per lane.
- FIG. 29 shows a denaturing gel (0.8 % alkaline agarose) of representative constructs from ITR mutant library.
- the ceDNA vector is produced from plasmids constucts comprising a Left wt- ITR with the other ITR selected from various mutant Right ITRs disclosed in Table 10A. From left to right, Lane 1) lkb Plus DNA Ladder, Lane 2) ITR-18 Right un-cut, Lane 3) ITR-18 Right restriction digest, Lane 4) ITR-19 Right un-cut, Lane 5) ITR-19 Right restriction digest, Lane 6) ITR-21 Right un-cut, Lane 7) ITR-21 Right restriction digest, Lane 8) ITR-25 Right un-cut, Lane 9) ITR-25 Right restriction digest.
- Extracts were treated with EcoRI restriction endonuclease. Each mutant ceDNA is expected to have a single EcoRI recognition site, producing two characteristic fragments, -2,000 bp and -3,000 bp, which will run at -4,000 and -6,000 bp, respectively, under denaturing conditions. Untreated ceDNA extracts are -5,000 bp and expected to migrate at -11,000 bp under denaturing conditions.
- FIG. 30 shows luciferase activity in vitro in HEK293 cells of ITR mutants ITR-18 Right, ITR-19 Right, ITR-21 Right and ITR-25 Right, and ITR-49, where the left ITR in the ceDNA vector is WT ITR. "Mock" conditions are transfection reagents only, without donor DNA, and untreated is the negative control.
- heterologous nucleotide sequence and “transgene” are used interchangeably and refer to a nucleic acid of interest (other than a nucleic acid encoding a capsid polypeptide) that is incorporated into and may be delivered and expressed by a ceDNA vector as disclosed herein.
- Transgenes of interest include, but are not limited to, nucleic acids encoding polypeptides, preferably therapeutic (e.g., for medical, diagnostic, or veterinary uses) or immunogenic polypeptides (e.g., for vaccines).
- nucleic acids of interest include nucleic acids that are transcribed into therapeutic RNA.
- Transgenes included for use in the ceDNA vectors of the invention include, but are not limited to, those that express or encode one or more polypeptides, peptides, ribozymes, aptamers, peptide nucleic acids, siRNAs, RNAis, miRNAs, lncRNAs, antisense oligo- or polynucleotides, antibodies, antigen binding fragments, or any combination thereof.
- expression cassette and “transcription cassette” are used interchangeably and refer to a linear stretch of nucleic acids that includes a transgene that is operably linked to one or more promoters or other regulatory sequences sufficient to direct transcription of the transgene, but which does not comprise capsid-encoding sequences, other vector sequences or inverted terminal repeat regions.
- An expression cassette may additionally comprise one or more cis- acting sequences (e.g., promoters, enhancers, or repressors), one or more introns, and one or more post-transcriptional regulatory elements.
- terminal repeat includes any viral terminal repeat or synthetic sequence that comprises at least one minimal required origin of replication and a region comprising a palindrome hairpin structure.
- a Rep-binding sequence (“RBS”) (also referred to as RBE (Rep-binding element)) and a terminal resolution site (“TRS”) together constitute a "minimal required origin of replication” and thus the TR comprises at least one RBS and at least one TRS.
- TRs that are the inverse complement of one another within a given stretch of polynucleotide sequence are typically each referred to as an "inverted terminal repeat" or "ITR".
- ITRs mediate replication, virus packaging, integration and provirus rescue.
- ITR is used herein to refer to a TR in a ceDNA genome or ceDNA vector that is capable of mediating replication of ceDNA vector. It will be understood by one of ordinary skill in the art that in complex ceDNA vector configurations more than two ITRs or asymmetric ITR pairs may be present.
- the ITR can be an AAV ITR or a non-AAV ITR, or can be derived from an AAV ITR or a non-AAV ITR.
- the ITR can be derived from the family Parvoviridae, which encompasses parvoviruses and dependoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin that serves as the origin of SV40 replication can be used as an ITR, which can further be modified by truncation, substitution, deletion, insertion and/or addition.
- Parvoviridae family viruses consist of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates.
- Dependoparvoviruses include the viral family of the adeno-associated viruses (AAV) which are capable of replication in vertebrate hosts including, but not limited to, human, primate, bovine, canine, equine and ovine species.
- AAV adeno-associated viruses
- asymmetric ITRs refers to a pair of ITRs within a single ceDNA genome or ceDNA vector that are not inverse complements across their full length. The difference in sequence between the two ITRs may be due to nucleotide addition, deletion, truncation, or point mutation.
- one ITR of the pair may be a wild-type AAV sequence and the other a non-wild-type or synthetic sequence.
- neither ITR of the pair is a wild-type AAV sequence and the two ITRs differ in sequence from one another.
- an ITR located 5' to (upstream of) an expression cassette in a ceDNA vector is referred to as a "5' ITR” or a "left ITR”
- an ITR located 3 ' to (downstream of) an expression cassette in a ceDNA vector is referred to as a "3' ITR” or a "right ITR”.
- ceDNA genome refers to an expression cassette that further incorporates at least one inverted terminal repeat region.
- a ceDNA genome may further comprise one or more spacer regions.
- the ceDNA genome is incorporated as an intermolecular duplex polynucleotide of DNA into a plasmid or viral genome.
- ceDNA spacer region refers to an intervening sequence that separates functional elements in the ceDNA vector or ceDNA genome.
- ceDNA spacer regions keep two functional elements at a desired distance for optimal functionality.
- ceDNA spacer regions provide or add to the genetic stability of the ceDNA genome within e.g., a plasmid or baculovirus.
- ceDNA spacer regions facilitate ready genetic manipulation of the ceDNA genome by providing a convenient location for cloning sites and the like.
- an oligonucleotide "polylinker” containing several restriction endonuclease sites, or a non-open reading frame sequence designed to have no known protein (e.g., transcription factor) binding sites can be positioned in the ceDNA genome to separate the cis - acting factors, e.g., inserting a 6mer, 12mer, 18mer, 24mer, 48mer, 86mer, 176mer, etc. between the terminal resolution site and the upstream transcriptional regulatory element.
- the spacer may be incorporated between the polyadenylation signal sequence and the 3 '-terminal resolution site.
- Rep binding site As used herein, the terms "Rep binding site, "Rep binding element, “RBE” and “RBS” are used interchangeably and refer to a binding site for Rep protein (e.g., AAV Rep 78 or AAV Rep 68) which upon binding by a Rep protein permits the Rep protein to perform its site-specific endonuclease activity on the sequence incorporating the RBS.
- An RBS sequence and its inverse complement together form a single RBS.
- RBS sequences are known in the art, and include, for example, 5'- GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531), an RBS sequence identified in AAV2.
- any known RBS sequence may be used in the embodiments of the invention, including other known AAV RBS sequences and other naturally known or synthetic RBS sequences. Without being bound by theory it is thought that he nuclease domain of a Rep protein binds to the duplex nucleotide sequence GCTC, and thus the two known AAV Rep proteins bind directly to and stably assemble on the duplex oligonucleotide, 5'-(GCGC)(GCTC)(GCTC)(GCTC)-3' (SEQ ID NO: 531). In addition, soluble aggregated conformers (i.e., undefined number of inter-associated Rep proteins) dissociate and bind to oligonucleotides that contain Rep binding sites. Each Rep protein interacts with both the nitrogenous bases and phosphodiester backbone on each strand. The interactions with the nitrogenous bases provide sequence specificity whereas the interactions with the phosphodiester backbone are non- or less- sequence specific and stabilize the protein-DNA complex.
- terminal resolution site and “TRS” are used interchangeably herein and refer to a region at which Rep forms a tyrosine-phosphodiester bond with the 5 ' thymidine generating a 3' OH that serves as a substrate for DNA extension via a cellular DNA polymerase, e.g., DNA pol delta or DNA pol epsilon.
- the Rep-thymidine complex may participate in a coordinated ligation reaction.
- a TRS minimally encompasses a non- base-paired thymidine.
- the nicking efficiency of the TRS can be controlled at least in part by its distance within the same molecule from the RBS.
- TRS sequences are known in the art, and include, for example, 5'-GGTTGA-3' (SEQ ID NO: 45), the hexanucleotide sequence identified in AAV2. Any known TRS sequence may be used in the embodiments of the invention, including other known AAV TRS sequences and other naturally known or synthetic TRS sequences such as AGTT (SEQ ID NO: 46), GGTTGG (SEQ ID NO: 47), AGTTGG (SEQ ID NO: 48), AGTTGA (SEQ ID NO: 49), and other motifs such as RRTTRR (SEQ ID NO: 50).
- ceDNA-plasmid refers to a plasmid that comprises a ceDNA genome as an intermolecular duplex.
- ceDNA-bacmid refers to an infectious baculovirus genome comprising a ceDNA genome as an intermolecular duplex that is capable of propagating in E. coli as a plasmid, and so can operate as a shuttle vector for baculovirus.
- ceDNA-baculovirus refers to a baculovirus that comprises a ceDNA genome as an intermolecular duplex within the baculovirus genome.
- ceDNA-baculovirus infected insect cell and “ceDNA-BIIC” are used interchangeably, and refer to an invertebrate host cell (including, but not limited to an insect cell (e.g., an Sf9 cell)) infected with a ceDNA-baculovirus.
- the terms "closed-ended DNA vector”, “ceDNA vector” and “ceDNA” are used interchangeably and refer to a non-virus capsid-free DNA vector with at least one covalently- closed end (i.e., an intramolecular duplex).
- the ceDNA comprises two covalently-closed ends.
- reporter refer to proteins that can be used to provide deteactable readouts. Reporters generally produce a measurable signal such as fluorescence, color, or luminescence. Reporter protein coding sequences encode proteins whose presence in the cell or organism is readily observed. For example, fluorescent proteins cause a cell to fluoresce when excited with light of a particular wavelength, luciferases cause a cell to catalyze a reaction that produces light, and enzymes such as ⁇ -galactosidase convert a substrate to a colored product.
- reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to ⁇ -lactamase, ⁇ - galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.
- effector protein refers to a polypeptide that provides a detectable read-out, either as, for example, a reporter polypeptide, or more appropriately, as a polypeptide that kills a cell, e.g.
- Effector proteins include any protein or peptide that directly targets or damages the host cell's DNA and/or R A.
- effector proteins can include, but are not limited to, a restriction endonuclease that targets a host cell DNA sequence (whether genomic or on an extrachromosomal element), a protease that degrades a polypeptide target necessary for cell survival, a DNA gyrase inhibitor, and a ribonuclease-type toxin.
- the expression of an effector protein controlled by a synthetic biological circuit as described herein can participate as a factor in another synthetic biological circuit to thereby expand the range and complexity of a biological circuit system's responsiveness.
- Transcriptional regulators refer to transcriptional activators and repressors that either activate or repress transcription of a gene of interest. Promoters are regions of nucleic acid that initiate transcription of a particular gene Transcriptional activators typically bind nearby to transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Repressors bind to transcriptional promoters and sterically hinder transcriptional initiation by RNA polymerase. Other transcriptional regulators may serve as either an activator or a repressor depending on where they bind and cellular and environmental conditions. Non-limiting examples of transcriptional regulator classes include, but are not limited to homeodomain proteins, zinc-finger proteins, winged-helix (forkhead) proteins, and leucine-zipper proteins.
- a "repressor protein” or “inducer protein” is a protein that binds to a regulatory sequence element and represses or activates, respectively, the transcription of sequences operatively linked to the regulatory sequence element.
- Preferred repressor and inducer proteins as described herein are sensitive to the presence or absence of at least one input agent or environmental input.
- Preferred proteins as described herein are modular in form, comprising, for example, separable DNA-binding and input agent-binding or responsive elements or domains.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- dispersion media includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- Supplementary active ingredients can also be incorporated into the compositions.
- pharmaceutically -acceptable refers to molecular entities and compositions that do not produce a toxic, an allergic, or similar untoward reaction when administered to a host.
- an "input agent responsive domain” is a domain of a transcription factor that binds to or otherwise responds to a condition or input agent in a manner that renders a linked DNA binding fusion domain responsive to the presence of that condition or input.
- the presence of the condition or input results in a conformational change in the input agent responsive domain, or in a protein to which it is fused, that modifies the transcription-modulating activity of the transcription factor.
- in vivo refers to assays or processes that occur in or within an organism, such as a multicellular animal. In some of the aspects described herein, a method or use can be said to occur “/ ' « vivo” when a unicellular organism, such as a bacterium, is used.
- ex vivo refers to methods and uses that are performed using a living cell with an intact membrane that is outside of the body of a multicellular animal or plant, e.g. , explants, cultured cells, including primary cells and cell lines, transformed cell lines, and extracted tissue or cells, including blood cells, among others.
- in vitro refers to assays and methods that do not require the presence of a cell with an intact membrane, such as cellular extracts, and can refer to the introducing of a programmable synthetic biological circuit in a non-cellular system, such as a medium not comprising cells or cellular systems, such as cellular extracts.
- promoter refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving transcription of the nucleic acid sequence, which can be a heterologous target gene encoding a protein or an RNA. Promoters can be constitutive, inducible, repressible, tissue-specific, or any combination thereof.
- a promoter is a control region of a nucleic acid sequence at which initiation and rate of transcription of the remainder of a nucleic acid sequence are controlled.
- a promoter can also contain genetic elements at which regulatory proteins and molecules can bind, such as RNA polymerase and other transcription factors.
- a promoter can drive the expression of a transcription factor that regulates the expression of the promoter itself, or that of another promoter used in another modular component of the synthetic biological circuits described herein.
- a transcription initiation site within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase.
- Eukaryotic promoters will often, but not always, contain
- TATA boxes and "CAT” boxes.
- Various promoters including inducible promoters, may be used to drive the expression of transgenes in the ceDNA vectors disclosed herien.
- Enhancer refers a cis-acting regulatory sequence (e.g., 50-1,500 base pairs) that bind one or more proteins (e.g., activator proteins, or transcription factor) to increase transcriptional activation of a nucleic acid sequence. Enhancers can be positioned up to 1,000,000 base pars upstream of the gene start site or downstream of the gene start site that they regulate. An enhancer can be positioned within an intronic region, or in the exonic region of an unrelated gene. [0085] A promoter can be said to drive expression or drive transcription of the nucleic acid sequence that it regulates.
- operably linked indicates that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence it regulates to control transcriptional initiation and/or expression of that sequence.
- a promoter can be one naturally associated with a gene or sequence, as can be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon of a given gene or sequence. Such a promoter can be referred to as "endogenous.”
- an enhancer can be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.
- a coding nucleic acid segment is positioned under the control of a "recombinant promoter” or “heterologous promoter,” both of which refer to a promoter that is not normally associated with the encoded nucleic acid sequence it is operably linked to in its natural environment.
- a recombinant or heterologous enhancer refers to an enhancer not normally associated with a given nucleic acid sequence in its natural environment.
- promoters or enhancers can include promoters or enhancers of other genes; promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell; and synthetic promoters or enhancers that are not "naturally occurring,” i.e.
- promoter sequences can be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR, in connection with the synthetic biological circuits and modules disclosed herein (see, e.g., U.S. Pat. No. 4,683,202, U.S. Pat. No. 5,928,906, each incorporated herein by reference).
- control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
- an "inducible promoter” is one that is characterized by initiating or enhancing transcriptional activity when in the presence of, influenced by, or contacted by an inducer or inducing agent.
- An “inducer” or “inducing agent,” as defined herein, can be endogenous, or a normally exogenous compound or protein that is administered in such a way as to be active in inducing transcriptional activity from the inducible promoter.
- the inducer or inducing agent i.e., a chemical, a compound or a protein
- the inducer or inducing agent can itself be the result of transcription or expression of a nucleic acid sequence (i.e., an inducer can be an inducer protein expressed by another component or module), which itself can be under the control or an inducible promoter.
- an inducible promoter is induced in the absence of certain agents, such as a repressor.
- inducible promoters include but are not limited to, tetracycline, metallothionine, ecdysone, mammalian viruses (e.g., the adenovirus late promoter; and the mouse mammary tumor virus long terminal repeat (MMTV-LTR)) and other steroid-responsive promoters, rapamycin responsive promoters and the like.
- mammalian viruses e.g., the adenovirus late promoter; and the mouse mammary tumor virus long terminal repeat (MMTV-LTR)
- MMTV-LTR mouse mammary tumor virus long terminal repeat
- subject refers to a human or animal, to whom treatment, including prophylactic treatment, with the ceDNA vector according to the present invention, is provided.
- the animal is a vertebrate such as, but not limited to a primate, rodent, domestic animal or game animal.
- Primates include but are not limited to, chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus.
- Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.
- domestic and game animals include, but are not limited to, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
- the subject is a mammal, e.g., a primate or a human.
- a subject can be male or female.
- a subject can be an infant or a child.
- the subject can be a neonate or an unborn subject, e.g., the subject is in utero.
- the subject is a mammal.
- the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of diseases and disorders.
- the methods and compositions described herein can be used for domesticated animals and/or pets.
- a human subject can be of any age, gender, race or ethnic group, e.g., Caucasian (white), Asian, African, black, African American, African European, Hispanic, Mideastern, etc.
- the subject can be a patient or other subject in a clinical setting. In some embodiments, the subject is already undergoing treatment.
- antibody is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
- An “antibody fragment” refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the same antigen to which the intact antibody binds.
- the antibody or antibody fragment comprises an
- antibodies or fragments thereof include, but are not limited to, an Fv, an scFv, a Fab fragment, a Fab', a F(ab')2, a Fab'-SH, a single domain antibody (dAb), a heavy chain, a light chain, a heavy and light chain, a full antibody (e.g., includes each of the Fc, Fab, heavy chains, light chains, variable regions etc.), a bispecific antibody, a diabody, a linear antibody, a single chain antibody, an intrabody, a monoclonal antibody, a chimeric antibody, a multispecific antibody, or a multimeric antibody.
- an antibody or fragment thereof can be of any class, including but not limited to IgA, IgD, IgE, IgG, and IgM, and of any subclass thereof including but not limited to IgGl, IgG2, IgG3, IgG4, IgAl and IgA2.
- an antibody can be derived from any mammal, for example, primates, humans, rats, mice, horses, goats etc.
- the antibody is human or humanized.
- the antibody is a modified antibody.
- the components of an antibody can be expressed separately such that the antibody self-assembles following expression of the protein components.
- the antibody is "humanized" to reduce immunogenic reactions in a human.
- the antibody has a desired function, for example, interaction and inhibition of a desired protein for the purpose of treating a disease or a symptom of a disease.
- the antibody or antibody fragment comprises a framework region or an F c region.
- the term "antigen-binding domain" of an antibody molecule refers to the part of an antibody molecule, e.g., an immunoglobulin (Ig) molecule, that participates in antigen binding.
- the antigen binding site is formed by amino acid residues of the variable (V) regions of the heavy (H) and light (L) chains.
- V variable regions of the heavy and light chains
- hypervariable regions Three highly divergent stretches within the variable regions of the heavy and light chains, referred to as hypervariable regions, are disposed between more conserved flanking stretches called “framework regions,” (FRs).
- FRs are amino acid sequences that are naturally found between, and adjacent to, hypervariable regions in immunoglobulins.
- the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are disposed relative to each other in three dimensional space to form an antigen-binding surface, which is complementary to the three-dimensional surface of a bound antigen.
- the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity -determining regions," or "CDRs.”
- the framework region and CDRs have been defined and described, e.g., in Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91- 3242, and Chothia, C. et al.
- variable chain e.g., variable heavy chain and variable light chain
- full length antibody refers to an immunoglobulin (Ig) molecule (e.g., an IgG antibody), for example, that is naturally occurring, and formed by normal
- the term “functional antibody fragment” refers to a fragment that binds to the same antigen as that recognized by the intact (e.g., full-length) antibody.
- the terms “antibody fragment” or “functional fragment” also include isolated fragments consisting of the variable regions, such as the "Fv” fragments consisting of the variable regions of the heavy and light chains or recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker ("scFv proteins").
- an antibody fragment does not include portions of antibodies without antigen binding activity, such as Fc fragments or single amino acid residues.
- an "immunoglobulin variable domain sequence” refers to an amino acid sequence which can form the structure of an immunoglobulin variable domain.
- the sequence may include all or part of the amino acid sequence of a naturally-occurring variable domain.
- the sequence may or may not include one, two, or more N- or C-terminal amino acids, or may include other alterations that are compatible with formation of the protein structure.
- compositions, methods, and respective component(s) thereof are used in reference to compositions, methods, and respective component(s) thereof, that are essential to the method or composition, yet open to the inclusion of unspecified elements, whether essential or not.
- the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment.
- compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
- novel non-viral, capsid-free ceDNA molecules with covalently- closed ends can be produced in permissive host cells from an expression construct (e.g., a ceDNA-plasmid, a ceDNA-bacmid, a ceDNA- baculovirus, or an integrated cell-line) containing a heterologous gene (transgene) positioned between two different inverted terminal repeat (ITR) sequences, where the ITRs are different with respect to each other.
- an expression construct e.g., a ceDNA-plasmid, a ceDNA-bacmid, a ceDNA- baculovirus, or an integrated cell-line
- a heterologous gene transgene
- ITR inverted terminal repeat
- one of the ITRs is modified by deletion, insertion, and/or substitution as compared to a wild-type ITR sequence (e.g.
- the ceDNA vector is preferably duplex, e.g self-complementary, over at least a portion of the molecule, such as the expression cassette (e.g. ceDNA is not a double stranded circular molecule).
- the ceDNA vector has covalently closed ends, and thus is resistant to exonuclease digestion (e.g. exonuclease I or exonuclease III), e.g. for over an hour at 37°C.
- ceDNA vectors disclosed herein have no packaging constraints imposed by the limiting space within the viral capsid.
- ceDNA vectors represent a viable eukaryotically-produced alternative to prokaryote -produced plasmid DNA vectors, as opposed to encapsulated AAV genomes. This permits the insertion of control elements, e.g., regulatory switches as disclosed herein, large transgenes, multiple transgenes etc.
- a ceDNA vector comprises, in the 5' to 3' direction: a first adeno- associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (for example an expression cassette as described herein) and a second AAV ITR, where the first ITR and the second ITR are asymmetric with respect to each other - that is, they are different from one another.
- the first ITR can be a wild-type ITR and the second ITR can be a mutated or modified ITR.
- the first ITR can be a mutated or modified ITR and the second ITR a wild-type ITR.
- the first ITR and the second ITR are both modified but are different sequences, or have different modifications, or are not identical modified ITRs.
- the ITRs are asymmetric in that any changes in one ITR are not reflected in the other ITR; or alternatively, where the ITRs are different with respect to each other.
- Exemplary ITRs in the ceDNA vector and for use to generate a ceDNA-plasmid are discussed below in the section entitled "ITRs".
- the wild-type or mutated or otherwise modified ITR sequences provided herein represent DNA sequences included in the expression construct (e.g., ceDNA-plasmid, ce-DNA Bacmid, ceDNA-baculovirus) for production of the ceDNA vector.
- ITR sequences actually contained in the ceDNA vector produced from the ceDNA-plasmid or other expression construct may or may not be identical to the ITR sequences provided herein as a result of naturally occurring changes taking place during the production process (e.g., replication error).
- a ceDNA vector described herein comprising the expression cassette with a transgene, which can be, for example, a regulatory sequence, a sequence encoding a nucleic acid (e.g., such as a miR or an antisense sequence), or a sequence encoding a polypeptide (e.g., such as a transgene).
- the transgene may be operatively linked to one or more regulatory sequence(s) that allows or controls expression of the transgene.
- the polynucleotide comprises a first ITR sequence and a second ITR sequence, wherein the nucleotide sequence of interest is flanked by the first and second ITR sequences, and the first and second ITR sequences are asymmetrical relative to each other.
- an expression cassette is located between two ITRs comprised in the following order with one or more of: a promoter operably linked to a transgene, a posttranscriptional regulatory element, and a polyadenylation and termination signal.
- the promoter is regulatable - inducible or repressible.
- the promoter can be any sequence that facilitates the transcription of the transgene.
- the promoter is a CAG promoter (e.g. SEQ ID NO: 03), or variation thereof.
- the posttranscriptional regulatory element is a sequence that modulates expression of the transgene, as a non-limiting example, any sequence that creates a tertiary structure that enhances expression of the transgene.
- the posttranscriptional regulatory element comprises WPRE (e.g.
- the polyadenylation and termination signal comprises
- BGHpolyA (e.g. SEQ ID NO: 09).
- Any cis regulatory element known in the art, or combination thereof, can be additionally used e.g., SV40 late polyA signal upstream enhancer sequence (USE), or other posttranscriptional processing elements including, but not limited to, the thymidine kinase gene of herpes simplex virus, or hepatitis B virus (HBV).
- the expression cassette length in the 5 ' to 3 ' direction is greater than the maximum length known to be encapsidated in an AAV virion. In one embodiment, the length is greater than 4.6 kb, or greater than 5 kb, or greater than 6 kb, or greater than 7 kb.
- the expression cassette can comprise more than 4000 nucleotides, 5000 nucleotides,
- the expression cassette can comprise a transgene or nucleic acid in the range of 500 to 50,000 nucleotides in length. In some embodiments, the expression cassette can comprise a transgene or nucleic acid in the range of 500 to 75,000 nucleotides in length. In some embodiments, the expression cassette can comprise a transgene or nucleic acid is in the range of 500 to 10,000 nucleotides in length.
- the expression cassette can comprise a transgene or nucleic acid is in the range of 1000 to 10,000 nucleotides in length. In some embodiments, the expression cassette can comprise a transgene or nucleic acid is in the range of 500 to 5,000 nucleotides in length.
- the ceDNA vectors do not have the size limitations of encapsidated AAV vectors, thus enable delivery of a large-size expression cassette to provide efficient expression of transgenes. In some embodiments, the ceDNA vector is devoid of prokaryote-specific methylation.
- the expression cassette can also comprise an internal ribosome entry site (IRES) and/or a 2A element.
- the cis-regulatory elements include, but are not limited to, a promoter, a riboswitch, an insulator, a mir-regulatable element, a post-transcriptional regulatory element, a tissue- and cell type-specific promoter and an enhancer.
- the ITR can act as the promoter for the transgene.
- the ceDNA vector comprises additional components to regulate expression of the transgene, for example, a regulatory switches, which are described herein in the section entitled "Regulatory Switches" for controlling and regulating the expression of the transgene, and can include if desired, a regulatory switch which is a kill switch to enable controlled cell death of a cell comprising a ceDNA vector.
- a regulatory switch which is a kill switch to enable controlled cell death of a cell comprising a ceDNA vector.
- FIG. 1A-1C show schematics of nonlimiting, exemplary ceDNA vectors, or the corresponding sequence of ceDNA plasmids.
- ceDNA vectors are capsid-free and can be obtained from a plasmid encoding in this order: a first ITR, expressible transgene cassette and a second ITR, where at least one of the first and/or second ITR sequence is mutated with respect to the
- the expressible transgene cassette preferably includes one or more of, in this order: an enhancer/promoter, an ORF reporter (transgene), a post-transcription regulatory element (e.g., WPRE), and a polyadenylation and termination signal (e.g., BGH poly A).
- an enhancer/promoter an ORF reporter (transgene)
- transgene an ORF reporter
- WPRE post-transcription regulatory element
- BGH poly A polyadenylation and termination signal
- the expression cassette can comprise any transgene of interest.
- Transgenes of interest include but are not limited to, nucleic acids encoding polypeptides, or non-coding nucleic acids (e.g., RNAi, miRs etc.) preferably therapeutic (e.g., for medical, diagnostic, or veterinary uses) or immunogenic (e.g., for vaccines) polypeptides.
- the transgenes in the expression cassette encodes one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNAs, RNAis, antisense oligonucleotides, antisense polynucleotides, antibodies, antigen binding fragments, or any combination thereof.
- the transgene is a therapeutic gene, or a marker protein. In some embodiments, the transgene is an agonist or antagonist. In some embodiments, the antagonist is a mimetic or antibody, or antibody fragment, or antigen-binding fragment thereof, e.g., a neutralizing antibody or antibody fragment and the like. In some embodiments, the transgene encodes an antibody, including a full-length antibody or antibody fragment, as defined herein. In some embodiments, the antibody is an antigen-binding domain or an immunoglobulin variable domain sequence, as that is defined herein.
- the transgene can encode one or more therapeutic agent(s), including, but not limited to, for example, protein(s), polypeptide(s), peptide(s), enzyme(s), antibodies, antigen binding fragments, as well as variants, and/or active fragments thereof, for use in the treatment, prophylaxis, and/or amelioration of one or more symptoms of a disease, dysfunction, injury, and/or disorder.
- therapeutic agent(s) including, but not limited to, for example, protein(s), polypeptide(s), peptide(s), enzyme(s), antibodies, antigen binding fragments, as well as variants, and/or active fragments thereof.
- Exemplary transgenes are described herein in the section entitled "Method of Treatment”.
- ceDNA vectors that differ from plasmid-based expression vectors.
- ceDNA vectors may possess one or more of the following features: the lack of original (i.e. not inserted) bacterial DNA, the lack of a prokaryotic origin of replication, being self- containing, i.e., they do not require any sequences other than the two ITRs, including the Rep binding and terminal resolution sites (RBS and TRS), and an exogenous sequence between the ITRs, the presence of ITR sequences that form hairpins, of the eukaryotic origin (i.e., they are produced in eukaryotic cells), and the absence of bacterial -type DNA methylation or indeed any other methylation considered abnormal by a mammalian host.
- ceDNA vectors are single-strand linear DNA having closed ends, while plasmids are always double -stranded DNA.
- ceDNA vectors produced by the methods provided herein preferably have a linear and continuous structure rather than a non-continuous structure, as determined by restriction enzyme digestion assay (FIG.4D).
- the linear and continuous structure is believed to be more stable from attack by cellular endonucleases, as well as less likely to be recombined and cause mutagenesis.
- a ceDNA vector in the linear and continuous structure is a preferred embodiment.
- the continuous, linear, single strand intramolecular duplex ceDNA vector can have covalently bound terminal ends, without sequences encoding AAV capsid proteins.
- These ceDNA vectors are structurally distinct from plasmids (including ceDNA plasmids described herein), which are circular duplex nucleic acid molecules of bacterial origin.
- ceDNA vectors as described herein can be produced without DNA base methylation of prokaryotic type, unlike plasmids.
- ceDNA vectors and ceDNA-plasmids are different both in term of structure (in particular, linear versus circular) and also in view of the methods used for producing and purifying these different objects (see below), and also in view of their DNA methylation which is of prokaryotic type for ceDNA-plasmids and of eukaryotic type for the ceDNA vector.
- ceDNA vectors described herein over plasmid-based expression vectors include, but are not limited to: 1) plasmids contain bacterial DNA sequences and are subjected to prokaryotic-specific methylation, e.g., 6-methyl adenosine and 5-methyl cytosine methylation, whereas capsid-free AAV vector sequences are of eukaryotic origin and do not undergo prokaryotic- specific methylation; as a result, capsid-free AAV vectors are less likely to induce inflammatory and immune responses compared to plasmids; 2) while plasmids require the presence of a resistance gene during the production process, ceDNA vectors do not; 3) while a circular plasmid is not delivered to the nucleus upon introduction into a cell and requires overloading to bypass degradation by cellular nucleases, ceDNA vectors contain viral cis-elements, i.e., ITRs, that confer resistance to nucleases and can be
- the minimal defining elements indispensable for ITR function are a Rep-binding site (RBS; 5'- GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531) for AAV2) and a terminal resolution site (TRS; 5'- AGTTGG-3' (SEQ ID NO: 48) for AAV2) plus a variable palindromic sequence allowing for hairpin formation; and 4) ceDNA vectors do not have the over-representation of CpG dinucleotides often found in prokaryote-derived plasmids that reportedly binds a member of the Toll-like family of receptors, eliciting a T cell-mediated immune response.
- transductions with capsid-free AAV vectors disclosed herein can efficiently target cell and tissue-types that are difficult to transduce with conventional AAV virions using various delivery reagent.
- ceDNA vectors contain a heterologous gene positioned between two inverted terminal repeat (ITR) sequences, that differ with respect to each other (i.e. are asymmetric ITRs).
- ITR inverted terminal repeat
- at least one of the ITRs is modified by deletion, insertion, and/or substitution as compared to a wild-type ITR sequence (e.g. AAV ITR); and at least one of the ITRs comprises a functional Rep binding site (RBS; e.g. 5'-GCGCGCTCGCTCGCTC-3' for AAV2, SEQ ID NO: 531) and a functional terminal resolution site (TRS; e.g.
- the ITRs are a non-functional ITR.
- the different ITRs are not each wild type ITRs from different serotypes.
- ITRs any known parvovirus
- a dependovirus such as AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV 5, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAVrh8, AAVrhlO, AAV-DJ, and AAV- DJ8 genome.
- AAV e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV 5, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAVrh8, AAVrhlO, AAV-DJ, and AAV- DJ8 genome.
- NCBI NC 002077; NC 001401; NC001729; NC001829; NC006152; NC 006260; NC 006261
- chimeric ITRs or ITRs from any synthetic AAV.
- the AAV can infect warm-blooded animals, e.g., avian (AAAV), bovine (BAAV), canine, equine, and ovine adeno- associated viruses.
- the ITR is from B19 parvoviris (GenBank Accession No: NC 000883), Minute Virus from Mouse (MVM) (GenBank Accession No. NC 001510); goose parvovirus (GenBank Accession No. NC 001701); snake parvovirus 1 (GenBank Accession No. NC 006148).
- the ITR sequence can be from viruses of the Parvoviridae family, which includes two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect insects.
- the subfamily Parvovirinae (referred to as the parvoviruses) includes the genus Dependovirus, the members of which, under most conditions, require coinfection with a helper virus such as adenovirus or herpes virus for productive infection.
- the genus Dependovirus includes adeno- associated virus (AAV), which normally infects humans (e.g., serotypes 2, 3A, 3B, 5, and 6) or primates (e.g., serotypes 1 and 4), and related viruses that infect other warm-blooded animals (e.g., bovine, canine, equine, and ovine adeno-associated viruses).
- AAV adeno- associated virus
- the parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996).
- ITR sequences have a common structure of a double -stranded Holliday junction, which typically is a T-shaped or Y-shaped hairpin structure (see e.g., FIG. 2A and FIG.
- each ITR is formed by two palindromic arms or loops (B-B' and C-C) embedded in a larger palindromic arm ( ⁇ - ⁇ '), and a single stranded D sequence, (where the order of these palindromic sequences defines the flip or flop orientation of the ITR), one can readily determine corresponding modified ITR sequences from any AAV serotype for use in a ceDNA vector or ceDNA -plasmid based on the exemplary AAV2 ITR sequences provided herein. See, for example, structural analysis and sequence comparison of ITRs from different AAV serotypes (AAV1-AAV6) and described in Grimm et al, J. Virology, 2006; 80(1); 426-439; Yan et al, J. Virology, 2005; 364- 379; Duan et al, Virology 1999; 261; 8-14.
- altered or mutated indicates that nucleotides have been inserted, deleted, and/or substituted relative to the wild-type, reference, or original ITR sequence, and can be altered relative to the other flanking ITR in a ceDNA vector having two flanking ITRs.
- the altered or mutated ITR can be an engineered ITR.
- engineered refers to the aspect of having been manipulated by the hand of man.
- a polypeptide is considered to be “engineered” when at least one aspect of the polypeptide, e.g., its sequence, has been manipulated by the hand of man to differ from the aspect as it exists in nature.
- an ITR may be synthetic.
- a synthetic ITR is based on ITR sequences from more than one AAV serotype.
- a synthetic ITR includes no AAV-based sequence.
- a synthetic ITR preserves the ITR structure described above although having only some or no AAV-sourced sequence.
- a synthetic ITR may interact preferentially with a wildtype Rep or a Rep of a specific serotype, or in some instances will not be recognized by a wild-type Rep and be recognized only by a mutated Rep.
- ITR sequences have a common structure of a double-stranded Holliday junction, which typically is a T-shaped or Y-shaped hairpin structure (see, e.g., FIG. 2A and FIG. 3A), where each ITR is formed by two palindromic arms or loops ( ⁇ - ⁇ and C-C) embedded in a larger palindromic arm ( ⁇ - ⁇ '), and a single stranded D sequence, (where the order of these palindromic sequences defines the 'flip' or 'flop' orientation of the ITR).
- ITR sequences or modified ITR sequences from any AAV serotype for use in a ceDNA vector or ceDNA-plasmid based on the exemplary AAV2 ITR sequences provided herein. See, for example, the sequence comparison of ITRs from different AAV serotypes (AAV1-AAV6, and avian AAV (AAAV) and bovine AAV (BAAV)) described in Grimm et al., J.
- AAV-1 84%
- AAV-3 86%
- AAV-4 79%
- AAV-5 58%
- AAV-6 left ITR
- AAV-6 right ITR
- a ceDNA vector disclosed herein may be prepared with or based on ITRs of any known AAV serotype, including, for example, AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV 10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12).
- AAV serotype 1 AAV1
- AAV2 AAV2
- AAV4 AAV serotype 4
- AAV5 AAV-5
- AAV serotype 6 AAV6
- AAV serotype 7 AAV7
- AAV8 AAV serotype 8
- AAV9 AAV serotype 9
- AAV 10 AAV 10
- AAV 11 AAV11
- the skilled artisan can determine the corresponding sequence in other serotypes by known means. For example, determining if the change is in the A, A', B, B', C, C or D region and determine the corresponding region in another serotype.
- the invention further provides populations and pluralities of ceDNA vectors comprising ITRs from a combination of different AAV serotypes - that is, one ITR can be from one AAV serotype and the other ITR can be from a different serotype.
- one ITR can be from or based on an AAV2 ITR sequence and the other ITR of the ceDNA vector can be from or be based on any one or more ITR sequence of AAV serotype 1 (AAVl), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAVl 1), or AAV serotype 12 (AAV 12).
- AAV serotype 1 AAVl
- AAV4 AAV serotype 4
- AAV5 AAV serotype 5
- AAV6 AAV serotype 6
- AAV7 AAV serotype 7
- AAV8 AAV serotype 8
- AAV9 AAV serotype 9
- AAV9 AAV serotype 10 (AAV10), AAV serotype 11
- Any parvovirus ITR can be used as an ITR or as a base ITR for modification.
- the parvovirus is a dependovirus. More preferably AAV.
- the serotype chosen can be based upon the tissue tropism of the serotype.
- AAV2 has a broad tissue tropism
- AAVl preferentially targets to neuronal and skeletal muscle
- AAV5 preferentially targets neuronal, retinal pigmented epithelia, and photoreceptors.
- AAV6 preferentially targets skeletal muscle and lung.
- AAV8 preferentially targets liver, skeletal muscle, heart, and pancreatic tissues.
- AAV9 preferentially targets liver, skeletal and lung tissue.
- the modified ITR is based on an AAV2 ITR.
- the vector polynucleotide comprises a pair of ITRs, selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO:52; and SEQ ID NO:2 and SEQ ID NO: 51.
- the vector polynucleotide or the non-viral, capsid-free DNA vectors with covalently-closed ends comprises a pair of different ITRs selected from the group consisting of: SEQ ID NO: 101 and SEQ ID NO: 102; SEQ ID NO: 103, and SEQ ID
- a modified ITR is selected from any of the ITRs, or partial ITR sequences of SEQ ID NOS: 2, 52, 63, 64, 101-499 or 545-547.
- a ceDNA vector can comprise an ITR with a modification in the ITR corresponding to any of the modifications in ITR sequences or ITR partial sequences shown in any one or more of Tables 2, 3, 4, 5, 6, 7, 8, 9, 10A and 10B herein, or the sequences shown in FIG. 26A or 26B.
- ceDNA can form an intramolecular duplex secondary structure.
- the secondary structure of the first ITR and the asymmetric second ITR are exemplified in the context of wild-type ITRs (see, e.g., FIGS. 2A, 3A, 3C) and modified ITR structures (see e.g., FIGS. 2B and FIGS. 3B, 3D). Secondary structures are inferred or predicted based on the ITR sequences of the plasmid used to produce the ceDNA vector. Exemplary secondary structures of the modified ITRs in which part of the stem-loop structure is deleted are shown in FIGS. 9A-25B and FIGS. 26A-26B, and also shown in Tables 10A and 10B.
- Exemplary secondary structures of the modified ITRs comprising a single stem and two loops are shown in FIGS. 9A-13B.
- Exemplary secondary structure of a modified ITR with a single stem and single loop is shown in FIG. 14.
- the secondary structure can be inferred as shown herein using thermodynamic methods based on nearest neighbor rules that predict the stability of a structure as quantified by folding free energy change. For example, the structure can be predicted by finding the lowest free energy structure.
- Bioinformatics. 11,129 and implemented in the RNAstructure software can be used for prediction of the ITR structure.
- the algorithm can also include both free energy change parameters at 37°C and enthalpy change parameters derived from experimental literature to allow prediction of conformation stability at an arbitrary temperature.
- some of the modifed ITR structures can be predicted as modified T-shaped stem-loop structures with estimated Gibbs free energy (AG) of unfolding under physiological conditions shown in FIGS. 3A-3D.
- AG Gibbs free energy
- modified ITRs are predicted to have a Gibbs free energy of unfolding higher than a wild-type ITR of AAV2 (-92.9 kcal/mol) and are as follows: (a) The modified ITRs with a single-arm/single-unpaired-loop structure provided herein are predicted to have a Gibbs free energy of unfolding that ranges between -85 and -70 kcal/mol. (b) The modified ITRs with a single-hairpin structure provided herein are predicted to have a Gibbs free energy of unfolding that ranges between -70 and -40 kcal/mol. (c) The modified ITRs with a two-arm structure provided herein are predicted to have a Gibbs free energy of unfolding that ranges between -90 and -70
- modified ITRs having higher Gibbs free energy of unfolding e.g. , a single-arm/single-unpaired-loop structure, a single-hairpin structure, a truncated structure - tend to be replicated more efficiently than wild-type ITRs.
- the left ITR of the ceDNA vector is modified or mutated with respect to a wild type (wt) AAV ITR structure, and the right ITR is a wild type AAV ITR.
- the right ITR of the ceDNA vector is modified with respect to a wild type AAV ITR structure, and the left ITR is a wild type AAV ITR.
- a modification of the ITR e.g., the left or right ITR
- the ITRs used herein can be resolvable and non-resolvable, and selected for use in the ceDNA vectors are preferably AAV sequences, with serotypes 1, 2, 3, 4, 5, 6, 7, 8 and 9 being preferred.
- Resolvable AAV ITRs do not require a wild-type ITR sequence (e.g., the endogenous or wild-type AAV ITR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, integration, and/or provirus rescue, and the like.
- the ITRs are from the same AAV serotype, e.g., both ITR sequences of the ceDNA vector are from AAV2.
- the ITRs may be synthetic sequences that function as AAV inverted terminal repeats, such as the "double- D sequence" as described in U.S. Pat. No. 5,478,745 to Samulski et al. While not necessary, the ITRs can be from the same parvovirus, e.g., both ITR sequences are from AAV2.
- ceDNA can include an ITR structure that is mutated with respect to one of the wild type ITRs disclosed herein, but where the mutant or modified ITR still retains an operable Rep binding site (RBE or RBE') and terminal resolution site (trs).
- the mutant ceDNA ITR includes a functional replication protein site (RPS- 1) and a replication competent protein that binds the RPS-1 site is used in production.
- At least one of the ITRs is a defective ITR with respect to Rep binding and/or Rep nicking.
- the defect is at least 30% relative to a wild type reduction ITR, in other embodiments it is at least 35%..., 50%..., 65%..., 75%..., 85%..., 90%..., 95%..., 98%..., or completely lacking in function or any point h between.
- the host cells do not express viral capsid proteins and the polynucleotide vector template is devoid of any viral capsid coding sequences.
- the polynucleotide vector templates and host cells that are devoid of AAV capsid genes and the resultant protein also do not encode or express capsid genes of other viruses.
- the nucleic acid molecule is also devoid of AAV Rep protein coding sequences
- the structural element of the ITR can be any structural element that is involved in the functional interaction of the ITR with a large Rep protein (e.g., Rep 78 or Rep 68).
- the structural element provides selectivity to the interaction of an ITR with a large Rep protein, i.e., determines at least in part which Rep protein functionally interacts with the ITR.
- the structural element physically interacts with a large Rep protein when the Rep protein is bound to the ITR.
- Each structural element can be, e.g., a secondary structure of the ITR, a nucleotide sequence of the ITR, a spacing between two or more elements, or a combination of any of the above.
- the structural elements are selected from the group consisting of an A and an A' arm, a B and a B' arm, a C and a C arm, a D arm, a Rep binding site (RBE) and an RBE' (i.e., complentary RBE sequence), and a terminal resolution sire (trs).
- the ability of a structural element to functionally interact with a particular large Rep protein can be altered by modifying the structural element.
- the nucleotide sequence of the structural element can be modified as compared to the wild-type sequence of the ITR.
- the structural element e.g., A arm, A' arm, B arm, B' arm, C arm, C arm, D arm, RBE, RBE', and trs
- the structural element of an ITR can be removed and replaced with a wild-type structural element from a different parvovirus.
- the replacement structure can be from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, snake parvovirus (e.g., royal python parvovirus), bovine parvovirus, goat parvovirus, avian parvovirus, canine parvovirus, equine parvovirus, shrimp parvovirus, porcine parvovirus, or insect AAV.
- the ITR can be an AAV2 ITR and the A or A' arm or RBE can be replaced with a structural element from AAV5.
- the ITR can be an AAV5 ITR and the C or C arms, the RBE, and the trs can be replaced with a structural element from AAV2.
- the AAV ITR can be an AAV5 ITR with the B and B' arms replaced with the AAV2 ITR B and B' arms.
- Table 1 indicates exemplary modifications of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in regions of modified ITRs, where X is indicative of a modification of at least one nucleic acid (e.g., a deletion, insertion and/ or substitution) in that section relative to the corresponding wild-type ITR.
- any modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in any of the regions of C and/or C and/or B and/or B' retains three sequential T nucleotides (i.e., TTT) in at least one terminal loop.
- a single arm ITR e.g., single C-C arm, or a single B-B' arm
- a modified C-B' arm or C'-B arm or a two arm ITR with at least one truncated arm (e.g., a truncated C-C arm and/or truncated B-B' arm)
- at least the single arm or at least one of the arms of a two arm ITR (where one arm can be truncated) retains three sequential T nucleotides (i.e., TTT) in at least one terminal loop.
- a truncated C-C arm and/or a truncated B-B' arm has three sequential T nucleotides (i.e., TTT) in the terminal loop.
- Table 1 Exemplary combinations of modifications of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) to different B-B' and C-C regions or arms of ITRs (X indicates a nucleotide modification, e.g., addition, deletion or substitution of at least one nucleotide in the region).
- X indicates a nucleotide modification, e.g., addition, deletion or substitution of at least one nucleotide in the region.
- a modified ITR for use herein can comprise any one of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide in any one or more of the regions selected from: between A' and C, between C and C, between C and B, between B and B' and between B' and A.
- any modification of at least one nucleotide e.g., a deletion, insertion and/ or substitution
- in the C or C or B or B' regions still preserves the terminal loop of the stem-loop.
- any modification of at least one nucleotide e.g., a deletion, insertion and/ or substitution
- C and C and/or B and B' retains three sequential T nucleotide (i.e., TTT) in at least one terminal loop.
- any modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) between C and C and/or B and B' retains three sequential A nucleotides (i.e., AAA) in at least one terminal loop
- a modified ITR for use herein can comprise any one of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in any one or more of the regions selected from: A', A and/or D.
- a modified ITR for use herein can comprise any one of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in the A region.
- a modified ITR for use herein can comprise any one of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in the A' region.
- a modified ITR for use herein can comprise any one of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in the A and/or A' region.
- a modified ITR for use herein can comprise any one of the combinations of modifications shown in Table 1, and also a modification of at least one nucleotide (e.g., a deletion, insertion and/ or substitution) in the D region.
- the nucleotide sequence of the structural element can be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides or any range therein) to produce a modified structural element.
- the specific modifications to the ITRs are exemplified herein (e.g., SEQ ID NOS: 2, 52, 63, 64, 101- 499, or 545-547).
- an ITR can be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides or any range therein).
- the ITR can have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity with one of the modified ITRs of SEQ ID NOS: 469-499 or 545-547, or the RBE-containing section of the A-A' arm and C-C and B- B' arms of SEQ ID NO: 101-134 or 545-547.
- a modified ITR can for example, comprise removal or deletion of all of a particular arm, e.g., all or part of the A-A' arm, or all or part of the B-B' arm or all or part of the C-C arm, or alternatively, the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs forming the stem of the loop so long as the final loop capping the stem (e.g., single arm) is still present (e.g., see ITR-6).
- a modified ITR can comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B-B' arm.
- a modified ITR can comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C-C arm. In some embodiments, a modified ITR can comprise the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the C-C arm and the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs from the B-B' arm. Any combination of removal of base pairs is envisioned, for example, 6 base pairs can be removed in the C-C arm and 2 base pairs in the B-B' arm. As an illustrative example, FIG.
- 13A-13B show an exemplary modified ITR with at least 7 base pairs deleted from each of the C portion and the C portion, a substitution of a nucleotide in the loop between C and C region, and at least one base pair deletion from each of the B region and B' regions such that the modified ITR comprises two arms where at least one arm (e.g., C-C) is truncated.
- arm B-B' is also truncated relative to WT ITR.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each of the C portion and the C portion of the C-C arm such that the C-C arm is truncated. That is, if a base is removed in the C portion of the C-C arm, the complementary base pair in the C portion is removed, thereby truncating the C-C arm.
- 2, 4, 6, 8 or more base pairs are removed from the C-C arm such that the C-C arm is truncated.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C portion of the C-C arm such that only C portion of the arm remains.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the C portion of the C-C arm such that only C portion of the arm remains.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more complementary base pairs are removed from each of the B portion and the B' portion of the B-B' arm such that the B-B' arm is truncated. That is, if a base is removed in the B portion of the B-B' arm, the complementary base pair in the B' portion is removed, thereby truncating the B-B' arm.
- 2, 4, 6, 8 or more base pairs are removed from the B-B' arm such that the B-B' arm is truncated.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the B portion of the B-B' arm such that only B' portion of the arm remains.
- 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs are removed from the B' portion of the B-B' arm such that only B portion of the arm remains.
- a modified ITR can have between 1 and 50 (e.g. 1, 2, 3, 4, 5,
- a modified ITR can have between 1 and 30 nucleotide deletions relative to a full-length WT ITR sequence. In some embodiments, a modified ITR has between 2 and 20 nucleotide deletions relative to a full-length wild-type ITR sequence.
- a modified ITR forms two opposing, lengthwise-asymmetric stem-loops, e.g., C-C loop is a different length to the B-B' loop.
- one of the opposing, lengthwise-asymmetric stem-loops of a modified ITR has a C-C and/or B-B' stem portion in the range of 8 to 10 base pairs in length and a loop portion (e.g., between C-C or between B-B') having 2 to 5 unpaired deoxyribonucleotides.
- a one lengthwise -asymmetric stem-loop of a modified ITR has a C-C and/or B-B' stem portion of less than 8, or less than 7, 6, 5, 4, 3, 2, 1 base pairs in length and a loop portion (e.g., between C-C or between B-B') having between 0-5 nucleotides.
- a modified ITR with a lengthwise-asymmetric stem-loop has a C-C and/or B-B' stem portion less than 3 base pairs in length.
- a modified ITR does not contain any nucleotide deletions in the RBE-containing portion of the A or A' regions, so as not to interfere with DNA replication (e.g. binding to a RBE by Rep protein, or nicking at a terminal resolution site).
- a modified ITR encompassed for use herein has one or more deletions in the B, B', C, and/or C region as described herein.
- modified ITRS are shown in FIGS 9A-26B.
- a modified ITR can comprise a deletion of the B-B' arm, so that the C-C arm remains, for example, see exemplary ITR-2 (left) and ITR-2 (right) shown in FIG 9A-9B and ITR-4 (left) and ITR-4 (right) (FIGS, 1 lA-1 IB).
- a modified ITR can comprise a deletion of the C-C arm such that the B-B' arm remains, for example, see exemplary ITR-3 (left) and ITR-3 (right) shown in FIG 10A-10B.
- a modified ITR can comprise a deletion of the B-B' arm and C-C arm such that a single stem-loop remains, for example, see exemplary ITR-6 (left) and ITR-6 (right) shown in FIG 14A-14B, and ITR-21 and ITR-37.
- a modified ITR can comprise a deletion of the C region such that a truncated C- loop and B-B' arm remains, for example, see exemplary ITR-1 (left) and ITR-1 (right) shown in FIG 15A-15B.
- a modified ITR can comprise a deletion of the C region such that a truncated C'-loop and B-B' arm remains, for example, see exemplary ITR-5 (left) and ITR-5 (right) shown in FIG 16A-16B.
- a modified ITR can comprise a deletion of base pairs in any one or more of: the C portion, the C portion, the B portion or the B' portion, such that
- a modified ITR for use herein can comprise a modification (e.g., deletion, substitution or addition) of at least 1, 2, 3, 4, 5, 6 nucleotides in any one or more of the regions selected from: between A' and C, between C and C, between C and B, between B and B' and between B' and A.
- the nucleotide between B' and C in a modified right ITR can be substituted from a nA to a G, C or A or deleted or one or more nucleotides added;
- a nucleotide between C and B in a modified left ITR can be changed from a T to a G, C or A, or deleted or one or more nucleotides added.
- the ceDNA vector does not have a modified ITR consisting of the nucleotide sequence selected from any of: SEQ ID NOs: 550-557. In certain embodiments of the present invention, the ceDNA vector does not have a modified ITR comprising the nucleotide sequence selected from any of: SEQ ID NOs: 550-557.
- the ceDNA vector comprises a regulatory switch as disclosed herein and a modified ITR selected having the nucleotide sequence selected from any of the group consisting of: SEQ ID NO: 550-557.
- the structure of the structural element can be modified.
- the structural element a change in the height of the stem and/or the number of nucleotides in the loop.
- the height of the stem can be about 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides or more or any range therein.
- the stem height can be about 5 nucleotides to about 9 nucleotides and functionally interacts with Rep.
- the stem height can be about 7 nucleotides and functionally interacts with Rep.
- the loop can have 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides or more or any range therein.
- the number of GAGY binding sites or GAGY-related binding sites within the RBE or extended RBE can be increased or decreased.
- the RBE or extended RBE can comprise 1, 2, 3, 4, 5, or 6 or more GAGY binding sites or any range therein.
- Each GAGY binding site can independently be an exact GAGY sequence or a sequence similar to GAGY as long as the sequence is sufficient to bind a Rep protein.
- the spacing between two elements can be altered (e.g., increased or decreased) to alter functional interaction with a large Rep protein.
- the spacing can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides or more or any range therein.
- the ceDNA vector described herein can include an ITR structure that is modified with respect to the wild type AAV2 ITR structure disclosed herein, but still retains an operable RBE, trs and RBE ' portion.
- FIG. 2A and FIG. 2B show one possible mechanism for the operation of a trs site within a wild type ITR structure portion of a ceDNA vector.
- the ceDNA vector contains one or more functional ITR polynucleotide sequences that comprise a Rep-binding site (RBS; 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 531) for AAV2) and a terminal resolution site (TRS; 5'-AGTT (SEQ ID NO: 46)).
- At least one ITR (wt or modified ITR) is functional.
- a ceDNA vector comprises two modified ITRs that are different or asymmetrical to each other, at least one modified ITR is functional and at least one modified ITR is non-functional.
- a ceDNA vector does not have a modified ITR selected from any sequence consisting of, or consisting essentially of: SEQ ID NOs:500-529, as provided herein. In some embodiments, a ceDNA vector does not have an ITR that is selected from any sequence selected from SEQ ID NOs: 500-529.
- the modified ITR (e.g., the left or right ITR) of the ceDNA vector described herein has modifications within the loop arm, the truncated arm, or the spacer.
- Exemplary sequences of ITRs having modifications within the loop arm, the truncated arm, or the spacer are listed in Table 2.
- the modified ITR (e.g., the left or right ITR) of the ceDNA vector described herein has modifications within the loop arm and the truncated arm. Exemplary sequences of ITRs having modifications within the loop arm and the truncated arm are listed in Table 3. [00155] In some embodiments, the modified ITR (e.g., the left or right ITR) of the ceDNA vector described herein has modifications within the loop arm and the spacer. Exemplary sequences of ITRs having modifications within the loop arm and the spacer are listed in Table 4.
- the modified ITR (e.g., the left or right ITR) of the ceDNA vector described herein has modifications within the truncated arm and the spacer.
- Exemplary sequences of ITRs having modifications within the truncated arm and the spacer are listed in Table 5.
- the modified ITR (e.g., the left or right ITR) of the ceDNA vector described herein has modifications within the loop arm, the truncated arm, and the spacer.
- the ITR (e.g., the left or right ITR) is modified such that it comprises the lowest energy of unfolding ("low energy structure").
- a low energy will have reduced Gibbs free energy as compared to a wild type ITR.
- Exemplary sequences of ITRs that are modified to low (i.e., reduced) energy of unfolding are presented herein in Table 7-9.
- the modified ITR is selected from any or a combination of those shown in Table 2-9, 10A or 10B.
- Table 2 ITR Sequences with Modifications in Loop Arm, Truncated Arm or Spacer.
- GCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC 2 268 GCGCTCGCTCGCTCACTAAGGCCAAAAAAAAAAA I 1 1 1 1 1 1 I GAC -58.1 GCCCGGGCGGCCTTAGTGAGCGAGCGAGCGCGC 1
- Table 5 ITR Sequences with Modifications in Truncated Arm and Spacer 314 GCGCGCTCGCTCGCTCAATAAAACCGGGCGACCAAAGGTCGCCCGA -64.3
- the modified ITR can be generated to include deletion, insertion, or substitution of one or more nucleotides from the wild-type ITR derived from AAV genome.
- the modified ITR can be generated by genetic modification during propagation in a plasmid in
- the modified ITR include deletion, insertion, or substitution of one or more nucleotides from the wild-type ITR of AAV2 (Left) (SEQ ID NO: 51) or the wild-type ITR of AAV2 (Right) (SEQ ID NO: 1). Specifically, one or more nucleotides are deleted, inserted, or substituted from B-C or C-C of the T-shaped stem-loop structure.
- the modified ITR includes no modification in the Rep-binding elements (RBE) and the terminal resolution site (trs) of wild-type ITR of AAV2, although the RBE'(TTT) may be or may not be present depending on the whether the template has undergone one round of replication thereby converting the AAA triplet to the complimentary RBE' - TTT.
- RBE Rep-binding elements
- trs terminal resolution site
- modified ITRs Three types are exemplified - ( 1) a modified ITR having a lowest energy structure comprising a single arm and a single unpaired loop ("single-arm/single-unpaired-loop structure"); (2) a modified ITR having a lowest energy structure with a single hairpin ("single-hairpin structure”); and (3) a modified ITR having a lowest energy structure with two arms, one of which is truncated ("truncated structure”).
- Modified ITR with a single-arm/single-unpaired-loop structure [00165]
- the wild-type ITR can be modified to form a secondary structure comprising a single arm and a single unpaired loop (i.e., "single-arm/single-unpaired-loop structure").
- Gibbs free energy (AG) of unfolding of the structure can range between -85 kcal/mol and -70 kcal/mol.
- Exemplary structures of the modified ITRs are provided.
- Modified ITRs predicted to form the single-arm/single-unpaired-loop structure can include deletion, insertion, or substitution of one or more nucleotides from the wild-type ITR in the sequences forming B and B' arm and/or C and C arm. Modified ITR can be generated by genetic modification or biological and/or chemical synthesis.
- ITR-2 Left and Right provided in FIGS. 9A-9B (SEQ ID NOS: 101 and 102), are generated to have deletion of two nucleotides from C-C arm and deletion of 16 nucleotides from B-B' arm in the wild-type ITR of AAV2. Three nucleotides remaining in the B-B' arm of the modified ITR do not make a complementary pairing.
- ITR-2 Left and Right have the lowest energy structure with a single C-C arm and a single unpaired loop. Gibbs free energy of unfolding the structure is predicted to be about -72.6 kcal/mol.
- ITR-3 Left and Right provided in FIGS. 10A and 10B (SEQ ID NOS: 103 and 104), are generated to include 19 nucleotide deletions in C-C arm from the wild-type ITR of AAV2. Three nucleotides remaining in the B-B' arm of the modified ITR do not make a complementary pairing. Thus, ITR-3 Left and Right have the lowest energy structure with a single B-B' arm and a single unpaired loop. Gibbs free energy of unfolding the structure is predicted to be about -74.8 kcal/mol.
- ITR-4 Left and Right provided in FIGS. 11A and 1 IB (SEQ ID NOS: 105 and 106), are generated to include 19 nucleotide deletions in B-B' arm from the wild-type ITR of AAV2. Three nucleotides remaining in the B-B' arm of modified ITR do not make a complementary pairing. Thus, ITR-4 Left and Right have the lowest energy structure with a single C-C arm and a single unpaired loop. Gibbs free energy of unfolding the structure is predicted to be about -76.9 kcal/mol.
- ITR-10 Left and Right provided in FIGS. 12A and 12B are generated to include 8 nucleotide deletions in B-B' arm from the wild-type ITR of AAV2.
- ITR-10 Left and Right have the lowest energy structure with a single B-C or C-B' arm and a single unpaired loop. Gibbs free energy of unfolding the structure is predicted to be about -83.7 kcal/mol.
- ITR-17 Left and Right provided in FIGS. 13A and 13B (SEQ ID NOS: 109 and 110), are generated to include 14 nucleotide deletions in C-C arm from the wild-type ITR of AAV2. Eight nucleotides remaining in the C-C arm do not make complementary bonds. As a result, ITR-17 Left and Right have the lowest energy structure with a single B-B' arm and a single unpaired loop. Gibbs free energy of unfolding the structure is predicted to be about -73.3 kcal/mol.
- Table 7 Alignment of wt-ITR and modified ITRs (ITR-2, ITR-3, ITR-4, ITR-10 and ITR- 17) with a sin le-arm/single-unpaired-loop structure.
- the wild-type ITR can be modified to have the lowest energy structure comprising a single-hairpin structure. Gibbs free energy (AG) of unfolding of the structure can range between -70 kcal/mol and -40 kcal/mol. Exemplary structures of the modified ITRs are provided in FIGS. 14A and 14B.
- Modified ITRs predicted to form the single hairpin structure can include deletion, insertion, or substitution of one or more nucleotides from the wild-type ITR in the sequences forming B and B' arm and/or C and C arm. Modified ITR can be generated by genetic modification or biological and/or chemical synthesis.
- ITR-6 Left and Right provided in FIGS. 14A and 14B include 40 nucleotide deletions in B-B' and C-C arms from the wild-type ITR of AAV2. Nucleotides remaining in the modified ITR are predicted to form a single hairpin structure. Gibbs free energy of unfolding the structure is about -54.4 kcal/mol.
- Table 8 Alignment of wt-ITR and modified ITR-6 with a single -hairpin structure.
- the wild-type ITR can be modified to have the lowest energy structure comprising two arms, one of which is truncated.
- Their Gibbs free energy (AG) of unfolding ranges between -90 and -70 kcal/mol. Thus, their Gibbs free energies of unfolding are lower than the wild-type ITR of AAV2.
- the modified ITRs can include deletion, insertion, or substitution of one or more nucleotides from the wild-type ITR in the sequences forming B and B' arm and/or C and C arm.
- a modified ITR can, for example, comprise removal of all of a particular loop, e.g., A-A' loop, B-B' loop or C-C loop, or alternatively, the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9 or more base pairs forming the stem of the loop so long as the final loop at the end of the stem is still present.
- Modified ITR can be generated by genetic modification or biological and/or chemical synthesis.
- FIGS. 15A-15B are identical to FIGS. 15A-15B.
- Table 9 Alignment of wt-ITR and modified ITRs (ITR-5, ITR-7, ITR-8, ITR-9, ITR-
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2018327348A AU2018327348A1 (en) | 2017-09-08 | 2018-09-07 | Modified closed-ended DNA (ceDNA) |
| RU2020109904A RU2800026C2 (ru) | 2017-09-08 | 2018-09-07 | МОДИФИЦИРОВАННАЯ ДНК С ЗАМКНУТЫМИ КОНЦАМИ (зкДНК) |
| UAA202000594A UA129010C2 (uk) | 2017-09-08 | 2018-09-07 | Невірусний безкапсидний днк-вектор із ковалентно закритими кінцями |
| MX2020002500A MX2020002500A (es) | 2017-09-08 | 2018-09-07 | Adn de extremo cerrado modificado (adnec). |
| CA3075168A CA3075168A1 (en) | 2017-09-08 | 2018-09-07 | Modified closed-ended dna (cedna) |
| SG11202000698SA SG11202000698SA (en) | 2017-09-08 | 2018-09-07 | Modified closed-ended dna (cedna) |
| JP2020512843A JP2020532981A (ja) | 2017-09-08 | 2018-09-07 | 修飾型閉端dna(cedna) |
| KR1020207009737A KR20200051011A (ko) | 2017-09-08 | 2018-09-07 | 변형된 폐쇄-종결된 dna(cedna) |
| CN201880058155.7A CN111132699A (zh) | 2017-09-08 | 2018-09-07 | 修饰的封闭端dna(cedna) |
| BR112020004151-3A BR112020004151A2 (pt) | 2017-09-08 | 2018-09-07 | dna modificado de extremidade fechada (cedna) |
| US16/644,568 US20200283794A1 (en) | 2017-09-08 | 2018-09-07 | Modified closed-ended dna (cedna) |
| EP18854941.4A EP3678710A4 (en) | 2017-09-08 | 2018-09-07 | MODIFIED CLOSED-END DNA (CEDNA) |
| NZ761178A NZ761178B2 (en) | 2018-09-07 | Modified closed-ended dna (cedna) | |
| IL272797A IL272797A (en) | 2017-09-08 | 2020-02-20 | DNA with a modified closed end |
| PH12020500465A PH12020500465A1 (en) | 2017-09-08 | 2020-03-06 | Modified closed-ended dna (cedna) |
Applications Claiming Priority (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762556331P | 2017-09-08 | 2017-09-08 | |
| US201762556324P | 2017-09-08 | 2017-09-08 | |
| US201762556335P | 2017-09-08 | 2017-09-08 | |
| US201762556329P | 2017-09-08 | 2017-09-08 | |
| US201762556319P | 2017-09-08 | 2017-09-08 | |
| US201762556281P | 2017-09-08 | 2017-09-08 | |
| US62/556,329 | 2017-09-08 | ||
| US62/556,331 | 2017-09-08 | ||
| US62/556,324 | 2017-09-08 | ||
| US62/556,281 | 2017-09-08 | ||
| US62/556,335 | 2017-09-08 | ||
| US62/556,319 | 2017-09-08 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019051255A1 true WO2019051255A1 (en) | 2019-03-14 |
Family
ID=65635235
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/049996 Ceased WO2019051255A1 (en) | 2017-09-08 | 2018-09-07 | CLOSED-ENDED DNA (CEDNA) MODIFIED |
Country Status (15)
| Country | Link |
|---|---|
| US (1) | US20200283794A1 (https=) |
| EP (1) | EP3678710A4 (https=) |
| JP (3) | JP2020532981A (https=) |
| KR (1) | KR20200051011A (https=) |
| CN (1) | CN111132699A (https=) |
| AU (1) | AU2018327348A1 (https=) |
| BR (1) | BR112020004151A2 (https=) |
| CA (1) | CA3075168A1 (https=) |
| IL (1) | IL272797A (https=) |
| MA (1) | MA50100A (https=) |
| MX (1) | MX2020002500A (https=) |
| PH (1) | PH12020500465A1 (https=) |
| SG (1) | SG11202000698SA (https=) |
| UA (1) | UA129010C2 (https=) |
| WO (1) | WO2019051255A1 (https=) |
Cited By (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10704021B2 (en) | 2012-03-15 | 2020-07-07 | Flodesign Sonics, Inc. | Acoustic perfusion devices |
| US10785574B2 (en) | 2017-12-14 | 2020-09-22 | Flodesign Sonics, Inc. | Acoustic transducer driver and controller |
| WO2020217057A1 (en) | 2019-04-23 | 2020-10-29 | Lightbio Limited | Nucleic acid constructs and methods for their manufacture |
| WO2021011842A1 (en) * | 2019-07-17 | 2021-01-21 | Generation Bio Co. | Synthetic production of single-stranded adeno associated viral dna vectors |
| WO2021011840A1 (en) * | 2019-07-17 | 2021-01-21 | Generation Bio Co. | Compositions and production of nicked closed-ended dna vectors |
| WO2021046265A1 (en) * | 2019-09-06 | 2021-03-11 | Generation Bio Co. | Lipid nanoparticle compositions comprising closed-ended dna and cleavable lipids and methods of use thereof |
| WO2021055760A1 (en) * | 2019-09-18 | 2021-03-25 | Intergalactic Therapeutics, Inc. | Synthetic dna vectors and methods of use |
| US10975368B2 (en) | 2014-01-08 | 2021-04-13 | Flodesign Sonics, Inc. | Acoustophoresis device with dual acoustophoretic chamber |
| WO2021072031A1 (en) * | 2019-10-11 | 2021-04-15 | Insideoutbio, Inc. | Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases |
| EP3720952A4 (en) * | 2017-12-06 | 2021-09-01 | Generation Bio Co. | GENE EDITING USING CLOSED-END MODIFIED DNA (ADNCE) |
| WO2021169167A1 (en) * | 2020-02-29 | 2021-09-02 | Nanjing GenScript Biotech Co., Ltd. | Method for treating coronavirus infections |
| EP3752191A4 (en) * | 2018-02-14 | 2021-12-22 | Generation Bio Co. | NON-VIRAL DNA VECTORS AND ASSOCIATED USES FOR THE PRODUCTION OF ANTIBODIES AND FUSION PROTEINS |
| WO2022046665A1 (en) | 2020-08-23 | 2022-03-03 | Bioverativ Therapeutics Inc. | MODIFIED BACULOVIRUS SYSTEM FOR IMPROVED PRODUCTION OF CLOSED-ENDED DNA (ceDNA) |
| WO2022058755A1 (en) * | 2020-09-18 | 2022-03-24 | Lightbio Limited | Self-targeting expression vector |
| US11377651B2 (en) | 2016-10-19 | 2022-07-05 | Flodesign Sonics, Inc. | Cell therapy processes utilizing acoustophoresis |
| US20220288101A1 (en) * | 2019-08-15 | 2022-09-15 | The Children's Hospital Of Philadelphia | Combined transgene and intron-derived mirna therapy for treatment of sca1 |
| WO2022232289A1 (en) * | 2021-04-27 | 2022-11-03 | Generation Bio Co. | Non-viral dna vectors expressing therapeutic antibodies and uses thereof |
| WO2022232286A1 (en) * | 2021-04-27 | 2022-11-03 | Generation Bio Co. | Non-viral dna vectors expressing anti-coronavirus antibodies and uses thereof |
| US11634742B2 (en) | 2020-07-27 | 2023-04-25 | Anjarium Biosciences Ag | Compositions of DNA molecules, methods of making therefor, and methods of use thereof |
| JP2023520763A (ja) * | 2020-03-24 | 2023-05-19 | ジェネレーション バイオ カンパニー | ゴーシェ治療薬を発現するための非ウイルス性dnaベクター及びその使用 |
| JP2023520764A (ja) * | 2020-03-24 | 2023-05-19 | ジェネレーション バイオ カンパニー | 第ix因子治療薬を発現するための非ウイルス性dnaベクター及びその使用 |
| JP2023527747A (ja) * | 2020-05-18 | 2023-06-30 | ジェネレーション バイオ カンパニー | 新規脂質及びそれらのナノ粒子組成物 |
| US11708572B2 (en) | 2015-04-29 | 2023-07-25 | Flodesign Sonics, Inc. | Acoustic cell separation techniques and processes |
| US20230255999A1 (en) * | 2021-10-18 | 2023-08-17 | Flagship Pioneering Innovations Vii, Llc | Dna compositions and related methods |
| WO2023177655A1 (en) | 2022-03-14 | 2023-09-21 | Generation Bio Co. | Heterologous prime boost vaccine compositions and methods of use |
| JP2023542131A (ja) * | 2020-09-16 | 2023-10-05 | ジェネレーション バイオ カンパニー | フェニルアラニンヒドロキシラーゼ(pah)を発現させるための閉端dnaベクター及びその使用 |
| JP2023542132A (ja) * | 2020-09-16 | 2023-10-05 | ジェネレーション バイオ カンパニー | Fviii治療薬を発現させるための非ウイルス性dnaベクター及びその使用 |
| RU2811724C2 (ru) * | 2017-12-06 | 2024-01-16 | Дженерейшен Био Ко. | РЕДАКТИРОВАНИЕ ГЕНОВ С ИСПОЛЬЗОВАНИЕМ МОДИФИЦИРОВАННОЙ ДНК С ЗАМКНУТЫМИ КОНЦАМИ (зкДНК) |
| US11993783B1 (en) | 2023-03-27 | 2024-05-28 | Genecraft Inc. | Nucleic acid molecule comprising asymmetrically modified ITR for improving expression rate of inserted gene, and use thereof |
| WO2024204882A1 (en) * | 2023-03-27 | 2024-10-03 | Genecraft Inc. | Modified complex platform of adeno-associated virus with improved rate of expression of loaded genes and reduced genotoxicity |
| WO2024204881A1 (en) * | 2023-03-27 | 2024-10-03 | Genecraft Inc. | Adeno-associated virus complex with improved expression of runx3 gene and uses for preventing or treating kras mutated lung cancer |
| US12123013B2 (en) | 2020-03-11 | 2024-10-22 | Immatics US, Inc. | WPRE mutant constructs, compositions, and methods thereof |
| US12168776B2 (en) | 2017-08-09 | 2024-12-17 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof |
| WO2025114932A1 (en) * | 2023-11-30 | 2025-06-05 | Sanofi | Purification of closed-ended dna molecules |
| US12364774B2 (en) | 2018-08-09 | 2025-07-22 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| WO2026085495A1 (en) | 2024-10-18 | 2026-04-23 | Generation Bio Co. | Synthetic partially single-stranded nucleic acid compositions and uses and methods therefor |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20210090619A (ko) * | 2018-11-09 | 2021-07-20 | 제너레이션 바이오 컴퍼니 | 대칭인 변형된 역말단반복을 포함하는 변형된 폐쇄형 DNA(ceDNA) |
| US20220243201A1 (en) * | 2020-08-23 | 2022-08-04 | Bioverativ Therapeutics Inc. | Engineered itr sequences and methods of use |
| CA3211687A1 (en) * | 2021-03-19 | 2022-09-22 | Ozan ALKAN | Non-viral dna vectors and uses thereof for expressing pfic therapeutics |
| US20240209393A1 (en) * | 2021-04-26 | 2024-06-27 | University Of Florida Research Foundation, Incorporated | Synthetic aav vectors for repeated delivery of therapeutic genes |
| CA3218126A1 (en) * | 2021-05-07 | 2022-11-10 | Matthew MANGANIELLO | Lyophilized non-viral dna vector compositions and uses thereof |
| KR20240005903A (ko) * | 2021-05-07 | 2024-01-12 | 제너레이션 바이오 컴퍼니 | 백신 전달을 위한 비바이러스성 dna 벡터 |
| CN117802161A (zh) * | 2022-06-30 | 2024-04-02 | 苏州吉恒基因科技有限公司 | 精准重组腺相关病毒载体及其用途 |
| US20260055426A1 (en) * | 2022-08-19 | 2026-02-26 | Generation Bio Co. | CLEAVABLE CLOSED-ENDED DNA (ceDNA) AND METHODS OF USE THEREOF |
| AU2024229184A1 (en) | 2023-03-02 | 2025-08-28 | Krystal Biotech, Inc. | Interleukin-2 and interleukin-12 for cancer therapy |
| EP4698646A2 (en) * | 2023-04-21 | 2026-02-25 | ARIZONA BOARD OF REGENTS ON BEHALF OF ARIZONA STATE UNIVERSITY 1475 North Scottsdale Road | Novel transmembrane sensors and method of characterization for lysis-free detection of intracellular targets |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140107186A1 (en) * | 2011-03-11 | 2014-04-17 | Association Institut De Myologie | Capsid-free aav vectors, compositions, and methods for vector production and gene delivery |
| WO2017123918A1 (en) * | 2016-01-15 | 2017-07-20 | American Gene Technologies International Inc. | Methods and compositons for the activation of gamma-delta t-cells |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050019824A1 (en) * | 1994-03-08 | 2005-01-27 | Human Genome Sciences, Inc. | Fibroblast Growth Factor-10 |
| US20050026838A1 (en) * | 1995-06-05 | 2005-02-03 | Human Genome Sciences, Inc. | Fibroblast Growth Factor-13 |
| DE10044384A1 (de) * | 2000-09-08 | 2002-04-18 | Medigene Ag | Wirtszellen zur Verpackung von rekombinantem Adeno-assoziiertem Virus (rAAV), Verfahren zu ihrer Herstellung und deren Verwendung |
| US20060166363A1 (en) * | 2004-01-27 | 2006-07-27 | Sergei Zolotukhin | Modified baculovirus expression system for production of pseudotyped rAAV vector |
| WO2008016391A2 (en) * | 2006-01-31 | 2008-02-07 | The Board Of Trustees Of The Leland Stanford Junior University | Self-complementary parvoviral vectors, and methods for making and using the same |
| US9943574B2 (en) * | 2012-06-27 | 2018-04-17 | Arthrogen B.V. | Combination for treating an inflammatory disorder |
| CN104087613B (zh) * | 2014-06-30 | 2017-08-29 | 中国科学院苏州生物医学工程技术研究所 | 基于aav‑itr的基因表达微载体及其构建方法和应用 |
| MX2018010633A (es) * | 2016-03-03 | 2019-06-13 | Univ Massachusetts | Acido desoxirribonucleico (adn) lineal duplex de extremos cerrados para transferencia genica no viral. |
-
2018
- 2018-09-07 CA CA3075168A patent/CA3075168A1/en active Pending
- 2018-09-07 US US16/644,568 patent/US20200283794A1/en not_active Abandoned
- 2018-09-07 MX MX2020002500A patent/MX2020002500A/es unknown
- 2018-09-07 WO PCT/US2018/049996 patent/WO2019051255A1/en not_active Ceased
- 2018-09-07 EP EP18854941.4A patent/EP3678710A4/en active Pending
- 2018-09-07 AU AU2018327348A patent/AU2018327348A1/en not_active Abandoned
- 2018-09-07 BR BR112020004151-3A patent/BR112020004151A2/pt not_active Application Discontinuation
- 2018-09-07 MA MA050100A patent/MA50100A/fr unknown
- 2018-09-07 KR KR1020207009737A patent/KR20200051011A/ko not_active Ceased
- 2018-09-07 SG SG11202000698SA patent/SG11202000698SA/en unknown
- 2018-09-07 JP JP2020512843A patent/JP2020532981A/ja active Pending
- 2018-09-07 UA UAA202000594A patent/UA129010C2/uk unknown
- 2018-09-07 CN CN201880058155.7A patent/CN111132699A/zh active Pending
-
2020
- 2020-02-20 IL IL272797A patent/IL272797A/en unknown
- 2020-03-06 PH PH12020500465A patent/PH12020500465A1/en unknown
-
2022
- 2022-11-02 JP JP2022176371A patent/JP2022190081A/ja active Pending
-
2024
- 2024-10-28 JP JP2024189111A patent/JP2025010253A/ja active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140107186A1 (en) * | 2011-03-11 | 2014-04-17 | Association Institut De Myologie | Capsid-free aav vectors, compositions, and methods for vector production and gene delivery |
| WO2017123918A1 (en) * | 2016-01-15 | 2017-07-20 | American Gene Technologies International Inc. | Methods and compositons for the activation of gamma-delta t-cells |
Cited By (53)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10704021B2 (en) | 2012-03-15 | 2020-07-07 | Flodesign Sonics, Inc. | Acoustic perfusion devices |
| US10975368B2 (en) | 2014-01-08 | 2021-04-13 | Flodesign Sonics, Inc. | Acoustophoresis device with dual acoustophoretic chamber |
| US11708572B2 (en) | 2015-04-29 | 2023-07-25 | Flodesign Sonics, Inc. | Acoustic cell separation techniques and processes |
| US11377651B2 (en) | 2016-10-19 | 2022-07-05 | Flodesign Sonics, Inc. | Cell therapy processes utilizing acoustophoresis |
| US12168776B2 (en) | 2017-08-09 | 2024-12-17 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof |
| RU2811724C2 (ru) * | 2017-12-06 | 2024-01-16 | Дженерейшен Био Ко. | РЕДАКТИРОВАНИЕ ГЕНОВ С ИСПОЛЬЗОВАНИЕМ МОДИФИЦИРОВАННОЙ ДНК С ЗАМКНУТЫМИ КОНЦАМИ (зкДНК) |
| EP3720952A4 (en) * | 2017-12-06 | 2021-09-01 | Generation Bio Co. | GENE EDITING USING CLOSED-END MODIFIED DNA (ADNCE) |
| US10785574B2 (en) | 2017-12-14 | 2020-09-22 | Flodesign Sonics, Inc. | Acoustic transducer driver and controller |
| EP3752191A4 (en) * | 2018-02-14 | 2021-12-22 | Generation Bio Co. | NON-VIRAL DNA VECTORS AND ASSOCIATED USES FOR THE PRODUCTION OF ANTIBODIES AND FUSION PROTEINS |
| US12364774B2 (en) | 2018-08-09 | 2025-07-22 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| RU2812852C2 (ru) * | 2019-03-13 | 2024-02-02 | Дженерейшен Био Ко. | Невирусные днк-векторы и варианты их применения для экспрессии терапевтического средства на основе фактора viii (fviii) |
| CN113874504A (zh) * | 2019-04-23 | 2021-12-31 | 莱特比奥有限公司 | 核酸构建体和其制造方法 |
| CN113874504B (zh) * | 2019-04-23 | 2024-06-14 | 莱特比奥有限公司 | 核酸构建体和其制造方法 |
| WO2020217057A1 (en) | 2019-04-23 | 2020-10-29 | Lightbio Limited | Nucleic acid constructs and methods for their manufacture |
| AU2020262371B2 (en) * | 2019-04-23 | 2026-02-19 | Lightbio Limited | Nucleic acid constructs and methods for their manufacture |
| WO2021011842A1 (en) * | 2019-07-17 | 2021-01-21 | Generation Bio Co. | Synthetic production of single-stranded adeno associated viral dna vectors |
| US12577573B2 (en) | 2019-07-17 | 2026-03-17 | Generation Bio Co. | Synthetic production of single-stranded adeno associated viral DNA vectors |
| WO2021011840A1 (en) * | 2019-07-17 | 2021-01-21 | Generation Bio Co. | Compositions and production of nicked closed-ended dna vectors |
| US20220228171A1 (en) * | 2019-07-17 | 2022-07-21 | Generation Bio Co. | Compositions and production of nicked closed-ended dna vectors |
| US20220288101A1 (en) * | 2019-08-15 | 2022-09-15 | The Children's Hospital Of Philadelphia | Combined transgene and intron-derived mirna therapy for treatment of sca1 |
| CN114929205A (zh) * | 2019-09-06 | 2022-08-19 | 世代生物公司 | 包括末端封闭式dna和可切割脂质的脂质纳米颗粒组合物及其使用方法 |
| WO2021046265A1 (en) * | 2019-09-06 | 2021-03-11 | Generation Bio Co. | Lipid nanoparticle compositions comprising closed-ended dna and cleavable lipids and methods of use thereof |
| GB2606844B (en) * | 2019-09-18 | 2025-08-06 | Aldevron Llc | Synthetic DNA vectors and methods of use |
| GB2606844A (en) * | 2019-09-18 | 2022-11-23 | Intergalactic Therapeutics Inc | Synthetic DNA vectors and methods of use |
| US11602569B2 (en) | 2019-09-18 | 2023-03-14 | Intergalactic Therapeutics, Inc. | Synthetic DNA vectors and methods of use |
| WO2021055760A1 (en) * | 2019-09-18 | 2021-03-25 | Intergalactic Therapeutics, Inc. | Synthetic dna vectors and methods of use |
| US11766490B2 (en) | 2019-09-18 | 2023-09-26 | Intergalactic Therapeutics, Inc. | Synthetic DNA vectors and methods of use |
| US11684680B2 (en) | 2019-09-18 | 2023-06-27 | Intergalactic Therapeutics, Inc. | Synthetic DNA vectors and methods of use |
| US11324839B2 (en) | 2019-09-18 | 2022-05-10 | Intergalactic Therapeutics, Inc. b | Synthetic DNA vectors and methods of use |
| WO2021072031A1 (en) * | 2019-10-11 | 2021-04-15 | Insideoutbio, Inc. | Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases |
| WO2021169167A1 (en) * | 2020-02-29 | 2021-09-02 | Nanjing GenScript Biotech Co., Ltd. | Method for treating coronavirus infections |
| US12123013B2 (en) | 2020-03-11 | 2024-10-22 | Immatics US, Inc. | WPRE mutant constructs, compositions, and methods thereof |
| JP2023520764A (ja) * | 2020-03-24 | 2023-05-19 | ジェネレーション バイオ カンパニー | 第ix因子治療薬を発現するための非ウイルス性dnaベクター及びその使用 |
| JP2023520763A (ja) * | 2020-03-24 | 2023-05-19 | ジェネレーション バイオ カンパニー | ゴーシェ治療薬を発現するための非ウイルス性dnaベクター及びその使用 |
| JP2023527747A (ja) * | 2020-05-18 | 2023-06-30 | ジェネレーション バイオ カンパニー | 新規脂質及びそれらのナノ粒子組成物 |
| US11634742B2 (en) | 2020-07-27 | 2023-04-25 | Anjarium Biosciences Ag | Compositions of DNA molecules, methods of making therefor, and methods of use thereof |
| WO2022046665A1 (en) | 2020-08-23 | 2022-03-03 | Bioverativ Therapeutics Inc. | MODIFIED BACULOVIRUS SYSTEM FOR IMPROVED PRODUCTION OF CLOSED-ENDED DNA (ceDNA) |
| EP4214309A4 (en) * | 2020-09-16 | 2025-07-16 | Generation Bio Co | CLOSED-END DNA VECTORS AND RELATED USES FOR EXPRESSING PHENYLALANINE HYDROXYLASE (PAH) |
| JP2023542132A (ja) * | 2020-09-16 | 2023-10-05 | ジェネレーション バイオ カンパニー | Fviii治療薬を発現させるための非ウイルス性dnaベクター及びその使用 |
| JP2023542131A (ja) * | 2020-09-16 | 2023-10-05 | ジェネレーション バイオ カンパニー | フェニルアラニンヒドロキシラーゼ(pah)を発現させるための閉端dnaベクター及びその使用 |
| WO2022058755A1 (en) * | 2020-09-18 | 2022-03-24 | Lightbio Limited | Self-targeting expression vector |
| WO2022232289A1 (en) * | 2021-04-27 | 2022-11-03 | Generation Bio Co. | Non-viral dna vectors expressing therapeutic antibodies and uses thereof |
| WO2022232286A1 (en) * | 2021-04-27 | 2022-11-03 | Generation Bio Co. | Non-viral dna vectors expressing anti-coronavirus antibodies and uses thereof |
| US12303526B2 (en) * | 2021-10-18 | 2025-05-20 | Flagship Pioneering Innovations Vii, Llc | DNA compositions and related methods |
| US20230255999A1 (en) * | 2021-10-18 | 2023-08-17 | Flagship Pioneering Innovations Vii, Llc | Dna compositions and related methods |
| WO2023177655A1 (en) | 2022-03-14 | 2023-09-21 | Generation Bio Co. | Heterologous prime boost vaccine compositions and methods of use |
| TWI903434B (zh) * | 2023-03-27 | 2025-11-01 | 韓商基因科福特公司 | 具有改良負載基因表現率及降低基因毒性之腺相關病毒之經修飾複合體平台 |
| WO2024204881A1 (en) * | 2023-03-27 | 2024-10-03 | Genecraft Inc. | Adeno-associated virus complex with improved expression of runx3 gene and uses for preventing or treating kras mutated lung cancer |
| US11993783B1 (en) | 2023-03-27 | 2024-05-28 | Genecraft Inc. | Nucleic acid molecule comprising asymmetrically modified ITR for improving expression rate of inserted gene, and use thereof |
| WO2024204883A1 (en) * | 2023-03-27 | 2024-10-03 | Genecraft Inc. | Nucleic acid molecule comprising asymmetrically modified itr for improving expression rate of inserted gene, and use thereof |
| WO2024204882A1 (en) * | 2023-03-27 | 2024-10-03 | Genecraft Inc. | Modified complex platform of adeno-associated virus with improved rate of expression of loaded genes and reduced genotoxicity |
| WO2025114932A1 (en) * | 2023-11-30 | 2025-06-05 | Sanofi | Purification of closed-ended dna molecules |
| WO2026085495A1 (en) | 2024-10-18 | 2026-04-23 | Generation Bio Co. | Synthetic partially single-stranded nucleic acid compositions and uses and methods therefor |
Also Published As
| Publication number | Publication date |
|---|---|
| IL272797A (en) | 2020-04-30 |
| RU2020109904A (ru) | 2021-10-08 |
| PH12020500465A1 (en) | 2021-01-25 |
| JP2025010253A (ja) | 2025-01-20 |
| SG11202000698SA (en) | 2020-03-30 |
| AU2018327348A1 (en) | 2020-02-20 |
| JP2022190081A (ja) | 2022-12-22 |
| MX2020002500A (es) | 2020-09-17 |
| US20200283794A1 (en) | 2020-09-10 |
| CN111132699A (zh) | 2020-05-08 |
| UA129010C2 (uk) | 2024-12-25 |
| BR112020004151A2 (pt) | 2020-09-08 |
| CA3075168A1 (en) | 2019-03-14 |
| KR20200051011A (ko) | 2020-05-12 |
| JP2020532981A (ja) | 2020-11-19 |
| EP3678710A4 (en) | 2021-06-09 |
| NZ761178A (en) | 2024-05-31 |
| MA50100A (fr) | 2020-07-15 |
| EP3678710A1 (en) | 2020-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200283794A1 (en) | Modified closed-ended dna (cedna) | |
| US12442015B2 (en) | Closed-ended DNA vectors obtainable from cell-free synthesis and process for obtaining ceDNA vectors | |
| JP7590963B2 (ja) | 対称的な修飾型逆位末端反復配列を含む修飾型閉端dna(cedna) | |
| JP7644014B2 (ja) | 閉端DNA(ceDNA)の産生におけるREPタンパク質活性の調節 | |
| US20220175970A1 (en) | Controlled expression of transgenes using closed-ended dna (cedna) vectors | |
| AU2020315444A1 (en) | Synthetic production of single-stranded adeno associated viral DNA vectors | |
| EP3999646A1 (en) | Compositions and production of nicked closed-ended dna vectors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18854941 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2018327348 Country of ref document: AU Date of ref document: 20180907 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2020512843 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 3075168 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112020004151 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 20207009737 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018854941 Country of ref document: EP Effective date: 20200408 |
|
| ENP | Entry into the national phase |
Ref document number: 112020004151 Country of ref document: BR Kind code of ref document: A2 Effective date: 20200228 |
|
| WWR | Wipo information: refused in national office |
Ref document number: 520411490 Country of ref document: SA |
|
| WWR | Wipo information: refused in national office |
Ref document number: 1020207009737 Country of ref document: KR |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 272797 Country of ref document: IL |