WO2019050240A1 - Nouvelle utilisation d'un kit d'exosomes comprenant un exosome dérivé de cellules souches - Google Patents

Nouvelle utilisation d'un kit d'exosomes comprenant un exosome dérivé de cellules souches Download PDF

Info

Publication number
WO2019050240A1
WO2019050240A1 PCT/KR2018/010254 KR2018010254W WO2019050240A1 WO 2019050240 A1 WO2019050240 A1 WO 2019050240A1 KR 2018010254 W KR2018010254 W KR 2018010254W WO 2019050240 A1 WO2019050240 A1 WO 2019050240A1
Authority
WO
WIPO (PCT)
Prior art keywords
mask
exosome
patch
battery
skin
Prior art date
Application number
PCT/KR2018/010254
Other languages
English (en)
Korean (ko)
Inventor
이용원
조병성
Original Assignee
주식회사 엑소코바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020180101494A external-priority patent/KR102197562B1/ko
Application filed by 주식회사 엑소코바이오 filed Critical 주식회사 엑소코바이오
Publication of WO2019050240A1 publication Critical patent/WO2019050240A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/51—Umbilical cord; Umbilical cord blood; Umbilical stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/98—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin

Definitions

  • the present invention relates to a new use of an exosome kit comprising exosomes derived from stem cells.
  • the skin of the human body is an organ that physically and chemically protects the body from the outside and performs the biochemical functions necessary for the metabolism of the whole body.
  • inflammatory skin diseases that appear on human skin are called dermatitis.
  • Relatively common dermatitis includes atopic dermatitis, contact dermatitis, and seborrhoic dermatitis.
  • Contact dermatitis is a dermatitis caused by contact with foreign substances. Contact dermatitis is characterized by irritant contact dermatitis and allergic contact dermatitis, depending on the mechanism by which one substance can cause both of these reactions simultaneously. Most of the substances that cause contact dermatitis are organic compounds. When the dermatitis-inducing substance comes into contact with the skin sensitized to these substances, it is known that the memory cell senses it and secretes various chemicals to cause inflammation.
  • Atopic dermatitis is a chronic inflammatory skin disease characterized by itchy and eczematous lesions. According to the results of previous studies, it is known that various factors are involved in the onset of atopic dermatitis. When atopic dermatitis is induced, inflammatory cells such as eosinophil, neutrophil and mast cell are observed in the lesion and immunoglobulin IgE produced from mast cells increases. In addition, IL-4, IL-5, and IL-13, which are inflammatory cytokines, are amplified and amplified by this process.
  • TSLP Thimic stromal lymphopoietin
  • seborrheic dermatitis is a chronic inflammatory skin disease that occurs due to increased activity of sebaceous gland, which occurs in the scalp and face, especially around eyebrows, nose, lips, ears, underarms, chest, groin and the like.
  • Drug remedies developed to date include steroids, antihistamines, and immunosuppressants such as cyclosporin A.
  • these drugs have serious problems such as skin atrophy, vasodilation, pigment desalination, hypersensitivity of injection site, tolerance and neutropenia.
  • exosome which has intercellular signal transduction
  • Extracellular vesicles Cells release various membrane-type vesicles in the extracellular environment, and these release vesicles are commonly referred to as extracellular vesicles (EVs).
  • the extracellular endoplasmic reticulum is sometimes referred to as cell membrane-derived endoplasmic reticulum, ectosomes, shedding vesicles, microparticles, exosomes and, in some cases, differentiated from exosomes.
  • Exosome is an endoplasmic reticulum of several tens to several hundreds of nanometers in size, composed of double lipid membranes identical to the cell membrane structure, and contains proteins, nucleic acids (mRNA, miRNA, etc.) called exosomal cargo inside.
  • Exosomal cargo contains a wide range of signaling factors, which are known to be specific for cell types and differentially regulated by the environment of the secretory cells.
  • Exosome is an intercellular signaling mediator that is secreted by the cell, and various cell signals transmitted through it regulate cell behavior including activation, growth, migration, differentiation, de-differentiation, apoptosis, and necrosis of target cells It is known.
  • Exosomes contain specific genetic material and bioactivity factors depending on the nature and condition of the derived cells.
  • the proliferating stem cell-derived exosomes regulate cell behavior such as cell migration, proliferation and differentiation, and reflect the characteristics of stem cells involved in tissue regeneration (Nature Review Immunology 2002 (2) 569-579).
  • the present inventors have conducted intensive studies on the development of new formulations capable of stably maintaining and storing exosomes and the combination of medical or cosmetic techniques, and have found that exosomes which can be applied to prevent, inhibit, alleviate, The kit was developed to complete the present invention.
  • the object of the present invention is to provide an exosome kit comprising exosome derived from stem cells and an application thereof.
  • the object of the present invention is to provide a mask pack, a mask sheet or a patch which is coated or immersed with a composition containing an exosome derived from a stem cell as an active ingredient for the prevention, inhibition, alleviation, improvement or treatment of dermatitis, And an iontophoresis device for use in the treatment of cancer.
  • Another object of the present invention is to provide a cosmetic method for controlling the condition of mammalian skin through prevention, suppression, alleviation or improvement of dermatitis except for therapeutic use using the exosomic kit.
  • the present invention provides a method for preventing, suppressing, alleviating, ameliorating, or treating dermatitis, which comprises applying a mask pack containing a composition containing an exosome derived from stem cells as an active ingredient, Or patch, and an iontophoresis device.
  • exosomes refers to an endoplasmic reticulum of several tens to several hundred nanometers (preferably about 30 to 200 nm) in size, consisting of double lipid membranes identical in structure to the cell membrane The particle size of the exosome can be varied according to the cell type, the separation method and the measurement method) (Vasiliy S. Chernyshev et al., "Size and shape characterization of hydrated and desiccated exosomes", Anal Bioanal Chem, DOI 10.1007 / s00216-015-8535-3). Exosomes contain proteins called exosomal cargo (cargo), nucleic acids (mRNA, miRNA, etc.).
  • Exosomal cargo contains a wide range of signaling factors, which are known to be specific for cell types and differentially regulated by the environment of the secretory cells.
  • Exosome is an intercellular signaling mediator that is secreted by the cell, and various cell signals transmitted through it regulate cell behavior including activation, growth, migration, differentiation, de-differentiation, apoptosis, and necrosis of target cells It is known.
  • exosome refers to a vesicle that has a nano-sized vesicle structure secreted from various stem cells and released into the extracellular space and has a composition similar to exosome (e.g., - pseudo-bezacl).
  • the type of the stem cell is not limited, but may be, for example, a mesenchymal stem cell, for example, a fat, a bone marrow, an umbilical cord or a cord blood derived stem cell, Derived stem cells.
  • the type of the adipose-derived stem cell is not limited as long as it does not cause a risk of infection by a pathogen and does not cause an immune rejection reaction, but it may be preferably a human adipose-derived stem cell.
  • the stem cell-derived exosome used in the present invention is effective for preventing, suppressing, alleviating, ameliorating or treating dermatitis and not causing adverse effects on the human body, so long as the stem cell-derived exosome can be used in a variety of stem cell- Of course, exosomes can be used. Therefore, it should be understood that the exosome isolated according to the separation method of the following embodiments should be understood as an example of exosome that can be used in the present invention, and the present invention is not limited thereto.
  • iontophoresis refers to a method in which an ionized active ingredient is allowed to permeate through the skin by an electrical repulsive force by applying a minute current to the skin to which the effective substance is applied, .
  • the iontophoresis used in one embodiment of the present invention is a method in which a current flows from an external power source to an electrode patch on the skin to introduce minute current into the skin, A method in which minute current is introduced, a method in which minute current is introduced into skin through a patch equipped with a reversed electrodialysis means for generating current through a difference in ion concentration between a high concentration electrolyte solution and a low concentration electrolyte solution, and the like .
  • the present invention is not limited thereto, and it is needless to say that various types of iontophoresis can be used.
  • the exosome kit of one embodiment of the present invention comprises a first mask pack, a mask sheet or a patch which is applied or immersed with a composition containing an exosome derived from a stem cell as an active ingredient, And an iontophoresis device for flowing an electric current.
  • an exosome kit is characterized in that the first mask pack, the mask sheet or the patch is brought into contact with or attached to the skin of the mammal, and the ion mask By positioning the phoresis device, the first mask pack, mask sheet or patch can be contacted or attached to be used in such a way that micro-currents flow to the skin of the mammal to which the composition is applied.
  • the composition may be used in combination with a conventionally used dermatitis remedy and / or moisturizer to the extent that its action (alleviation or improvement of dermatitis symptoms) is not impaired.
  • the composition may be supported on or mixed with at least one of hydrogel, hyaluronic acid, hyaluronic acid salt (for example, sodium hyaluronate), or hyaluronic acid gel.
  • the type of the hydrogel is not limited, but it may preferably be a hydrogel obtained by dispersing a gelated polymer in a polyhydric alcohol.
  • the gel polymer is at least one selected from the group consisting of pluronic, purified agar, agarose, gellan gum, alginic acid, carrageenan, cacao gum, xanthan gum, galactomannan, glucomannan, pectin, cellulose, guar gum and locust bean gum
  • the polyhydric alcohol may be at least one selected from the group consisting of ethylene glycol, propylene glycol, 1,3-butylene glycol, isobutylene glycol, dipropylene glycol, sorbitol, xylitol and glycerin.
  • the iontophoresis device may be applied to a flexible battery, a lithium ion secondary battery, an alkaline battery, a dry battery, a mercury battery, a lithium battery, a nickel-cadmium battery, Or a second mask pack, a mask sheet, or a patch having the at least one battery mounted thereon.
  • the second mask pack, the mask sheet or the patch may be laminated on the first mask pack, the mask sheet or the patch.
  • At least one surface of the first mask pack, the mask sheet or the patch, at least one surface of the first mask pack, the mask sheet or the patch may be coated with a hydrogel, hyaluronic acid, hyaluronic acid salt (for example, sodium hyaluronate) At least one of the gels may be applied.
  • the type of the hydrogel is not limited, but it may preferably be a hydrogel obtained by dispersing a gelated polymer in a polyhydric alcohol. The gelled polymer and the polyhydric alcohol may be exemplified in the above description.
  • the micro current flows from the iontophoresis device so that the exosomes can effectively penetrate the epidermis and penetrate deeply into the skin.
  • the exosome kit of one embodiment of the present invention can be effectively used for preventing, suppressing, ameliorating, alleviating or treating various dermatitis accompanied by itch, and is preferably used for the treatment of contact dermatitis, irritant contact dermatitis, allergic contact dermatitis, Allergic contact dermatitis, contact urticaria, atopic dermatitis, seborrheic dermatitis, autoimmune dermatitis, autoimmune progesterone dermatitis, dermatitis, acne or eczema.
  • Another embodiment of the present invention provides a cosmetic method for controlling the condition of a mammalian skin by preventing, suppressing, alleviating or improving dermatitis except for therapeutic use using the exosomic kit.
  • conditioning of the skin means improvement of the condition of the skin and / or prevention of the condition of the skin
  • improvement of the condition of the skin means visual and / Or a tactile perceptible positive change.
  • improvement of the condition of the skin may be mitigation or improvement of dermatitis related symptoms.
  • the cosmetic method of one embodiment of the present invention can be carried out using the exosome kit as described above.
  • the cosmetic method of one embodiment of the present invention comprises the steps of (a) contacting a first mask pack, a mask sheet or a patch with a composition containing an exosome derived from a stem cell as an active ingredient, (B) positioning the iontophoresis device on the first mask pack, mask sheet or patch, and (c) contacting the first mask pack, mask sheet or patch with the iontophoresis device, Performing iontophoresis to flow a microcurrent into the skin of the mammal to which the composition is applied; and (d) delivering the exosomes through the microcurrent to the inside of the mammalian skin.
  • At least one surface of the first mask pack, the mask sheet or the patch, at least one surface of the first mask pack, the mask sheet or the patch may be coated with a hydrogel, hyaluronic acid, hyaluronate (e.g., sodium hyaluronate) At least one of the gels may be applied.
  • the type of the hydrogel is not limited, but it may preferably be a hydrogel obtained by dispersing a gelated polymer in a polyhydric alcohol. The gelled polymer and the polyhydric alcohol may be exemplified in the above description.
  • the iontophoresis device comprises a flexible battery, a lithium ion secondary battery, an alkaline battery, a dry battery, a mercury battery, a lithium battery, a nickel-cadmium battery, Or a second mask pack, a mask sheet or a patch having the at least one battery mounted thereon.
  • the step (b) may be performed by laminating the second mask pack, the mask sheet or the patch on the first mask pack, the mask sheet or the patch.
  • the exosome kits of the present invention exhibit excellent effects on dermatitis symptoms and skin cosmetics such as improving or restoring the dermatological conditions deteriorated due to the dermatitis symptoms, and it is possible to alleviate or improve the condition of the skin condition due to dermatitis, .
  • the exosome kit of the present invention can prevent the exosomes applied or deposited on the mask pack, the mask sheet or the patch by the iontophoresis action to effectively penetrate the epidermis and penetrate deeply into the skin, Thereby exhibiting an effect of improving or alleviating the skin condition.
  • FIG. 1 shows the results of physical property analysis of exosomes obtained according to one embodiment of the present invention.
  • Figure 1A shows the particle size distribution and number of particles by TRPS (tunable resistive pulse sensing) analysis.
  • Figure 1B shows particle size distribution and particle number by NTA (nanoparticle tracking analysis) analysis.
  • Fig. 1C shows particle images by transmission electron microscopy (TEM) according to magnification.
  • TEM transmission electron microscopy
  • Figure 1D shows the Western blot results of exosomes obtained according to one embodiment of the present invention.
  • RTI ID 0.0 > 1E < / RTI > shows flow cytometric analysis results for CD63 and CD81 in marker assays for exosomes obtained according to one embodiment of the present invention.
  • FIG. 2 shows the result of confirming the absence of cytotoxicity after treatment of exosomes obtained according to one embodiment of the present invention in human skin fibroblast HS68 cells.
  • FIG. 3 shows that the amount of mRNA expression of TNF- ⁇ , IL-6, IL-1 ⁇ and iNOS induced by LPS was decreased when the exosome used in the exosome kit of the present invention was treated with LPS for RAW 264.7 cells And a real-time PCR result.
  • FIG. 4 shows experimental results showing that NO formation, which is a type of inflammatory reaction, is reduced by the exosome used in the exosome kit of the present invention.
  • PBS is phosphate-buffered saline
  • DEX is dexamethasone
  • EXO is exosome
  • CM is conditioned medium
  • CM-EXO is adipocyte- (Exosome-depeleted conditioned media).
  • FIG. 5 shows experimental results confirming that TNF-.alpha. Formation, which is an inflammatory cytokine, is reduced by exosomes used in the exosome kit of the present invention.
  • PBS represents phosphate-buffered saline
  • DEX represents dexamethasone
  • each numeral represents exosome throughput ( ⁇ g / mL).
  • FIG. 6 shows the results of co-treatment of exosomes used in the exosomal kit of the present invention together with LPS and IFN-y for THP-1-derived macrophages obtained after differentiating THP-1 monocytes into macrophages Time PCR results confirming that the mRNA expression level of the pro-inflammatory cytokine IL-6 was decreased.
  • FIGS. 7 to 9 show the results of pre-treatment of the exosomes used in the exosomal kit of the present invention and culturing for a predetermined period of time on THP-1-derived macrophages obtained after differentiating THP-1 monocytes into macrophages
  • FIGS. 7 to 9 show the results of pre-treatment of the exosomes used in the exosomal kit of the present invention and culturing for a predetermined period of time on THP-1-derived macrophages obtained after differentiating THP-1 monocytes into macrophages
  • FIGS. 7 to 9 show the results of pre-treatment of the exosomes used in the exosomal kit of the present invention and culturing for a predetermined period of time on THP-1-derived macrophages obtained after differentiating THP-1 monocytes into macrophages
  • FIGS. 7 to 9 show the results of pre-treatment of the exosomes used in the exosomal kit of the present invention and culturing for
  • FIG. 10 shows fluorescence intensity measurement results of exosomes stained with PKH67.
  • Fig. 11 is a fluorescence microscope image showing the degree of transfer of fluorescent stained exosomes into pig skin tissue.
  • Fig. 12 is a confocal fluorescence microscope image showing the extent of fluorescence-stained exosomes transferred into the mouse skin tissue.
  • FIG. 13 is a graph showing a comparison of the total fluorescence intensity obtained by measuring the fluorescence intensity on each image in Fig.
  • FIG. 14 is a photograph showing the skin condition before and after the treatment of human skin with the exosomal kit of the present invention.
  • FIG. 15 is a graph showing the results of application of iontophoresis for applying a microcurrent to a skin (affected part) coated with the composition after applying the composition containing exosome used in the exosome kit of the present invention to human skin As a result, it is a photograph showing that the erythema of the skin (the affected part) which has a severe dermatitis is remarkably improved.
  • 16 is a perspective view showing a configuration of the exosome kit 100 according to one embodiment of the present invention.
  • Mouse macrophage line RAW 264.7 was purchased from Korean Cell Line Bank and cultured.
  • DMEM purchased from ThermoFisher Scientific
  • medium containing 10% fetal bovine serum purchased from ThermoFisher Scientific
  • 1% antibiotic-antimycotics purchased from ThermoFisher Scientific 2 , and 37 ° C.
  • HS68 cells a human dermal fibroblast, were purchased from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum (purchased from ThermoFisher Scientific) and 1% antibiotic-antimycotics (purchased from ThermoFisher Scientific) The cells were subcultured in DMEM (purchased from ThermoFisher Scientific) medium containing 5% CO 2 at 37 ° C.
  • adipose-derived stem cells were cultured at 5% CO 2 and 37 ° C. Then, the cells were washed with a phosphate-buffered saline (purchased from ThermoFisher Scientific), replaced with serum-free, non-phenol red medium, cultured for 1 to 10 days, and the supernatant .
  • a phosphate-buffered saline purchased from ThermoFisher Scientific
  • Trehalose was added to the culture medium in an amount of 2% by weight in order to obtain an exosome having a uniform particle size distribution and high purity in the process of separating exosome.
  • the culture was filtered with a 0.22 ⁇ m filter to remove impurities such as cellular debris, waste products and large particles.
  • the filtered cultures were immediately separated to isolate exosomes.
  • the filtered culture was stored in a refrigerator (image below 10 ° C) and used for exosome isolation.
  • the filtered culture was frozen in an ultra-low temperature freezer at -60 ° C or lower, and thawed, followed by exosome isolation. Then, the exosomes were separated from the culture medium by using Tangential Flow Filtration (TFF).
  • TMF Tangential Flow Filtration
  • Example 1 a TFF (Tangential Flow Filtration) method was used for separating, concentrating, desalting and diafiltration exosomes from a culture filtrated with a 0.22 ⁇ m filter.
  • a cartridge filter also called a hollow fiber filter (purchased from GE Healthcare) or a cassette filter (purchased from Pall or Sartorius or Merck Millipore) was used.
  • the TFF filter can be selected by a variety of molecular weight cutoffs (MWCO). Exosomes were selectively isolated and concentrated by selected MWCOs, and particles, proteins, lipids, nucleic acids, low molecular weight compounds, etc. smaller than MWCO were removed.
  • MWCO molecular weight cutoffs
  • TFF filters of MWCO 100,000 Da (Dalton), 300,000 Da, or 500,000 Da were used.
  • the culture medium was concentrated to a volume of about 1/100 to 1/25 using the TFF method, and substances smaller than MWCO were removed to separate the exosomes.
  • Separated and concentrated exosomal solutions were further desalted and buffered (diafiltration) using the TFF method.
  • the desalination and buffer exchange are performed by continuous diafiltration or discontinuous diafiltration, and at least 4 times, preferably 6 times to 10 times or more, more preferably, Was performed using a buffer solution having a volume of 12 times or more.
  • 2% by weight of trehalose dissolved in PBS was added to obtain an exosome having a uniform particle size distribution and high purity.
  • NTA nanoparticle tracking analysis
  • TRPS tunable resistive pulse sensing
  • FIG. 1D shows the presence of CD9, CD63, CD81 and TSG101 markers as a result of performing Western blotting on isolated exosomes according to the method of one embodiment of the present invention.
  • Anti-CD9 purchased from Abcam
  • anti-CD63 purchasedd from System Biosciences
  • anti-CD81 purchasedd from System Biosciences
  • anti-TSG101 purchasedd from Abcam
  • FIG. 1E shows the presence of CD63 and CD81 markers as a result of analysis using flow cytometry on exosomes isolated according to the method of one embodiment of the present invention.
  • Human CD63 isolation / detection kit purchased from ThermoFisher Scientific
  • PE-mouse anti-human CD63 PE-Mouse anti markers were stained using the PE-mouse CD63 (purchased from BD) and PE-mouse anti-human CD81 (purchased from BD), and analyzed using a flow cytometer (ACEA Biosciences) Respectively.
  • exosomes derived from stem cells used in the present invention are not limited to the exosomes of the above-mentioned embodiments, and it is possible to use various stem cell-derived exosomes which are used in the art or can be used in the future Of course. It is to be understood that the exosomes isolated according to the above embodiments are to be understood as an example of exosomes derived from stem cells which can be used in the present invention, and the present invention is not limited thereto.
  • exosomes were treated by concentration to the cells and the proliferation rate of the cells was confirmed.
  • HS68 cells were suspended in DMEM containing 10% FBS, and the cells were mixed with 80 ⁇ 90% confluency and cultured in a 5% CO 2 incubator at 37 ° C for 24 hours. After 24 hours, the culture solution was removed, and the cell survival rate was evaluated by culturing the exosome prepared in Example 2 for each concentration and culturing for 24 to 72 hours.
  • WST-1 reagent purchased from Takara
  • MTT reagent purchased from Sigma
  • CellTiter-Glo reagent purchased from Promega
  • Aramar Blue reagent alamarBlue reagent purchased from ThermoFisher Scientific
  • a microplate reader purchased from Molecular Devices
  • the comparison group was based on the number of cells cultured in the normal cell culture medium not treated with exosome, and it was confirmed that the cytosolic effect of exosome derived from stem cells did not appear within the tested concentration range (FIG. 2).
  • RAW 264.7 cells were suspended in DMEM medium containing 10% FBS and dispensed into each well of a multiwell plate to have a confluency of 80-90%.
  • the stem cell-derived exosomes (used as the exosome prepared in Example 2 as used in the exosome kit of the present invention) diluted in a new serum-free medium containing LPS were treated for 1 to 24 hours at an appropriate concentration and cultured .
  • the cultured supernatant was taken and NO and inflammatory cytokines present in the culture were measured to confirm the inflammatory response.
  • the inflammatory response in the culture medium was measured using a NO detection kit (purchased from Intron Bio or Promega).
  • ELISA kit purchased from the R & D system
  • Dexamethasone purchased from Sigma
  • cDNA was prepared from the total RNA obtained from the RAW 264.7 cells treated as described above, and the amount of mRNA change of iNOS, TNF- ⁇ , IL-6 and IL-1 ⁇ was measured using a real-time PCR method.
  • the GAPDH gene was used as a standard gene for quantifying the above genes.
  • the types and sequences of the primers used in the real-time PCR are shown in Table 1 below.
  • RAW 264.7 cells which are macrophages of mice
  • NO production which is an inflammatory reaction induced by LPS
  • FIG. 5 RAW 264.7 cells, macrophages of mice, were treated with exosomes used in the exosomal kit of the present invention in the presence of LPS.
  • LPS-induced inflammatory cytokine TNF-a production As shown in FIG. 4, RAW 264.7 cells, which are macrophages of mice, were treated with exosomes used in the exosomal kit of the present invention in the presence of LPS.
  • exosome used in the exosomal kit of the present invention has an activity of reducing the inflammatory reaction induced by LPS, which is useful for preventing, inhibiting, improving, alleviating or treating dermatitis, It strongly suggests that exosome kits may be useful for the prevention, inhibition, amelioration, palliation or treatment of dermatitis.
  • THP-1 monocyte THP-1 human monocyte
  • the anti-inflammatory effect of exosomes used in the exosome kit of the present invention was confirmed as follows.
  • THP-1 monocytes were cultured in RPMI supplemented with 10% FBS (Fetal Bovine Serum), 1% penicillin-streptomycin and 100 nM Phorbol 12-myristate 13-acetate (purchased from Sigma) 1640 (purchased from ThermoFisher Scientific) medium at 1640 (purchased from ThermoFisher Scientific), and then seeded in a 12-well plate at a density of 6 ⁇ 10 5 cells / mL and cultured in a 5% CO 2 incubator at 37 ° C. for 48 hours to obtain THP-1 Derived macrophage (THP-1 derived macrophage). The differentiated cells were then washed once with PBS and cultured in RPMI 1640 medium without formalin 12-myristate 13-acetate for 24 hours to stabilize the cells.
  • FBS Fetal Bovine Serum
  • penicillin-streptomycin 100 nM Phorbol 12-myristate 13-acetate
  • 1640 purchased from ThermoFisher
  • RPMI 1640 medium without FBS Fetal Bovine Serum
  • 100 ng / mL LPS purchased from Sigma
  • 20 ng / mL IFN - ⁇ purchased from Peprotech
  • RPMI 1640 medium containing no FBS (Fetal Bovine Serum) for the THP-1 derived macrophages and dexamethasone purchased from Sigma
  • the exosomes used in the kit were cultured and cultured for 24 hours and then treated with 100 ng / mL LPS (purchased from Sigma) and 20 ng / mL IFN-y (purchased from Peprotech) And incubated for 4 hours to activate THP-1-derived macrophages.
  • CDNA was prepared from the RNA isolated from cultured THP-1 derived macrophages, and cDNA was prepared from the pro-inflammatory cytokines IL-6, IL-1 ⁇ And TNF-alpha mRNA expression levels were measured. GAPDH was used as a standard gene for quantifying the genes.
  • the types and sequences of the primers used in the PCR are shown in Table 2 below.
  • the forward primer (5 '- > 3')
  • the reverse primer (5 '- > 3') IL-6 AAGCCAGAGCTGTGCAGATGAGTA (SEQ ID NO: 11) TGTCCTGCAGCCACTGGTTC (SEQ ID NO: 12) IL-1?
  • THP-1 derived macrophages obtained after differentiating THP-1 monocytes into macrophages were treated with LPS and IFN- co-treatment
  • mRNA expression of IL-6, a proinflammatory cytokine was decreased compared to negative control.
  • THP-1 derived macrophages obtained after differentiating THP-1 monocytes into macrophages were used in the exosome kit of the present invention before LPS and IFN- IL-6, IL-1 ⁇ and TNF- ⁇ mRNA expression levels were decreased in the pre-treatment of exosomes compared to negative control.
  • the proinflammatory cytokines IL-6, IL-1 [beta] and TNF- [alpha] increase expression in proinflammatory M1 macrophages and decrease expression in anti-inflammatory M2 macrophages.
  • the exosome used in the exosome kit of the present invention can inhibit, alleviate and reduce the inflammatory reaction and the dermatitis caused thereby, and the exosome kit of the present invention can prevent, , which may be useful for improving, alleviating, or treating a disease.
  • Example 7 Skin permeability test of exosome used in the exosome kit of the present invention
  • PKH67 dye (purchased from Sigma) was used to prepare fluorescently stained exosomes. 1 mM PKH67 was diluted in Diluent C (purchased from Sigma) to prepare a 10 ⁇ M PKH67 solution, mixed with an appropriate concentration of exosome solution, and allowed to react at room temperature for 10 minutes in the absence of light. After the reaction, an MW3000 spin column (purchased from ThermoFisher Scientific) was used to remove the remaining PKH67 dye from the exosomes stained with PKH67 (hereinafter abbreviated as "PKH-exosomes"). After confirming the use of a fluorescence meter (purchased from Molecular Devices), PKH67 not reacted with exosomes was removed, and fluorescence of sufficient intensity was detected in PKH-exosomes (FIG. 10).
  • PKH-exosomes were dispersed in phosphate buffer (PBS) at a proper concentration, for example, 1 ⁇ 10 5 to 1 ⁇ 10 9 particles / mL, and then applied to the outer surface of the pig skin.
  • PBS phosphate buffer
  • the nonwoven fabric was covered and allowed to react for an appropriate period of time, for example, 30 minutes to 1 hour to allow the PKH-exosomes to be delivered to the subcutaneous tissues.
  • the PKH-exosomes were applied to the outer surface of the pig skin and covered with the nonwoven fabric, followed by flowing a microcurrent for a predetermined time, for example, 30 minutes to 1 hour.
  • the pig skin tissue was immersed in a 3.7% formaldehyde solution, reacted overnight, and washed three times for 5 minutes each with phosphate buffered saline.
  • the washed pig skin tissue was immersed in a 30% sucrose solution and treated with OCT compound.
  • sections were prepared on a longitudinal section using a microtome, and tissue sections were placed on a slide glass.
  • the preparation of the tissue section may be carried out before the tissue is fixed with formaldehyde solution. Fluorescence detected from PKH-exosomes in tissue sections was observed using fluorescence microscopy.
  • the exosomes used in the exosome kit of the present invention can be effectively passed through the epidermis and deeply transferred into the skin tissue, and can be effectively absorbed to the skin. Therefore, the exosomic kit of the present invention is expected to be usefully used for preventing, suppressing, improving, alleviating or treating dermatitis.
  • PKH-exosomes were dispersed in phosphate buffer (PBS) at a proper concentration, for example, 1 ⁇ 10 5 to 1 ⁇ 10 9 particles / mL, and then applied to the outside of the skin tissue of the mice.
  • PBS phosphate buffer
  • the nonwoven fabric was pre-positioned outside the mouse skin tissue, and PKH-exosomes were injected between the nonwoven fabric and skin tissue. Then, the reaction was carried out for 30 minutes to 1 hour.
  • the PKH-exosomes were injected between the nonwoven fabric and the skin tissue, and the microcurrent was flowed for a predetermined time, for example, 30 minutes to 1 hour.
  • the PKH-exosomes transferred into the skin tissue were confirmed immediately using a confocal fluorescence microscope (Leica, SP8X) or the skin tissue and the PKH-exosomal solution were further reacted for 1 hour to 6 hours , And PKH-exosomes were identified by confocal fluorescence microscopy.
  • a confocal fluorescence microscope Leica, SP8X
  • PKH-exosomes were identified by confocal fluorescence microscopy.
  • exosome kits of the present invention can effectively pass through the epidermis to effectively prevent the dermatitis from being prevented, inhibited, alleviated, improved or treated when the exosome kit of the present invention is applied to the skin.
  • Example 8 Treatment of exosome kit against human skin
  • the exosome kit 100 includes a liquid immersion sheet mask 10 (a white sheet mask on which a composition containing a stem cell-derived exosome is applied or immersed) And a transdermal permeation promoting sheet mask (silver sheet mask) 20 which is an iontophoresis device.
  • a stem cell-derived exosome (12) is applied or deposited on the surface or inside of the liquid immersion sheet mask (10).
  • a battery 22 for generating a microcurrent is mounted on the percutaneous permeation enhancing sheet mask 20 and a conductive pattern 24 electrically connected to the cell 22 is attached to the percutaneous permeation enhancing sheet mask 20, So that the micro current generated from the battery 22 can be uniformly transmitted to the entirety of the percutaneous permeation enhancing sheet mask 20.
  • the conductive pattern 24 is formed by printing or plating a conductive metal such as gold, silver, or copper.
  • exosome kit (100) having the above-described structure is applied once to the face of a person having a flushing symptom and skin troubles (hereinafter referred to as "case 1") related to the dermatitis symptom, It was evaluated whether the symptom of trouble and redness was alleviated or improved.
  • the exosome kit 100 of the present invention is applied once to the face of a person having flushing symptoms (hereinafter referred to as " case 2 ") associated with dermatitis symptoms to evaluate whether the overall skin tone and flushing symptoms are improved Respectively.
  • a liquid immersion sheet mask 10 containing 5 ⁇ 10 5 exosomes 12 was uniformly adhered to the entire faces of the cases 1 and 2 by aligning them with the eyes and mouth parts and then a microcurrent of about 0.3 to 0.4 mA
  • An activated percutaneous permeation enhancing sheet mask 20 which was activated to flow was laminated on the liquid immersion sheet mask 10 and used for about 25 to 30 minutes.
  • the exosome kit 100 composed of the liquid-immersion sheet mask 10 containing the stem cell-derived exosome 12 at a concentration of 5 ⁇ 10 5 particles / mask and the percutaneous permeation- (See case 1 in FIG. 14), the overall skin tone was improved in "case 2" and the flushing was alleviated (see case 2 in FIG. 14) . Therefore, the exosomal kit (present invention) comprising the liquid immersion sheet mask 10 in which the composition containing the stem cell-derived exosome as an active ingredient is immersed and the percutaneous permeation promoting sheet mask (iontophoresis device) 100) can be said to have an effect of preventing, suppressing, alleviating or alleviating dermatitis symptoms and redness symptoms and skin troubles associated therewith.
  • compositions containing a stem cell-derived exosome at a concentration of 0.29 x 10 8 particles / mL was applied to the affected part (hand, neck, arm, etc.) of three severe atopic patients complaining of itching Iontophoresis was carried out by using a iontophoresis device (IONZYME DF MACHINE) (purchased from Environ) to flow a micro current of 0.4 mA for 20 minutes to the affected part of the composition.
  • IONZYME DF MACHINE purchased from Environ
  • the exosome kit 100 of the present invention can be effectively used for preventing, suppressing, ameliorating, alleviating or treating dermatitis and symptoms associated therewith, as confirmed by the clinical test as described above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Birds (AREA)
  • Reproductive Health (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Medicinal Preparation (AREA)

Abstract

La présente invention concerne un kit d'exosomes comprenant un dispositif d'iontophorèse avec un ensemble masque, une feuille de masque ou un patch auquel est appliquée ou immergée une composition comprenant un exosome dérivé de cellules souches en tant que principe actif pour la prévention, la suppression, le soulagement, l'amélioration ou le traitement de la dermatite. Le kit d'exosomes de la présente invention présente d'excellents effets dans le soin de la peau, tels que l'amélioration des symptômes de dermatite et de l'état de la peau qui s'est détérioré, et la récupération de celui-ci à un état normal, et présente des effets de soulagement et d'amélioration d'un état pathologique de la peau en raison de la dermatite ou de la récupération de l'état de la peau malade à un état normal. En particulier, le kit d'exosomes de la présente invention permet aux exosomes appliqués sur ou immergés dans ensemble masque, la feuille de masque ou le patch de traverser efficacement l'épiderme et de pénétrer profondément dans la peau par une action d'iontophorèse, et présente ainsi un effet de soulagement ou d'amélioration des symptômes de dermatite et de l'état de la peau détérioré associé à ceux-ci.
PCT/KR2018/010254 2017-09-07 2018-09-04 Nouvelle utilisation d'un kit d'exosomes comprenant un exosome dérivé de cellules souches WO2019050240A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
KR20170114487 2017-09-07
KR10-2017-0114487 2017-09-07
KR10-2018-0017355 2018-02-13
KR20180017355 2018-02-13
KR1020180101494A KR102197562B1 (ko) 2017-09-07 2018-08-28 줄기세포 유래의 엑소좀을 포함하는 엑소좀 키트의 새로운 용도
KR10-2018-0101494 2018-08-28

Publications (1)

Publication Number Publication Date
WO2019050240A1 true WO2019050240A1 (fr) 2019-03-14

Family

ID=65635067

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/010254 WO2019050240A1 (fr) 2017-09-07 2018-09-04 Nouvelle utilisation d'un kit d'exosomes comprenant un exosome dérivé de cellules souches

Country Status (1)

Country Link
WO (1) WO2019050240A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3639832A4 (fr) * 2017-06-30 2021-04-21 Exocobio Inc. Utilisation d'une composition comprenant un exosome dérivé de cellules souches adipeuses en tant que principe actif pour atténuer la dermatite

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160033555A (ko) * 2014-09-18 2016-03-28 (주)인성정보 이온토포레시스를 위한 시트형 마스크 및 이를 이용하는 마스크 어셈블리
WO2016072821A1 (fr) * 2014-11-07 2016-05-12 한양대학교 에리카산학협력단 Composition pour l'induction de la différenciation d'adipocyte contenant un exosome dérivé de cellules souches, la régénération de tissus adipeux, et la décoloration de la peau ou l'atténuation des rides
KR20170020245A (ko) * 2015-08-12 2017-02-22 (주)프로스테믹스 성체 줄기세포와 분화된 세포의 혼합 배양액 및 이의 용도
KR101753003B1 (ko) * 2016-05-30 2017-07-03 에이비지노쓰아시아(주) 이온토포레시스 패치 및 이를 포함하는 이온토포레시스 장치
KR20170085010A (ko) * 2016-01-12 2017-07-21 주식회사 강스템바이오텍 고함량의 성장인자를 함유한 줄기세포 유래 엑소좀

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160033555A (ko) * 2014-09-18 2016-03-28 (주)인성정보 이온토포레시스를 위한 시트형 마스크 및 이를 이용하는 마스크 어셈블리
WO2016072821A1 (fr) * 2014-11-07 2016-05-12 한양대학교 에리카산학협력단 Composition pour l'induction de la différenciation d'adipocyte contenant un exosome dérivé de cellules souches, la régénération de tissus adipeux, et la décoloration de la peau ou l'atténuation des rides
KR20170020245A (ko) * 2015-08-12 2017-02-22 (주)프로스테믹스 성체 줄기세포와 분화된 세포의 혼합 배양액 및 이의 용도
KR20170085010A (ko) * 2016-01-12 2017-07-21 주식회사 강스템바이오텍 고함량의 성장인자를 함유한 줄기세포 유래 엑소좀
KR101753003B1 (ko) * 2016-05-30 2017-07-03 에이비지노쓰아시아(주) 이온토포레시스 패치 및 이를 포함하는 이온토포레시스 장치

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3639832A4 (fr) * 2017-06-30 2021-04-21 Exocobio Inc. Utilisation d'une composition comprenant un exosome dérivé de cellules souches adipeuses en tant que principe actif pour atténuer la dermatite
US11612621B2 (en) 2017-06-30 2023-03-28 Exocobio Inc. Use of composition comprising exosome derived from adipose-derived stem cell as effective ingredient in ameliorating dermatitis

Similar Documents

Publication Publication Date Title
Kou et al. The Fas/Fap-1/Cav-1 complex regulates IL-1RA secretion in mesenchymal stem cells to accelerate wound healing
WO2019088656A1 (fr) Composition de charge contenant des exosomes stabilisés
JP6970459B2 (ja) 脂肪由来幹細胞由来のエキソソームを有効成分として含む組成物の皮膚炎の改善の用途
WO2019004757A9 (fr) Utilisation d'une composition comprenant un exosome dérivé de cellules souches à titre de principe actif pour la prévention ou le soulagement du prurit
KR20190069301A (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 민감성 피부의 예방, 억제, 완화 또는 개선용 화장료 조성물
WO2015088288A1 (fr) Procédé pour favoriser la génération d'exosome dérivé de cellule souche à l'aide de thrombine
WO2020027466A1 (fr) Procédé pour lyophilisation d'exosomes
KR102170387B1 (ko) 줄기세포 유래 엑소좀의 동결건조제제 및 이를 유효성분으로 포함하는 여드름의 예방, 억제, 완화, 개선 또는 치료용 조성물
KR102045188B1 (ko) 지방줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부염 개선 용도
KR20190003399A (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 피부 섬유증 개선 용도
KR20190069277A (ko) 줄기세포 유래의 엑소좀 및/또는 세포외 소포체를 유효성분으로 포함하는 조성물의 민감성 피부 예방, 억제, 완화 또는 개선 용도
WO2019182299A1 (fr) Procédé de soin de la peau utilisant le rayonnement ipl sur la peau et traitement d'exosome dérivé de cellules souches en combinaison
WO2022071643A1 (fr) Nouvelle composition comprenant un exosome dérivé d'edelweiss en tant que principe actif
WO2021246684A1 (fr) Composition pour l'anti-inflammation, la cicatrisation de plaies ou la stimulation de la cicatrisation des plaies, comprenant des exosomes dérivés de cellules souches de rose en tant que principe actif
KR20190136907A (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 모공 축소용 조성물
KR102209937B1 (ko) 생산성 향상 및 생리활성 강화를 위한 엑소좀의 생산방법 및 이의 응용
Xie et al. Adipose mesenchymal stem cell-derived exosomes enhance PC12 cell function through the activation of the PI3K/AKT pathway
WO2019050240A1 (fr) Nouvelle utilisation d'un kit d'exosomes comprenant un exosome dérivé de cellules souches
WO2019004738A2 (fr) Utilisation d'une composition comprenant un exosome dérivé de cellules souches adipeuses en tant que principe actif pour atténuer la dermatite
KR20190069291A (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 피부 보습용 화장료 조성물
WO2020027467A1 (fr) Préparation lyophilisée d'exosomes issus de cellules souches et composition anti-inflammatoire la comprenant en tant que principe actif
WO2019088545A1 (fr) Kit d'exosomes et procédé d'amélioration de la perméation transdermique d'exosomes l'utilisant
WO2019112238A2 (fr) Composition cosmétique pour hydrater la peau comprenant un exosome dérivé de cellules souches en tant qu'ingrédient actif
KR20190027720A (ko) 줄기세포 유래의 엑소좀을 포함하는 엑소좀 키트의 새로운 용도
WO2019112229A2 (fr) Nouvelle utilisation d'un kit d'exosomes comprenant un exosome dérivé d'une cellule souche

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18853308

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18853308

Country of ref document: EP

Kind code of ref document: A1