WO2019035646A1 - 세포사멸 수용체 저해제를 유효성분으로 포함하는 cx3cl1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물 - Google Patents

세포사멸 수용체 저해제를 유효성분으로 포함하는 cx3cl1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2019035646A1
WO2019035646A1 PCT/KR2018/009351 KR2018009351W WO2019035646A1 WO 2019035646 A1 WO2019035646 A1 WO 2019035646A1 KR 2018009351 W KR2018009351 W KR 2018009351W WO 2019035646 A1 WO2019035646 A1 WO 2019035646A1
Authority
WO
WIPO (PCT)
Prior art keywords
expression
chemokine
domain
crd2
antibody
Prior art date
Application number
PCT/KR2018/009351
Other languages
English (en)
French (fr)
Other versions
WO2019035646A8 (ko
Inventor
정두현
이유진
정동진
강민정
김동현
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to CN201880060305.8A priority Critical patent/CN111246856A/zh
Priority to US16/637,357 priority patent/US20230159650A1/en
Publication of WO2019035646A1 publication Critical patent/WO2019035646A1/ko
Publication of WO2019035646A8 publication Critical patent/WO2019035646A8/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30 CD40 or CD95

Definitions

  • Cell death receptor 5 (death receptor 5; DR5) relates to inhibitors CX 3 CL1 (fractalkine)
  • the composition for prevention or treatment due to chemokine overexpression containing as an active ingredient, the preparation for adjusting the DR5 expression or activity, e.g. using the inhibitor, by inhibiting the binding between FasL and DR5 at the cell surface, it is possible to reduce the expression of chemokine C3 ⁇ 4CL1, CX 3 CL1 can effectively prevent and treat diseases which are caused by the over-expressing the chemokine.
  • TNF-related apoptosis inducing ligand TRAIL or Apo2L
  • DR5 ath receptors 5
  • TRAIL TRAIL-Receptor 1
  • DR5 Death receptor .5, TRAI receptor
  • DR4 TRAIL-Receptor 2 -Receptor 3
  • DcR2 Decoy Receptor 1 and TRAIL-Receptor 4
  • recombinant TRAIL is less stable and has adverse effects on apoptosis in normal cells such as astrocytes, hepatocytes, keratocytes (Jo et al., Nature Med. 6, 564-567, 2000).
  • FasL, CD95L, CD 178, Apo-1 is a type II membrane protein, and is associated with TNF, CD40L, 4-1BBL, and Tumor necrosis factor , And is mainly expressed in immune privileged sites such as activated T cells, NK cells, tumor cells, and eyeballs.
  • Fas ligand has a homotrimer structure and is known to kill target cells through its receptor, Fas receptor (Fas; FasR; CD95; UniProt P25445).
  • FasL can be divided into membrane FasL and soluble FasL (sFasL). Since apoptosis is induced by cell-cell contact, the membrane FasL plays a role in destroying cells by forming a death inducing signaling complex (DISC) together with Fas.
  • sFasL is a cleaved form of membrane FasL truncated by serine matrix metalloproteinase (MMP-3 or ⁇ P-7), and in contrast to membrane FasL function, cell death of target cells Or as a chemoattractant depending on the cell microenvironment.
  • MMP-3 or ⁇ P-7 serine matrix metalloproteinase
  • FasL in inflammatory diseases, especially rheumatoid arthritis (RA). It is now known that the amount of sFasL in patients with RA and those with Osteoarthritis is increased and the amount of sFasL is increased in patients with RA, which decreases VEGF secreted from synovial fibroblasts, (Angiogenesis) is suppressed.
  • Angiogenesis VEGF secreted from synovial fibroblasts
  • cell death through Fas-FasL in the CIA (collagen induced arthritis) model plays a role in suppressing the production of autoreactive cells at the early stage of rheumatoid arthritis, thereby alleviating rheumatoid arthritis .
  • chemokine plays an important role in the development of various diseases
  • studies on the development of a chemokine inhibitor and a therapeutic agent using the chemokine capable of effectively preventing or treating various diseases caused by the chemokine are important, and more specifically, Inflammation and other inflammatory diseases, and it is necessary to develop a therapeutic agent having a good effect while aiming at a new target.
  • Inflammation and other inflammatory diseases it is necessary to develop a therapeutic agent having a good effect while aiming at a new target.
  • DR5 protein targets provides a chemokine expression control agent or CX 3 CL1 screening a therapeutic agent of diseases caused by over-expressing the chemokine method.
  • Another example is the prevention due to C CL1 chemokine overexpression comprising administering to a patient in need of prevention and / or treatment due to the CX 3 CL1 chemokine overexpressing the expression or the activity inhibitor a therapeutically effective amount of DR5 disease and And / or related to the method of treatment.
  • Another example is to provide a use in the prevention and / or treatment due to over-expression of CX 3 CL1 chemokine expression or activity inhibitors of DR5.
  • the present invention is based on the finding that an agent that regulates the expression or activity of death receptor 5 (DR5), for example, an inhibitor,
  • the present invention is due to the CX 3 CL1 chemokine overexpression comprising administering to a patient in need of prevention and / or treatment due to the CX 3 CL1 chemokine overexpressing the expression or activity a therapeutically effective amount of an inhibitor of DR5 disease / RTI > and / or < / RTI >
  • Another example provides a use in the prevention and / or treatment due to over-expression of CX 3 CL1 chemokine expression or activity inhibitors of DR5.
  • DR5 is also called the TRAIL receptor or 2 (TRAILR2) or tumor necrosis factor or receptor superfamily member 10B (TNFRSF10B), a cell surface receptor of the TNF-receptor superfamily that binds to TRAIL It carries apoptosis signal and mediates apoptosis.
  • TRAILR2 TRAIL receptor 2
  • TNFRSF10B tumor necrosis factor or receptor superfamily member 10B
  • DR5 is known to interact with Caspase 8, Caspase 10, and FADD (Fas-Associated Protein with Death Domain) TRAIL.
  • the DR5 may be derived from a mammal, for example, human DR5 (eg, NCBI accession no. UniProtKB / Swiss-Prot: Q6FH58, etc.).
  • the DR5 expression or activity inhibitor may be a CRD2 domain of DR5 or a CRD3 domain of DR5 or a CRD2 domain and a CRD3 domain.
  • the antibody may bind antigenically the amino acid sequence of amino acids 53 to 181 of SEQ ID NO: 1.
  • the antibody comprises the CRD2 domain of DR5 consisting of amino acid 101 to 120 of SEQ ID NO: 1 or the CRD3 domain of huDR5 consisting of amino acid sequence 143-160 of SEQ ID NO: 1, or both CRD2 and CRD3 domains
  • an antibody that binds the CRD2 domain of huDR5 or the CRD3 domain of huDR5 with an antigen epitope respectively.
  • the siRNA may include a CRD2 domain encoding sequence of DR5 consisting of 3 to 363 nucleotides of SEQ ID NO: 4 or a CRD3 domain of DR5 consisting of nucleotide numbers 430 to 483 of SEQ ID NO: Or an siRNA that binds to both the CR5 domain coding sequence of DR5 and the CR5 domain of DR5. It may preferably be an siRNA that binds to the CRD2 domain encoding sequence of DR5 and the CRD3 domain encoding sequence of DR5 to inhibit the expression of CRD2 and CRD3 of DR5, respectively.
  • the CX 3 CL1 chemokine called Frac lkine (FKN), is known as chemokine (C-X 3 -C motif) ligand 1 and is a chemokine involved in inflammation induction.
  • CX 3 CL1 is a unique form of chemokine, comprising an extracellular N-terminal domain, mucin-like stalk, transmembrane a helix, and a short cytoplasmic tail, consisting of 373 amino acids.
  • water-soluble forms of C? CL1 are known to exhibit chemotactic activity in monocytes, NK cells and T cells. Also, C3 ⁇ 4CL1 is expressed, etc.
  • RA Rheumatoid arthritis
  • CX 3 CL1 induced by TNF- ⁇ , IFN-y, and IL-1 ⁇ is known to be associated with axillary sclerosis, rheumatoid arthritis (RA), HIV infection, cancer and other diseases and complications, There is no clinical treatment targeting CX 3 CL1.
  • the present invention relates to a method for the treatment of allograft rejection, hypertension, eye disease, chronic pancreatitis, neuropathic pain, Sjogren's syndrome, chronic obstructive pulmonary disease, emphysema J Pathol 2008 Oct; 173 (4): 949-61), pulmonary fibrosis (Ann Rheum Dis 2005 Jan; 64 (l): 21-8), atopic dermatitis (J Allergy Clin Immunol 2004 May; 113 (5): 940-8), and lupus nephritis (Arthritis Rheum. 2005 May; 52 (5): 1522-33) , Especially arthritis, cardiovascular disease, cancer, HIV infection And one can work, can be
  • the arthritis may be selected from the group consisting of osteoarthritis, degenerative arthritis, peptic osteochondritis, joint ligament injury, meniscus osteogenesis injury, joint misalignment, avascular necrosis, rheumatoid arthritis, childhood idiopathic arthritis, trauma, inflammatory arthritis
  • the cardiovascular diseases include atherosclerosis, coronary artery disease, carotid artery di sease, stroke, or carotid artery sclerosis eros is), and the cancer may be colon cancer or lung cancer.
  • the composition for preventing or treating disease may be a carrier, an excipient, a disintegrant, a sweetener, a coating agent, a swelling agent, a lubricant, a lubricant, a flavoring agent, an antioxidant, a complete layer liquid, a bacteriostatic agent, a diluent, a dispersant, a surfactant,
  • a carrier an excipient, a disintegrant, a sweetener, a coating agent, a swelling agent, a lubricant, a lubricant, a flavoring agent, an antioxidant, a complete layer liquid, a bacteriostatic agent, a diluent, a dispersant, a surfactant
  • One or more adjuvants may be further included.
  • carriers, excipients and diluents include lactose, dextrose, sucrose, sorbic, mannitol, xyli, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, There may be used water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, and solid formulations for oral administration may be used. These solid preparations can be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like in the composition.
  • lubricants such as magnesium stearate and talc may also be used.
  • liquid preparation for oral use include suspensions, solutions, emulsions, syrups and the like, and various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin which are commonly used simple diluents.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.
  • suspending agent examples include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like.
  • base material of the suppository wi tepsol, macrogol, tween 61, cacao paper, laurinic acid glycerogelatin and the like can be used.
  • the formulation of the composition is not particularly limited, but granules, powders, coated tablets, tablets, pills, capsules, suppositories, gels, syrups, juices, and suspensions may be used. , An emulsion, a drip agent, or a liquid agent.
  • the effective dose range of the composition of the present invention may vary depending on various factors such as sex, severity, age, administration method, target cell and expression level, and can be easily determined by those skilled in the art.
  • the present inventors have treated a TRAIL commonly known as a ligand that binds to DR5, the amount of TRAIL eu unlike when sikyeoteul the DR5 binding reaction, FasL and DR5 is specific binding to FasL_DR5 joining time, intracellular CX 3 CL1 (See Example 4 below).
  • compositions for inhibiting C? CL1 chemokine expression which comprises as an active ingredient an expression or activity inhibitor of DR5.
  • the DR5 inhibitor may be selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, DNAzyme, PNA (pepti de nuclease acids), antisense oligonucleotides, peptides, antibodies, And may be at least one selected from the group consisting of starch, natural extract or chemical, and the like.
  • an antibody or s iRNA can be used.
  • the DR5 expression or activity inhibitor may be a CRD2 domain of DR5 or a CRD3 domain of DR5 or a CRD2 domain and a CRD3 domain.
  • the antibody may be an antigen binding part of amino acid residues 53 to 181 of the amino acid sequence of SEQ ID NO: 1.
  • the antibody comprises the DR5 and CRD3 domains or the CRD2 and CD3 domains consisting of the CRD2 domain of DR5 consisting of amino acids 1 to 120 of SEQ ID NO: 1 or amino acid sequences 143 to 160 of SEQ ID NO:
  • CRD2 of DR5 < RTI ID 0.0 > Domain or hRlDR5, respectively, with an antigen epitope.
  • the siRNA comprises a CRD2 domain encoding sequence of DR5 consisting of 3 to 363 nucleotides of SEQ ID NO: 4, or a CRD2 domain encoding sequence of DR5 consisting of nucleotide numbers 430 to 483 of SEQ ID NO: Domain encoding sequence, or an siRNA that binds to both the CRD2 domain encoding sequence of DR5 and the CRD3 domain encoding sequence of DR5.
  • the CRD2 domain encoding sequence of DR5 may be siRNA which binds to each CRD3 domain encoding sequence of DR5 and inhibits the expression of CRD2 and CRD3 of DR5, respectively.
  • the present invention also provides a method for screening a chemokine expression inhibitor.
  • the screening method may be an agent for preventing and / or screening method for a therapeutic agent for diseases which are caused by the over-expressing CX 3 CL1 chemokines.
  • the sample may be a cell, tissue or organ obtained from an animal, preferably a mammal, and preferably includes a RA (Rheumato id arthritis) site, an immunocompetent site (i uni pr i vi edged si te) More preferably, it may be a tau cell, an NK cell, a rheumatoid cell, a tumor cell or an eyeball, and the like.
  • RA Ra (Rheumato id arthritis) site
  • immunocompetent site i uni pr i vi edged si te
  • the activity of the single-stranded DR5 can be measured by a conventional method, and it can be easily understood by a person having ordinary skill in the art to which the present invention belongs.
  • the identification of the interaction between DR5 and the sample can be determined by measuring the protein- Methods commonly used to determine the antagonism between compounds may be used. For example, a method of measuring activity after repelling DR5 and a test substance, a yeast two hybr id, a search for a phage display peptide clone binding to DR5, a HTS hi gh throughput screening, a drug-hitting HTS or a cell-based screening method, but the present invention is not limited thereto.
  • the expression level of the DR5 can be measured by confirming the reaction between the composition containing the DR5-encoding gene and the sample, and the repetition confirmation can be used to confirm the reaction between DNA-DNA, DNA-RNA and DNA-protein
  • the repetition confirmation can be used to confirm the reaction between DNA-DNA, DNA-RNA and DNA-protein
  • a method of measuring the expression rate of a gene or a method of introducing a reporter gene into the gene, introducing the gene into a cell, reacting the substance with a test substance, and measuring the expression level of a reporter protein, but the present invention is not limited thereto.
  • the sample is in accordance with conventional selection methods CX 3 CLl (f ract alki ne ) individual nucleic acid is supposed to, with the potential for disease prevention or treatment due to chemokine overexpression or randomly selected for the protein , Other extracts or natural products, compounds, and the like.
  • such a material is therefore by suppressing i the expression or activity of DR5 display the expression inhibitory effect of the CX 3 CL1 arthritis, cardiovascular jilhuin -, cancer, HIV infection , Primary biliary cirrhosis, nephropathy, allograft rejection, hypertension, eye disease, chronic pancreatitis, neurogenic pain, Sjogren's syndrome,
  • Chronic obstructive pulmonary disease emphysema, pulmonary fibrosis, atopic dermatitis, and rheumatoid diseases, especially that caused by the over-expressing CX 3 CL1 chemokines, such as salts, such as lupus kongpal It can prevent or treat arthritis including diseases.
  • Still another aspect of the invention is the prevention of caused by comprising the step of administering to a patient in need of prevention or treatment due to the CX 3 CL1 chemokine overexpressing the expression or activity inhibitors of DR5 in a therapeutically effective amount, C3 ⁇ 4CL1 chemokine overexpressing diseases or Provide a treatment method.
  • the DR5 expression or activity inhibitor may be siRNA, shRNA, miRNA, ribozyme, DNAzyme, peptide nucleic acids, antisense, nucleotide, peptide, antibody, aptamer, natural extract, Preferably an antibody or siRNA.
  • the DR5 expression or activity inhibitor is
  • the antibody binds to the 53rd to 181st amino acid portions of the amino acid sequence of SEQ ID NO: 1, preferably the CRD2 domain of DR5 consisting of amino acids 101 to 120 of SEQ ID NO: 1 or 143 To 160 < th > amino acid sequence, or to both the CRD2 and CRD3 domains of DR5.
  • the DR5 expression or activity inhibitor may be a CRD2 domain of DR5, a CRD3 domain of DR5, or a CRD2 domain and a CRD3 domain.
  • the antibody binds to the 53rd to 181st amino acid portions of the amino acid sequence of SEQ ID NO: 1, preferably the CRD2 domain of DR5 consisting of amino acids 101 to 120 of SEQ ID NO: 1 or 143 To 160 < th > amino acid sequence, or to both the CRD2 and CRD3 domains of DR5.
  • CX 3 CL1 chemokine induced by overexpression Technology for the prevention and / or treatment of diseases, and novel chemokine expression using the same.
  • the screening technique of inhibitors not only can effectively prevent the occurrence of diseases caused by overexpression of C < 3 > CL < 1 >, but also provides excellent therapeutic effects after a certain degree of disease progression, , C < 4 > CL1 chemokine overexpression,
  • a treatment method can be provided.
  • the DR5 inhibitor is not particularly limited as long as it inhibits the expression of the DR5 gene or inhibits the activity of the DR5 protein.
  • the DR5 inhibitor may be a siRNA, a shRNA, a miRNA, a ribozyme, , DNAzyme, PNA (peptidase deacylase), antisense oligonucleotides, peptides, antibodies, aptamers, natural extracts or chemicals.
  • the present invention uses an agent, for example an inhibitor to control the DR5 expression or activity, by inhibiting the binding between FasL and DR5 at the cell surface, it is possible to reduce the expression of, one of the inflammatory cytokines C3 ⁇ 4CL1, CX 3 CL1 chemokine
  • an agent for example an inhibitor to control the DR5 expression or activity, by inhibiting the binding between FasL and DR5 at the cell surface, it is possible to reduce the expression of, one of the inflammatory cytokines C3 ⁇ 4CL1, CX 3 CL1 chemokine
  • the disease caused by overexpression can be effectively prevented and treated.
  • Figure 1 (A) shows the results obtained by isolating synovial cells (Adherent cell I adh.) And normal immune cells (Supernatant cell I Sup.) From the joints obtained from normal and arthritis-inducing mice (RA)
  • FIG. 1 (B) shows the expression of DR5 surface protein in synovial cells of joints obtained from arthritis-induced mice (RA) by flow cytometry analysis
  • FIG. 1 (C) shows the results of flow cytometric analysis of expression of DR5 surface protein in hFLS.
  • FIG. 1 (B) shows the results obtained by isolating synovial cells (Adherent cell I adh.) And normal immune cells (Supernatant cell I Sup.) From the joints obtained from normal and arthritis-inducing mice (RA)
  • FIG. 1 (B) shows the expression of DR5 surface protein in synovial cells of joints obtained from arthritis-induced mice (RA) by flow cytometry analysis
  • FIG. 1 (C) shows the results of flow cytometric analysis of expression of DR5 surface
  • FIG. 2 shows experimental results for confirming the mutual binding of FasL-DR5
  • FIG. 2 (A) shows the results of verifying the interaction of FasL-DR5 by confirming that FasL-IgG binding was inhibited when FasL binding to hFLS was inhibited by treatment with anti-DR5 antibody
  • (B) is the result of treatment of s iRNA and knockdown of DR5 in hFLS, treatment of IgG-conjugated FasL, and confirmation of IgG signal intensity on cell surface by flow cytometry.
  • FIG. 3 shows the results of ELISA for the secretion of CX3CL1 after treating hFLS with FasL and TRAIL alone or in combination.
  • FIG. 4 (A) shows the result of ELISA assaying the amount of secreted CX3CL1 after inhibiting the interaction between FasL and DR5 by treating anti-DR5 antibody against hFLS
  • FIG. 4 (B) The amount of secreted CX3CL1 was measured by ELISA after treatment of anti-DR5 antibody with synovial cells and FasL treatment.
  • FIG. 5 (A) is a graph showing the results of reduction of DR5 surface protein expression on the cell surface of hFLS due to DR5 s iRNA treatment.
  • FIG. 6 shows the result of confirming that sFasL is injected into gl d mouse, which is a FasL-deficient mouse, and that the anti-DR5 antibody is injected to alleviate arthritic disease induced by sFasL injection.
  • Changes in arthritic disease in gld mice treated with K / BxN serum, gld mice treated with K / BxN serum and sFasL, K / BxN serum, sFas ligand and anti-DR5 antibody (ant i -DR5) (A) is the thickness of the joint, and (B) is the clinical index measurement graph.
  • huDR5_CRD2 and huDR5-CRD3 which are candidate regions in which the huDR5 protein amino acid sequence and sFasL are expected to bind, and 111, 114, 119, 120, 148, 150, It is the site where ion occurs.
  • FIG. 7B shows the nucleotide sequence from 1 to 840 of SEQ ID NO: 4 which is the huDR5 DNA sequence, and the polynucleotide consisting of nucleotides 334 to 363 and the nucleotide sequence from 445 to 471 is mut ation Indicates the area where it occurs.
  • FIG. 8a shows the huDR5 protein amino acid sequence, the candidate site of sFasL to which it is expected to bind, the huDR5-CRD2 and huDR5-CRD3 and the immunogen site of the DR5 FACS antibody.
  • FIG. 8B shows the result of flow cytometry analysis using human FasL (hFasL-IgG) conjugated with immunoglobulin (IgG) binding to huDR5 after expressing DR5 mutated with huDR5-CRD2 or huDR5-CRD3.
  • Figure 9 shows that sFasL binds to the DR5 receptor of human FLS
  • SCX3CL1 increases the expression of chemokines such as CCL2, CCL3, and CXCL10 from immune cells to induce inflammation.
  • chemokines such as CCL2, CCL3, and CXCL10
  • Example 1 Identification of membrane protein (DR5) binding to sFas ligand
  • FasL binds to its receptor, Fas, and induces the inflammation of the joint by inducing the avidity of target cells. Furthermore, previous studies by the present inventors have revealed that FasL regulates the expression of chemokines by a novel mechanism independent of induction of inflammation, and that FasL itself is a chemokine that attracts inflammatory cells . Previous studies, however, did not elucidate how FasL binds to membrane proteins to regulate inflammation in the new inflammatory mechanism of FasL.
  • the present inventors performed protein identification experiments to identify a protein binding to sFasL (soluble Fas ligand) in a new inflammatory mechanism caused by FasL.
  • hFLS human fibroblast-1 ike synoviocyte
  • the biotinylated sFasL obtained by biotinylation of the obtained hFLS and recombinant human Fas ligand (R & D Systems 126-FL-010) with Sul fo-NHS-SS-Biot in-Thermo Scientific # 21331 was reacted to bind sFasL and hFLS target receptor protein .
  • cross-linking was performed using a bis (sulfosuccinimidyl) suberate (BS3), followed by cell lysis.
  • BS3 bis (sulfosuccinimidyl) suberate
  • Flow cytometric analysis and real-time PCR were performed to confirm expression of DR5 surface protein.
  • Real-time PCR was performed using an Applied Biosystems 7500 Real Time PC System.
  • F GGGCCACAGGGACACCTT
  • IR GCATCTCGCCCGGTTTT was used as a primer. The reaction was performed at 50 ° C for 2 minutes, 95 ° C for 2 minutes, 95 ° C for 15 seconds, 60 ° C for 1 minute at 40 cycles.
  • Fig. 1 (A) the relative expression level of DR5 surface protein in the synovial cells of the joints obtained from arthritis-induced mice was higher than in normal mice, and the flow cytometry analysis results of Figs. 1 (B) and , The expression of DR5 surface protein in arthritis-induced mouse synovial cells (supertant cells) and hFLS was confirmed.
  • hFLS was treated with an anti-DR5 antibody (R & D systems AF631) to inhibit binding of FasL on the cell surface DR5.
  • FIG. 2 (A) the signal intensity of IgG was decreased when the anti-DR5 antibody was treated, and the FasL-DR5 binding was decreased when the DR5 activity was inhibited by the anti-DR5 antibody there was.
  • s iRNA Sigma Aldrich MISSION s iRNA; SASI_Hs01- 00040567
  • FasL and TRAIL were treated with 200ng / mL of hFLS alone or in combination for 24 hours, and secretion of CX3CL1 was measured by ELISA (R & D systems DY365) The results are shown in Fig. As can be seen from FIG. 3, when TRAIL, which is known as a general ligand for DR5, did not increase the amount of CX3CL1, it was confirmed that the amount of CX3CL1 increased upon treatment with FasL.
  • CX3CL1 chemokine in hFLS was increased due to the binding of FasL and DR5, not other ligands.
  • CX3CL1 It was confirmed that inflammation is induced by promoting the secretion of CX3CL1 from hFLS cells upon binding of FasL-DR5 with one inflammatory chemokine.
  • Example 5 Decreased expression of chemokine upon inhibition of FasL-DR5
  • FIG. 4A shows the expression of CX3CL1 in ant i -DR5 was decreased compared to Isotype (Goat IgG, R & D Systems AB-108- C) treated with DR5 antibody against hFLS, The expression of CX3CL1 in ant i-DR5 was also decreased by treatment with anti-DR5 antibody.
  • the hFLS was treated with s iRNA (Sigma Aldrich MISSION siRNA; SASI_Hs01_00040567) and the expression of DR5 was knocked down using an electroporator (Neon T ransfactory system, Thermo Fi sher Scientific) As a result, as shown in FIG. 5 (A), it was confirmed that the expression of DR5 surface protein on the cell surface of hFLS was reduced by DR5 s iRNA treatment.
  • s iRNA Sigma Aldrich MISSION siRNA; SASI_Hs01_00040567
  • Example 6 Arthritic pain relief test when an anti-DR5 antibody was injected
  • FasL-deficient gld mice central laboratory animals
  • K / BxN mice Harvard obtained by crossing with KRN TCR transgenic mice and NOD mice from Drs. D. Mathis and C. Beneno of the medical school, Boston, Mass.
  • K / BxN serum injection (-) 2), BxN serum and sFas ligand ((-) + sFas ligand)), 3) K / BxN serum, sFas ligand and anti-DR5 antibody (anti_DR5) for 10 days, and the thickness of each joint was measured with a caliper (Manostat, Switzerland) and the clinical index was measured.
  • the Clinical Index refers to:
  • the thickness of the joint measured as above .
  • the clinical index is shown in Fig.
  • FIG. 6 (A) when the gld mouse was treated with serum and sFasL, the joints began to swell from the fourth day and the highest index could be observed at 9-10 days. However, when treated with serum and sFasL and anti-DR5 in gld mice, it was observed that the joints were scarcely swollen . Also, as can be seen in Fig. 6 (B). Clinical indices also showed that the clinical index remained at 3 to 4 points when the serum and sFasL and anti-DR5 were treated with gld mice, and that the joints were scarcely swollen.
  • huDR5 SEQ ID NO: 1 in Table 1
  • TRAIL a ligand for DR5
  • huDR5-CRD2 445-471 of the entire sequence
  • huDR5 DNA was transfected into mouse cells (36 ( ⁇ 1011) and DR5 (Table 1, SEQ ID NO: 4) mutating each huDR5-CRD2 or DR5 mutated huDR5-CRD3 ), And flow cytometry was performed using human FasL (huFasL-IgG) conjugated with immunoglobulin (IgG) binding only to cells expressing huDR5. The results are shown in FIG. 8B.
  • huFasL-IgG was not bound to huDR5 in which CRD2 or CRD3 was mutated.
  • the binding site between FasL_DR5 binds to DR5 using CRD2 and CRD3 similarly to TRAIL.

Abstract

세포사멸 수용체 5(death receptor 5； DR5) 저해제를 유효성분으로 포함하는 CX3CLl( fractalkine) 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물, DR5의 발현 또는 활성 저해제를 치료적 유효량으로 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는, CX3CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법, 및 DR5의 발현 또는 활성 저해제의 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도에 관한 것이다.

Description

【명세서】
【발명의 명칭】
세포사멸 수용체 저해제를 유효성분으로 포함하는 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물
【기술분야】
세포사멸 수용체 5(death receptor 5； DR5) 저해제를 유효성분으로 포함하는 CX3CL1 ( fractalkine) 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물에 관한 것으로서, DR5 발현 또는 활성을 조절하는 제제, 예를 들면 저해제를 사용하여， 세포 표면에서의 FasL과 DR5간의 결합을 저해함으로써, C¾CL1케모카인의 발현을 감소시켜， CX3CL1 케모카인 과발현으로 인해 유발되는 질환을 효과적으로 예방 및 치료할 수 있다.
【배경기술】
최근 암 치료제 개발의 표적 물질로써, 정상세포에는 영향 없이 암세포만을 선택적으로 세포사멸을 유도하는 TNF-related apoptosi s inducing l igand (TRAIL 또는 Apo2L)와 이의 수용체 중 하나인 DR5 (death receptors 5) 시스템을 통한 세포사멸 경로가 중요하게 여겨지고 있다 (Ashkenazi 등， Nat Rev Cancer 2 : 420 , 2002) . 현재 DR5를 표적으로 하는 암세포 치료제로서 재조합 TRAIL과 세포사멸 수용체 특이적인 항체가 개발되고 있다.
하지만 TRAIL의 경우, 세포 사멸 신호를 전달하는 DR4 (Death receptor 4, TRAIL-Receptor 1) , DR5 (Death receptor .5, TRAI느 Receptor 2)뿐만 아니라， 세포 사멸 신호를 전달하지 못하는 DcRKDecoy Receptor 1， TRAIL-Receptor 3)， DcR2( Decoy Receptor 1 , TRAIL-Receptor 4)에도 모두 결합하여 DR5에 대한 특이성이 낮다는 문제가 있다. 또한 재조합 TRAIL은 안정성이 떨어지고 정상세포인 성상세포 ( astrocytes )， 간세포 (hepatocytes )， 각질세포 (kerat inocytes) 등에도 세포 사멸을 유발하는 부작용이 있다 (Jo 등， Nature Medi cine 6， 564-567 , 2000) .
따라서 최근에는 부작용이 적으며， 암세포 선택적인 세포사멸을 유도하는 항 -DR5 내지 항 DR4 항체 개발이 활발하게 연구되고 있다.
하지만 이제까지 연구는 DR5 시스템을 통한 세포사멸 경로를 이용하는 암세포 치료제 개발에 초점이 맞춰져 있을 뿐， DR5의 염증 유발 메커니즘 및 이를 이용한 염증치료제 개발에 관해서는 구체적으로 연구된 바 없다.
1
대체용지 (규칙 제 26조) Fas 리간드 (FasL, CD95L, CD 178, Apo-1)는 제 II형 막단백질 (Type II membrane protein)의 하나로서, TNF, CD40L, 4-1BBL 등과 함께 종양괴사인자 (Tumor necrosis factor, TNF) 계통에 속하며， 주로 활성화된 T 세포， NK 세포， 종양 세포 및 안구 등과 같은 면역 특전 부위 (immune privileged site)에서 발현된다. Fas 리간드 (이하 FasL)는 동종 삼합체 (homotrimer) 구조를 가지며, 그 수용체인 Fas receptor (Fas； FasR; CD95; UniProt P25445)와의 tr imer i zat ion을 통하여 표적세포를 세포사멸 시키는 것으로 알려져 있다.
FasL은 membrane FasL과 soluble FasL (sFasL)로 나눌 수 있다. 세포사멸은 세포—세포 접촉으로 유도되기 때문에， 막 FasL이 Fas와 함께 사멸 유도 신호 복합체 (Death inducing signaling complex, DISC)를 이루어 세포를 사멸시키는 역할을 담당한다. sFasL은 세린 메트릭스 메탈로프로테이네이즈 -3 또는 -7(serine matrix metal loproteinase , MMP-3 또는 匪 P-7)에 의하여 잘려진 membrane FasL의 절단형태이며， membrane FasL 기능과는 반대로 표적 세포의 세포사멸을 억제하거나， 세포 미세환경에 따라서 화학 유인 물질 (chemoattractant)로써 기능한다고 알려져 있다.
FasL의 염증질환， 특히 류마티스 관절염 (Rheumatoid arthritis, RA)에서의 구체적 역할에 대한 보고는 많지 않다. 이제까지 알려진 바로는, RA 환자와 골관절염 (Oasteoarthritis) 환자에서의 sFasL의 양을 비교한 결과， RA 환자에서 sFasL의 양이 증가되어 있으며， 이는 활막 섬유모세포 (synovial fibroblast)에서 분비하는 VEGF를 감소시켜 혈관형성 (angiogenesis)을 억제하는 역할을 함을 입증한 보고가 유일하다. 한편 , membrane FasL과 관련해서는 CIA(col lagen induced arthritis) 모델에서 Fas-FasL를 통한 세포사멸이 류마티스 관절염 발병 초기단계에서 자가반웅성 세포 (autoreactive cell)들의 생성을 억제하여 류마티스 관절염을 완화시키는 역할을 한다는 보고가 있었다.
케모카인이 각종 질환 발병에 중요한 역할을 한다는 점을 고려할 때， 케모카인에 의해 유발되는 각종 질환을 효과적으로 예방 또는 치료할 수 있는, 케모카인 저해제 및 이를 이용한 치료제 개발에 관한 연구는 중요하며， 또한 구체적으로 세포 내 케모카인의 염증 등의 질환 유발 메커니즘을 밝히고， 새로운 표적을 타깃으로 하면서 효과가 우수한 치료제 개발이 필요한 실정이다. 하지만 아직까지 , 구체적인 연구 성과는 미미한 실정이다.
【발명의 상세한 설명】
【기술적 과제】
이에 본 발명자들은， DR5 활성 또는 발현을 억제하는 조절제의 CX3CL1 케모카인 발현 억제 용도를 새로이 밝힘으로써 DR5 저해제 활성 또는 발현을 억제하는 조절제를 유효성분으로 함유하는 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물 및 C¾CL1 케모카인 발현 억제용 조성물을 제공한다.
또 다른 일 예는, DR5 단백질을 표적으로 하여 케모카인 발현 조절제 또는 CX3CL1 케모카인 과발현으로 인한 질환 치료제의 스크리닝 방법을 제공한다.
또 다른 예는 DR5의 발현 또는 활성 저해제를 치료적 유효량으로 CX3CL1 케모카인 과발현으로 인한 질환 예방 및 /또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는 C CL1 케모카인 과발현으로 인한 질환의 예방 및 /또는 치료 방법에 관련된 것이디- .
또 다른 예는 DR5의 발현 또는 활성 저해제의 CX3CL1 케모카인 과발현으로 인한 질환 예방 및 /또는 치료에 있어서의 용도를 제공하는 것이다.
【기술적 해결방법】
본 발명은 세포사멸 수용체 5(death receptor 5； DR5) 발현 또는 활성을 조절하는 제제， 예를 들면 저해제를 사용하여， 세포 표면에서의
FasL과 DR5간의 결합을 저해함으로써， 염증성 사이토카인 중 하나인
CX3CL1의 발현을 감소시켜， C¾CL1 케모카인 과발현으로 인한 질환의 효과적인 예방 및 치료 방법을 제공한다.
따라서， 본 발명은 DR5의 발현 또는 활성 저해제를 치료적 유효량으로 CX3CL1 케모카인 과발현으로 인한 질환 예방 및 /또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는 CX3CL1 케모카인 과발현으로 인한 질환의 예방 및 /또는 치료 방법을 제공한다. 또 다른 예는 DR5의 발현 또는 활성 저해제의 CX3CL1 케모카인 과발현으로 인한 질환 예방 및 /또는 치료에 있어서의 용도를 제공한다.
DR5는， TRAIL recept or 2 (TRAILR2) 또는 tumor necros i s fact or receptor super f ami ly member 10B (TNFRSF10B)라고도 칭해지며， TRAIL에 결합하는 TNF-수용체 super f ami ly의 세포표면 수용체이고 세포자멸사 (apoptosis) 신호를 전달하여 세포자멸사를 매개한다. DR5는 Caspase 8， Caspase 10, FADD (Fas-Associated protein with Death Domain) TRAIL 등과 상호작용하는 것으로 알려져 있다. 상기 DR5는 포유동물로부터 유래된 것일 수 있으며， 예컨대， 인간의 DR5 (e.g. , NCBI accession no. UniProtKB/Swiss-Prot: Q6FH58 등)일 수 있다.
본 발명의 구체적인 일 예에서는， DR5의 발현 또는 활성 저해제를 유효성분으로 함유하는 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물을 제공한다.
싱-기 DR5의 발현 또는 활성 저해제는 그 종류를 특별히 한정하지 않으나， DR5의 활성을 감소시키거나 제거하는 것은 물론， DR5의 발현억제， 제거 및 불활성화를 포함하여 DR5의 작용을 감소， 제거, 및 /또는 차단하는 작용을 하는 모든 물질을 의미하는 것이다. 예컨대， siRNA, shRNA, mi NA, 리보자임 (ribozyme), DNAzyme , ΡΝΑ( peptide nucleic acids), 안티센스 올리고뉴클레오타이드， 펩타이드， 항체， 앱타머, 천연추출물 또는 화학물질 등으로 이루어진 군에서 선택된 1종 이상의 것일 수 있으며， 바람직하게는 항체 또는 siRNA를 사용할 수 있다.
본 발명의 일 예에 따르면, 상기 DR5의 발현 또는 활성 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것일 수 있다.
본 발명의 또다른 일 구체예에 따르면， 상기 항체는 서열번호 1의 아미노산 서열 증 53번 내지 181번째 아미노산 부분을 항원으로 결합하는 것일 수 있다.
바람직하게는， 상기 항체는 서열번호 1번의 101번 내지 120번 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1번의 143번째 내지 160번째 아미노산 서열로 이루어진 huDR5의 CRD3 도메인 또는 CRD2와 CRD3 도메인 모두에 결합하는 것일 수 있으며， 예를 들어, huDR5의 CRD2 도메인 또는 huDR5의 CRD3 도메인 각각을 항원 에피토프로 결합하는 항체일 수 있따.
본 발명의 일 예에 따르면， 상기 siRNA는 서열번호 4번의 3이번 내지 363번 염기서열로 이루어진 DR5의 CRD2 도메인 암호화 염기서열， 또는 서열번호 4번의 430번 내지 483번 염기서열로 이루어진 DR5의 CRD3 도메인 암호화 염기서열 또는, 상기 DR5의 CRD2 도메인 암호화 염기서열 및 DR5의 CRD3 도메인을 암호화하는 염기서열 모두에 결합하는 siRNA일 수 있다. 바람직하게는 DR5의 CRD2 도메인 암호화 염기서열과 DR5의 CRD3 도메인 암호화 염기서열 각각에 결합해 DR5의 CRD2 및 CRD3의 발현을 억제하는 siRNA 일 수 있다.
CX3CL1 케모카인은 프렉탈카인 (Frac lkine; FKN)이라고 불리며， chemokine (C— X3— C motif) ligand 1로 알려져 있으며 염증 유발에 관여하는 케모카인이다. CX3CL1은 세포 외 N말단 도메인， mucin-like stalk, transmembrane a helix 및 짧은 세포질내 꼬리를 포함하며, 373개의 아미노산으로 구성되어 있는 독특한 형태의 케모카인이다. 특히 수용성 형태의 C¾CL1은 단핵구， NK cell 및 T cell에서 주화성 활성 (chemotact ic activity)을 나타내는 것으로 알려져 있다. 또한， C¾CL1은 류마티스관절염 (RA) 활막조직 '내의 대식세포, 섬유아세포， 내피세포 및 수지상세포 등에서 발현되며 백혈구에서는 접착성 분자로 작용하고 내피를 통한 백혈구의 혈관 외 유출을 향상시킨다. 또한， TNF-α , IFN-y , and IL- 1β에 의해 유도된 CX3CL1은 축삭 경화증， 류마티스관절염 (RA), HIV 감염， 암 및 다른 여러 질환， 합병증 등과 연관되어 있는 것으로 알려져 있으나， 현재까지 CX3CL1을 타겟으로 하는 임상적 치료법은 나와있지 않다.
상기 CX3CL1 케모카인 과발현으로 인한 질환은 그 종류를 특별히 한정하지 않으나, 관절염', 심혈관계 질환, 암， HIV 감염증， 일차성 담즙성 간경화증 (Primary biliary cirrhosis) , 신장병 (renal disorder) , 동종이식거부반응 (allograft rejection), 고혈압 (Hypertension)， 눈병 (eye disease) , 만성 췌장염 (Chronic pancreatitis), 신경성 동통 (neuropathic pain), 쇼그렌 증후군 (Sjogren's syndrome), 만성폐쇄성폐질환， 폐기종 (COPD and emphysema; Am J Pathol . 2008 Oct； 173(4) :949-61) , 폐섬유화증 (Pulmonary fibrosis; Ann Rheum Dis. 2005 Jan;64(l)：21-8. ) , 아토피성 피부염 (Atopic dermatitis; J Allergy Clin Immunol . 2004 May; 113(5) :940—8)， 및 루푸스콩팥염 (Lupus nephritis; Arthritis Rheum. 2005 May;52(5): 1522-33.) 으로 이루어진 군에서 선택된 어느 하나 이상일 수 있으며 , 특히， 관절염， 심혈관계 질환， 암， HIV 감염증 중 어느 하나일 수 있고, 바람직하게는 관절염일 수 있다.
구체적으로 상기 관절염은 골관절염， 퇴행성관절염， 박리성 골연골염， 관절 인대손상， 반월상 연골판 손상, 관절의 부정정렬, 무혈성 괴사증, 류마티스성 관절염, 소아 특발성 관절염， 외상， 염증성 관절염 또는
'감염으로 인한 관절염이다. 한편， 상기 심혈관계 질환은 죽상동맥경화증 (atherosc leros i s) , 관상동맥질환 (coronary artery di sease) , 경동맥질환 (carot i d artery di sease) , 뇌졸중 (stroke) 또는 경동맥 죽상동맥경화증 (carot i d atherosc l eros i s )일 수 있으며， 상기 암은 대장암 또는 폐암일 수 있다.
상기 질환 예방 또는 치료용 조성물은 담체， 부형제， 붕해제, 감미저 1， 피복제， 팽창제， 윤활제， 활택제， 향미제， 항산화제， 완층액， 정균제， 희석제， 분산제， 계면활성제， 결합제 및 윤활제로 이루어진 군에서
선택되는 하나 이상의 보조제를 추가로 포함할 수 있다.
구체적으로 담체 , 부형제 및 희석제는 락토즈 , 덱스트로즈， 수크로스， 솔비를， 만니롤, 자일리를， 에리스리를， 말티를， 전분， 아카시아 고무， 알지네이트, 젤라틴, 칼슘 포스페이트， 칼슘 실리케이트， 셀롤로즈， 메틸 샐를로즈， 미정질 셀를로스, 폴리비닐 피를리돈， 물， 메틸히드록시벤조에이트， 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며， 경구투여를 위한 고형제제에는 정제, 환제, 산제， 과립제， 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제， 예를 들면， 전분， 칼슘카보네이트， 수크로스 또는 락토오스， 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트， 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제， 내용액제， 유제， 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물， 리퀴드 파라핀 이외에 여러 가지 부형제， 예를 들면 습윤제， 감미제， 방향제， 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제， 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제， 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름， 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다 . 좌제의 기재로는 위텝솔 (wi tepsol ) , 마크로골， 트원 (tween) 61， 카카오지， 라우린지ᅳ 글리세로제라틴 등이 사용될 수 있다.
상기 조성물의 제형은 그 종류를 특별히 한정하지 않으나， 과립제， 산제， 피복정, 정제, 환제， 캡술제, 좌제， 겔， 시럽, 즙， 현탁제. , 유제， 점적제 또는 액제로 이루어진 군에서 선택될 수 있다.
본 발명의 조성물의 유효 투여량의 범위는 성별, 중증도, 연령, 투여방법， 표적세포 및 발현 수준 등 다양한 요인에 따라 달라질 수 있으며， 당 분야의 전문가들에 의해 용이하게 결정될 수 있다. . 또한, 본 발명자들은 일반적으로 DR5에 결합하는 리간드로 알려져있는 TRAIL을 처리하여 TRAILᅳ DR5 결합반응을 시켰을 때와 달리， FasL과 DR5가 특이적 결합하여 FasL_DR5 결합 시， 세포 내 CX3CL1의 양이 증가됨을 구체적 실험을 통해 확인하였다 (하기 실시예 4 참조) . 또한， FasL-DR5에 항 DR5항체 또는 DR5 유전자를 넉다운시키기 위한 s iRNA를 처리하여 FasL-DR5 결합체 형성을 방해할 시， 분비되는 CX3CL1의 양이 감소됨을 확인하였다 (하기 실시예 5 참조) .
즉, 본 발명자들은 DR5의 발현 또는 활성 저해제를 처리하면 세포 내 CX3CL1 케모카인 발현이 유의적으로 억제시킬 수 있음을 밝혔으며， 상기에서 언급한 바와 같이 DR5의 발현 또는 활성 저해제를 CX3CL1 과발현에 의해 유발되는 질환의 예방 및 치료용 조성물의 유효성분으로 사용할 수 있음을 밝혔다 (하기 실시예 6 참조) .
이러한 발견에 기초하여， 본 발명의 또 다른 일 예에서는， DR5의 발현 또는 활성 저해제를 유효성분으로 함유하는， C¾CL1 케모카인 발현 억제용 조성물을 제공한다.
DR5 단백질은 FasL과 결합하여， 세포 내 C¾CL1의 발현을
증가시키므로 본발명의 DR5의 발현 또는 활성 저해제를 처리할 경우， 세포 내 CX3CL1의 발현을 유의적으로 억제할 수 있다.
상기 DR5저해제는 그 종류를 특별히 한정하지는 않으나， s i RNA , shRNA , mi RNA , 리보자임 ( r i bozyme ) , DNAzyme , PNA( pept i de nuc l e i c ac i ds ) , 안티센스 올리고뉴클레오타이드， 펩타이드, 항체， 앱타머， 천연추출물 또는 화학물질 등으로 이루어진 군에서 선택된 1종 이상의 것일 수 있으며， . 바람직하게는 항체 또는 s iRNA를 사용할 수 있다.
본 발명의 일 예에 따르면， 상기 DR5의 발현 또는 활성 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것일 수 있다.
본 발명의 또다른 일 구체예에 따르면， 상기 항체는 서열번호 1의 아미노산 서열 중 53번 내지 181번째 아미노산 부분을 항원으로 결합하는 것일 수 있다.
바람직하게는， 상기 항체는 서열번호 1번의 1이번 내지 120번 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1번의 143번째 내지 160번째 아미노산 서열로 이루어진 DR5와 CRD3 도메인 또는 CRD2와 C D3 도메인 모두에 결합하는 것일 수 있으며， 예를 들어， DR5의 CRD2 도메인 또는 hLiDR5의 .CRD3 도메인 각각을 항원 에피토프로 결합하는 항체일 수 있다. ,
본 발명의 일 예에 따르면， 상기 s iRNA는 서열번호 4번의 3이번 내지 363번 염기서열로 이루어진 DR5의 CRD2 도메인 암호화 염기서열， 또는 서열번호 4번의 430번 내지 483번 염기서열로 이루어진 DR5의 CRD3 도메인 암호화 염기서열 또는， 상기 DR5의 CRD2 도메인 암호화 염기서열 및 DR5의 CRD3 도메인 암호화 염기서열 모두에 결합하는 s iRNA 일 수 있다. 바람직하게는 DR5의 CRD2 도메인 암호화 염기서열 각각 DR5의 CRD3 도메인 암호화 염기서열 각각에 결합해 DR5의 CRD2 및 CRD3의 발현을 억제하는 s i RNA 일 수 있다.
또한, 본 발명의 또 다른 구체예에서는, · 시료에 후보 물질을 반웅시키는 단계 ;
상기 시료의 DR5 활성 또는 발현양을 측정하는 단계를 포함하고， 상기 후보 물질을 처리한 시료에서의 DR5의 활성 또는 발현양이， 후보물질을 처리하지 않은 시료에서의 DR5보다 감소된 경우; 상기 후보 물질을 C¾CL1 케모카인 발현 저해제로 결정하는 단계를 포함하는， 케모카인 발현 저해제의 스크리닝 방법을 제공한다.
상기 스크리닝 방법에 의하여 선별된 CX3CL1 케모카인 발현 저해제는 관절염 , 심혈관계 질환， 암， HIV 감염증, 일차성 담즙성 간경화증， 신장병， 동종이식거부반응， 고혈압， 눈병， 만성 췌장염， 신경성 동통， 쇼그렌 증후군， 만성폐쇄성폐질환， 폐기종， 폐섬유화증， 아토피성 피부염， 및 루푸스콩팔염 등 과 같은 C¾CL1 케모카인 과발현으로 인해 유발되는 질환의 예방제 및 /또는 치료제로서 사용 가능하다. 따라서, 상기 스크리닝 방법은 CX3CL1 케모카인 과발현으로 인해 유발되는 질환의 예방제 및 /또는 치료제의 스크리닝 방법일 수 있다.
상기 시료는 동물, 바람직하게는 포유류로부터 얻어진 세포, 조직 또는 기관일 수 있으며， 바람직하게는 RA(Rheumato i d arthr i t i s ) 부위, 면역 특전 부위 ( i隱 une pr i vi l eged s i te) 등을 포함하는 것일 수 있으며， 보다 바람직하게는， τ 세포, NK 세포, 류마티스 세포， 종양 세포 또는 안구 등일 수 있다.
싱-기 DR5의 활성은 통상적 방법으로 측정 가능하며， 이는 이 발명이 속하는 기술분야의 통상의 지식을 가진 자라면 용이하게 알 수 있다.
예컨대 DR5와 시료사이의 반웅 확인은 단백질-단백질간 또는 단백질一 화합물간의 반웅 여부를 확인하는데 통상 사용되는 방법들을 사용할 수 있다. 예를 들어 DR5와 시험대상물질을 반웅시킨 후 활성을 측정하는 방법, 효모 이중 흔성법 (yeast two hybr i d) , DR5에 결합하는 파지 디스플레이 펩티드 클론의 검색， 천연물 및 화학물질 라이브러리 등을 이용한 HTS(hi gh throughput screening) , 드럭 히트 HTS 또는 세포 기반 스크리닝 (ce l l- based screeni ng) 등을 이용하는 스크리닝법 등을 사용할 수 있으나， 이러한 방법에 제한되는 것은 아니다.
또한, 상기 DR5의 발현양은 DR5를 암호화하는 유전자를 포함하는 조성물과 시료 사이의 반웅을 확인함으로써 측정할 수 있으며， 반웅 확인은 DNA-DNA , DNA-RNA , DNA-단백질 간의 반응 여부를 확인하는데 사용되는 통상적인 방법들을 사용할 수 있다ᅳ 예를 들어 in vitro 에서 상기
유전자와 시험대상물질 사이의 결합 여부를 확인하기 위한 흔성화 시험, 포유류 세포와 시험대상물질을 반응시킨 후 노던 분석을 통한 상기
유전자의 발현율 측정 방법， 또는 상기 유전자에 리포터 유전자를 연결시켜 세포 내로 도입한 후 시험대상물질과 반응시키고 리포터 단백질의 발현울을 측정하는 방법 등을 사용할 수 있으나, 이러한 방법에 제한되는 것은 아니다.
본 발명의 스크리닝 방법에서， 상기 시료는 통상적인 선정방식에 따라 CX3CLl ( f ract alki ne ) 케모카인 과발현으로 인한 질환 예방 또는 치료의 가능성을 지닌 것으로 추정되거나 또는 무작위적으로 선정된 개별적인 핵산， 단백질, 기타 추출물 또는 천연물, 화합물 등이 될 수 있다.
이러한 스크리닝 방법에 의하여 얻어진 물질은 이후의 C¾CL1 케모카인 과발현으로 인한 질환의 발병 예방 및 발병 초기의 치료효과뿐만 아니라, 병세가 어느 정도 진행된 중기 및 말기에도 우수한 병세 완화 및 치료 효과를 갖는다는 이점이 있으며， C¾CL1 케모카인 과발현으로 인한 질환 예방 또는 치료제 개발과정에서 선도 물질 ( l eading compound)로서 작용할 수 있다. 선도물질의 구조를 변형시키고 최적화함으로써， 새로운 치료제를 개발할 수 있으며, 이러한 물질은 DR5의 발현 또는 활성을ᅵ 억제함으로써 CX3CL1의 발현 억제 효과를 나타나게 되므로 관절염， 심혈관계 질흰-， 암, HIV 감염증， 일차성 담즙성 간경화증, 신장병, 동종이식거부반웅， 고혈압, 눈병， 만성 췌장염, 신경성 동통， 쇼그렌 증후군，
만성폐쇄성폐질환， 폐기종， 폐섬유화증， 아토피성 피부염， 및 루푸스콩팔염 등 과 같은 CX3CL1 케모카인 과발현으로 인해 유발되는 질환 특히 류마티스 질환을 포함하는 관절염을 예방 또는 치료할 수 있다ᅳ
본 발명의 일 예는 DR5의 발현 또는 활성 저해제를 치료적 유효량으로 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는, C¾CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법을 제공한다.
상기 DR5의 발현 또는 활성 저해제는 siRNA, shRNA, miRNA, 리보자임 (ribozyme)， DNAzyme , PNA(peptide nucleic acids) , 안티센스 을리고뉴클레오타이드， 펩타이드， 항체， 앱타머， 천연추출물 또는 화학물질일 수 있으며， 바람직하게는 항체 또는 siRNA일 수 있다.
본 발명의 일 구체예에. 따르면， 상기 DR5의 발현 또는 활성 저해제는
DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것일 수 있다.
또한， 상기 항체는 서열번호 1의 아미노산 서열 중 53번 내지 181번째 아미노산 부분에 결합하는 것이며， 바람직하게는 서열번호 1의 101번 내지 120번째 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1의 143번째 내지 160번째 아미노산 서열로 이루어진 DR5의 CRD3 도메인 또는 상기 CRD2와 CRD3 도메인 모두에 결합하는 것일 수 있다.
본 발명의 또다른 일 예는 DR5의 발현 또는 활성 저해제의 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도를 제공한다. 상기 DR5의 발현 또는 활성 저해제는 siRNA, shRNA, miRNA, 리보자임 (ribozyme), DNAzyme , PNA(peptide nucleic acids), 안티센스 올리고뉴클레오타이드， 펩타이드， 항체， 앱타머, 천연추출물 또는 화학물질일 수 있으며， 바람직하게는 항체 또는 siRNA일 수 있다.
본 발명의 일 구체예에 따르면， 상기 DR5의 발현 또는 활성 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것일 수 있다.
또한, 상기 항체는 서열번호 1의 아미노산 서열 중 53번 내지 181번째 아미노산 부분에 결합하는 것이며， 바람직하게는 서열번호 1의 101번 내지 120번째 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1의 143번째 내지 160번째 아미노산 서열로 이루어진 DR5의 CRD3 도메인 또는 상기 CRD2와 CRD3 도메인 모두에 결합하는 것일 수 있다.
따라서， 본 발명에서 제시된 DR5의 발현 또는 활성 저해제를
유효성분으로 함유하는 염증， CX3CL1 케모카인 과발현으로 인해 유발되는 질환의 예방 및 /또는 치료기술， 및 이를 이용한 신규한 케모카인 발현 . 억제제의 스크리닝 기술은， C¾CL1 케모카인 과발현으로 인해 유발되는 질환의 발생을 효과적으로 예방할 수 있을 뿐 아니라， 병세가 어느 정도 진행된 후에도 우수한 치료 효과를 얻을 수 있게 하여， 고통받는 많은 환자들을 치료하는데 매우 유용한 기술이며， C¾CL1 케모카인 과발현으로 인해 유발되는 질환의 예방 또는 치료제의 탐색 및 개발에 유용하게 사용될 수 있다.
한편， 본 발명의 또 다른 예에 있어서， 케모카인 발현 감소를 필요로 하는 환자 또는 케모카인이 과다 발현된 세포에 DR5 저해제를 투여하여， CX3CL1 케모카인 발현을 감소시키는 방법을 제공할 수 있으며， 또한 CX3CL1 케모카인이.과발현된 세포에 DR5 저해제를 투여함으로써, 염증， CX3CL1 케모카인 과발현으로 인해 유발되는 질환 특히 관절염의 예방 또는
치료방법을 제공할 수 있다.
상기 DR5 저해제는 DR5 유전자의 발현을 억제하거나, 또는 DR5 단백질의 활성을 억제하는 물질이라면， 그 종류를 특별히 한정하지 않으며， 상기 DR5저해제는 s iRN/\ , shRNA , miRNA , 리보자임 (r ibozyme)， DNAzyme , PNA(pept i de nuc lei c aci ds) , 안티센스 올리고뉴클레오타이드, 펩타이드, 항체, 앱타머, 천연추출물 또는 화학물질일 수 있다.
【발명의 효과】
본 발명은 DR5 발현 또는 활성을 조절하는 제제， 예를 들면 저해제를 사용하여， 세포 표면에서의 FasL과 DR5간의 결합을 저해함으로써， 염증성 사이토카인 중 하나인 C¾CL1의 발현을 감소시켜， CX3CL1 케모카인 과발현으로 인해 유발되는 질환을 효과적으로 예방 및 치료할 수 있다.
【도면의 간단한 설명】
도 1의 (A)는 정상 마우스 (Normal )와 관절염 유도 마우스 (RA)에서 얻은 관절에서 활막세포 (Adherent cel l I Adh. ) 및 일반 면역세포 (Supernatant cel l I Sup . )를 각각 분리한 후， 각각의 세포에서 DR5 유전자의 발현을 real—t ime PCR을 통해 확인한 결과를 나타내며, 도 1의 (B)는 관절염 유도 마우스 (RA)에서 얻은 관절의 활막세포에서 DR5 표면단백질의 발현을 유세포분석을 통해 확인한 결과를 나타내고， 도 1의 (C)는 hFLS에서 DR5 표면단백질의 발현을 유세포분석을 통해 확인한 결과를 나타낸다.
도 2는 FasL-DR5 상호결합을 확인하기 위한 실험 결과를 나타내며， 도 2의 (A)는 hFLS에 대한 FasL의 결합을 항— DR5 항체를 처리해 저해하였을 때, FasL— IgG의 결합이 저해되었음을 확인함으로써 FasL— DR5의 상호작용을 검증한 결과를 나타낸 것이며， 도 2의 (B)는 s iRNA를 처리하여 hFLS에서의 DR5 넉다운 (knock down)시킨 후 IgG가 결합된 FasL을 처리한 하고 세포표면에서의 IgG 신호 세기를 유세포분석으로 확인한 결과이다.
도 3은 hFLS에 FasL과 TRAIL을 단독 또는 공동으로 처리한 후， CX3CL1의 분비를 ELISA로 확인한 결과를 나타낸다.
도 4의 (A)는 hFLS에 항 -DR5 항체를 처리하여 FasL과 DR5의 상호작용을 억제한 후, 분비되는 CX3CL1의 양을 ELISA를 통해 측정한 결과를 나타내며, 도 4의 (B)는 마우스 활막세포에 항— DR5 항체를 처리한 후 FasL을 처리하고 나서， 분비되는 CX3CL1의 양을 ELISA를 통해 측정한 결과를 나타낸다.
도 5의 (A)는 DR5 s iRNA 처리로 인해 hFLS의 세포 표면에서의 DR5 표면단백질의 발현이 감소 결과를 나타낸 그래프이며, 도 5의 (B)는 DR5 s iRNA 처리로 인해 hFLS에서의 CX3CL1의 분비가 감소되는 결과를 나타낸 그래프이다.
도 6은 FasL 결핍 마우스인 gl d 마우스에 sFasL을 주사함과 동시에 항 -DR5 항체를 주입하였을 경우， sFasL 주사에 의해 유도되는 관절염의 병증이 완화됨을 확인한 결과를 나타낸다. K/BxN 혈청을 처리한 gld 마우스， K/BxN 혈청과 sFasL을 처리한 gld 마우스， K/BxN 혈청, sFas 리간드 및 항- DR5 항체 (ant i -DR5)를 주사한 gld 마우스에서 관절염 병증의 변화를 나타내며, (A)는 관절의 두께, (B)는 임상지수 측정 그래프이다.
도 7a는 huDR5 단백질 아미노산 서열 및 sFasL이 결합할 것으로 예상되는 후보 부위인 huDR5_CRD2와 huDR5-CRD3을 나타내며， 111， 114， 119， 120 , 148 , 150， 153 , 및 156번째 아미노산은 Al anin 치환 匪 tat ion이 일어나는 부위이다.
도 7b는 huDR5 DNA 서열인 서열번호 4의 1번 내지 840번째 염기서열을 나타내고， 334번 내지 363번째 염기서열로 이루어진 폴리뉴클레오타이드와 445번 내지 471 번째 염기서열로 이루어진 폴리뉴클레오타이드는 mut at i on이 일어나는 부위를 나타낸다.
도 8a는 huDR5 단백질 아미노산 서열, sFasL이 결합할 것으로 예상되는 후보 부위인 huDR5-CRD2와 huDR5— CRD3 및 DR5 FACS 항체의 면역원 부위를 나타낸다. 도 8b는 huDR5-CRD2 또는 huDR5— CRD3를 mutation한 DR5를 발현시킨 후， huDR5에 결합하는 면역 글로블린 (IgG)이 결합된 인간 FasL(hFasL— IgG)을 이용하여 유세포분석을 수행한 결과를 나타낸다.
도 9는 sFasL이 인체유래 FLS의 DR5 수용체와 결합함으로써
SCX3CL1의 발현을 촉진시키고, 이 sCX3CLl이 면역세포로부터의 CCL2, CCL3, CXCL10 등의 케모카인의 발현을 증가시킴으로써 염증을 유발하는 메커니즘 모델의 개략도를 나타낸다. ᅳ
【발명의 실시를 위한 형태】
이하， 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 제한되는 것은 아니다. 실시예 1. sFas 리간드와결합하는 막단백질 (DR5) 동정
지금까지 FasL이 그것의 수용체인 Fas와 결합하여 표적세포의 아품토시스를 유도함으로써 관절 염증을 유발함이 알려졌다. 이에 더 나아가, 이전 본 발명자들의 연구에서 기존 Fas-FasL간의 아폼토시스가 염증유발과는 별개의 새로운 기작으로 FasL이 케모카인의 발현을 조절함을 밝혔고， 또한 FasL 자체가 염증세포를 끌어들이는 케모카인으로 작용함을 입증하였다. 하지만, 이전 연구에서는 새로운 FasL에 의한 염증 유발 기작에서 FasL이 어떠한 막단백질과 결합하여 염증발생을 조절하는지를 구체적으로 밝히지는 못하였다.
이에， 본 발명자들은 새로운 FasL에 의한 염증유발 메커니즘에서 sFasL( soluble Fas Ligand)와 결합하는 단백질을 밝히기 위해 단백질 동정 실험을 수행하였다.
우선, in vitro에서 관절염 환자의 윤활막 (synovium)을 얻은 후
Collagenase로 digestion 시키고 3일간 배양한 후 adherent cell을 분리하여 인간 섬유모세포 유사 윤활막세포 (human f ibroblast-1 ike synoviocyte; hFLS)를 얻었다. 얻은 hFLS와 재조합 인간 Fas 리간드 (R&D Systems 126-FL-010)를 Sul fo—NHS-SS-Biot in - Thermo Scientific #21331 로 biotinylation 시켜 얻은 biotinylated sFasL을 반응시켜， sFasL과 hFLS표적 수용체단백질을 결합시켰다. 다음으로 가교제 (bis(sulfosuccinimidyl)suberate; BS3)를 사용하여 가교시킨 후， 세포 용혈 (cell lysis)을 수행하였다. ' 다음으로 sFasL과 결합한 hFLS 표적 단백질을 분리하기 위하여， avidin pur i f icat ion을 수행하여 biot inylated sFas 리간드 재조합 단백질과 이와 결합한 hFLS 표적 수용체단백질을 함께 분리하였다. 이후, SDS— PAGE로 시료를 분리하고 gel을 분획화한 뒤 m-gel digestion 방법으로 템타이드를 추출하였다.
추출한 펩타이드를 고해상도 Hybrid Quadrupole— orbi trap 질량분석기를 이용하여 2회 반복 분석한 후， SEQUEST 알고리즘을 이용하여 대조군 (Biotinylated Fc)에서는 나타나지 않고 실험군에서만 한 번 이상 나타나는 단백질을 선별하였다. 선별한 단백질 중 Uniprot database에 의한 분류를 이용해 세포막 또는 세포 외 기질에 존재하는 것으로 알려진 단백질을 분류하였으며， 그 중 DR5를 동정하였다. 실시예 2. hFLS및 관절염 유도마우스의 관절 활막세포에서 DR5 표면단백질의 발현 확인
인체 유래 FLS(hFLS) 및 관절염 유도 마우스의 관절 활막세포에서
DR5 표면단백질의 발현 여부를 확인하기 위해， 유세포 분석과 real-time PCR 을 수행하였다. real—time PCR은 Applied Biosystems 7500 Real Time PC System을 사용하였으며， 프라이머로 F: GGGCCACAGGGACACCTT I R ： GCATCTCGCCCGGTTTT 을 사용하였고， 50° C 2분， 95° C 2분， 95° C 15초 간 반웅 시킨 후， 60° C 1분간 40 cycles로 반웅시켰다..
다음으로， 정상 마우스 (Normal)와 관절염 유도 마우스 (RA)에서 얻은 관절에서 활막세포 (Adherent cell I Adh.) 및 일반 면역세포 (Supernatant cell I Sup.)를 각각 분리한 후, 각각의 세포에서 DR5 유전자의 발현을 비교하였다. 상기 실험결과를 도 1에 나타냈다.
도 1의 (A)에서 확인되는 바와 같이， 관절염 유도 마우스에서 얻은 관절의 활막세포에서 DR5 표면단백질의 상대 발현량이 정상 마우스에서보다 증가하였으며, 도 1의 (B) 및 (C)의 유세포 분석 결과로 확인되는 바와 같이， 관절염 유도 마우스 활막세포 (Supertant cells) 및 hFLS 에서의 DR5 표면단백질의 발현함을 확인하였다.
따라서， 정상마우스와 비교해 hFLS 및 관절염 유도 마우스의 관절에서 얻은 세포， 특히 활막세포에서 특이적으로 DR5 표면단백질의 발현이 증가함을 알 수 있었다. 실시예 3. FasL-DR5상호결합확인
3-1. DR5항체 처리
FasL과 막단백질 DR5가 실제로 결합하는지 여부를 확인하기 위하여， hFLS에 항 DR5 항체 (R&D systems AF631)를 처리하여 FasL의 세포 표면 DR5의 결합을 방해하였다.
다음으로 IgG가 결합된 FasL을 처리하고， 표면에서의 IgG 신호 세기를 유세포 분석으로 확인하였으며， 그 결과를 도 2의 (A)에 나타냈다. 도 2의 (A)에서 알 수 있는 바와 같이， 항 DR5 항체를 처리하였을 시 IgG에 의한 신호세기가 감소하였으며 , 항 DR5항체에 의해 DR5 활성이 저해된 경우 FasL-DR5 결합이 감소함을 알 수 있었다.
3-2. DR5에 대한 siRNA를 이용한 knock-down
FasL과 막단백질 DR5가 실제로 결합하는지 여부를 확인하기 위하여， hFLS에 s iRNA(Sigma Aldr i ch MISSION s iRNA ; SASI_Hs01— 00040567)를 처리하고, e l ect roporator (Neon t rans f ect ion system , Thermo Fi sher Sc i ent i f i c)을 이용하여, DR5의 발현을 넉다운 (knock-down)시켰다.
다음으로 IgG가 결합된 FasL을 처리한 뒤， 표면에서의 IgG 신호 세기를 유세포분석으로 확인하였으며， 그 결과를 도 2의 (B)에 나타냈다. 도 2(B)에서 알 수 있는 바와 같이 s iRNA를 처리하였을 때 IgG에 의한 신호세기가 감소하였으며, 즉 hFLS 표면에 DR5의 발현이 감소될 경우， Fas 리간드의 결합이 감소해 IgG에 의한 신호세기가 감소함을 알 수 있었다. 상기 결과들 로부터， FasL과 DR5가 서로 특이적으로 상호 결합함을 확인하였다. 실시예 4. FasL DR5결합으로 C¾CL1 케모카인 발현 증가확인
. FasL-DR5 결합으로 인해 발현이 증가하는 케모카인을 확인하기 위하여， hFLS에 FasL과 TRAIL을 각 200ng/mL씩 단독 또는 공동으로 24시간 동안처리한 후， CX3CL1의 분비를 ELISA(R&D systems DY365) 제조사에서 제공한 프로토콜에 따라 확인하였으며, 그 결과를 도 3에 나타내었다. 도 3에서 알 수 있는 바와 같이， DR5의 일반적인 리간드로 알려진 TRAIL을 처리하였을 때는 CX3CL1 양이 증가하지 않았으나， FasL을 처리시 CX3CL1 양이 증가함을 확인할 수 있었다.
이로부터， 다른 리간드가 아닌, FasL과 DR5의 결합으로 인해 hFLS에서의 CX3CL1 케모카인의 발현이 증가함을 알 수 있었다. CX3CL1은 염증을 유발하는 케모카인 증 하나로 FasL-DR5의 결합 시 hFLS 세포의 CX3CL1의 분비를.촉진시켜 염증을 유발함을 확인할 수 있었 실시예 5. FasL-DR5 억제시 케모카인 발현 감소 확인
FasL과 DR5의 상호작용을 억제할 시， FasL 처리시 분비되는 케모카인
CX3CL1의 분비가 감소되는지 여부를 확인하기 위하여， 하기 실험을 수행하였다.
5-1. DR5 항체 처리
hFLS에 또는 마우스 활막세포에 DR5에 대한 항체 (R&D Systems AF631) 0.5ug/mL을 1시간 동안 처리하고 FasL 200 ng/mL를 처리한 뒤， 분비되는 CX3CL1의 양을 ELISA를 통해 확인하였으며， 그 결과를 도 4에 나타냈다. 도 4의 (A)는 hFLS에 DR5 항체를 처리한 것으로 Isotype(Goat IgG , R&D Systems AB-108— C) 보다 ant i -DR5에서 CX3CL1의 발현이 감소하였으며， 도 4의 (B)는 마우스 활막세포에 항 -DR5 항체를 처리한 것으로 역시 ant i- DR5에서 CX3CL1의 발현이 감소함을 알 수 있었다.
5-2. s iDR5 knock-down
hFLS에 s iRNA(Sigma Aldr i ch MISSION siRNA ; SASI_Hs01_00040567)를 처리하고, electroporator (Neon t ransf ect i on system, Thermo Fi sher Sc i ent i f i c)를 이용하여 DR5의 발현을 넉다운 (knock-down)시켰으며， 그 결과 도 5의 (A)에서 알 수 있는 바와 같이 DR5 s iRNA 처리로인해 hFLS의 세포 표면 DR5 표면단백질의 발현이 감소됨을 확인하였다.
다음으로 FasL 200ng/mL을 24시간동안 처리한 뒤， 분비되는 CX3CL1의 양을 ELISA를 통해 확인하였으며， 그 결과 도 5의 (B)에서 알 수 있는 바와 같이 FasL 처리 시 분비되는 CX3CL1의 양이 대조군에 비해 감소함을 확인하였다.
상기 결과들을 종합해 볼 때， FasL이 DR5와 결합하고 이 DR5 결합을 통해 CX3CL1의 발현이 증가하며， FasL-DR5 상호작용을 방해 할 경우，
CX3CL1의 발현이 감소됨을 알 수 있었다. 이로써 DR5 항체를 처리하거나，
DR5를 넉다운시켜 DR5와 FasL간의 결합을 방해할 경우, 세포 내 염증 발생 사이토카인 CX3CL1의 발현양을 감소시켜 염증 발생을 억제하며， 염증 특히 관절염의 발병 초기 뿐만 아니라， 발명 후에도 관절염 증세 억제에 효과적이라는 것을 확인할 수 있었다. 실시예 6. 항 -DR5항체를주입했을 때 관절염 병증 완화시험
FasL에 의해 유도된 관절염 마우스 모델에 항— DR5 항체를 주입했을 때 관절염 병증 완화 여부를 확인하기 위하여， 우선 FasL이 겹핍된 gld 마우스 (중앙실험동물)와 관절염이 자연스럽게 유발된 K/BxN 마우스 (Harvard medical school , Boston, MA의 Drs .D.Mathis와 C.Benoist에게서 KRN TCR 트랜스제닉 마우스와 NOD 마우스를 제공받아 교배하여 얻음)에서 혈액으로부터 혈청을 채취해 준비하였다.
gld 마우스에 1) 상기에서 얻어진 K/BxN 혈청 주입 (-) 2)， /BxN 혈청과 sFas 리간드 ( (-) + sFas 리간드))주입， 3) K/BxN 혈청, sFas 리간드 및 항— DR5 항체 (anti_DR5)을 10일간 주사하고 각각의 관절의 두께는 칼리퍼 (Manostat, Switzerland)로 측정하고， 임상지수를 측정하였다.
임상지수 (Clinical index)는 다음을 .참조하였다:
0: no joint swelling,
1: swelling of one finger joint ,
2： mild swelling of wrist or ankle ,
3: severe swelling of wrist or ankle .
상기와 같이 측정된 관절의 두께와 .임상지수를 도 6에 나타냈다. 도 6의 (A)에서 확인되는 바와 같이， gld마우스에 혈청과 sFasL 을 처리한 경우 4일째부터 관절이 붓기 시작하여 9 ~ 10일에 가장 높은 지수를 관찰할 수 있었다. 하지만 gld 마우스에 혈청과 sFasL 및 항— DR5를 함께 처리한 경우， 관절이 거의 붓지 않은 것을 관찰할 수ᅵ 있었다. 또한, 도 6의 (B)에서 확인되는 바와 같이. 임상지수 역시 gld 마우스에 혈청과 sFasL 및 항 -DR5를 함께 처리하였을 때 임상지수가 3~4점에 머물러 있었으며， 관절이 거의 붓지 않은 것을 관찰할 수 있었다.
상기 결과들 로부터， 항— DR5 처리로 인한 DR5— FasL의 결합 차단은 염증 반웅을 억제하며， 관절염을 비롯한 염증의 예방 및 치료제로 사용 가능함을 확인할 수 있었다ᅳ
실시예 7. DR5 mutagenesis를통해 sFasL-DR5결합부위 확인
sFasL과 DR5의 결합 부위를 확인하기 위하여， huDR5(표 1의 서열번호 1)가 cloning 된 piRES3-Puro vector를 주형으로 사용하고， Overlap PCR method를 이용하여 huDR5 단백질 아미노산 서열에서 (도 7a 참조) sFasL이 결합할 것으로 예상되는 후보 부위 (기존에 DR5의 ligand인 TRAIL이 binding 하는 부분을 후보부위로 선정)인 huDR5— CRD2(전체 sequence 중 334~363) 또는 huDR5-CRD3(전체 sequence 중 445~471)에서 도 7b 에서 파란색으로 표시된 amino acid를 alanine으로 치환한 후 클로닝 (cloning)하여， huDR5 mutation DNA (도 7b 및 표 1참조)를 제조하였다.
Mutation시킨 huDR5 DNA를 마우스 세포에 형질주입( 3 6(^1011)하고 각각의 huDR5-CRD2를 mutation한 DR5(표 1， 서열번호 4) 또는 huDR5-CRD3를 mutation한 DR5(표 1， 서열번호 5)를 발현시킨 후， huDR5가 발현되는 세포에만 결합하는 면역 글로블린 (IgG)이 결합된 인간 FasL(huFasL-IgG)을 이용하여 유세포분석을 수행하였으며， 그 결과를 도 8b에 나타냈다.
도 8b에서 알 수 있는 바와 같이， CRD2 또는 CRD3가 mutation된 huDR5에는 huFasL-IgG가 결합하지 않았으며， 이로써 FasL_DR5간의 결합부위는 TRAIL 과 유사하게 DR5의 CRD2 와 CRD3를 이용하여 결합함을 확인하였다.
【표 1】
Figure imgf000020_0001
gacccagggaggcgcggggagccaggcctgggccccgggtccccaagacccttgtgctcgt tgtcgccgcggtcctgctgttggtctcagctgagtctgctctgatcacccaacaagacct gctccccagcagagagcggccccacaacaaaagaggtccagcccctcagagggat tgtgtc cacctggacaccatatctcagaagacggtagagat tgcatctcctgcaaatatggacagga ctatagcactcactggaatgacctcctt t tctgct tgcgctgcaccaggtgtgattcaggt gaagtggagctaagtccctgcaccacgaccagaaacacagtgtgtcagtgcgaagaaggca ccttccgggaagaagat tctcctgagatgtgccggaagtgccgcacagggtgtcccagagg gatggtcaaggtcggtgattgtacaccctggagtgacatcgaatgtgtccacaaagaatca ggcatcatcataggagtcacagttgcagccgtagtct tgat tgtggctgtgtttgtttgca agtct t tactgtggaagaaagtcct tcct tacctgaaaggcatctgctcaggtggtggtgg ggaccctgagcgtgtggacagaagctcacaacgacctggggctgaggacaatgtcctcaat gagatcgtgagtatct tgcagcccacccaggtccctgagcaggaaatggaagtccaggagc cagcagagccaacaggtgtcaacatgt tgtcccccggggagtcagagcatctgctggaacc ggcagaagctgaaaggtctcagaggaggaggctgctggttccagcaaatgaaggtgatccc actgagactctgagacagtgc tcgatgactttgcagacttggtgccctt tgactcctggg agccgctcatgaggaagttgggcctcatggacaatgagataaaggtggctaaagctgaggc agcgggccacagggacacct tgtacacgatgct a aaagtgggtcaacaaaaccgggcga gatgcctctgtccacaccctgctggatgccttggagacgctgggagagagacttgccaagc agaagat tgaggaccacttgt tgagctctggaaagttcatgtatctagaaggtaatgcaga ctctgccatgtcctaa
Mutat ion atggaacaacggggacagaacgccccggccgcttcgggggcccggaaaaggcacggcccag 5 huDR5— gacccagggaggcgcggggagccaggcctgggccccgggtccccaagacccttgtgctcgt CRD2 DNA tgtcgccgcggtcctgctgt ggtctcagctgagtctgctctgatcacccaacaagaccta
gctccccagcagagagcggccccacaacaaaagaggtccagcccctc gaggga gtgtc cacctggacaccatatctcagaagacggtagagat tgcatctcctgcaaatatggacagga ctatagcactcactggaatgacctccttgcctgct tggcctgcaccacgtgtgctgcaggt gaagtggagctaagtccctgcaccacgaccagaaacacagtgtgtcagtgcgaagaaggca ccttccgggaagaagat tctcctgagatgtgccggaagtgccgcacagggtgtcccagagg gatggtcaaggtcggtgat tgtacaccctggagtgacatcgaatgtgtccacaaagaatca ggcat cat cataggagtcacagttgcagccgt agtct tgat tgtggctgtgtttgtttgca agtc t tactgtggaagaaagtcct tcct tacc tgaaaggca tctgct caggtggtggtgg ggaccctgagcgtgtggacagaagctcacaacgacctggggctgaggacaatgtcctcaat gagatcgtgagtatct tgcagcccacccaggtccctgagcaggaaatggaagtccaggagc cagcagagccaacaggtgtcaacatgt tgtcccccggggagtcagagcatctgctggaacc ggcagaagctgaaaggtctcagaggaggaggctgctggttccagcaaatgaaggt atccc actgagactctgagacagtgcttcgatgactttgcagacttggtgccctt tgactcctggg agccgctcatgaggaagttgggcctcat gacaatgagataaaggtggctaaagctgaggc agcgggccacagggacaccttgtacacgat ct ataaagtgggtcaacaaaaccgggcga gatgcctctgtccacaccctgctggatgccttggagacgctgggagagagacttgccaagc agaagat tgaggaccact tgt tgagctctggaaagt tcatgtatctagaaggtaatgcaga ctctgccatgtcctaa
Mutation atggaacaacggggacagaacgccccggccgcttcgggggcccggaaaaggcacggcccag 6 huDR5~ gacccagggaggcgcggggagccaggcctgggccccgggtccccaagacccttgtgctcgt CRD3 DNA tgtcgccgcggtcctgctgttggtctcagctgagtctgctctgatcacccaacaagaccta
get ccccagcagagagcggccccacaacaaaagaggtccagcccctcagagggat tgtgtc cacctggacaccatatctcagaagacggtagagat tgcatctcctgcaaatatggacagga ctatagcactcactggaatgacctcct t ctgcttgcgctgcaccaggtgtgattcaggt gaagtggagctaagtccctgcaccacgaccagaaacacagtgtgtcagtgcgaagaaggca ccttccgggaagaagatgctcctgcgatgtgcgcgaagtgcgccacagggtgtcccagagg gatggtcaaggtcggtgat tgt caccctggagtgacatcgaatgtgtccacaaagaatca ggcatcatcataggagtcacagttgcagccgtagtcttgattgtggctgtgtttgtttgca agtct t tactgtggaagaaagtcct tcct tacctgaaaggcatctgctcaggtggtggtgg ggaccc gagcgtgtggacagaagctcacaacgacctggggctgaggacaatgtcctcaat gagatcgtgagta cttgcagcccacccaggtccctgagcaggaaatggaagtccaggagc cagcagagccaacaggtgtcaacatgttgtcccccggggagtcagagcatctgctggaacc ggcagaagctgaaaggtctcagaggaggaggctgctggttccagcaaatgaaggtgatccc act gagactctgagacagtgcttcgatgactt gcagact tggtgccctttgactcctggg agccgctcatgaggaagttgggcctcatggacaatgagataaaggtggctaaagctgaggc agcgggccacagggacaccttgtacacgatgctgataaagtgggtcaacaaaaccgggcga gatgcctctgtccacacc'ctgctggatgccttggagacgctgggagagagacttgccaagc agaagat tgaggaccact tgt tgagctctggaaagt tcat t tctagaaggtaatgcaga ctctgccatgtcctaa

Claims

【청구의 범위】
【청구항 1】
세포사멸 수용체 5(death receptor 5； DR5)의 발현 또는 활성 저해제를 유효성분으로 함유하는, CX3CLl(fractalkine) 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물.
【청구항 2]
제 1항에 있어서', 상기 DR5의 발현 또는 활성 저해제는 s iRNA , shRNA , miR A , 리보자임 (r i bozyme)， DNAzyme , PNA(pept i de nuc l ei c ac i ds) , 안티센스 올리고뉴클레오타이드， 펩타이드， 항체， 앱타머， 천연추출물 또는 화학물질인 것인， 조성물.
【청구항 3】
제 1항에 있어서， 상기 DR5의 발현 또는 활성 저해제는 항체 또는 s iRNA인， 조성물.
【청구항 4】
제 1항에 있어서， 상기 DR5의 발현 또는 활성 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것인， 조성물.
【청구항 5】
제 3항에 있어서， 상기 항체는 서열번호 1의 아미노산 서열 중 53번 내지 181번째 아미노산 부분에 결합하는 것인， 조성물.
【청구항 6】
제 3항에 있어서 , 상기 항체는 서열번호 1의 1이번 내지 120번째 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1번의 143번째 내지 160번째 아미노산 서열로 이루어진 DR5의 CRD3 도메인 또는 상기 CRD2와 CRD3 도메인 모두에 결합하는 것인， 조성물.
【청구항 7】
제 1항에 있어서, 상기 CX3CL1 케모카인 관련 질환은 관절염， 심혈관계 질환， 암， HIV 감염증， 일차성 담즙성 간경화증， 신장병， 동종이식거부반웅， 고혈압， 눈병， 만성췌장염， 신경성 동통， 쇼그렌 증후군， 만성폐쇄성폐질환， 폐기종， 폐섬유화증， 아토피성 피부염， 및 루푸스콩팔염으로 이루어진 군에서 선택된 1종 이상인.， 조성물.
【청구항 8】
제 7항에 있어서， 상기 심혈관계 질환은 죽상동맥경화증, 관상동맥질환， 경동맥질환， 뇌졸중 또는 경동맥 죽상동맥경화증인， 조성물.
【청구항 9】
제 7항에 있어서， 상기 암은 대장암 또는 폐암인， 조성물.
【청구항 10】
세포사멸 수용체 5(death receptor 5； DR5)의 발현 또는 활성 저해제를 유효성분으로 함유하는, CX3CL1 케모카인 발현 억제용 조성물.
【청구항 11】
제 10항에 있어서， 상기 DR5 단백질은 Fas 리간드와 결합하여， CX3CL1의 발현을 증가시키는 것을 특징으로 하는， CX3CL1 케모카인 발현 억제용 조성물.
【청구항 12】
제 10항에 있어서， 상기 DR5의 저해제는 s iRNA , shRNA , miRNA , 리보자임 ( r i bozyme) , DNAzyme , PNA(pept i de nuc l e i c ac i ds ) , 안티센스 올리고뉴클레오타이드， 펩타이드, 항체， 앱타머， 천연추출물 또는 화학물질인 것인， 조성물. ■
【청구항 13]
제 12항에 있어서， 상기 DR5의 저해제는 항체 또는 s iRNA인， 조성물.
【청구항 14】
제 12항에 있어서， 상기 DR5의 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것인， 조성물.
【청구항 15】
제 13항에 있어서， 상기 항체는 서열번호 1의 아미노산 서열 중 53번 내지 181번째 아미노산 부분에 결합하는 것인， 조성물.
【청구항 16】
제 13항에 있어서， 상기 항체는 서열번호 1번의 1이번 내지 120번째 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1번의 143번째 내지 160번째 아미노산 서열로 이루어진 DR5의 CRD3 도메인 또는 CRD2와 CRD3 도메인 모두에 결합하는 것인, 조성물.
【청구항 17】
시료에 후보 물질을 반응시키는 단계; 및
상기 시료의 DR5 활성 또는 발현양을 측정하는 단계를 포함하고， 상기 후보 물질을 처리한 시료에서의 DR5의 활성 또는 발현양이 후보물질을 처리하지 않은 시료에서의 DR5보다 감소된 경우， 상기 후보 물질을 C¾CL1 케모카인 발현 저해제로 결정하는 것을 특징으로 하는，
CX3CL1 케모카인 발현 저해제의 스크리닝 방법.
【청구항 18】
시료에 후보 물질을 반응시키는 단계 ; 및
상기 시료의 DR5 활성 또는 발현양을 측정하는 단계를 포함하고， 상기 후보 물질을 처리한 시료에서의 DR5의 활성 또는 발현양이 감소되거나, 후보물질을 처리하지 않은 시료에서의 DR5 활성보다 감소된 경우 상기 후보 물질을 C¾CL1 케모카인 과발현으로 인한 질환 치료제로 결정하는 것을 특징으로 하는， CX3CL1 케모카인 과발현으로 인한 질환 치료제의 스크리닝 방법.
【청구항 19】
제 18항에 있어서， 상기 C¾CL1 케모카인 과발현으로 인한 질환은， 관절염, 심혈관계 질환, 암, 및 HIV 감염증으로 이루어진 군에서 선택된 1종 이상인, 스크리닝 방법 .
【청구항 20]
DR5의 발현 또는 활성 저해제를 치료적 유효량으로 CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 필요로 하는 환자에게 투여하는 단계를 포함하는， CX3CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법 .
【청구항 21】
제 20항에 있어서, 상기 DR5의 발현 또는 활성 저해제는 s iRNA , shRNA , miRNA , 리보자임 ( r i bozyme)， DNAzyme , PNA( pep t i de nuc l ei c ac i ds ) , 안티센스 올리고뉴클레오타이드， 펩타이드， 항체， 앱타머 , 천연추출물 또는 화학물질인 것인， CX3CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법 ·
【청구항 22]
제 20항에 있어서, 상기 DR5의 발현 또는 활성 저해제는 항체 또는 s iRNA인, CX3CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법 .
【청구항 23】
제 20항에 있어서, 상기 DR5의 발현 또는 활성 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것인, C¾CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법.
【청구항 24】
제 22항에 있어서， 상기 항체는 서열번호 1의 아미노산 서열 증 53번 내지 181번째 아미노산 부분에 결합하는 것인， CX3CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법 .
【청구항 25]
제 22항에 있어서， 상기 항체는 서열번호 1의 1이번 내지 120번째 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1의 143번째 내지 160번째 아미노산 서열로 이루어진 1 5의 CRD3 도메인 또는 상기 CRD2와 CRD3 도메인 모두에 결합하는 것인， CX3CL1 케모카인 과발현으로 인한 질환의 예방 또는 치료 방법.
【청구항 26]
DR5의 발현 또는 활성 저해제의 C¾CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도.
【청구항 27】
제 26항에 있어서， 상기 DR5의 발현 또는 활성 저해제는 s iRNA , shRNA mi RNA , 리보자임 (r i bozyme )， DNAzyme , PNA(pept i de nuc l e i c ac i ds ) , 안티센스 을리고뉴클레오타이드， 펩타이드, 항체， 앱타머， 천연추출물 또는 화학물질인 것인， C¾CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도.
【청구항 28]
제 26항에 있어서， 상기 DR5의 발현 또는 활성 저해제는 항체 또는 s iRNA인, CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도.
【청구항 29】
제 26항에 있어서, 상기 DR5의 발현 또는 활성 저해제는 DR5의 CRD2 도메인 또는 DR5의 CRD3. 도메인 또는 CRD2 도메인과 CRD3 도메인 모두에 결합하는 것인， CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도.
【청구항 30】
제 28항에 있어서， 상기 항체는 서열번호 1의 아미노산 서열 중 53번 내지 181번째 아미노산 부분에 결합하는 것인， CX3CL1. 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도. 【청구항 31】
제 29항에 있어서， 상기 항체는 서열번호 1의 101번 내지 120번째 아미노산 서열로 이루어진 DR5의 CRD2 도메인 또는 서열번호 1번의 143번째 내지 160번째 아미노산 서열로 이루어진 DR5의 CRD3 도메인 또는 상기 CRD2와 CRD3 도메인 모두에 결합하는 것인， CX3CL1 케모카인 과발현으로 인한 질환 예방 또는 치료를 위한 용도.
PCT/KR2018/009351 2017-08-17 2018-08-14 세포사멸 수용체 저해제를 유효성분으로 포함하는 cx3cl1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물 WO2019035646A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201880060305.8A CN111246856A (zh) 2017-08-17 2018-08-14 含有死亡受体抑制剂作为活性成分的预防或治疗由趋化因子cx3cl1的过表达引起的疾病的组合物
US16/637,357 US20230159650A1 (en) 2017-08-17 2018-08-14 Composition for preventing or treating diseases caused by overexpression of chemokine cx3cl1, containing death receptor inhibitor as active ingredient

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0104381 2017-08-17
KR1020170104381A KR101951025B1 (ko) 2017-08-17 2017-08-17 세포사멸 수용체 저해제를 유효성분으로 포함하는 cx3cl1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물

Publications (2)

Publication Number Publication Date
WO2019035646A1 true WO2019035646A1 (ko) 2019-02-21
WO2019035646A8 WO2019035646A8 (ko) 2020-03-05

Family

ID=65362889

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/009351 WO2019035646A1 (ko) 2017-08-17 2018-08-14 세포사멸 수용체 저해제를 유효성분으로 포함하는 cx3cl1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물

Country Status (4)

Country Link
US (1) US20230159650A1 (ko)
KR (1) KR101951025B1 (ko)
CN (1) CN111246856A (ko)
WO (1) WO2019035646A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040081422A (ko) * 2001-11-01 2004-09-21 유에이비 리서치 파운데이션 종양 괴사 인자-관련 세포사멸-유도 리간드 수용체에선택적인 항체와 다른 치료제와의 복합물
KR20070010046A (ko) * 2004-04-06 2007-01-19 제넨테크, 인크. Ｄｒ5 항체 및 그의 용도
KR20070102585A (ko) * 2005-02-02 2007-10-18 제넨테크, 인크. Ｄｒ５ 항체 및 그의 용도
KR20080004339A (ko) * 2006-07-05 2008-01-09 아주대학교산학협력단 세포사멸 수용체 5 (ｄｒ5)에 특이적으로 결합하는 항체 및이를 포함하는 암 예방 또는 치료용 조성물
KR20100045903A (ko) * 2008-10-24 2010-05-04 아주대학교산학협력단 친화도와 안정성이 향상된 항 ｄｒ5 항체, 및 이를 포함하는 암 예방 또는 치료용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2301202A1 (en) * 1997-08-15 1999-02-25 Idun Pharmaceuticals, Inc. Trail receptors, nucleic acids encoding the same, and methods of use thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20040081422A (ko) * 2001-11-01 2004-09-21 유에이비 리서치 파운데이션 종양 괴사 인자-관련 세포사멸-유도 리간드 수용체에선택적인 항체와 다른 치료제와의 복합물
KR20070010046A (ko) * 2004-04-06 2007-01-19 제넨테크, 인크. Ｄｒ5 항체 및 그의 용도
KR20070102585A (ko) * 2005-02-02 2007-10-18 제넨테크, 인크. Ｄｒ５ 항체 및 그의 용도
KR20080004339A (ko) * 2006-07-05 2008-01-09 아주대학교산학협력단 세포사멸 수용체 5 (ｄｒ5)에 특이적으로 결합하는 항체 및이를 포함하는 암 예방 또는 치료용 조성물
KR20100045903A (ko) * 2008-10-24 2010-05-04 아주대학교산학협력단 친화도와 안정성이 향상된 항 ｄｒ5 항체, 및 이를 포함하는 암 예방 또는 치료용 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE protein [O] 9 April 2017 (2017-04-09), "Tumor Necrosis Factor Receptor Super Family Member 10B Isoform 2 Precursor [Homo sapiens)", XP055572344, Database accession no. NP_671716.2 *

Also Published As

Publication number Publication date
CN111246856A (zh) 2020-06-05
US20230159650A1 (en) 2023-05-25
KR101951025B1 (ko) 2019-02-21
WO2019035646A8 (ko) 2020-03-05

Similar Documents

Publication Publication Date Title
JP6788062B2 (ja) 抗炎症活性を有するペプチド、及びそれを含む組成物
Winkles The TWEAK–Fn14 cytokine–receptor axis: discovery, biology and therapeutic targeting
Tanaka Signaling axis in osteoclast biology and therapeutic targeting in the RANKL/RANK/OPG system
US7691804B2 (en) BAFF receptor (BCMA), an immunoregulatory agent
US7273609B2 (en) Methods for treating autoimmune and chronic inflammatory conditions using antagonists of CD30 or CD30L
EP3539984A1 (en) Methods of treating conditions with antibodies that bind colony stimulating factor 1 receptor (csf1r)
US20110033451A1 (en) Interleukin-17f antibodies and other il-17f signaling antagonists and uses therefor
TW201919691A (zh) 用結合群落刺激因子1受體(csf1r)之抗體治療病狀之方法
JP5554703B2 (ja) 自己免疫疾患の治療のための組成物および方法
JP2008538553A (ja) Ｉｌ−２１／ｉｌ−２１ｒアンタゴニストによって線維症を治療および予防する方法
KR101004362B1 (ko) 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＴＷＥＡＫ 이중 길항제
CA2587889A1 (en) Antigenic epitopes of interleukin-21, related antibodies and their use in medical field
US20180169183A1 (en) Dual signaling protein (dsp) fusion proteins, and methods of using thereof for treating diseases
EP1811838A2 (en) Tweak as a therapeutic target for treating central nervous system diseases associated with cerebral edema and and cell death
Yuan et al. Therapeutic role of a vaccine targeting RANKL and TNF-α on collagen-induced arthritis
Ware Protein therapeutics targeted at the TNF superfamily
EP1432438A2 (en) Use of rank antagonists to treat cancer
GB2526898A (en) Biological materials and therapeutic uses thereof
WO2019035646A1 (ko) 세포사멸 수용체 저해제를 유효성분으로 포함하는 cx3cl1 케모카인 과발현으로 인한 질환 예방 또는 치료용 조성물
CN106349388B (zh) 一种促细胞程序性坏死抗体及其应用
Chen et al. Bispecific antibody binding to RANKL and osteonectin with enhanced localization to the bone
Lee et al. Adalimumab for the treatment of rheumatoid arthritis
Neely The Development of Local-acting Biologics to Treat Rheumatoid Arthritis
CN113015746A (zh) 在类风湿性关节炎中的ptprs和蛋白聚糖
JP2010539917A (ja) 疾患を診断、治療又はモニタリングするための可溶性ｃｅａｃａｍ８の使用及びアポトーシスを予防する化合物のスクリーニング方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18845988

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18845988

Country of ref document: EP

Kind code of ref document: A1