WO2019028051A1 - COMPOSITIONS AND METHODS FOR TREATING CANCER BY ANTI-CD19 / CD20 IMMUNOTHERAPY - Google Patents
COMPOSITIONS AND METHODS FOR TREATING CANCER BY ANTI-CD19 / CD20 IMMUNOTHERAPY Download PDFInfo
- Publication number
- WO2019028051A1 WO2019028051A1 PCT/US2018/044654 US2018044654W WO2019028051A1 WO 2019028051 A1 WO2019028051 A1 WO 2019028051A1 US 2018044654 W US2018044654 W US 2018044654W WO 2019028051 A1 WO2019028051 A1 WO 2019028051A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- car
- cell
- domain
- cells
- antigen binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2887—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/421—Immunoglobulin superfamily
- A61K40/4211—CD19 or B4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4221—CD20
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70517—CD8
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70521—CD28, CD152
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/48—Blood cells, e.g. leukemia or lymphoma
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
Definitions
- This application relates to the field of cancer, particularly to CD19/CD20 antigen binding domains and chimeric antigen receptors (CARs) containing such CD 19/CD20 antigen binding domains and methods of use thereof.
- CARs chimeric antigen receptors
- Cancer is one of the most deadly threats to human health. In the U.S. alone, cancer affects nearly 1.3 million new patients each year, and is the second leading cause of death after cardiovascular disease, accounting for approximately 1 in 4 deaths. Solid tumors are responsible for most of those deaths. Although there have been significant advances in the medical treatment of certain cancers, the overall 5-year survival rate for all cancers has improved only by about 10% in the past 20 years. Cancers, or malignant tumors, metastasize and grow rapidly in an uncontrolled manner, making treatment extremely difficult.
- CD 19 is a 85-95 kDa transmembrane cell surface glycoprotein receptor.
- CD19 is a member of immunoglobulin (Ig) superfamily of proteins, and contains two extracellular Ig-like domains, a transmembrane, and an intracellular signaling domain (Tedder TF, Isaacs, CM, 1989, J Immunol 143:712-171).
- Ig immunoglobulin
- CD 19 modifies B cell receptor signaling, lowering the triggering threshold for the B cell receptor for antigen (Carter, RH, and Fearon, DT, 1992, Science, 256: 105- 107) , and co-ordinates with CD81 and CD21 to regulate this essential B cell signaling complex (Bradbury, LE, Kansas GS, Levy S, Evans RL, Tedder TF, 1992, J Immunol, 149:2841-50).
- B cell ontogeny CD 19 is able to signal at the pro-B, pre-pre-B cell, pre-B, early B cell stages independent of antigen receptor, and is associated with Src family protein tyrosine kinases, is tyrosine phosphorylated, inducing both intracellular calcium mobilization and inositol phospholipid signaling (Uckun FM, Burkhardt AL, Jarvis L, Jun X, Stealy B, Dibirdik I, Myers DE, Tuel-Ahlgren L, Bolen JB, 1983, J Biol Chem 268:21 172-84).
- CD19 is expressed in a tightly regulated manner on normal B cells, being restricted to early B cell precursors at the stage of IgH gene rearrangement, mature B cells, but not expressed on hematopoietic stem cells, or mature plasma cells (Anderson, KC, Bates, MP, Slaughenhout BL, Pinkus GS, Schlossman SF, Nadler LM, 1984, Blood 63: 1424- 1433).
- CD20 (also termed LEU- 16, MS4A 1 ) is a membrane-spanning 4A family protein that is expressed on the surface of B cells from pro-B phase to mature B cell phase, and plays a role in B cell development and differentiation. CD20 antigen is also expressed on a variety of hematological tumors, and a variety of monoclonal anti-CD20 antibodies have been applied over the years for the treatment of CD20-positive malignancies (Reviewed in Lim, Sean H. et al. "Anti- CD20 Monoclonal Antibodies: Historical and Future Perspectives.” Haematologica 95.1 (2010): 135-143. PMC. Web.
- the anti CD20 monoclonal antibody Rituximab (Rituxan ®) is widely used in treatment of B-cell lymphomas, such as follicular lymphoma (FL), and diffuse large B cell lymphoma (DLBCL), and chronic lymphocytic leukemia (CLL) (Rituxan prescribing information).
- B-cell lymphomas such as follicular lymphoma (FL), and diffuse large B cell lymphoma (DLBCL), and chronic lymphocytic leukemia (CLL) (Rituxan prescribing information).
- CD 19 on both adult and pediatric (pre-B-ALL) B cell malignancies has led to exploiting this target for both antibody and chimeric antigen receptor (CAR)-T cell-based therapy
- CAR chimeric antigen receptor
- CD20 antigen on lymphomas (DLBCL, FL), and leukemias (CLL) make it an attractive
- the present standard of care for B-lineage leukemias may consists of remission induction treatment by high dose of chemotherapy or radiation, followed by consolidation, and may feature stem cell transplantation and additional courses of chemotherapy as needed (see the world wide web at cancer.gov).
- CD 19 on both adult and pediatric (pre-B-ALL) B cell malignancies has led to exploiting this target for both antibody and chimeric antigen receptor (CAR)-T cell-based therapy
- CAR chimeric antigen receptor
- bi-specific antibodies that link an anti-CD19 or anti-CD20 binding motif to a T cell binding motif (i.e. Blinatumomab, Blincyto® indicated for the treatment of Philadelphia chromosome-negative relapsed or refractory B-cell precursor acute lymphoblastic leukemia (ALL).
- Blinatumomab Blincyto® indicated for the treatment of Philadelphia chromosome-negative relapsed or refractory B-cell precursor acute lymphoblastic leukemia (ALL).
- ALL Philadelphia chromosome-negative relapsed or refractory B-cell precursor acute lymphoblastic leukemia
- Chimeric Antigen Receptors are hybrid molecules comprising three essential units: ( 1 ) an extracellular antigen-binding motif, (2) linking/transmembrane motifs, and (3) intracellular T-ceII signaling motifs (Long AH, Haso WM, Orentas RJ. Lessons learned from a highly-active CD22-specific chimeric antigen receptor. Oncoimmunology. 2013; 2 (4):e23621).
- the antigen-binding motif of a CAR is commonly fashioned after an single chain Fragment variable (ScFv), the minimal binding domain of an immunoglobulin (Ig) molecule.
- Alternate antigen-binding motifs such as receptor ligands (i.e., IL-13 has been engineered to bind tumor expressed IL-13 receptor), intact immune receptors, library-derived peptides, and innate immune system effector molecules (such as NKG2D) also have been engineered.
- Alternate cell targets for CAR expression such as NK or gamma-delta T cells are also under development (Brown CE et al Clin Cancer Res. 2012;18(8):2199-209; Lehner M et al. PLoS One. 2012; 7 (2):e31210).
- the linking motifs of a CAR can be a relatively stable structural domain, such as the constant domain of IgG, or designed to be an extended flexible linker.
- Structural motifs such as those derived from IgG constant domains, can be used to extend the ScFv binding domain away from the T-cell plasma membrane surface. This may be important for some tumor targets where the binding domain is particularly close to the tumor cell surface membrane (such as for the disialoganglioside GD2; Orentas et al., unpublished observations).
- the signaling motifs used in CARs always include the CD3 ⁇ chain because this core motif is the key signal for T cell activation.
- the first reported second-generation CARs featured CD28 signaling domains and the CD28 transmembrane sequence.
- This motif was used in third-generation CARs containing CD137 (4-1 BB) signaling motifs as well (Zhao Y et al J Immunol. 2009; 183 (9): 5563-74). With the advent of new technology, the activation of T cells with beads linked to anti-CD3 and anti- CD28 antibody, and the presence of the canonical "signal 2" from CD28 was no longer required to be encoded by the CAR itself.
- third-generation vectors were found to be not superior to second-generation vectors in in vitro assays, and they provided no clear benefit over second-generation vectors in mouse models of leukemia (Haso W, Lee DW, Shah NN, Stetler-Stevenson M, Yuan CM, Pastan IH, Dimitrov DS, Morgan RA, FitzGerald DJ, Barrett DM, Wayne AS, Mackall CL, Orentas RJ.
- CD 19-specific CARs that are in a second generation CD28/CD3 ⁇ (Lee DW et al. American Society of Hematology Annual Meeting. New Orleans, LA; December 7-10, 2013) and a CD137/CD3 ⁇ signaling format (Porter DL et al. N Engl J Med. 201 1 ; 365 (8): 725-33).
- CD137 other tumor necrosis factor receptor superfamily members such as OX40 also are able to provide important persistence signals in CAR-transduced T cells (Yvon E et al. Clin Cancer Res. 2009; 15(1 8):5852-60).
- CD3 ⁇ and CD28 signal units are split between two different CAR constructs expressed in the same cell; in another, two CARs are expressed in the same T cell, but one has a lower affinity and thus requires the alternate CAR to be engaged first for full activity of the second (Lanitis E et al. Cancer Immunol Res.
- a second challenge for the generation of a single ScFv-based CAR as an immunotherapeutic agent is tumor cell heterogeneity.
- At least one group has developed a CAR strategy for glioblastoma whereby the effector cell population targets multiple antigens (HER2, IL-13Ra, EphA2) at the same time in the hope of avoiding the outgrowth of target antigen-negative populations.
- HER2, IL-13Ra, EphA2 multiple antigens
- T-cell-based immunotherapy has become a new frontier in synthetic biology; multiple promoters and gene products are envisioned to steer these highly potent cells to the tumor microenvironment, where T cells can both evade negative regulatory signals and mediate effective tumor killing.
- the elimination of unwanted ' I' cells through the drug-induced dimerization of inducible caspase 9 constructs with chemical-based dimerizers, such as API 903, demonstrates one way in which a powerful switch that can control T-cell populations can be initiated pharmacologically (Di Stasi A et al. N Engl J Med. 201 1 ;365( 18): 1673-83).
- effector T-cell populations that are immune to the negative regulatory effects of transforming growth factor- ⁇ by the expression of a decoy receptor further demonstrates the degree to which effector T cells can be engineered for optimal antitumor activity (Foster AE et al. J Immunother. 2008;31 (5):500-5).
- CARs can trigger T-cell activation in a manner similar to an endogenous T-cell receptor, a major impediment to the clinical application of this technology to date has been limited in vivo expansion of CAR+ T cells, rapid disappearance of the cells after infusion, and disappointing clinical activity. This may be due in part to the murine origin of some of the CAR sequences employed.
- Blinotumomab (bi-specific anti-CD 19 and anti-CD3 antibody) has shown impressive results for the gravely ill patients who have received this therapy. Nevertheless the durable remission rate is less than 40%, and at best only 50% of responders can be salvaged to hematopoietic stem cell transplant (HSCT) (see Gore et al., 2014, NCT01471782 and Von Stackelberg, et al., 2014, NCT01471782, summarized in: Benjamin, JE, Stein AS, 2016, Therapeutic Advances in Hematology 7: 142-156). The requirement of patients who have received either bi-specific antibody or CAR-T therapy to subsequently undergo HSCT in order to maintain durable responses remains an area of active debate.
- HSCT hematopoietic stem cell transplant
- the present invention addresses these needs by providing CAR compositions and therapeutic methods that can be used to treat cancers and other diseases and/or conditions.
- the present invention as disclosed and described herein provides CARs that may be used for the treatment of diseases, disorders or conditions associated with dysregulated expression of CD19 and/ or CD20 and which CARs contain tandem CD19/CD20 antigen binding domains that exhibit a high surface expression on transduced T cells, exhibit a high degree of cytolysis of CD19-expressing cells, and in which the transduced T cells demonstrate in vivo expansion and persistence.
- Novel tandem CD 19 and CD20-targeting antibodies or antigen binding domains thereof in which the CD 19 targeting moiety is positioned either before or after the CD20 targeting moiety in the amino acid sequence (hereinafter termed "CD19/CD20"), and chimeric antigen receptors (tandem CARs) that contain such CD 19 and/or CD20 antigen binding domains are provided herein, as well as host cells (e.g., T cells) expressing the receptors, and nucleic acid molecules encoding the receptors.
- the CARs exhibit a high surface expression on transduced T cells, with a high degree of cytolysis, and with transduced T cell expansion and persistence in vivo.
- Methods of using the disclosed CARs, host cells, and nucleic acid molecules are also provided, for example, to treat a cancer in a subject.
- an isolated nucleic acid molecule encoding a tandem CD 19/CD20 chimeric antigen receptor (CAR) comprising, from N-terminus to C-terminus, at least one CD 19/CD20 antigen binding domain, at least one transmembrane domain, and at least one intracellular signaling domain, wherein the tandem CD 19/CD20 CAR comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 and 3.
- an isolated nucleic acid molecule encoding a tandem CD 19/CD20 chimeric antigen receptor (CAR) comprising, from N-terminus to C-terminus, at least one CD19/CD20 antigen binding domain, at least one transmembrane domain, and at least one intracellular signaling domain, wherein the tandem CD 19/CD20 CAR encoded by the nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 and 3 encodes a tandem CD19/CD20 CAR comprising the amino acid sequence selected from the group consisting of SEQ ID NO. 2 and 4.
- CAR chimeric antigen receptor
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded extracellular CD19/CD20 antigen binding domain comprises at least one single chain variable fragment of an antibody that binds to CD19/CD20.
- an isolated nucleic acid molecule encoding the CAR wherein the encoded extracellular CD19/CD20 antigen binding domain comprises at least one heavy chain variable region of an antibody that binds to CD19/CD20.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded CAR extracellular CD19/CD20 antigen binding domain further comprises at least one lipocalin-based antigen binding antigen (anticalins) that binds to CD19/CD20.
- the encoded CAR extracellular CD19/CD20 antigen binding domain further comprises at least one lipocalin-based antigen binding antigen (anticalins) that binds to CD19/CD20.
- an isolated nucleic acid molecule wherein the encoded extracellular CD 19/CD20 antigen binding domain is connected to the transmembrane domain by a linker domain.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded CD19/CD20 extracellular antigen binding domain is preceded by a sequence encoding a leader or signal peptide.
- an isolated nucleic acid molecule encoding the CAR comprising at least one CD 19/CD20 antigen binding domain encoded by a nucleotide sequence comprising a CD19/CD20 nucleotide sequence contained within SEQ ID Nos: 1 and 3, respectively, and wherein the CAR additionally encodes an extracellular antigen binding domain targets an antigen that includes, but is not limited to, CD22, ROR1 , mesothelin, CD33, CD38, CD 123 (IL3RA), CD138, BCMA (CD269), GPC2, GPC3, FGFR4, c-Met, PSMA, Glycolipid F77, EGFRvIII, GD-2, TSLPR, NY-ESO-1 TCR, MAGE A3 TCR, or any combination thereof.
- an isolated nucleic acid molecule encoding the CAR wherein the additionally encoded extracellular antigen binding domain comprises an anti-CD22 ScFv antigen binding domain, an anti-RORl ScFv antigen binding domain, an anti-mesothelin ScFv antigen binding domain, an anti-CD33 ScFv antigen binding domain, an anti-CD38 ScFv antigen binding domain, an anti-CD123 (IL3RA) ScFv antigen binding domain, an anti-CD138 ScFv antigen binding domain, an anti-BCMA (CD269) ScFv antigen binding domain, an anti- GPC2 ScFv antigen binding domain, an anti-GPC3 ScFv antigen binding domain, an anti-FGFR4 ScFv antigen binding domain, an anti-TSLPR ScFv antigen binding domain an anti-c-Met ScFv antigen binding domain, an anti-PMSA ScFv antigen binding domain, an anti-glycolipid F77 ScFv antigen binding domain, an anti-EGFR
- the CARs provided herein further comprise a linker or spacer domain.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the extracellular CD 19/CD20 antigen binding domain, the intracellular signaling domain, or both are connected to the transmembrane domain by a linker or spacer domain.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded linker domain is derived from the extracellular domain of CD8 or CD28, and is linked to a transmembrane domain.
- an isolated nucleic acid molecule encoding the CAR wherein the encoded CAR further comprises a transmembrane domain that comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD83, CD86, CD 134, CD137 and CD 154, or a combination thereof.
- a transmembrane domain that comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD83, CD86, CD 134, CD137 and CD 154, or a combination thereof.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded intracellular signaling domain further comprises a CD3 zeta intracellular domain.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded intracellular signaling domain is arranged on a C-terminal side relative to the CD3 zeta intracellular domain.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded at least one intracellular signaling domain comprises a costimulatory domain, a primary signaling domain, or a combination thereof.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded at least one costimulatory domain comprises a functional signaling domain of OX40, CD70, CD27, CD28, CD5, ICAM-1 , LFA-1 (CD1 l a/CD18), ICOS (CD278), DAP10, DAP 12, and 4- I BB (CD 137), or a combination thereof.
- an isolated nucleic acid molecule encoding the CAR is provided that further contains a leader sequence or signal peptide wherein the leader or signal peptide nucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 1 1.
- an isolated nucleic acid molecule encoding the CAR is provided wherein the encoded leader sequence comprises the amino acid sequence of SEQ ID NO: 12.
- a chimeric antigen receptor comprising, from N- terminus to C-terminus, at least one CD19/CD20 antigen binding domain, at least one transmembrane domain, and at least one intracellular signaling domain.
- a CAR wherein the extracellular CD19/CD20 antigen binding domain comprises at least one single chain variable fragment of an antibody that binds to the antigen, or at least one heavy chain variable region of an antibody that binds to the antigen, or a combination thereof.
- a CAR wherein the at least one transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD 137, CD154, TNFRSF 19, or a combination thereof.
- a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD 137, CD154, TNFRSF 19, or a combination thereof.
- the CAR is provided wherein CAR additionally encodes an extracellular antigen binding domain comprising CD22, ROR1 , mesothelin, CD33, CD38, CD123 (IL3RA), CD138, BCMA (CD269), GPC2, GPC3, FGFR4, TSLPR, c-Met, PSMA, Glycolipid F77, EGFRvIII, GD-2, TSLPR, NY-ESO- 1 TCR, MAGE A3 TCR, or an amino acid sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof, or any combination thereof.
- CAR additionally encodes an extracellular antigen binding domain comprising CD22, ROR1 , mesothelin, CD33, CD38, CD123 (IL3RA), CD138, BCMA (CD269), GPC2, GPC3, FGFR4, TSLPR, c-Met, PSMA, Glycolipid F77, EGFRvIII, GD-2, TSLPR, NY-ESO- 1
- the CAR is provided wherein the extracellular antigen binding domain comprises an anti-CD22 ScFv antigen binding domain, an anti-RORl ScFv antigen binding domain, an anti-mesothelin ScFv antigen binding domain, an anti-CD33 ScFv antigen binding domain, an anti-CD38 ScFv antigen binding domain, an anti-CD 123 (IL3RA) ScFv antigen binding domain, an anti-CD138 ScFv antigen binding domain, an anti-BCMA (CD269) ScFv antigen binding domain, an anti-GPC2 ScFv antigen binding domain, an anti-GPC3 ScFv antigen binding domain, an anti-FGFR4 ScFv antigen binding domain, anti-TSLPR ScFv antigen binding domain, an anti-c-Met ScFv antigen binding domain, an anti-PMSA ScFv antigen binding domain, an anti-glycolipid F77 ScFv antigen binding domain, an anti-EGFRvIII ScFv antigen binding domain, an anti-GD
- a CAR is provided wherein the at least one intracellular signaling domain comprises a costimulatory domain and a primary signaling domain.
- a CAR wherein the at least one intracellular signaling domain comprises a costimulatory domain comprising a functional signaling domain of a protein selected from the group consisting of OX40, CD70, CD27, CD28, CD5, ICAM-1, LFA- 1 (CL> l l a/CD 18), ICOS (CD278), DAP10, DAP 12, and 4-1BB (CD137), or a combination thereof.
- a protein selected from the group consisting of OX40, CD70, CD27, CD28, CD5, ICAM-1, LFA- 1 (CL> l l a/CD 18), ICOS (CD278), DAP10, DAP 12, and 4-1BB (CD137), or a combination thereof.
- the nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 1 (nucleotide sequence of Leader-CD 19 VL- Whitlow linker CD 19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD8 hinge+TM-4- l BB- CD3z (Construct 1920) (FIGURE 10A)).
- the nucleic acid sequence encodes a CAR comprising the amino acid sequence of SEQ ID NO: 2 Leader-CD19 VL- Whitlow linker CD19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD8 hinge+TM-4-l BB- CD3z (Construct 1920) ((FIGURE 10A)).
- the nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 3 (nucleotide sequence of Leader-CD20 VH (GGGGS)3 - CD20 VL -(GGGGS)5 -CD 19 VL- Whitlow linker- CD 19 VH CD8 hinge+TM-4-l BB- CD3z (Construct 2019) (FIGURE 10B)).
- the nucleic acid sequence encodes a CAR comprising the amino acid sequence of SEQ ID NO: 4 (Leader-CD20 VH (GGGGS)s - CD20 VL -(GGGGS)s -CD 19 VL-Whitlow linker-CD19 VH CD8 hinge+TM-4-l BB- CD3z CAR amino acid sequence (FIGURE 10B)).
- the CARs disclosed herein are modified to express or contain a detectable marker for use in diagnosis, monitoring, and/or predicting the treatment outcome such as progression free survival of cancer patients or for monitoring the progress of such treatment.
- the nucleic acid molecule encoding the disclosed CARs can be contained in a vector, such as a viral vector.
- the vector is a DNA vector, an RNA vector, a plasmid vector, a cosmid vector, a herpes virus vector, a measles virus vector, a lentivirus vector, adenoviral vector, or a retrovirus vector, or a combination thereof.
- the vector further comprises a promoter wherein the promoter is an inducible promoter, a tissue specific promoter, a constitutive promoter, a suicide promoter or any combination thereof.
- the vector expressing the CAR can be further modified to include one or more operative elements to control the expression of CAR T cells, or to eliminate CAR-T cells by virtue of a suicide switch.
- the suicide switch can include, for example, an apoptosis inducing signaling cascade or a drug that induces cell death.
- the vector expressing the CAR can be further modified to express an enzyme such thymidine kinase (TK) or cytosine deaminase (CD).
- host cells including the nucleic acid molecule encoding the CAR are also provided.
- the host cell is a T cell, such as a primary T cell obtained from a subject.
- the host cell is a CD8 + T cell.
- a pharmaceutical composition comprising an anti-tumor effective amount of a population of human T cells, wherein the T cells comprise a nucleic acid sequence that encodes a chimeric antigen receptor (CAR) comprising the amino acid sequence of SEQ ID NO. 2 and 4, wherein the CAR comprises at least one extracellular antigen binding domain comprising a CD 19/CD20 antigen binding domain, at least one linker domain, at least one transmembrane domain, and at least one intracellular signaling domain, wherein the T cells are T cells of a human having a cancer.
- CAR chimeric antigen receptor
- the cancer includes, inter alia, a hematological cancer such as leukemia (e.g., chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), or chronic myelogenous leukemia (CML), lymphoma (e.g., mantle cell lymphoma, non-Hodgkin's lymphoma or Hodgkin's lymphoma) or multiple myeloma, or a combination thereof.
- leukemia e.g., chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), or chronic myelogenous leukemia (CML)
- lymphoma e.g., mantle cell lymphoma, non-Hodgkin's lymphoma or Hodgkin's lymphoma
- multiple myeloma e.g., multiple myeloma, or a combination thereof.
- a pharmaceutical composition wherein the at least one transmembrane domain of the CAR contains a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD 16, CD22, Mesothelin, CD33, CD37, CD64, CD80, CD83, CD86, CD 134, CD 137, CD 154, TNFRSF19, or a combination thereof.
- a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD 16, CD22, Mesothelin, CD33, CD37, CD64, CD80, CD83, CD86, CD 134, CD 137, CD 154, TNFRSF19, or a combination thereof.
- a pharmaceutical composition wherein the human cancer includes an adult carcinoma comprising oral and pharynx cancer (tongue, mouth, pharynx, head and neck), digestive system cancers (esophagus, stomach, small intestine, colon, rectum, anus, liver, interhepatic bile duct, gallbladder, pancreas), respiratory system cancers (larynx, lung and bronchus), bones and joint cancers, soft tissue cancers, skin cancers (melanoma, basal and squamous cell carcinoma), pediatric tumors (neuroblastoma, rhabdomyosarcoma, osteosarcoma, Ewing's sarcoma), tumors of the central nervous system (brain, astrocytoma, glioblastoma, glioma), and cancers of the breast, the genital system (uterine cervix, uterine corpus, ovary, vulva, vagina, prostate, testis,
- a pharmaceutical composition comprising an antitumor effective amount of a population of human T cells of a human having a cancer wherein the cancer is a refractory cancer non-responsive to one or more chemotherapeutic agents.
- the cancer includes hematopoietic cancer, myelodysplastic syndrome pancreatic cancer, head and neck cancer, cutaneous tumors, minimal residual disease (MRD) in acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adult B cell malignancies including, CLL (Chronic lymphocytic leukemia), CML (chronic myelogenous leukemia), non-Hodgkin's lymphoma (NHL), pediatric B cell malignancies (including B lineage ALL (acute lymphocytic leukemia)), multiple myeloma lung cancer, breast cancer, ovarian cancer, prostate cancer, colon cancer, melanoma or other hematological cancer and solid tumors, or any combination thereof.
- ALL acute lymphoblastic le
- CAR-T cells methods of making CAR-containing T cells.
- the methods include transducing a T cell with a vector or nucleic acid molecule encoding a disclosed CAR that specifically binds CD 19 and/or CD20, thereby making the CAR-T cell.
- a method of generating a population of RNA-engineered cells comprises introducing an in vitro transcribed RNA or synthetic RNA of a nucleic acid molecule encoding a disclosed CAR into a cell of a subject, thereby generating a CAR cell.
- the disease, disorder or condition associated with the expression of CD 19 is cancer including hematopoietic cancer, myelodysplastic syndrome pancreatic cancer, head and neck cancer, cutaneous tumors, minimal residual disease (MRD) in acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adult B cell malignancies including, CLL (Chronic lymphocytic leukemia), CML (chronic myelogenous leukemia), non-Hodgkin's lymphoma (NHL), pediatric B cell malignancies (including B lineage ALL (acute lymphocytic leukemia)), multiple myeloma lung cancer, breast cancer, ovarian cancer, prostate cancer, colon cancer, melanoma or other hematological cancer and solid tumors, or any combination thereof.
- ALL acute lymphoblastic leukemia
- AML acute myeloid leukemia
- adult B cell malignancies including, CLL (Chronic lymphocytic leukemia), CML (chronic my
- a method of blocking T-cell inhibition mediated by a CD19- and/or CD20 expressing cell and altering the tumor microenvironment to inhibit tumor growth in a mammal comprising administering to the mammal an effective amount of a composition comprising a CAR comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 2 and 4.
- the cell is selected from the group consisting of a CD 19 and/or CD20-expressing tumor cell, a tumor-associated macrophage, and any combination thereof.
- a method of inhibiting, suppressing or preventing immunosuppression of an anti-tumor or anti-cancer immune response in a mammal comprising administering to the mammal an effective amount of a composition comprising a CAR selected from the group consisting of SEQ ID NOs: 2 and 4.
- the CAR inhibits the interaction between a first cell with a T cell, wherein the first cell is selected from the group consisting of a CD 19 and/or CD20-expressing tumor cell, a tumor-associated macrophage, and any combination thereof.
- a method for inducing an anti-tumor immunity in a mammal comprising administering to the mammal a therapeutically effective amount of a T cell transduced with vector or nucleic acid molecule encoding a disclosed CAR.
- a method of treating or preventing cancer in a mammal comprising administering to the mammal one or more of the disclosed CARs, in an amount effective to treat or prevent cancer in the mammal.
- the method includes administering to the subject a therapeutically effective amount of host cells expressing a disclosed CAR that specifically binds CD 19 and/or CD20 and/or one or more of the aforementioned antigens, under conditions sufficient to form an immune complex of the antigen binding domain on the CAR and the extracellular domain of CD 19 and/or CD20 and/or one or more of the aforementioned antigens in the subject.
- a method for treating a mammal having a disease, disorder or condition associated with an elevated expression of a tumor antigen comprising administering to the subject a pharmaceutical composition comprising an anti-tumor effective amount of a population of T cells, wherein the T cells comprise a nucleic acid sequence that encodes a chimeric antigen receptor (CAR), wherein the CAR includes at least one extracellular CD 19 and/or CD20 antigen binding domain, or any combination thereof, at least one linker or spacer domain, at least one transmembrane domain, at least one intracellular signaling domain, and wherein the T cells are T cells of the subject having cancer.
- CAR chimeric antigen receptor
- a method for treating cancer in a subject in need thereof comprising administering to the subject a pharmaceutical composition comprising an antitumor effective amount of a population of T cells, wherein the T cells comprise a nucleic acid sequence that encodes a chimeric antigen receptor (CAR), wherein the CAR comprises the amino acid sequence of SEQ ID NOs. 2 and 4, or any combination thereof, at least one linker or spacer domain, at least one transmembrane domain, at least one intracellular signaling domain, wherein the T cells are T cells of the subject having cancer.
- CAR chimeric antigen receptor
- the at least one transmembrane domain comprises a transmembrane the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD19, CD22, Mesothelin, CD33, CD37, CD64, CD80, CD83, CD86, CD134, CD137, CD154, TNFRSF 16, TNFRSF 19, or a combination thereof.
- a method for generating a persisting population of genetically engineered T cells in a human diagnosed with cancer.
- the method comprises administering to a human a T cell genetically engineered to express a CAR wherein the CAR comprises the amino acid sequence of SEQ ID NOs. 2 and 4, or any combination thereof, at least one transmembrane domain, and at least one intracellular signaling domain wherein the persisting population of genetically engineered T cells, or the population of progeny of the T cells, persists in the human for at least one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, twelve months, two years, or three years after administration.
- the progeny T cells in the human comprise a memory T cell.
- the T cell is an autologous T cell.
- kits for making a chimeric antigen receptor T-cell as described supra or for preventing, treating, or ameliorating any of the cancers, diseases, disorders or conditions associated with an elevated expression of a tumor antigen in a subject as described supra, comprising a container comprising any one of the nucleic acid molecules, vectors, host cells, or compositions disclosed supra or any combination thereof, and instructions for using the kit.
- FIGURE 1 A and I B depict the construction of CARs targeting CD19 and CD20.
- FIGURE 1 A Anti-CD 19 and anti-CD20 single targeting CAR constructs were generated by linking single chain fragment variable region of monoclonal antibody F C-63 (CD 19) of Leu- 16 (CD20) in frame to CD8 hinge and transmembrane domain, the 4- I BB (CD 137) signaling domain and the CD3 zeta signaling domain.
- Constructs 19A and 19B differ only in the linker sequence connecting the heavy and the light chains of FMC63.
- Tandem targeting constructs 2019 and 1920 were generated in a similar manner to single targeting constructs, except that the single chain fragment variable regions of CD20 and CD 19 were linked to each other sequentially by a flexible linker, followed by CD8, 4-1BB and CD3 zeta domains.
- FIGURE IB Schematic representation of Tandem-CAR T cells targeting CD 19 and CD20 tumor antigens.
- the tandem-CAR 1920 (left) and 2019 (right) are comprised of tandem extracellular targeting domains linked in frame to CD8- derived hinge and transmembrane domains, followed by the 4- I BB costimulatory domain, and the CD3 zeta activation domain.
- Each CAR T construct is capable of activation via binding to either CD 19 or CD20 tumor antigens, or both.
- FIGURE 2A Surface expression of single and tandem-CAR T constructs on human primary T cells.
- CAR T expression was determined by flow cytometry.
- T cells were activated with Miltenyi Biotec Trans ActTM CD3 CD28 reagent in the presence of IL-2, and transduced with LV as described in Materials and Methods.
- viable transduced T cells (7-AAD negative) were assayed for CAR surface expression using one of three staining reagents: Protein L (column 1 ), CD 19 Fc followed by anti-Fc-AF647 (column 2), or CD20-biotin followed by streptavidin-PE staining (column 3).
- the LV used in transduction is listed to the left of each row.
- FIGURE 2B The ratio of CD19 and CD20 antigen binding by each tandem-CAR is expressed as the ratio of percent cells bound by CD20 biotin vs CD19 Fc. The average + SD of 3 separate experiments using three donors is shown, **p ⁇ 0.01.
- FIGURES 3A and 3B depict CAR T cytotoxicity in vitro.
- Luciferase-based cytotoxicity assays were performed using, K562, 562 CD19+, or K562 CD20+ cell lines (FIGURE 3 A), or leukemia or lymphoma cell lines (Raji, NALM6, REH; FIGURE 3B), stably transduced with luciferase.
- CAR T cells and target tumor cells were co-incubated overnight at the listed effector to target (E:T) ratios, x-axis. Differences between groups were determined using 1- way ANOVA followed by Dunnett's post-hoc test. Mean +SD, *** *p ⁇ 0.0001 , **p ⁇ 0.01 vs non- transduced control from the same donor (N.T.).
- FIGURE 4 CAR T cytokine release in response to leukemia cell lines. Cytokine production by CAR-T, listed on the x-axis, upon overnight co-culture with the Raji leukemia line at an E:T ratio of 10: 1 , was measured using a flow-based bead array. Bars represent mean +SD of replicate samples. Data are representative of three independent experiments performed with CAR T cells from three separate donors.
- FIGURES 5A and 5B depict the in vivo activity of CAR T constructs.
- FIGURE 5A depicts a time course of tumor growth based on mouse whole body bioluminescence. 10 mice per CAR T treatment group, and 5 mice per control group were studied.
- FIGURE 5B is a plot depicting the mean signal per mouse ⁇ SD. Statistical analysis for Day 25 (the last time point when subjects in the no treatment control group remained alive) is shown, using two-way ANOVA followed by Dunnett's multiple comparisons test vs no treatment group. Mean +SD, ***P ⁇ 0.001
- FIGURES 6A, 6B, and 6C depict a single CAR19 construct that strongly selects Raji tumor escape variants.
- FIGURE 6A Diagram of the experimental design for tumor escape experiments. Raji and CAR T cells were co-cultured at E:T ratio of 1 : 1 either overnight or for 4 days. After overnight incubation and on day 4, cultures were harvested and viable Raji cells examined for CD19, CD20, and CD22 surface expression by flow cytometry.
- FIGURE 6B Gating strategy for flow cytometric analysis used to analyze viable Raji cells (7AAD- and CD3-) from co-cultures is shown for representative treatment groups is shown in column 1.
- FIGURE 6C Graphs of CD19, CD20 and CD22 surface expression (solid, open, gray, respectively) in surviving Raji and NALM-6 cells after overnight or four days of co-culture with CAR T cells, as listed on x-axis, as determined by flow cytometry. Bars represent group means +SD. Statistical analysis was performed by one-way ANOVA followed by Dunnett's multiple comparisons test vs N.T. (non-transduced T cells) control from the same donor, *p ⁇ 0.05. T.A.- tumor alone control group.
- FIGURE 7 The down-modulation of CD 19, CD20 and CD22 on Raji surface requires direct contact with CART cells. Multi-well plates with transwell inserts were used in this experiment. At the bottom of each well, 5 x 105 each of Raji and CAR T cells were combined, and in the transwell upper portion 2.5 x 105 Raji cells were cultured in the absence of T cells. After overnight incubation, cells from the upper transwell compartment and from the bottom compartment were harvested, and viable Raji cells were examined for CD19, CD20, and CD22 surface expression by flow cytometry (black, light grey, and dark grey bars, respectively. Surface expression for each marker with reference to the specific CAR T included in the lower compartment (x- axis) is shown. Bars depict mean +SD of three independent experiments performed using CAR T cells originating from three different donors. One way ANOVA, Dunnett's multiple comparisons test *p ⁇ 0.05.
- FIGURES 8A, 8B and 8C depict the Down-modulation of CD19 full-length protein and CD 19 splice variant by CAR19 constructs.
- Raji cells were co-incubated with CAR T cells at a 1 : 1 E:T ratio. After overnight incubation, T cells were removed from co-incubated cell populations using magnetic beads. CD19 expression on purified Raji populations was investigated by flow cytometry and Western blot.
- FIGURE 8A Raji cell samples were stained with anti-CD 19 antibody and acquired by flow cytometry. Median fluorescence intensity for Raji cells representing each treatment group is shown. Bars depict mean +SD of three independent experiments performed using CAR T cells originating from three different donors.
- FIGURE 8B Lysates of purified Raji cells from each of the co-incubated groups (CAR-T identity is listed above each line) were resolved on a 4%-12% SDS polyacrylamide gel as described in the Materials and Methods, and probed with antibodies targeting the C-terminus of CD19 molecule, or ⁇ -actin (loading control).
- FIGURE 8C The intensity of specific immunoreactive bands representing full-length CD 19 protein (FL CD 19), and the exon 2 spliced CD 19 variant (A2CD19) was quantified using Image Studio software (LI-COR Biosciences). Relative band intensity of CD 19 bands was calculated as signal CD 19/signal ⁇ actin.
- FIGURES 9A and 9B show the in vivo activity of CAR T cells in a high tumor burden model.
- FIGURE 9A Disease burden is plotted as the average bioluminescent signal (mean radiance [p/s/cm2/sr]) ⁇ SEM. Groups with less than half of the mice surviving to day 25 are plotted as dotted lines. Groups where more than half survived are plotted as solid lines.
- FIGURE 9B Bioluminescent images of the tumor burden in mice treated with singe and tandem-CAR T constructs as indicated in the plot above on day 25 post tumor engraftment are shown. Red X indicates mice that did not survive to study day 25.
- FIGURES 10A and 10B depict the nucleic acid sequence and the encoded amino acid sequence of CAR T constructs.
- FIGURE 10A depicts a lentiviral vector expressing the CAR Leader-CD 19 VL- Whitlow linker CD 19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD 8 hinge+TM-4-l BB- CD3z (CD 1920 CAR Construct) nucleic acid sequence and the encoded amino acid sequence.
- FIGURE 10B depicts a lentiviral vector expressing the CAR containing the Leader-CD20 VH (GGGGS)3 - CD20 VL -(GGGGS)5 -CD 19 VL- Whitlow linker-CD 19 VH CD8 hinge+TM-4-l BB- CD3z (CD2019 CAR Construct) nucleic acid sequence and the encoded amino acid sequence.
- FIGURES 1 1A and 1 I B depict Plasmid Maps of the tandem CAR lentiviral vectors (LV) encoding the CD19_20 (FIGURE 1 1A) and the CD20J 9 (FIGURE 1 1B) tandem CARs.
- the CD19_20 and CD20_19 tandem CARs were expressed using lentiviral backbone plasmids featuring a human EF-1 alpha internal promoter (EF l a), leader sequence (leader), VH and VL sequence from FMC63 and Leu 16 antibodies (CD19VL, CD 19VH, CD20 VL, CD20VH, respectively), inter-chain linker sequence, and intra-scFv sequence, linked to CD8, 4 I BB, and CD3zeta signaling domains.
- EF l a human EF-1 alpha internal promoter
- leader leader
- VH and VL sequence from FMC63 and Leu 16 antibodies
- CD19VL, CD 19VH, CD20 VL, CD20VH, respectively
- an antigen includes single or plural antigens and can be considered equivalent to the phrase “at least one antigen.”
- the term “comprises” means “includes.”
- “comprising an antigen” means “including an antigen” without excluding other elements.
- the phrase “and/or” means “and” or “or.” It is further to be understood that any and all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for descriptive purposes, unless otherwise indicated.
- the present disclosure provides for CD 19/CD20 antibodies or fragments thereof as well as chimeric antigen receptors (CARs) having such CD19/CD20 antigen binding domains.
- the enhancement of the functional activity of the CAR directly relates to the enhancement of functional activity of the CAR-expressing T cell.
- the CARs exhibit both a high degree of cytokine-induced cytolysis and cell surface expression on transduced T cells, along with an increased level of in vivo T cell expansion and persistence of the transduced CAR-expressing T cell.
- the CARs of the present disclosure are advantageous in that one CART lentiviral product may be utilized to treat multiple patient populations (i.e. CD 19+, CD20+ or double CD19+CD20+ cancer patients), which allows flexibility in circumstances where resources are limited.
- CARs Chimeric Antigen Receptors
- the choice of each of these protein domains is a key design feature, as is the way in which they are specifically combined.
- Each design domain is an essential component that can be used across different CAR platforms to engineer the function of lymphocytes. For example, the choice of the extracellular binding domain can make an otherwise ineffective CAR be effective.
- the invariable framework components of the immunoglobulin-derived protein sequences used to create the extracellular antigen binding domain of a CAR can either be entirely neutral, or they can self-associate and drive the T cell to a state of metabolic exhaustion, thus making the therapeutic T cell expressing that CAR far less effective. This occurs independently of the antigen binding function of this CAR domain. Furthermore, the choice of the intracellular signaling domain(s) also can govern the activity and the durability of the therapeutic lymphocyte population used for immunotherapy.
- the CARs disclosed herein are expressed at a high level in a cell.
- a cell expressing the CAR has a high in vivo proliferation rate, produces large amounts of cytokines, and has a high cytotoxic activity against a cell having, on its surface, a CD 19/CD20 antigen to which a CAR binds.
- the use of an extracellular CD19/CD20 antigen binding domain results in generation of a CAR that functions better in vivo, while avoiding the induction of anti-CAR immunity in the host immune response and the killing of the CAR T cell population.
- the CARs expressing the extracellular CD 19/CD20 ScFv antigen binding domain exhibit superior activities/properties including i) prevention of poor CAR T persistence and function as seen with mouse-derived binding sequences; ii) lack of regional ⁇ i.e. intrapleural) delivery of the CAR to be efficacious; and iii) ability to generate CAR T cell designs based both on binders with high and low affinity to CD 19/CD20.
- CARs Chimeric Antigen Receptors
- the CARs disclosed herein comprise at least one CD19/CD20 antigen binding domain capable of binding to CD 19/CD20, at least one transmembrane domain, and at least one intracellular domain.
- a chimeric antigen receptor is an artificially constructed hybrid protein or polypeptide containing the antigen binding domains of an antibody (e.g., single chain variable fragment (ScFv)) linked to T-cell signaling domains via the transmembrane domain.
- Characteristics of CARs include their ability to redirect T-cell specificity and reactivity toward a selected target in a non-MHC-restricted manner, and exploiting the antigen-binding properties of monoclonal antibodies.
- the non-MHC-restricted antigen recognition gives T cells expressing CARs the ability to recognize antigen independent of antigen processing, thus bypassing a major mechanism of tumor escape.
- CARs advantageously do not dimerize with endogenous T cell receptor (TCR) alpha and beta chains.
- the intracellular T cell signaling domains of the CARs can include, for example, a T cell receptor signaling domain, a T cell costimulatory signaling domain, or both.
- the T cell receptor signaling domain refers to a portion of the CAR comprising the intracellular domain of a T cell receptor, such as, for example, and not by way of limitation, the intracellular portion of the CD3 zeta protein.
- the costimulatory signaling domain refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule, which is a cell surface molecule other than an antigen receptor or their ligands that are required for an efficient response of lymphocytes to antigen.
- the CAR comprises a target-specific binding element otherwise referred to as an antigen binding domain or moiety.
- the choice of domain depends upon the type and number of ligands that define the surface of a target cell.
- the antigen binding domain may be chosen to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state.
- cell surface markers that may act as ligands for the antigen binding domain in the CAR include those associated with viral, bacterial and parasitic infections, autoimmune disease and cancer cells.
- the CAR can be engineered to target a tumor antigen of interest by way of engineering a desired antigen binding domain that specifically binds to an antigen on a tumor cell.
- Tumor antigens are proteins that are produced by tumor cells that elicit an immune response, particularly T-cell mediated immune responses. The selection of the antigen binding domain will depend on the particular type of cancer to be treated.
- Tumor antigens include, for example, a glioma-associated antigen, carcinoembryonic antigen (CEA), .beta.-human chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1 , MN-CA IX, human telomerase reverse transcriptase, RU 1 , RU2 (AS), intestinal carboxyl esterase, mut hsp70- 2, M-CSF, prostase, prostate-specific antigen (PSA), PAP, NY-ESO- 1 , LAGE-l a, p53, prostein, PSMA, Her2/neu, survivin and telomerase, prostate-carcinoma tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrinB2, CD22, insulin growth factor (IGF)-l, IGF-II, IGF- I receptor and CD19
- the tumor antigen comprises one or more antigenic cancer epitopes associated with a malignant tumor.
- Malignant tumors express a number of proteins that can serve as target antigens for an immune attack. These molecules include, but are not limited to, tissue- specific antigens such as MART-1 , tyrosinase and GP 100 in melanoma and prostatic acid phosphatase (PAP) and prostate-specific antigen (PSA) in prostate cancer.
- Other target molecules belong to the group of transformation-related molecules such as the oncogene HER-2 Neu/ErbB- 2.
- Yet another group of target antigens are onco-fetal antigens such as carcinoembryonic antigen (CEA).
- B-cell lymphoma the tumor-specific idiotype immunoglobulin constitutes a truly tumor-specific immunoglobulin antigen that is unique to the individual tumor.
- B-cell differentiation antigens such as CD 19, CD20, CD22, BCMA, RORl, and CD37 are other candidates for target antigens in B-cell lymphoma.
- Some of these antigens (CEA, HER-2, CD 19, CD20, idiotype) have been used as targets for passive immunotherapy with monoclonal antibodies with limited success.
- the tumor antigen is CD19/CD20 and the tumors associated with expression of CD19/CD20 comprise lung mesothelioma, ovarian, and pancreatic cancers that express high levels of the extracellular protein CD 19/CD20, or any combination thereof.
- the type of tumor antigen may also be a tumor-specific antigen (TSA) or a tumor- associated antigen (TAA).
- TSA tumor-specific antigen
- TAA tumor-associated antigen
- a TSA is unique to tumor cells and does not occur on other cells in the body.
- a TAA is not unique to a tumor cell and instead is also expressed on a normal cell under conditions that fail to induce a state of immunologic tolerance to the antigen.
- the expression of the antigen on the tumor may occur under conditions that enable the immune system to respond to the antigen.
- TAAs may be antigens that are expressed on normal cells during fetal development when the immune system is immature and unable to respond or they may be antigens that are normally present at extremely low levels on normal cells but which are expressed at much higher levels on tumor cells.
- TSAs or TAAs include the following: Differentiation antigens such as MART- l/MelanA (MART-I), gpl OO (Pmel 17), tyrosinase, TRP-1 , TRP-2 and tumor- specific multi-lineage antigens such as MAGE-1 , MAGE-3, BAGE, GAGE- 1 , GAGE-2, pi 5; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor- suppressor genes such as p53, Ras, HER-2/neu; unique tumor antigens resulting from chromosomal translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens, such as the Epstein Barr virus antigens EBVA and the human papillomavirus (HPV) antigens E6 and E7.
- Differentiation antigens such as MART- l/M
- the antigen binding domain portion of the CAR targets an antigen that includes but is not limited to CD 19, CD20, CD22, ROR1 , CD33, CD38, CD 123, CD 138, BCMA, c-Met, PSMA, Glycolipid F77, EGFRvIII, GD-2, FGFR4, TSLPR, NY-ESO- 1 TCR, MAGE A3 TCR, and the like.
- the antigen binding domain portion of the CAR targets the extracellular CD 19/CD20 antigen.
- the general scheme is set forth in FIGURES 1A and IB and includes, from the N-terminus to the C- terminus, a signal or leader peptide, anti-CD 19/CD20 ScFv, extracellular linker, CD8 transmembrane, 4-1 BB, CD3 zeta.
- the nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 1 (Leader-CD19 VL- Whitlow linker CD19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD8 hinge+TM-4-l BB- CD3z (Construct 1920)), and encodes the CAR comprising the amino acid sequence as set forth in SEQ ID NO: 2 (Leader-CD 19 VL- Whitlow linker CD 19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD8 hinge+TM-4- l BB- CD3z (Construct 1920) amino acid sequence (as depicted in Figure 10A)].
- the nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 1 , or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof, and encodes the CAR comprising the amino acid sequence as set forth in SEQ ID NO: 2 or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof (Leader-CD 19 VL- Whitlow linker CD 19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD8 hinge+TM-4-l BB- CD3z (Construct 1920)) amino acid sequence (as depicted in Figure 10A)].
- the nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 3 (Leader-CD20 VH (GGGGS)3 - CD20 VL -(GGGGS)5 -CD19 VL-Whitlow linker- CD 19 VH CD8 hinge+TM-4- l BB- CD3z (Construct 2019) (FIGURE 2B))), and encodes the CAR comprising the amino acid sequence as set forth in SEQ ID NO: 4 [Leader- CD20 VH (GGGGS)3 - CD20 VL -(GGGGS)5 -CD 19 VL-Whitlow linker- CD 19 VH CD8 hinge+TM-4- l BB- CD3z CAR amino acid sequence (as depicted in Figure 10B)].
- the nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 3 or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof, and encodes the CAR comprising the amino acid sequence as set forth in SEQ ID NO: 4 or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof [Leader- CD20 VH (GGGGS)3 - CD20 VL -(GGGGS)5 -CD19 VL-Whitlow linker- CD19 VH CD8 hinge+TM-4-l BB- CD3z CAR amino acid sequence (as depicted in Figure 10B)].
- the surface expression of anti-CD 19/CD20 CARs incorporating single chain fragment variable (ScFv) sequences reactive with CD 19/CD20 antigen is shown in Example 1 infra.
- the expression level for each ScFv-containing CAR was determined by flow cytometric analysis of LV-transduced T cells from healthy donors using one of three detection methods: i) Protein L- Biotin, followed by Streptavidin PE; ii) CD 19 Fc recombinant protein, followed by anti Fc AF647 (APC); iii) recombinant CD20 Biotin conjugate, followed by Streptavidin PE.
- the ScFv-based anti-CD 19/CD20 CAR constructs LTG 1920 and LTG 2019 were highly expressed in human primary T cells (as indicated by the gated population) as compared to non-transduced T cell controls (non-gated cell population).
- Example 1 and Figures 3 A and 3B high cytolytic activity of the CD19/CD20 CARs was demonstrated.
- Human primary T cells were transduced with LV encoding CAR constructs ( 19A, 19B, 20A, 1920, 2019, see Methods), then incubated for 18 hours with the Raji, NALM-6, REH, K562 or 293T cell lines, stably transduced with firefly luciferase, for luminescence based in vitro killing assays. All leukemia lines tested express CD19 on their surface, while the negative controls, K562 and 293T do not. CD20 expression varied between tumor lines.
- the Raji line is CD20 positive, while REH are CD20 negative, as are the control lines 562 and 293T.
- NALM-6 line has a weak but detectable expression of CD20.
- K562 lines were created that express CD19 (K562-19+), or CD20 (K562-20+).
- K562- 19+ were lysed by the CAR 19A and 19B constructs, tandem-CAR constructs 1920 and 2019, but not the single 20A CAR, Figure 3 A.
- 562-CD20+ were lysed by all CART constructs except for the single CAR 19 constructs, demonstrating target antigen-restricted killing. Similar results were seen with the other leukemia cell lines tested.
- the 20A single targeting CAR construct had no specific killing activity against the CD20-negative REH line, but did demonstrate killing of NALM-6, which has low but detectable levels of CD20 surface expression.
- tandem-CAR 1920 which appeared to show lower binding to CD20 peptide than to CD19-Fc by flow cytometry, also has lower cytotoxicity against K562-19+ and K562-20+, but not against the CD19+ CD20- REH. This may suggest that the 1920 tandem-CAR is inferior to 2019 tandem-CAR for some tumor targets.
- CAR T cells were co-incubated with CAR T cells or control T cells at effector to target ratio of 10: 1 overnight, and culture supernatants were analyzed by ELISA for IFN gamma, TNF alpha, IL- 2, and GM-CSF (c.f, Figure 4). All CAR T groups induced cytokines in response to tumor cells, whereas the negative controls (untransduced, N.T.) and GFP yielded no appreciable cytokine induction.
- tandem CAR T-expressing cells LTG 1920 and/or LTG2019 showed intermediate levels of IFN gamma, TNF alpha, IL-2, and GM-CSF, which may prove useful of the context of the clinical safety and avoidance of cytokine release syndrome.
- the enhanced therapeutic function associated with the exemplary CARs of the invention include, for example, and not by way of limitation, a) improved lateral movement within the plasma membrane allowing for more efficient signal transduction, b) superior location within plasma membrane microdomains, such as lipid rafts, and greater ability to interact with transmembrane signaling cascades associated with T cell activation, c) superior location within the plasma membrane by preferential movement away from dampening or down-modulatory interactions, such as less proximity to or interaction with phosphatases such as CD45, and d) superior assembly into T cell receptor signaling complexes (i.e. the immune synapse), or any combination thereof.
- CD19/CD20 variable heavy chain only and ScFv antigen binding domains While the disclosure has been illustrated with an exemplary extracellular CD19/CD20 variable heavy chain only and ScFv antigen binding domains, other nucleotide and/or amino acid variants within the CD I 9/CD20 variable heavy chain only and ScFv antigen binding domains may be used to derive the CD 19/CD20 antigen binding domains for use in the CARs described herein.
- the CAR can be additionally engineered to include the appropriate antigen binding domain that is specific to the desired antigen target.
- an antibody for CD19/CD20 can be used as the antigen bind domain incorporation into the CAR.
- the antigen binding domain portion of the CAR additionally targets CD33.
- the antigen binding domain in the CAR is anti-CD33 ScFv, wherein the nucleic acid sequence of the anti-CD33 ScFv comprises the sequence set forth in SEQ ID NO: 46.
- the anti-CD33 ScFv comprises the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 46.
- the anti- CD 19/CD20 ScFv portion of the CAR comprises the amino acid sequence set forth in SEQ ID NO: 47.
- the antigen binding domain portion of the CAR additionally targets mesothelin.
- the antigen binding domain in the CAR is anti- mesothelin ScFv, wherein the nucleic acid sequence of the anti-mesothelin ScFv comprises the sequence set forth in SEQ ID NO: 48.
- the anti-mesothelin ScFv comprises the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 48.
- the anti-mesothelin ScFv portion of the CAR comprises the amino acid sequence set forth in SEQ ID NO: 49.
- a CAR capable of binding to a non-TSA or non-TAA including, for example and not by way of limitation, an antigen derived from Retroviridae (e.g. human immunodeficiency viruses such as HIV-1 and HIV-LP), Picornaviridae (e.g.
- poliovirus hepatitis A virus, enterovirus, human coxsackievirus, rhinovirus, and echovirus
- rubella virus coronavirus
- vesicular stomatitis virus rabies virus
- ebola virus parainfluenza virus
- mumps virus measles virus
- respiratory syncytial virus influenza virus
- hepatitis B virus parvovirus
- Adenoviridae Herpesviridae [e.g. type 1 and type 2 herpes simplex virus (HSV), varicella-zoster virus, cytomegalovirus (CMV), and herpes virus]
- Herpesviridae e.g. type 1 and type 2 herpes simplex virus (HSV), varicella-zoster virus, cytomegalovirus (CMV), and herpes virus
- Herpesviridae e.g. type 1 and type 2 herpes simplex virus (HSV), varicella-zoster virus
- a CAR capable of binding to an antigen derived from a bacterial strain of Staphylococci, Streptococcus, Escherichia coli, Pseudomonas, or Salmonella.
- a CAR capable of binding to an antigen derived from an infectious bacterium, for example, Helicobacter pyloris, Legionella pneumophilia, a bacterial strain of Mycobacteria sps. (e.g. M. tuberculosis, M. avium, M. intracellular, M. kansaii, or M.
- the CAR comprises one or more transmembrane domains fused to the extracellular CD19/CD20 antigen binding domain of the CAR.
- the transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein.
- Transmembrane regions of particular use in the CARs described herein may be derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T- cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, mesothelin, CD33, CD37, CD64, CD80, CD83, CD86, CD 134, CD 137, CD 154, TNFRSF 16, or TNFRSF 19.
- the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine.
- a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
- a short oligo- or polypeptide linker preferably between 2 and 10 amino acids in length may form the linkage between the transmembrane domain and the cytoplasmic signaling domain of the CAR.
- a glycine-serine doublet provides a particularly suitable linker.
- the transmembrane domain that naturally is associated with one of the domains in the CAR is used in addition to the transmembrane domains described supra.
- the transmembrane domain can be selected or by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
- the transmembrane domain in the CAR of the invention is the CD8 transmembrane domain.
- the CD8 transmembrane domain comprises the nucleic acid sequence of SEQ ID NO: 35.
- the CD8 transmembrane domain comprises the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 36.
- the CD8 transmembrane domain comprises the amino acid sequence of SEQ ID NO: 36.
- the encoded transmembrane domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 28, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 28.
- the transmembrane domain of the CAR comprises the CD8.alpha.hinge domain.
- the CD8 hinge domain comprises the nucleic acid sequence of SEQ ID NO: 37.
- the CD8 hinge domain comprises the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 38.
- the CD8 hinge domain comprises the amino acid sequence of SEQ ID NO: 38, or a sequence with 95-99% identify thereof.
- an isolated nucleic acid molecule wherein the encoded linker domain is derived from the extracellular domain of CD8, and is linked to the transmembrane CD8 domain, the transmembrane CD28 domain, or a combination thereof.
- a spacer domain can be arranged between the extracellular domain and the transmembrane domain, or between the intracellular domain and the transmembrane domain.
- the spacer domain means any oligopeptide or polypeptide that serves to link the transmembrane domain with the extracellular domain and/or the transmembrane domain with the intracellular domain.
- the spacer domain comprises up to 300 amino acids, preferably 10 to 100 amino acids, and most preferably 25 to 50 amino acids.
- the linker can include a spacer element, which, when present, increases the size of the linker such that the distance between the effector molecule or the detectable marker and the antibody or antigen binding fragment is increased.
- spacers are known to the person of ordinary skill, and include those listed in U.S. Pat. Nos.
- the spacer domain preferably has a sequence that promotes binding of a CAR with an antigen and enhances signaling into a cell.
- an amino acid that is expected to promote the binding include cysteine, a charged amino acid, and serine and threonine in a potential glycosylation site, and these amino acids can be used as an amino acid constituting the spacer domain.
- the spacer domain As the spacer domain, the entire or a part of amino acid numbers 137-206 (SEQ ID NO: 39) which is a hinge region of CD8.alpha. (NCBI RefSeq: NP.sub.--001759.3), amino acid numbers 135 to 195 of CD8.beta. (GenBank: AAA35664.1), amino acid numbers 315 to 396 of CD4 (NCBI RefSeq: NP.sub.--000607.1 ), or amino acid numbers 137 to 152 of CD28 (NCBI RefSeq: NP. sub.— 006130.1 ) can be used. Also, as the spacer domain, a part of a constant region of an antibody H chain or L chain can be used. Further, the spacer domain may be an artificially synthesized sequence.
- a signal peptide sequence can be linked to the N-terminus.
- the signal peptide sequence exists at the N-terminus of many secretory proteins and membrane proteins, and has a length of 15 to 30 amino acids. Since many of the protein molecules mentioned above as the intracellular domain have signal peptide sequences, the signal peptides can be used as a signal peptide for the CAR.
- the signal peptide comprises the amino acid sequence shown in SEQ ID NO: 18.
- the cytoplasmic domain or otherwise the intracellular signaling domain of the CAR is responsible for activation of at least one of the normal effector functions of the immune cell in which the CAR has been placed in.
- effector function refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines.
- intracellular signaling domain refers to the portion of a protein which transduces the effector function signal and directs the cell to perform a specialized function. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain.
- intracellular signaling domain is thus meant to include any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
- intracellular signaling domains for use in the CAR include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any synthetic sequence that has the same functional capability.
- TCR T cell receptor
- T cell activation can be said to be mediated by two distinct classes of cytoplasmic signaling sequence: those that initiate antigen-dependent primary activation through the TCR (primary cytoplasmic signaling sequences) and those that act in an antigen-independent manner to provide a secondary or co- stimulatory signal (secondary cytoplasmic signaling sequences).
- primary cytoplasmic signaling sequences those that initiate antigen-dependent primary activation through the TCR
- secondary cytoplasmic signaling sequences those that act in an antigen-independent manner to provide a secondary or co- stimulatory signal
- Primary cytoplasmic signaling sequences regulate primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way.
- Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyros ine-based activation motifs or ITA s.
- ITAM containing primary cytoplasmic signaling sequences that are of particular use in the CARS disclosed herein include those derived from TCR zeta (CD3 Zeta), FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.
- TCR zeta CD3 Zeta
- FcR gamma FcR beta
- CD3 gamma CD3 delta
- CD3 epsilon CD5, CD22, CD79a, CD79b, and CD66d.
- Specific, non-limiting examples, of the ITAM include peptides having sequences of amino acid numbers 51 to 164 of CD3.zeta. (NCBI RefSeq: NP.sub.--932170.1 ), amino acid numbers 45 to 86 of Fc.epsilon.RI.gamma.
- NCBI RefSeq NP.sub.--004097.1
- NCBI RefSeq: NP.sub.-OOO 130.1 amino acid numbers 139 to 182 of CD3.
- gamma NCBI RefSeq: NP.sub.--000064.1
- amino acid numbers 128 to 171 of CD3 .delta. NCBI RefSeq: NP.sub.--000723.1
- NCBI RefSeq: NP.sub.--000724.1 amino acid numbers 402 to 495 of CD5 (NCBI RefSeq: NP.sub.-055022.2), amino acid numbers 707 to 847 of 0022 (NCBI RefSeq: NP.sub.--001762.2), amino acid numbers 166 to 226 of CD79a (NCBI RefSeq: NP.sub.- 001774.1 ), amino acid numbers 1 82 to 229 of CD79b (NCBI RefSeq: NP.sub.--000617.1 ), and amino acid numbers 177 to 252 of CD66d (NCBI RefSeq: NP.sub.-001806.2), and their variants having the same function as these peptides have.
- the cytoplasmic signaling molecule in the CAR comprises a cytoplasmic signaling sequence derived from CD3 zeta.
- the intracellular domain of the CAR can be designed to comprise the CD3-zeta signaling domain by itself or combined with any other desired cytoplasmic domain(s) useful in the context of the CAR.
- the intracellular domain of the CAR can comprise a CD3 zeta chain portion and a costimulatory signaling region.
- the costimulatory signaling region refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule.
- a costimulatory molecule is a cell surface molecule other than an antigen receptor or their ligands that is required for an efficient response of lymphocytes to an antigen.
- costimulatory molecules examples include CD27, CD28, 4- IBB (CD 137), OX40, CD30, CD40, PD- 1 , ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, and the like.
- costimulatory molecules include peptides having sequences of amino acid numbers 236 to 351 of CD2 (NCB1 RefSeq: NP.
- NCBI RefSeq: NP.sub.-001759.3 amino acid numbers 196 to 210 of CD83 (GenBank: AAA35664.1 ), amino acid numbers 181 to 220 of CD28 (NCBI RefSeq: NP.sub.--006130.1 ), amino acid numbers 214 to 255 of CD 137 (4-1 BB, NCBI RefSeq: NP.sub.--001552.2), amino acid numbers 241 to 277 of CD 134 (OX40, NCBI RefSeq: NP.sub.--003318.1), and amino acid numbers 166 to 199 of ICOS (NCBI RefSeq: NP.sub.-036224.1 ), and their variants having the same function as these peptides have.
- 4-1 BB as the co-stimulatory signaling element
- other costimulatory elements are within the scope of the disclosure.
- the cytoplasmic signaling sequences within the cytoplasmic signaling portion of the CAR may be linked to each other in a random or specified order.
- a short oligo- or polypeptide linker preferably between 2 and 10 amino acids in length may form the linkage.
- a glycine-serine doublet provides a particularly suitable linker.
- the intracellular domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28. In another embodiment, the intracellular domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of 4- I BB. In yet another embodiment, the intracellular domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28 and 4-1 BB.
- the intracellular domain in the CAR is designed to comprise the signaling domain of 4- I BB and the signaling domain of CD3-zeta, wherein the signaling domain of 4-1 BB comprises the nucleic acid sequence set forth in SEQ ID NO: 40 and the signaling domain of CD3-zeta comprises the nucleic acid sequence set forth in SEQ ID NO: 42.
- the intracellular domain in the CAR is designed to comprise the signaling domain of 4- I BB and the signaling domain of CD3-zeta, wherein the signaling domain of 4-1 BB comprises the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 41 and the signaling domain of CD3-zeta comprises the nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 43.
- the intracellular domain in the CAR is designed to comprise the signaling domain of 4-1 BB and the signaling domain of CD3-zeta, wherein the signaling domain of 4- I BB comprises the amino acid sequence set forth in SEQ ID NO: 41 and the signaling domain of CD3-zeta comprises the amino acid sequence set forth in SEQ ID NO: 43.
- the term "functional portion" when used in reference to a CAR refers to any part or fragment of one or more of the CARs disclosed herein, which part or fragment retains the biological activity of the CAR of which it is a part (the parent CAR).
- Functional portions encompass, for example, those parts of a CAR that retain the ability to recognize target cells, or detect, treat, or prevent a disease, to a similar extent, the same extent, or to a higher extent, as the parent CAR.
- the functional portion can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95%, or more, of the parent CAR.
- the functional portion can comprise additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent CAR.
- the additional amino acids do not interfere with the biological function of the functional portion, e.g., recognize target cells, detect cancer, treat or prevent cancer, etc. More desirably, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent CAR.
- the term "functional variant” as used herein refers to a CAR, polypeptide, or protein having substantial or significant sequence identity or similarity to a parent CAR, which functional variant retains the biological activity of the CAR of which it is a variant.
- Functional variants encompass, for example, those variants of the CAR described herein (the parent CAR) that retain the ability to recognize target cells to a similar extent, the same extent, or to a higher extent, as the parent CAR.
- the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent CAR.
- a functional variant can, for example, comprise the amino acid sequence of the parent CAR with at least one conservative amino acid substitution.
- the functional variants can comprise the amino acid sequence of the parent CAR with at least one non-conservative amino acid substitution.
- the non-conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent CAR.
- Amino acid substitutions of the CARs are preferably conservative amino acid substitutions.
- Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and/or chemical properties is exchanged for another amino acid that has the same or similar chemical or physical properties.
- the conservative amino acid substitution can be an acidic/negatively charged polar amino acid substituted for another acidic/negatively charged polar amino acid (e.g., Asp or Glu), an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain (e.g., Ala, Gly, Val, He, Leu, Met, Phe, Pro, Trp, Cys, Val, etc.), a basic/positively charged polar amino acid substituted for another basic/positively charged polar amino acid (e.g.
- an acidic/negatively charged polar amino acid substituted for another acidic/negatively charged polar amino acid e.g., Asp or Glu
- an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain e.g., Ala, Gly, Val, He, Leu, Met, Phe, Pro, Trp, Cys, Val, etc.
- an uncharged amino acid with a polar side chain substituted for another uncharged amino acid with a polar side chain e.g., Asn, Gin, Ser, Thr, Tyr, etc.
- an amino acid with a beta- branched side-chain substituted for another amino acid with a beta-branched side-chain e.g., He, Thr, and Val
- an amino acid with an aromatic side-chain substituted for another amino acid with an aromatic side chain e.g., His, Phe, Trp, and Tyr
- the CAR can consist essentially of the specified amino acid sequence or sequences described herein, such that other components, e.g., other amino acids, do not materially change the biological activity of the functional variant.
- the CARs can be of any length, i.e., can comprise any number of amino acids, provided that the CARs (or functional portions or functional variants thereof) retain their biological activity, e.g., the ability to specifically bind to antigen, detect diseased cells in a mammal, or treat or prevent disease in a mammal, etc.
- the CAR can be about 50 to about 5000 amino acids long, such as 50, 70, 75, 100, 125, 1 50, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids in length.
- the CARs can comprise synthetic amino acids in place of one or more naturally-occurring amino acids.
- Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, -amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4- chlorophenylalanine, 4-carboxyphenylalanine, ⁇ -phenylserine ⁇ -hydroxyphenylalanine, phenylglycine, a-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, l ,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, amino
- the CARs can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized via, e.g., a disulfide bridge, or converted into an acid addition salt and/or optionally dimerized or polymerized, or conjugated.
- the CARs can be obtained by methods known in the art.
- the CARs may be made by any suitable method of making polypeptides or proteins. Suitable methods of de novo synthesizing polypeptides and proteins are described in references, such as Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford, United Kingdom, 2000; Peptide and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., 2000; Epitope Mapping, ed. Westwood et al., Oxford University Press, Oxford, United Kingdom, 2001 ; and U.S. Patent 5,449,752.
- polypeptides and proteins can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY 2001 ; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY, 1994. Further, some of the CARs (including functional portions and functional variants thereof) can be isolated and/or purified from a source, such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc.
- a source such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc.
- One embodiment further provides a CAR, a T cell expressing a CAR, an antibody, or antigen binding domain or portion thereof, which specifically binds to one or more of the antigens disclosed herein.
- a "T cell expressing a CAR,” or a “CAR T cell” means a T cell expressing a CAR, and has antigen specificity determined by, for example, the antibody-derived targeting domain of the CAR.
- antibody can include an antibody and antigen binding fragments thereof.
- antibody is used herein in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multi-specific antibodies (e.g., bispecific antibodies), and antigen binding fragments thereof, so long as they exhibit the desired antigen-binding activity.
- Non-limiting examples of antibodies include, for example, intact immunoglobulins and variants and fragments thereof known in the art that retain binding affinity for the antigen.
- a “monoclonal antibody” is an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic epitope. The modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
- a monoclonal antibody is an antibody produced by a single clone of B lymphocytes or by a cell into which nucleic acid encoding the light and heavy variable regions of the antibody of a single antibody (or an antigen binding fragment thereof) have been transfected, or a progeny thereof.
- monoclonal antibodies are isolated from a subject. Monoclonal antibodies can have conservative amino acid substitutions which have substantially no effect on antigen binding or other immunoglobulin functions. Exemplary methods of production of monoclonal antibodies are known, for example, see Harlow & Lane, Antibodies, A Laboratory Manual, 2nd ed. Cold Spring Harbor Publications, New Y ork (2013).
- an immunoglobulin typically has heavy (H) chains and light (L) chains interconnected by disulfide bonds.
- Immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable domain genes.
- Each heavy and light chain contains a constant region (or constant domain) and a variable region (or variable domain; see, e.g., Kindt et al. Kuby Immunology, 6 th ed., W.H. Freeman and Co., page 91 (2007).)
- the heavy and the light chain variable regions combine to specifically bind the antigen.
- only the heavy chain variable region is required.
- naturally occurring camelid antibodies consisting of a heavy chain are functional and stable in the absence of light chain (see, e.g., Hamers- Casterman et al., Nature, 363:446-448, 1993; Sheriff el al., Nat. Struct. Biol., 3 :733-736, 1996).
- VH refers to the variable region of an antibody heavy chain, including that of an antigen binding fragment, such as Fv, ScFv, dsFv or Fab.
- VL refers to the variable domain of an antibody light chain, including that of an Fv, ScFv, dsFv or Fab.
- Light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called “complementarity-determining regions” or "CDRs" (see, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1991 ).
- CDRs complementarity-determining regions
- the sequences of the framework regions of different light or heavy chains are relatively conserved within a species.
- the framework region of an antibody that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs in three-dimensional space.
- the CDRs are primarily responsible for binding to an epitope of an antigen.
- the amino acid sequence boundaries of a given CDR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. ("Sequences of Proteins of Immunological Interest," 5 th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991 ; “Kabat” numbering scheme), Al-Lazikani et al., (JMB 273,927-948, 1997; “Chothia” numbering scheme), and Lefranc et al. (“IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains," Dev. Comp.
- the CDRs of each chain are typically referred to as CDR1 , CDR2, and CDR3 (from the N-terminus to C-terminus), and are also typically identified by the chain in which the particular CDR is located.
- a VH CDR3 is the CDR3 from the variable domain of the heavy chain of the antibody in which it is found
- a VL CDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found.
- Light chain CDRs are sometimes referred to as LCDR1 , LCDR2, and LCDR3.
- Heavy chain CDRs are sometimes referred to as LCDR1, LCDR2, and LCDR3.
- an "antigen binding fragment” is a portion of a full length antibody that retains the ability to specifically recognize the cognate antigen, as well as various combinations of such portions.
- antigen binding fragments include Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g. ScFv); and multi-specific antibodies formed from antibody fragments.
- Antibody fragments include antigen binding fragments either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies (see, e.g., Kontermann and Dubel (Ed), Antibody Engineering, Vols. 1 -2, 2nd Ed., Springer Press, 2010).
- a single-chain antibody is a genetically engineered molecule containing the VH and VL domains of one or more antibody(ies) linked by a suitable polypeptide linker as a genetically fused single chain molecule (see, for example, Bird et al., Science, 242:423 426, 1988; Huston et al., Proc. Natl. Acad. Sci., 85 :5879 5883, 1988; Ahmad et al., Clin. Dev. Immunol., 2012, doi: 10.1 155/2012/980250; Marbry, IDrugs, 13:543-549, 2010).
- VH-domain-linker domain- VL-domain VL- domain-linker domain-VH-domain
- Diabodies which are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see, for example, Holliger et al., Proc. Natl. Acad. Sci., 90:6444 6448, 1993; Poljak et al., Structure, 2: 1 121 1 123, 1994).
- Antibodies also include genetically engineered forms such as chimeric antibodies (such as humanized murine antibodies) and heteroconjugate antibodies (such as bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York, 1997.
- Non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantiy, or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as described by Huse et al., Science 246: 1275-1281 (1989), which is incorporated herein by reference.
- These and other methods of making, for example, chimeric, humanized, CDR-grafted, single chain, and bifunctional antibodies are well known to those skilled in the art (Winter and Harris, Immunol.
- an "antibody that binds to the same epitope” as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more.
- Antibody competition assays are known, and an exemplary competition assay is provided herein.
- a “humanized” antibody or antigen binding fragment includes a human framework region and one or more CDRs from a non-human (such as a mouse, rat, or synthetic) antibody or antigen binding fragment.
- the non-human antibody or antigen binding fragment providing the CDRs is termed a "donor,” and the human antibody or antigen binding fragment providing the framework is termed an "acceptor.”
- all the CDRs are from the donor immunoglobulin in a humanized immunoglobulin. Constant regions need not be present, but if they are, they can be substantially identical to human immunoglobulin constant regions, such as at least about 85-90%, such as about 95% or more identical.
- all parts of a humanized antibody or antigen binding fragment, except possibly the CDRs are substantially identical to corresponding parts of natural human antibody sequences.
- a “chimeric antibody” is an antibody which includes sequences derived from two different antibodies, which typically are of different species.
- a chimeric antibody includes one or more CDRs and/or framework regions from one human antibody and CDRs and/or framework regions from another human antibody.
- a “fully human antibody” or “human antibody” is an antibody which includes sequences from (or derived from) the human genome, and does not include sequence from another species.
- a human antibody includes CDRs, framework regions, and (if present) an Fc region from (or derived from) the human genome.
- Human antibodies can be identified and isolated using technologies for creating antibodies based on sequences derived from the human genome, for example by phage display or using transgenic animals (see, e.g., Barbas et al. Phage display: A Laboratory Manuel. 1 st Ed. New York: Cold Spring Harbor Laboratory Press, 2004. Print.; Lonberg, Nat. Biotech., 23 : 1 1 17- 1 125, 2005; Lonenberg, Curr. Opin. Immunol., 20:450- 459, 2008).
- An antibody may have one or more binding sites. If there is more than one binding site, the binding sites may be identical to one another or may be different. For instance, a naturally- occurring immunoglobulin has two identical binding sites, a single-chain antibody or Fab fragment has one binding site, while a bispecific or bifunctional antibody has two different binding sites.
- Methods of testing antibodies for the ability to bind to any functional portion of the CAR include any antibody-antigen binding assay, such as, for example, radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays (see, e.g., Janeway et al., infra, U.S. Patent Application Publication No. 2002/0197266 Al, and U.S. Patent No. 7,338,929).
- RIA radioimmunoassay
- ELISA ELISA
- Western blot Western blot
- immunoprecipitation immunoprecipitation
- competitive inhibition assays see, e.g., Janeway et al., infra, U.S. Patent Application Publication No. 2002/0197266 Al, and U.S. Patent No. 7,338,929.
- a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof can be modified to comprise a detectable label, such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
- a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles).
- FITC fluorescein isothiocyanate
- PE phycoerythrin
- an enzyme e
- a CAR, a T cell expressing a CAR, or monoclonal antibodies, or antigen binding fragments thereof, specific for one or more of the antigens disclosed herein can be conjugated to an agent, such as an effector molecule or detectable marker, using any number of means known to those of skill in the art. Both covalent and noncovalent attachment means may be used. Conjugates include, but are not limited to, molecules in which there is a covalent linkage of an effector molecule or a detectable marker to an antibody or antigen binding fragment that specifically binds one or more of the antigens disclosed herein.
- effector molecules and detectable markers can be used, including (but not limited to) chemotherapeutic agents, anti-angiogenic agents, toxins, radioactive agents such as 125 1, 32 P, , C, 3 H and 35 S and other labels, target moieties and ligands, etc.
- the choice of a particular effector molecule or detectable marker depends on the particular target molecule or cell, and the desired biological effect.
- the effector molecule can be a cytotoxin that is used to bring about the death of a particular target cell (such as a tumor cell).
- the procedure for attaching an effector molecule or detectable marker to an antibody or antigen binding fragment varies according to the chemical structure of the effector.
- Polypeptides typically contain a variety of functional groups; such as carboxylic acid (COOH), free amine (- NH 2 ) or sulfhydryl (-SH) groups, which are available for reaction with a suitable functional group on an antibody to result in the binding of the effector molecule or detectable marker.
- the antibody or antigen binding fragment is derivatized to expose or attach additional reactive functional groups.
- the derivatization may involve attachment of any of a number of known linker molecules such as those available from Pierce Chemical Company, Rockford, IL.
- the linker can be any molecule used to join the antibody or antigen binding fragment to the effector molecule or detectable marker.
- the linker is capable of forming covalent bonds to both the antibody or antigen binding fragment and to the effector molecule or detectable marker.
- Suitable linkers are well known to those of skill in the art and include, but are not limited to, straight or branched-chain carbon linkers, heterocyclic carbon linkers, or peptide linkers.
- the linkers may be joined to the constituent amino acids through their side groups (such as through a disulfide linkage to cysteine) or to the alpha carbon amino and carboxyl groups of the terminal amino acids.
- the linker can include a spacer element, which, when present, increases the size of the linker such that the distance between the effector molecule or the detectable marker and the antibody or antigen binding fragment is increased.
- spacers are known to the person of ordinary skill, and include those listed in U.S. Pat. Nos.
- the linker is cleavable under intracellular conditions, such that cleavage of the linker releases the effector molecule or detectable marker from the antibody or antigen binding fragment in the intracellular environment.
- the linker is not cleavable and the effector molecule or detectable marker is released, for example, by antibody degradation.
- the linker is cleavable by a cleaving agent that is present in the intracellular environment (for example, within a lysosome or endosome or caveolea).
- the linker can be, for example, a peptide linker that is cleaved by an intracellular peptidase or protease enzyme, including, but not limited to, a lysosomal or endosomal protease.
- the peptide linker is at least two amino acids long or at least three amino acids long.
- the linker can be 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14 or 15 amino acids long, such as 1-2, 1 -3, 2-5, 3-10, 3-15, 1 -5, 1 - 10, 1 -15 amino acids long.
- Proteases can include cathepsins B and D and plasmin, all of which are known to hydrolyze dipeptide drug derivatives resulting in the release of active drug inside target cells (see, for example, Dubowchik and Walker, 1999, Pharm. Therapeutics 83:67- 123).
- a peptide linker that is cleavable by the thiol-dependent protease cathepsin-B can be used (for example, a Phenylalanine -Leucine or a Glycine- Phenylalanine -Leucine-Glycine linker).
- Other examples of such linkers are described, for example, in U.S. Pat. No. 6,214,345, incorporated herein by reference.
- the peptide linker cleavable by an intracellular protease is a Valine-Citruline linker or a Phenylalanine-Lysine linker (see, for example, U.S. Pat. No. 6,214,345, which describes the synthesis of doxorubicin with the Valine- Citruline linker).
- the cleavable linker is pH-sensitive, i.e., sensitive to hydrolysis at certain pH values.
- the pH-sensitive linker is hydrolyzable under acidic conditions.
- an acid-labile linker that is hydrolyzable in the lysosome for example, a hydrazone, semicarbazone, thiosemicarbazone, cis-aconitic amide, orthoester, acetal, ketal, or the like
- an acid-labile linker that is hydrolyzable in the lysosome for example, a hydrazone, semicarbazone, thiosemicarbazone, cis-aconitic amide, orthoester, acetal, ketal, or the like
- the hydrolyzable linker is a thioether linker (such as, for example, a thioether attached to the therapeutic agent via an acylhydrazone bond (see, for example, U.S. Pat. No. 5,622,929).
- the linker is cleavable under reducing conditions (for example, a disulfide linker).
- a disulfide linker for example, a disulfide linker.
- disulfide linkers are known in the art, including, for example, those that can be formed using SATA (N-succinimidyl-S-acetylthioacetate), SPDP (N-succinimidyl-3- (2-pyridyldithio)propionate), SPDB (N-succinimidyl-3-(2-pyridyldithio)butyrate) and SMPT (N- succinimidyl-oxycarbonyl-alpha-methyl-alpha-(2-pyridyl-dithio)toluene)-, SPDB and SMPT.
- SATA N-succinimidyl-S-acetylthioacetate
- SPDP N-succinimidyl-3- (2-pyri
- the linker is a malonate linker (Johnson et al., 1995, Anticancer Res. 15 : 1387-93), a maleimidobenzoyl linker (Lau et al., 1995, Bioorg-Med-Chem. 3(10): 1299-1304), or a 3'-N-amide analog (Lau et al., 1995, Bioorg-Med-Chem. 3(10): 1305-12).
- the linker is not cleavable and the effector molecule or detectable marker is released by antibody degradation. (See U.S. Publication No. 2005/0238649 incorporated by reference herein in its entirety).
- the linker is resistant to cleavage in an extracellular environment. For example, no more than about 20%, no more than about 15%, no more than about 10%, no more than about 5%, no more than about 3%, or no more than about 1% of the linkers, in a sample of conjugate, are cleaved when the conjugate is present in an extracellular environment (for example, in plasma). Whether or not a linker is resistant to cleavage in an extracellular environment can be determined, for example, by incubating the conjugate containing the linker of interest with plasma for a predetermined time period (for example, 2, 4, 8, 16, or 24 hours) and then quantitating the amount of free effector molecule or detectable marker present in the plasma.
- a predetermined time period for example, 2, 4, 8, 16, or 24 hours
- linkers that can be used in conjugates are described in WO 2004-010957, U.S. Publication No. 2006/0074008, U.S. Publication No. 20050238649, and U.S. Publication No. 2006/0024317, each of which is incorporated by reference herein in its entirety.
- conjugates of a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof, and one or more small molecule toxins such as a calicheamicin, maytansinoids, dolastatins, auristatins, a trichothecene, and CC1065, and the derivatives of these toxins that have toxin activity, are provided.
- small molecule toxins such as a calicheamicin, maytansinoids, dolastatins, auristatins, a trichothecene, and CC1065, and the derivatives of these toxins that have toxin activity
- Maytansine compounds suitable for use as maytansinoid toxin moieties are well known in the art, and can be isolated from natural sources according to known methods, produced using genetic engineering techniques (see Yu et al (2002) PNAS 99:7968-7973), or maytansinol and maytansinol analogues prepared synthetically according to known methods. Maytansinoids are mitototic inhibitors which act by inhibiting tubulin polymerization. Maytansine was first isolated from the east African shrub Maytenus serrata (U.S. Pat. No. 3,896, 1 1 1 ).
- Additional toxins can be employed with a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof.
- exemplary toxins include Pseudomonas exotoxin (PE), ricin, abrin, diphtheria toxin and subunits thereof, ribotoxin, ribonuclease, saporin, and calicheamicin, as well as botulinum toxins A through F.
- PE Pseudomonas exotoxin
- ricin ricin
- abrin diphtheria toxin and subunits thereof
- ribotoxin ribonuclease
- saporin and calicheamicin
- botulinum toxins A through F as well known in the art and many are readily available from commercial sources (for example, Sigma Chemical Company, St. Louis, MO).
- Contemplated toxins also include variants of the toxins (see, for example, see, U.S. Patent Nos
- Saporin is a toxin derived from Saponaria officinalis that disrupts protein synthesis by inactivating the 60S portion of the ribosomal complex (Stirpe et al., Bio/Technology, 10:405-412, 1992).
- the toxin has no mechanism for specific entry into cells, and therefore requires conjugation to an antibody or antigen binding fragment that recognizes a cell-surface protein that is internalized in order to be efficiently taken up by cells.
- Diphtheria toxin is isolated from Corynebacterium diphtheriae. Typically, diphtheria toxin for use in immunotoxins is mutated to reduce or to eliminate non-specific toxicity.
- a mutant known as CRM 107 which has full enzymatic activity but markedly reduced non-specific toxicity, has been known since the 1970's (Laird and Groman, J. Virol. 19:220, 1976), and has been used in human clinical trials. See, U.S. Patent No. 5,792,458 and U.S. Patent No. 5,208,021 .
- Ricin is the lectin RCA60 from Ricinus communis (Castor bean).
- Ricinus communis agglutinin occurs in two forms designated RCA60 and RCA i 20 according to their molecular weights of approximately 65 and 120 kD, respectively (Nicholson & Blaustein, J. Biochim. Biophys. Acta 266:543, 1972).
- the A chain is responsible for inactivating protein synthesis and killing cells.
- the B chain binds ricin to cell-surface galactose residues and facilitates transport of the A chain into the cytosol (Olsnes et al., Nature 249:627-631 , 1974 and U.S. Patent No. 3,060, 165).
- Ribonucleases have also been conjugated to targeting molecules for use as immunotoxins (see Suzuki et al., Nat. Biotech. 17:265-70, 1999).
- Exemplary ribotoxins such as a-sarcin and restrictocin are discussed in, for example Rathore et al., Gene 190:31 -5, 1997; and Goyal and Batra, Biochem. 345 Pt 2:247-54, 2000.
- Calicheamicins were first isolated from Micromonospora echinospora and are members of the enediyne antitumor antibiotic family that cause double strand breaks in DNA that lead to apoptosis (see, for example Lee et al., J. Antibiot. 42: 1070-87, 1989). The drug is the toxic moiety of an immunotoxin in clinical trials (see, for example, Gillespie et al., Ann. Oncol. 1 1 :735-41 , 2000).
- Abrin includes toxic lectins from Abrus precatorius.
- the toxic principles, abrin a, b, c, and d have a molecular weight of from about 63 and 67 kD and are composed of two disulfide- linked polypeptide chains A and B.
- the A chain inhibits protein synthesis; the B chain (abrin-b) binds to D-galactose residues (see, Funatsu et al., Agr. Biol. Chem. 52: 1095, 1988; and Olsnes, Methods Enzymol. 50:330-335, 1978).
- a CAR, a T cell expressing a CAR, monoclonal antibodies, antigen binding fragments thereof, specific for one or more of the antigens disclosed herein, can also be conjugated with a detectable marker; for example, a detectable marker capable of detection by ELISA, spectrophotometry, flow cytometry, microscopy or diagnostic imaging techniques (such as computed tomography (CT), computed axial tomography (CAT) scans, magnetic resonance imaging (MRJ), nuclear magnetic resonance imaging NMRI), magnetic resonance tomography (MTR), ultrasound, fiberoptic examination, and laparoscopic examination).
- CT computed tomography
- CAT computed axial tomography
- MRJ magnetic resonance imaging
- NMRI nuclear magnetic resonance imaging
- MMR magnetic resonance tomography
- detectable markers include fluorophores, chemiluminescent agents, enzymatic linkages, radioactive isotopes and heavy metals or compounds (for example super paramagnetic iron oxide nanocrystals for detection by MRJ).
- useful detectable markers include fluorescent compounds, including fluorescein, fluorescein isothiocyanate, rhodamine, 5- dimethylamine- l-napthalenesulfonyl chloride, phycoerythrin, lanthanide phosphors and the like.
- Bioluminescent markers are also of use, such as luciferase, Green fluorescent protein (GFP), Yellow fluorescent protein (YFP).
- a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof can also be conjugated with enzymes that are useful for detection, such as horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase, glucose oxidase and the like.
- enzymes that are useful for detection such as horseradish peroxidase, ⁇ -galactosidase, luciferase, alkaline phosphatase, glucose oxidase and the like.
- a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof may also be conjugated with biotin, and detected through indirect measurement of avidin or streptavidin binding. It should be noted that the avidin itself can be conjugated with an enzyme or a fluorescent label.
- a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof, may be conjugated with a paramagnetic agent, such as gadolinium.
- Paramagnetic agents such as superparamagnetic iron oxide are also of use as labels.
- Antibodies can also be conjugated with lanthanides (such as europium and dysprosium), and manganese.
- An antibody or antigen binding fragment may also be labeled with a predetermined polypeptide epitopes recognized by a secondary reporter (such as leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags).
- a CAR, a T cell expressing a CAR, an antibody, or antigen binding portion thereof, can also be conjugated with a radiolabeled amino acid.
- the radiolabel may be used for both diagnostic and therapeutic purposes. For instance, the radiolabel may be used to detect one or more of the antigens disclosed herein and antigen expressing cells by x-ray, emission spectra, or other diagnostic techniques. Further, the radiolabel may be used therapeutically as a toxin for treatment of tumors in a subject, for example for treatment of a neuroblastoma.
- labels for polypeptides include, but are not limited to, the following radioisotopes or radionucleotides: 3 H, 14 C, 15 N, 35 S, 90 Y, "Tc, 1 1 'In, 125 I, 131 I.
- radiolabels may be detected using photographic film or scintillation counters
- fluorescent markers may be detected using a photodetector to detect emitted illumination.
- Enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and colorimetric labels are detected by simply visualizing the colored label.
- nucleic acid comprising a nucleotide sequence encoding any of the CARs, an antibody, or antigen binding portion thereof, described herein (including functional portions and functional variants thereof).
- the nucleic acids of the invention may comprise a nucleotide sequence encoding any of the leader sequences, antigen binding domains, transmembrane domains, and/or intracellular T cell signaling domains described herein.
- the nucleotide sequence may be codon-modified. Without being bound to a particular theory, it is believed that codon optimization of the nucleotide sequence increases the translation efficiency of the mRNA transcripts. Codon optimization of the nucleotide sequence may involve substituting a native codon for another codon that encodes the same amino acid, but can be translated by tRNA that is more readily available within a cell, thus increasing translation efficiency. Optimization of the nucleotide sequence may also reduce secondary mRNA structures that would interfere with translation, thus increasing translation efficiency.
- the nucleic acid may comprise a codon-modified nucleotide sequence that encodes the antigen binding domain of the inventive CAR. In another embodiment of the invention, the nucleic acid may comprise a codon-modified nucleotide sequence that encodes any of the CARs described herein (including functional portions and functional variants thereof).
- Nucleic acid as used herein includes “polynucleotide,” “oligonucleotide,” and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
- the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.
- a recombinant nucleic acid may be one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques, such as those described in Sambrook et al., supra.
- the nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al, supra, and Ausubel et al., supra.
- a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
- modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1 - methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyI-2-thiouracil, beta-D-mannos
- the nucleic acid can comprise any isolated or purified nucleotide sequence which encodes any of the CARs or functional portions or functional variants thereof.
- the nucleotide sequence can comprise a nucleotide sequence which is degenerate to any of the sequences or a combination of degenerate sequences.
- An embodiment also provides an isolated or purified nucleic acid comprising a nucleotide sequence which is complementary to the nucleotide sequence of any of the nucleic acids described herein or a nucleotide sequence which hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein.
- the nucleotide sequence which hybridizes under stringent conditions may hybridize under high stringency conditions.
- high stringency conditions is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization.
- High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3- 10 bases) that matched the nucleotide sequence.
- Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCI or the equivalent, at temperatures of about 50-70 °C.
- Such high stringency conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand, and are particularly suitable for detecting expression of any of the inventive CARs. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.
- nucleic acid comprising a nucleotide sequence that is at least about 70% or more, e.g., about 80%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to any of the nucleic acids described herein.
- the nucleic acids can be incorporated into a recombinant expression vector.
- an embodiment provides recombinant expression vectors comprising any of the nucleic acids.
- the term "recombinant expression vector” means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell.
- the vectors are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring.
- the recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and R A, which can be single-stranded or double- stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides.
- the recombinant expression vectors can comprise naturally-occurring or non-naturally-occurring internucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or altered nucleotides or internucleotide linkages do not hinder the transcription or replication of the vector.
- the recombinant expression vector can be any suitable recombinant expression vector, and can be used to transform or transfecl any suitable host cell.
- Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
- the vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences, Glen Burnie, MD), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
- Bacteriophage vectors such as ⁇ , ⁇ 1 , ⁇ 3 ⁇ (Stratagene), EMBL4, and ⁇ 149, also can be used.
- plant expression vectors include pBIOl, pBI 101 .2, pBHOl .3, pB1121 and pBI 19 (Clontech).
- animal expression vectors include pEUK-Cl, pMAM, and pMAMneo (Clontech).
- the recombinant expression vector may be a viral vector, e.g., a retroviral vector or a lentiviral vector.
- a lentiviral vector is a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453- 1464 (2009).
- Other examples of lentivirus vectors that may be used in the clinic include, for example, and not by way of limitation, the LENTIVECTOR.RTM. gene delivery technology from Oxford BioMedica pic, the LENT1MAX.TM. vector system from Lentigen and the like. Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
- Transfection methods include calcium phosphate co-precipitation (see, e.g., Graham et al., supra), direct micro injection into cultured cells (see, e.g., Capecchi, Cell, 22: 479-488 (1980)), electroporation (see, e.g., Shigekawa et al., BioTechniques, 6: 742-751 (1988)), liposome mediated gene transfer (see, e.g., Mannino et al., BioTechniques, 6: 682-690 (1988)), lipid mediated transduction (see, e.g., Feigner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)), and nucleic acid delivery using high velocity microprojectiles (see, e.g., Klein et al, Nature, 327: 70-73 (1987)).
- the recombinant expression vectors can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra.
- Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell.
- Replication systems can be derived, e.g., from ColEl, 2 ⁇ plasmid, ⁇ , SV40, bovine papilloma virus, and the like.
- the recombinant expression vector may comprise regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host cell (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate, and taking into consideration whether the vector is DNA- or RNA-based.
- the recombinant expression vector may comprise restriction sites to facilitate cloning.
- the recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected host cells.
- Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like.
- Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
- the recombinant expression vector can comprise a native or nonnative promoter operably linked to the nucleotide sequence encoding the CAR (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the CAR.
- the selection of promoters e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan.
- the combining of a nucleotide sequence with a promoter is also within the skill of the artisan.
- the promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, or a promoter found in the long-terminal repeat of the murine stem cell virus.
- CMV cytomegalovirus
- the recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.
- the recombinant expression vectors can be made to include a suicide gene.
- suicide gene refers to a gene that causes the cell expressing the suicide gene to die.
- the suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent.
- agent e.g., a drug
- HSV Herpes Simplex Virus
- TK thymidine kinase
- An embodiment further provides a host cell comprising any of the recombinant expression vectors described herein.
- the term "host cell” refers to any type of cell that can contain the inventive recombinant expression vector.
- the host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa.
- the host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human.
- the host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension.
- Suitable host cells are known in the art and include, for instance, DH5a E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like.
- the host cell may be a prokaryotic cell, e.g., a DH5a cell.
- the host cell may be a mammalian cell.
- the host cell may be a human cell.
- the host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage, the host cell may be a peripheral blood lymphocyte (PBL) or a peripheral blood mononuclear cell (PBMC).
- PBL peripheral blood lymphocyte
- PBMC peripheral blood mononuclear cell
- the host cell may be a T cell.
- the T cell can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupTI, etc., or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from numerous sources, including but not limited to blood, bone marrow, lymph node, the thymus, or other tissues or fluids. T cells can also be enriched for or purified.
- the T cell may be a human T cell.
- the T cell may be a T cell isolated from a human.
- the T cell can be any type of T cell and can be of any developmental stage, including but not limited to, CD4+/CD8+ double positive T cells, CD4+ helper T cells, e.g., Th l and Th2 cells, CD8+ T cells (e.g., cytotoxic T cells), tumor infiltrating cells, memory T cells, memory stem cells, i.e. Tscm, naive T cells, and the like.
- the T cell may be a CD8+ T cell or a CD4+ T cell.
- the CARs as described herein can be used in suitable non-T cells.
- suitable non-T cells are those with an immune-effector function, such as, for example, NK cells, and T-like cells generated from pluripotent stem cells.
- a population of cells comprising at least one host cell described herein.
- the population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cell, a muscle cell, a brain cell, etc.
- a host cell e.g., a T cell
- a cell other than a T cell e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cell, a muscle cell, a brain cell, etc.
- the population of cells can be a substantially homogeneous population, in which the population comprises mainly host cells (e.g., consisting essentially of) comprising the recombinant expression vector.
- the population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector.
- the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
- CARs including functional portions and variants thereof
- nucleic acids can be isolated and/or purified.
- a purified (or isolated) host cell preparation is one in which the host cell is more pure than cells in their natural environment within the body. Such host cells may be produced, for example, by standard purification techniques.
- a preparation of a host cell is purified such that the host cell represents at least about 50%, for example at least about 70%, of the total cell content of the preparation.
- the purity can be at least about 50%, can be greater than about 60%, about 70% or about 80%, or can be about 100%.
- an embodiment provides a method of treating or preventing cancer in a mammal, comprising administering to the mammal the CARs, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies and/or the antigen binding portions thereof, and/or the pharmaceutical compositions in an amount effective to treat or prevent cancer in the mammal.
- An embodiment further comprises lymphodepleting the mammal prior to administering the CARs disclosed herein.
- lymphodepletion include, but may not be limited to, nonmyeloablative lymphodepleting chemotherapy, myeloablative lymphodepleting chemotherapy, total body irradiation, etc.
- the cells can be cells that are allogeneic or autologous to the mammal.
- the cells are autologous to the mammal.
- allogeneic means any material derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically.
- autologous means any material derived from the same individual to whom it is later to be re-introduced into the individual.
- the mammal referred to herein can be any mammal.
- the term "mammal” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits.
- the mammals may be from the order Carnivora, including Felines (cats) and Canines (dogs).
- the mammals may be from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses).
- the mammals may be of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes).
- the mammal is a human.
- the cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., meduloblastoma), breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, head and neck cancer (e.g., head and neck squamous cell carcinoma), Hodgkin lymphoma, hypopharynx cancer, kidney cancer, larynx cancer, leukemia,
- bladder cancer
- the treatment or prevention provided by the method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented.
- prevention can encompass delaying the onset of the disease, or a symptom or condition thereof.
- Another embodiment provides a method of detecting the presence of cancer in a mammal, comprising: (a) contacting a sample comprising one or more cells from the mammal with the CARs, the nucleic acids, the recombinant expression vectors, the host cells, the population of cells, the antibodies, and/or the antigen binding portions thereof, or the pharmaceutical compositions, thereby forming a complex, (b) and detecting the complex, wherein detection of the complex is indicative of the presence of cancer in the mammal.
- the sample may be obtained by any suitable method, e.g., biopsy or necropsy.
- a biopsy is the removal of tissue and/or cells from an individual. Such removal may be to collect tissue and/or cells from the individual in order to perform experimentation on the removed tissue and/or cells. This experimentation may include experiments to determine if the individual has and/or is suffering from a certain condition or disease-state.
- the condition or disease may be, e.g., cancer.
- the sample comprising cells of the mammal can be a sample comprising whole cells, lysates thereof, or a fraction of the whole cell lysates, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction.
- the cells can be any cells of the mammal, e.g., the cells of any organ or tissue, including blood cells or endothelial cells.
- the contacting can take place in vitro or in vivo with respect to the mammal.
- the contacting is in vitro.
- the CARs disclosed herein, polypeptides, proteins, nucleic acids, recombinant expression vectors, host cells, populations of cells, or antibodies, or antigen binding portions thereof, described herein can be labeled with a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles) as disclosed supra.
- a detectable label such as, for instance, a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and element particles (e.g., gold particles) as disclosed supra
- cytokines e.g., interferon- ⁇ , granulocyte/monocyte colony stimulating factor (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL-2)
- cytokines e.g., interferon- ⁇ , granulocyte/monocyte colony stimulating factor (GM-CSF), tumor necrosis factor a (TNF-a) or interleukin 2 (IL-2)
- GM-CSF granulocyte/monocyte colony stimulating factor
- TNF-a tumor necrosis factor a
- IL-2 interleukin 2
- Another embodiment provides for the use of the CARs, nucleic acids, recombinant expression vectors, host cells, populations of cells, antibodies, or antigen binding portions thereof, and/or pharmaceutical compositions of the invention, for the treatment or prevention of a proliferative disorder, e.g., cancer, in a mammal.
- a proliferative disorder e.g., cancer
- the cancer may be any of the cancers described herein.
- any method of administration can be used for the disclosed therapeutic agents, including local and systemic administration.
- topical, oral, intravascular such as intravenous, intramuscular, intraperitoneal, intranasal, intradermal, intrathecal and subcutaneous administration can be used.
- the particular mode of administration and the dosage regimen will be selected by the attending clinician, taking into account the particulars of the case (for example the subject, the disease, the disease state involved, and whether the treatment is prophylactic).
- one or more routes of administration may be used; for example, a chemotherapeutic agent may be administered orally and an antibody or antigen binding fragment or conjugate or composition may be administered intravenously.
- Methods of administration include injection for which the CAR, CAR T Cell, conjugates, antibodies, antigen binding fragments, or compositions are provided in a nontoxic pharmaceutically acceptable carrier such as water, saline, Ringer's solution, dextrose solution, 5% human serum albumin, fixed oils, ethyl oleate, or liposomes.
- a nontoxic pharmaceutically acceptable carrier such as water, saline, Ringer's solution, dextrose solution, 5% human serum albumin, fixed oils, ethyl oleate, or liposomes.
- local administration of the disclosed compounds can be used, for instance by applying the antibody or antigen binding fragment to a region of tissue from which a tumor has been removed, or a region suspected of being prone to tumor development.
- sustained intra-tumoral (or near-tumoral) release of the pharmaceutical preparation that includes a therapeutically effective amount of the antibody or antigen binding fragment may be beneficial.
- the conjugate is applied as an eye drop topically to the cornea, or intravitreally into the eye.
- the disclosed therapeutic agents can be formulated in unit dosage form suitable for individual administration of precise dosages.
- the disclosed therapeutic agents may be administered in a single dose or in a multiple dose schedule.
- a multiple dose schedule is one in which a primary course of treatment may be with more than one separate dose, for instance 1-10 doses, followed by other doses given at subsequent time intervals as needed to maintain or reinforce the action of the compositions.
- Treatment can involve daily or multi-daily doses of compound(s) over a period of a few days to months, or even years.
- the dosage regime will also, at least in part, be determined based on the particular needs of the subject to be treated and will be dependent upon the judgment of the administering practitioner.
- Typical dosages of the antibodies or conjugates can range from about 0.01 to about 30 mg/kg, such as from about 0.1 to about 10 mg/kg.
- the subject is administered a therapeutic composition that includes one or more of the conjugates, antibodies, compositions, CARs, CAR T cells or additional agents, on a multiple daily dosing schedule, such as at least two consecutive days, 10 consecutive days, and so forth, for example for a period of weeks, months, or years.
- the subject is administered the conjugates, antibodies, compositions or additional agents for a period of at least 30 days, such as at least 2 months, at least 4 months, at least 6 months, at least 12 months, at least 24 months, or at least 36 months.
- the disclosed methods include providing surgery, radiation therapy, and/or chemotherapeutics to the subject in combination with a disclosed antibody, antigen binding fragment, conjugate, CAR or T cell expressing a CAR (for example, sequentially, substantially simultaneously, or simultaneously).
- chemotherapeutics for example, sequentially, substantially simultaneously, or simultaneously.
- Methods and therapeutic dosages of such agents and treatments are known to those skilled in the art, and can be determined by a skilled clinician.
- Preparation and dosing schedules for the additional agent may be used according to manufacturer's instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service, (1992) Ed., M. C. Perry, Williams & Wilkins, Baltimore, Md.
- the combination therapy can include administration of a therapeutically effective amount of an additional cancer inhibitor to a subject.
- additional therapeutic agents that can be used with the combination therapy include microtubule binding agents, DNA intercalators or cross-linkers, DNA synthesis inhibitors, DNA and RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulators, and angiogenesis inhibitors. These agents (which are administered at a therapeutically effective amount) and treatments can be used alone or in combination.
- any suitable anti- cancer or anti-angiogenic agent can be administered in combination with the CARS, CAR- T cells, antibodies, antigen binding fragment, or conjugates disclosed herein. Methods and therapeutic dosages of such agents are known to those skilled in the art, and can be determined by a skilled clinician.
- Additional chemotherapeutic agents include, but are not limited to alkylating agents, such as nitrogen mustards (for example, chlorambucil, chlormethine, cyclophosphamide, ifosfamide, and melphalan), nitrosoureas (for example, carmustine, fotemustine, lomustine, and streptozocin), platinum compounds (for example, carboplatin, cisplatin, oxaliplatin, and BBR3464), busulfan, dacarbazine, mechlorethamine, procarbazine, temozolomide, thiotepa, and uramustine; antimetabolites, such as folic acid (for example, methotrexate, pemetrexed, and raltitrexed), purine (for example, cladribine, clofarabine, fludarabine, mercaptopurine, and tioguanine), pyrimidine (for example, capecitabine),
- the combination therapy may provide synergy and prove synergistic, that is, the effect achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately.
- a synergistic effect may be attained when the active ingredients are: (1 ) co-formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by some other regimen.
- a synergistic effect may be attained when the compounds are administered or delivered sequentially, for example by different injections in separate syringes.
- an effective dosage of each active ingredient is administered sequentially, i.e. serially, whereas in combination therapy, effective dosages of two or more active ingredients are administered together.
- an effective amount of an antibody or antigen binding fragment that specifically binds to one or more of the antigens disclosed herein or a conjugate thereof is administered to a subject having a tumor following anti-cancer treatment. After a sufficient amount of time has elapsed to allow for the administered antibody or antigen binding fragment or conjugate to form an immune complex with the antigen expressed on the respective cancer cell, the immune complex is detected. The presence (or absence) of the immune complex indicates the effectiveness of the treatment. For example, an increase in the immune complex compared to a control taken prior to the treatment indicates that the treatment is not effective, whereas a decrease in the immune complex compared to a control taken prior to the treatment indicates that the treatment is effective.
- compositions are provided herein for use in gene therapy, immunotherapy and/or cell therapy that include one or more of the disclosed CARs, or T cells expressing a CAR, antibodies, antigen binding fragments, conjugates, CARs, or T cells expressing a CAR that specifically bind to one or more antigens disclosed herein, in a carrier (such as a pharmaceutically acceptable carrier).
- a carrier such as a pharmaceutically acceptable carrier.
- the compositions can be prepared in unit dosage forms for administration to a subject. The amount and timing of administration are at the discretion of the treating clinician to achieve the desired outcome.
- the compositions can be formulated for systemic (such as intravenus) or local (such as intra-tumor) administration.
- a disclosed CARs, or T cells expressing a CAR, antibody, antigen binding fragment, conjugate is formulated for parenteral administration, such as intravenous administration.
- Compositions including a CAR, or T cell expressing a CAR, a conjugate, antibody or antigen binding fragment as disclosed herein are of use, for example, for the treatment and detection of a tumor, for example, and not by way of limitation, a neuroblastoma.
- the compositions are useful for the treatment or detection of a carcinoma.
- the compositions including a CAR, or T cell expressing a CAR, a conjugate, antibody or antigen binding fragment as disclosed herein are also of use, for example, for the detection of pathological angiogenesis.
- compositions for administration can include a solution of the CAR, or T cell expressing a CAR, conjugate, antibody or antigen binding fragment dissolved in a pharmaceutically acceptable carrier, such as an aqueous carrier.
- a pharmaceutically acceptable carrier such as an aqueous carrier.
- aqueous carriers can be used, for example, buffered saline and the like. These solutions are sterile and generally free of undesirable matter.
- These compositions may be sterilized by conventional, well known sterilization techniques.
- the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, adjuvant agents, and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like.
- concentration of a CAR, or T cell expressing a CAR, antibody or antigen binding fragment or conjugate in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the subject's needs. Actual methods of preparing such dosage forms for use in in gene therapy, immunotherapy and/or cell therapy are known, or will be apparent, to those skilled in the art.
- a typical composition for intravenous administration includes about 0.01 to about 30 mg/kg of antibody or antigen binding fragment or conjugate per subject per day (or the corresponding dose of a CAR, or T cell expressing a CAR, conjugate including the antibody or antigen binding fragment).
- Actual methods for preparing administrable compositions will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington's Pharmaceutical Science, 19th ed, Mack Publishing Company, Easton, PA (1995).
- a CAR, or T cell expressing a CAR, antibodies, antigen binding fragments, or conjugates may be provided in lyophilized form and rehydrated with sterile water before administration, although they are also provided in sterile solutions of known concentration.
- the CARs, or T cells expressing a CAR, antibody or antigen binding fragment or conjugate solution is then added to an infusion bag containing 0.9% sodium chloride, USP, and in some cases administered at a dosage of from 0.5 to 15 mg/kg of body weight.
- a CAR, or T cell expressing a CAR, antibodies, antigen binding fragments and conjugates thereof can be administered by slow infusion, rather than in an intravenous push or bolus.
- a higher loading dose is administered, with subsequent, maintenance doses being administered at a lower level.
- an initial loading dose of 4 mg/kg antibody or antigen binding fragment (or the corresponding dose of a conjugate including the antibody or antigen binding fragment) may be infused over a period of some 90 minutes, followed by weekly maintenance doses for 4-8 weeks of 2 mg/kg infused over a 30 minute period if the previous dose was well tolerated.
- Controlled release parenteral formulations can be made as implants, oily injections, or as particulate systems.
- Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles.
- Microcapsules contain the therapeutic protein, such as a cytotoxin or a drug, as a central core. In microspheres, the therapeutic is dispersed throughout the particle. Particles, microspheres, and microcapsules smaller than about 1 ⁇ are generally referred to as nanoparticles, nanospheres, and nanocapsules, respectively.
- Capillaries have a diameter of approximately 5 ⁇ so that only nanoparticles are administered intravenously. Microparticles are typically around 100 ⁇ in diameter and are administered subcutaneously or intramuscularly. See, for example, Kreuter, J., Colloidal Drug Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New York, NY, pp. 219- 342 (1994); and Tice & Tabibi, Treatise on Controlled Drug Delivery, A. Kydonieus, ed., Marcel Dekker, Inc. New York, NY, pp. 315-339, (1992).
- Polymers can be used for ion-controlled release of the CARs, or T cells expressing a CAR, antibody or antigen binding fragment or conjugate compositions disclosed herein.
- Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer, Accounts Chem. Res. 26:537-542, 1993).
- the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has been shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al., Pharm. Res.
- hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al, Int. J. Pharm. 1 12:215-224, 1994).
- liposomes are used for controlled release as well as drug targeting of the lipid-capsulated drug (Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, PA ( 1993)). Numerous additional systems for controlled delivery of therapeutic proteins are known (see U.S. Patent No. 5,055,303; U.S. Patent No. 5, 188,837; U.S.
- Patent No. 4,235,871 U.S. Patent No. 4,501 ,728; U.S. Patent No. 4,837,028; U.S. Patent No. 4,957,735; U.S. Patent No. 5,019,369; U.S. Patent No. 5,055,303; U.S. Patent No. 5,514,670; U.S. Patent No. 5,413,797; U.S. Patent No. 5,268, 164; U.S. Patent No. 5,004,697; U.S. Patent No. 4,902,505; U.S. Patent No. 5,506,206; U.S. Patent No. 5,271 ,961 ; U.S. Patent No. 5,254,342 and U.S. Patent No. 5,534,496).
- G. Kits G. Kits
- kits employing the CARs disclosed herein are also provided.
- kits for treating a tumor in a subject, or making a CAR T cell that expresses one or more of the CARs disclosed herein will typically include a disclosed antibody, antigen binding fragment, conjugate, nucleic acid molecule, CAR or T cell expressing a CAR as disclosed herein. More than one of the disclosed antibodies, antigen binding fragments, conjugates, nucleic acid molecules, CARs or T cells expressing a CAR can be included in the kit.
- the kit can include a container and a label or package insert on or associated with the container.
- Suitable containers include, for example, bottles, vials, syringes, etc.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container typically holds a composition including one or more of the disclosed antibodies, antigen binding fragments, conjugates, nucleic acid molecules, CARs or T cells expressing a CAR.
- the container may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- a label or package insert indicates that the composition is used for treating the particular condition.
- the label or package insert typically will further include instructions for use of a disclosed antibodies, antigen binding fragments, conjugates, nucleic acid molecules, CARs or T cells expressing a CAR, for example, in a method of treating or preventing a tumor or of making a CAR T cell.
- the package insert typically includes instructions customarily included in commercial packages of therapeutic products that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
- the instructional materials may be written, in an electronic form (such as a computer diskette or compact disk) or may be visual (such as video files).
- the kits may also include additional components to facilitate the particular application for which the kit is designed.
- the kit may additionally contain means of detecting a label (such as enzyme substrates for enzymatic labels, filter sets to detect fluorescent labels, appropriate secondary labels such as a secondary antibody, or the like).
- the kits may additionally include buffers and other reagents routinely used for the practice of a particular method. Such kits and appropriate contents are well known to those of skill in the art.
- Adoptive immunotherapy for cancer with genetically engineered autologous human T cells is currently being evaluated in numerous centers.
- One common approach to creating a cell population for adoptive immunotherapy is to isolate T cells by apheresis from the patient and to transduce these cells ex vivo with retroviral or lentiviral vectors that integrate into the host genome and express a chimeric antigen receptor (CAR), reviewed in [1 ].
- Chimeric antigen receptors are created by linking functional sequence domains from different subunits of immunologically active proteins.
- an scFv domain created from the VH and VL domains of an anti-CD 19 or anti-CD20 antibody can be linked to transmembrane sequences derived from CD28 or CD8, and then linked to the intracellular signaling domains derived from the CD3-zeta chain and CD28 or CD 137 [2, 3].
- the CAR thus confers both a binding domain derived from the scFv and the linked signaling domains in a single transmembrane protein that allows activation of a vector-transduced T cells.
- CAR-T This transduced T cell population
- IFNy interferon-gamma
- IL-2 interleukin-2
- TNFa tumor necrosis factor-alpha
- Tandem CD 19- and CD20-expressing malignancies include chronic lymphocytic leukemia (CLL), hairy cell leukemia (HCL), mantle cell lymphoma (MCL), prolymphocytic leukemia (PLL), and splenic lymphoma with villous lymphocytes (SLVL) [9].
- CLL chronic lymphocytic leukemia
- HCL hairy cell leukemia
- MCL mantle cell lymphoma
- PLL prolymphocytic leukemia
- SLVL splenic lymphoma with villous lymphocytes
- the increased effectiveness of a tandem-CAR construct is modeled by testing the expression of both target antigens on the CD19+CD20+ Raji cell line upon co-culture with a series of both single specificity and tandem-specific CAR-T constructs.
- a rapid CD 19 target antigen down modulation mechanism present is demonstrated in this leukemia cell line.
- target antigen down-modulation also included non-targeted B cell receptor molecules, including CD22, which is not targeted by any of the vector constructs.
- the more rapid loss in target cell number with our tandem targeting vector indicates the presence of stronger antileukemic immune pressure.
- the kinetics of the escape from immune pressure by the leukemia cell line indicates that antigenic modulation is a pre-existing property of the leukemia cell, as opposed to a mechanisms of target antigen modulation or loss that is dependent on selection for genetic escape mutants.
- the Burkitt lymphoma cell line Raji the acute lymphocytic leukemia cell lines REH and NALM-6 (ACC-128 DSMZ, Leibniz Institute DSMZ, Braunschwieg, Germany), as well as the chronic myelogenous leukemia line K562 were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS, Hyclone, Logan, UT) and 2mM L-Glutamax (Thermo Fisher Scientific, Grand Island, NY).
- the human embryonic kidney cell line 293T was propagated in Dulbecco's modified Eagle medium supplemented with 10% heat-inactivated FBS.
- Single-cell clones of luciferase-expressing cell lines were generated by stably transducing wild-type tumor lines with lentiviral vector encoding firefly luciferase (Lentigen Technology, Inc., Gaithersburg, MD), followed by cloning and selection of luciferase-positive clones.
- the mouse-adapted Raji-luc line was generated by engrafting a Raji clone stably expressing firefly luciferase into NSG mice (NOD.Cg-Prkdcscid I12rgtm l Wjl/SzJ), The Jackson Laboratory Sacramento, CA), isolating the engrafted Raji-luc tumor cells from mouse spleens by either positive (CD 19 microBeads, human, Miltenyi Biotec, Bergisch Gladbach, Germany) or negative selection (mouse cell depletion kit, Miltenyi Biotec), expanding in culture, and re-cloning to facilitate the selection of clones with high expression of firefly luciferase, as previously described for the NALM6 cell line [10].
- CAR antigen-binding domains scFv, sequences were derived from the mouse hybridoma FMC-63 for CD 19 (FMC-63 : AA 1 -267, GenBank ID: HM852952.1) and Leu- 16 for CD20 [15], entire sequence of VL and VH), as in Additional files section.
- CAR 19A, CAR19B and CAR20A were generated by linking scFv of each antibody in frame to CD8 hinge and transmembrane domains (AA 123-191 , Ref sequence ID NP_001759.3), 4- IBB (CD 137, AA 214-255, UniProt sequence ID Q0701 1) transactivation domain and CD3 zeta signaling domain (CD247, AA 52-163, Ref sequence ID: NP_000725.1.).
- Constructs 19A and 19B were identical, except for the flexible linker connecting the variable H and L chains of the scFv binding domain, employing the Whitlow linker in 19A [1 1] and a (GGGGS)3 (SEQ ID NO: 13) linker in 19B. Tandem targeting constructs, CAR 1920 and CAR2019, were generated in a similar manner.
- the scFv regions of 19A and 20A were linked in sequence by a flexible interchain linker (GGGGS)s (SEQ ID NO: 14), followed by CD8, 4-1BB and CD3 zeta domains.
- Leader sequence from human granulocyte macrophage colony stimulating factor receptor alpha subunit was included in all constructs, as described in [12].
- CAR constructs sequences were codon optimized (DNA2.0, Newark, CA) and cloned into a third generation lentiviral plasmid backbone (Lentigen Technology Inc., Gaithersburg, MD) under the regulation of a human EF- la promoter.
- Lentiviral vector (LV) containing supernatants were generated by transient transfection of HEK 293T cells, as previously described [13].
- Harvested pelleted lentiviral supernatants were stored at -80°C.
- Selected CD4+ and CD8+ human primary T cells from normal donors were cultivated in TexMACS medium (serum-free) supplemented with 40 IU/ml IL-2 at a density of 0.3 to 2 x 106 cells/ml, activated with CD3/CD28 MACS® GMP TransActTM reagent (Miltenyi Biotec) and transduced on day 3 with lentiviral vectors encoding CAR constructs in the presence of 10 ug/ml protamine sulfate (Sigma-Aldrich, St. Louis, MO) overnight, and media exchanged on day 4. On day 5, cultures were transferred to TexMACS medium supplemented with 200 IU/ml IL-2, and propagated until harvest on day 10-13.
- CTL assay To determine cell-mediated cytotoxicity (CTL assay), 5,000 target cells stably transduced with firefly luciferase were combined with CAR T cells at various effector to target ratios and incubated overnight. SteadyGlo reagent (Promega, Madison WI) was added to each well and the resulting luminescence was analyzed on an EnSpire plate reader (Perkin Elmer, Shelton, Connecticut) and recorded as counts per second (sample CPS). Target only wells (max CPS) and target only wells plus 1 % Tween-20 (min CPS) were used to determine assay range. Percent specific lysis was calculated as: (1 -(sample CPS-min CPS)/(max CPS-min CPS)).
- cytokine release assays effector and target cells were combined at ratio 10: 1 and incubated overnight.
- Harvested supernatants were analyzed for secreted cytokines using MACSplex human 12 cytokine bead array kit (Miltenyi Biotec) as per manufacturer's instructions. Strong induction of IFNy, ⁇ ' ⁇ , IL-2 and GM-CSF were detected in CAR T-treated groups.
- the following cytokines could not be detected: IL-4, IL-5, IL-6, IL- 12p70, IL- 17A, IL- 10, IFNa.
- IL-9 was detected in some samples at low levels and was not reported. All samples were in duplicate or triplicate. Unless otherwise noted, all data shown is representative of three or more independent experiments.
- CAR T cells Two million CAR T cells were washed twice in cold PBS (Lonza, Walkersville, MD), then lysed in 100 ul cold RIPA buffer (Sigma-Aldrich, St. Louis, MO) containing a protease and phosphatase inhibitor cocktail (Thermo-Fisher Scientific, Grand Island, NY). The lysate was incubated at 4°C for 20 minutes, pelleted at 13000 RPM in a table top centrifuge at 4°C for 10 min, and supernatants collected and frozen at -20°C.
- Samples were denatured at 70°C in reducing loading buffer (Invitrogen) for 10 minutes and resolved on 4%-12% gradient SDS-PAGE gel under reducing conditions in MOPS buffer (Thermo-Fisher Scientific, Grand Island, NY) according to manufacturer's protocol. Proteins were transferred to 0.45 micron nitrocellulose transfer membrane (BioRad, Hercules, CA) and probed with antibody against pan-CD3 zeta (Clone ab40804, Abeam, Cambridge, MA).
- CAR surface expression on transduced T cells was detected by staining with protein L- biotin conjugate (stock l mg/ml, 1 : 1000 dilution, GenScript, Piscataway, NJ) for 30 minutes at 4°C, followed by two washes and staining with streptavidin-PE conjugate for 30 minutes at 4°C (stock: 1.0 ml, 1 :200 dilution, Jackson ImmunoResearch Laboratories, West Grove, PA).
- Non- transduced cells and transduced cells stained with streptavidin-PE only were used as negative controls.
- Anti-CD4 antibody was employed to determine CD4 to CD8 ratio of CAR T positive population, and was added during the second incubation step. Dead cells were excluded by 7AAD staining (BD Biosciences, San Jose, CA). Cells were washed twice and resuspended in 200 ul Staining Buffer before quantitative analysis by flow cytometry.
- Target tumor lines and luciferase-positive sub clones were performed using CD19-FITC, CD20 VioBlue, and CD22-APC antibodies. Dead cells were excluded from analysis by 7AAD staining (BD Biosciences, San Jose, CA).
- the extracellular domain (amino acids 20-291 , Uniprot PI 5391 ) was fused to human IgGl Fc (CD19-Fc) and expressed by transduction in HEK293 cells in a CMV-driven mammalian expression vector.
- Transfected cells were cultured in DMEM, 5% FBS, and cell culture supernatant containing CD19-Fc harvested after ten and twenty days of incubation in HYPERFlask® cell culture vessels (Corning).
- CD19-Fc was purified by protein A chromatography (HiTrap MabSelect, GE Healthcare) and stored in PBS at 4 °C. Purity was > 97% as determined by SDS-PAGE and Coomassie Blue staining. Identity of CD19-Fc was confirmed by intact mass spectrometry and peptide mass fingerprint analyses after trypsin digestion (Miltenyi Biotec, Bergisch Gladbach, Germany).
- CAR T cells were administered to mice via tail vein injection on Day 7. Imaging was performed on days 4, 6, 1 1 , 14, 18, 25, 32, 46 following injection to establish the kinetics of tumor growth and eradication by CAR T cells.
- CAR T and Raji cells were combined in vitro at an effector to target ratio of 1 : 1 .
- surface expression of CD19, CD20 and C22 was determined by flow cytometry after overnight incubation and at day 4 of co-culture. Cultures were harvested, washed, and stained with antibodies specific for CD3-PE, CD19-FITC, CD20- VioBlue, CD22-APC (Miltenyi Biotec), and 7AAD.
- CD3-negative 7AAD-negative i.e. live Raji
- sequences encoding the antigen binding domains from the murine antibodies FMC63 and Leul 6 were linked with a (GGGGS)5 (SEQ ID NO: 14) sequence.
- the linking, transmembrane and signaling domains were identical, each encoding a human CD8-derived hinge and transmembrane domain, a CD137 signaling domain, and a CD3-zeta-derived signaling domain, as previously reported [12], Figure 1 A.
- the heavy and light chains of FMC63 were linked together into an scFv structure as originally published (GenBank ID HM852952.1, AA 130-148, known as the Whitlow linker) [1 1] while the heavy and light chains of Leul6 were linked by a (GGGGS)3 (SEQ ID NO: 13) sequence.
- Tandem-CARs were created by joining the FM 6 -derived and Leu l 6-derived heavy and light chain sequences in a single transcript with a multiple-GGGGS (SEQ ID NO: 15) sequence as well. Unlike their single specificity counterparts, the tandem-CARs can induce activation of the CAR-expressing T cells by encountering target cells that express either CD19 or CD20.
- both scFv binding domains were intact we also co- incubated CAR T cells with a CD19-Fc fusion protein or with biotinylated CD20-peptide (see Methods). In tandem-specific constructs, both domains retained the ability to bind target antigen.
- protein L staining gave 89% expression and CD19-Fc expression was 80%, and CD20-peptide expression was 85%.
- CD 19-Fc staining yielded 80%, and CD20 peptide 68%. This observation was reproduced in CAR T cells generated from three separate donors.
- the CAR T CD20/CD 19 binding ratio was calculated. This ratio was defined as the percentage of the tandem-CAR T cells positively stained with the CD20 soluble peptide, divided by the percentage of CAR T cells positively stained by the CD19-Fc peptide in the same sample.
- the mean CD20/CD 19 binding ratio for three separate donor T cell transductions was 0.74 ⁇ 0.06 for CAR1920, and 1 .05 ⁇ 0.02 for CAR 2019 ( Figure 2B).
- the CD20 binding in the CAR 1920 construct may be partially sterically hindered.
- tandem-CAR constructs Given the ability to create LV that express tandem-CARs, and now having demonstrated the expression of full-length CAR proteins on the T cell surface that express two functional scFv, the anti-leukemic activity ot tandem-CAR constructs were then evaluated in in vitro assays.
- Human primary T cells were transduced with LV encoding CAR constructs (19A, 19B, 20A, 1920, 2019, see Methods), then incubated for 18 hours with the Raji, NALM-6, REH, K562 or 293T cell lines, stably transduced with firefly luciferase, for luminescence based in vitro killing assays. All leukemia lines tested express CD19 on their surface, while the negative controls, K562 and 293T do not. CD20 expression varied between tumor lines. The Raji line is CD20 positive, while REH are CD20 negative, as are the control lines K562 and 293T. NALM-6 line has a weak but detectable expression of CD20. As additional controls, 562 lines were created that express CD 19 (K562-19+), or CD20 (K562-20+).
- K562-19+ were lysed by the CAR 19A and 19B constructs, tandem-CAR constructs 1920 and 2019, but not the single 20A CAR, Figure 3A.
- K562-CD20+ were lysed by all CART constructs except for the single CAR19 constructs, demonstrating target antigen-restricted killing. Similar results were seen with the other leukemia cell lines tested.
- the 20A single targeting CAR construct had no specific killing activity against the CD20-negative REH line, but did demonstrate killing of NALM-6, which has low but detectable levels of CD20 surface expression.
- tandem-CAR 1920 which appeared to show lower binding to CD20 peptide than to CD19-Fc by flow cytometry, also has lower cytotoxicity against K562- 19+ and K562-20+, but not against the CD 19+ CD20- REH. This may suggest that the 1920 tandem-CAR is inferior to 2019 tandem-CAR for some tumor targets.
- cytokine secretion by tumor-activated CAR T cells was then examined.
- Co-culture media supernatants were harvested following overnight incubation of CAR-T effectors and the Raji cell line at ratio of 10: 1 , and analyzed by MACSPlex cytokine-specific bead array which allows simultaneous detection of 12 different cytokines, Figure 4.
- All CAR T constructs yielded increases in cytokine levels for IFN gamma, TNF alpha, IL-2 and GM-CSF when co-cultured with Raji cells, in comparison to non-transduced T cells, whereas cytokine levels in the negative control groups N.T. and GFP were undetectable.
- the 20A CAR was consistently the highest producer of IL-2, IFN gamma, TNF alpha, and GM-CSF. This was not due to a preferential expansion of the CD4+ T cell population, as the small changes seen, either up or down, in the CD4/CD8 ratio were not consistent, Supplementary Table 1 infra.
- CD4/CD8 ratio in CAR T cell preparations from three separate donors was determined by flow cytometry.
- the CD4 + and CD8 + T cells were co- purified from buffy coats, cells were activated with TransAct CD3 CD28 reagent in the presence of IL-2, transduced with LV as described in Materials and Methods, and assayed for CD4/CD8 composition on culture day 10, when immune function was assayed.
- the ratio of CD4/CD8 cells for each of the three donors is noted in columns, and CAR T groups noted in rows.
- CAR 19B in which ScFv heavy and light chains were connected by a Gly-Ser linker, performed better than CAR 19A with a Whitlow linker, Figure 5B.
- CAR 1920 and CAR 201 tandem-CAR constructs demonstrated in vivo activity superior of that of single CAR 19 in this model system.
- this data highlights that cytotoxicity, cytokine production, and in vivo activity in an NSG mouse system are each important, but the data must be interpreted together in order to understand the biology of a transduced T cell population.
- CD20 is less able to be lost from cells surviving immune pressure.
- the tandem construct 2019 generated more CD 19 epitope loss, but appeared to exert similar combined pressure on the other targeted antigen, CD20, and the non-targeted antigen CD22.
- the tandem-CAR2019 achieved strong reduction in tumor burden, in the absence of mortality, whereas the combination treatments 19A+20A and 19B+20A were effective but highly toxic, with only two out of six mice surviving to day 25 in each group.
- the tumor burden remained relatively high and only five out of six mice in each group survived to day 25.
- the tumors were cleared efficiently, but only two mice out off six survived.
- the study highlighted the toxicity of CAR administration, which was greatest in the single 20A group or when 20A was combined with 19A or 19B CAR T cells.
- the standard animal model did not reveal a clear advantage or establish a preferred order of the CD19 and CD20 scFv within the CAR structure itself. Nevertheless, the 2019 CAR construct showed better binding of the CD20-peptide staining reagent by flow cytometry, and improved killing of some tumor cells lines in vitro, Figures 2A, 2B, 3A, and 3B. Furthermore, analysis of immune pressure in overnight and 4-day co-culture experiments indicated that the 2019 CAR may exert stronger immune pressure on the target leukemia cell lines, Figures 6A-6C and 8A-8C.
- Protein L and recombinant CD20 peptide gave very similar results for the Leu l 6-based anti-CD20 CAR (construct 20A).
- Protein L staining was equivalently strong.
- the anti- CD ⁇ scFv binding of target peptide was essentially equivalent in tandem and single CARs, but signal for CD20-biotin-based staining was diminished in construct 1920, in comparison to 2019 ( Figure 2B), which may indicate steric hindrance for binding to CD20 in this construct.
- Figure 2B Figure 2B
- tandem-CAR activity In vitro cytokine release activity also demonstrated tandem-CAR activity, Figure 4.
- the CD20-specifc CAR 20A was superior to tandem and single CD 19 CAR constructs in the production of Th-1 like cytokines: IFN-gamma, IL-2, and TNF-alpha, and GM-CSF. Both tandem-CARs were similar in cytokine production and were greater than the single 19A and 19B constructs.
- the level of cytokine produced by the tandem-CAR constructs 1920 and 2019 may be primarily driven by CD20 recognition, and reflect another tandem-CAR advantage, namely that optimal features from each binder were preserved for better potential therapeutic effect.
- In vivo CAR 19B performed better than CAR 19A, Figures 5A and 5B.
- CAR-mediated immune pressure was then tested. To this end, it was found that although effector to target ratios of 5: 1 and above effectively eliminated leukemia cells in CTL assays, when the lower effector to target ratio of 1 : 1 was used, we could still harvest the surviving leukemia cells and analyze their surface antigen expression. Flow cytometry allowed the operator to gate for viable cells, exclude T cells, and quantify antigen expression, Figure 6A, 6B. After overnight incubation with the 19A and 19B CARs, strong down-modulation of CD 19 was seen. The tandem-CARs induced less antigenic loss, but there were far fewer cell remaining. CD20 expression was modulated less.
- CD 19 expression remained strongly down-modulated, especially with the CD 19 single specificity vectors.
- the 20A CAR immune pressure, both overnight and at day 4 showed a lesser ability to select for escape mutants, indicating perhaps a lesser ability for Raji cells to dispense with or alter its expression.
- Tumor antigen escape is one of the major challenges facing the field of adoptive cell therapy today. Despite significant progress achieved in the treatment of relapsed or refractory ALL using CAR19, tumor escape by downregulating the CD 19 epitope on tumor cells has been reported [5, 18, 19], and is responsible for a significant portion of disease relapse. It has become clear that combinatorial approaches will be necessary to overcome tumor escape in hematologic malignancies, especially in disease types that are more challenging to treat than pediatric pre-B- ALL, such as NHL, reviewed in [20].
- heterogeneous target antigen expression may lead to tumor escape variants when a single CAR T therapy is used. Therefore, targeting multiple tumor antigens with a single CAR T therapeutic product may mitigate tumor antigen escape.
- CD 19 loss occurs in primary disease as well as leukemia and lymphoma cell lines under CAR19 pressure by a variety of mechanisms, including both mutations and expansion of CD19-negative variants, as well as alternative splicing that yields the exon 2-deficient CD 19 variant.
- Recent studies have shown that after prolonged CAR-T immune pressure on CD 19 antigens, tumors may also escape detection by reverting to a CD19-negative myeloid phenotype [22, 23].
- CD 19 downregulation on Raji leukemia in the presence of CD 19 CAR constructs 19A and 19B was rapid, with a significant loss of detected CD19 expression occurring after just an overnight co- culture with CAR T.
- CD 19 expression was restored completely within 4 days after the CAR T cells were removed from culture. Given the rapidity of the change being measured, and considering that Raji cells replicate approximately once every 20 hours, CD 19 downregulation by an actual CD 19 loss mutation and the preferential expansion of CD19-negative lymphoma clones in our model is unlikely. Furthermore, it was determined that in the presence of the single CAR19 constructs 19A and 19B, the amount of full length CD19 protein in Raji whole cell lysates is reduced, in concordance with the diminished CD19 staining as probed by flow cytometry, whereas the amount of exon 2 spliced CD 19 remains relatively stable regardless of the type of CAR T used. Therefore, the alternative splicing of CD19 exon 2 is not modified by CAR- mediated downregulation of full-length CD 19.
- CD 19 is a B cell co-receptor, and it acts a positive regulator of maturation, proliferation and survival in early and late B cell development [24, 25].
- CD 19 is internalized together with the B cell receptor following its engagement by ligand.
- CD 19 can be internalized following binding by specific antibody, a fact that is being exploited in antibody-conjugate (ADC) therapy.
- ADC antibody-conjugate
- Internalization of CD20 from the surface of B cells is also known to occur following the use of the therapeutic antibody rituximab [26].
- CAR 19 pressure would cause CD19 internalization as well.
- the mere internalization of CD 19 could not explain the fact that the level of full-length CD 19 protein is diminished following 19A and 19B treatment, as shown by Western blot.
- CD 19 protein downregulation must occur at the transcriptional or translational level, or by increased degradation of the CD19 protein upon CAR- driven internalization. This effect is very dynamic, and is reversed soon after the CAR19 pressure in removed.
- CD 19 reduces B cell activation thresholds by promoting B cell receptor-antigen micro cluster formation, and initiating several downstream signaling pathways [27].
- CD 19 is typically thought of as a promoter of lymphomagenesis, and has been shown to drive B cell proliferation via a positive feedback loop with MYC oncoprotein [28, 29].
- CD19 is downregulated on some types of B cell leukemias, including CLL, B-PLL, SLVL, and MCL [9]. It is therefore possible that in some instances, such as when selective pressure is applied by CD19-targeted CART cells, CD19 loss may confer a tumor growth advantage.
- the plasticity of CD 19 evidenced in leukemic cells may be a characteristic preserved from normal B cell biology, now providing an additional survival advantage to the malignancy.
- AA- amino acids 7AAD- seven-actinomycin D, AF - alexa fluor, ALL - acute lymphoblastic leukemia, ANOVA - analysis of variance, APC- allophycocyanin, CAR T - chimeric antigen receptor T cells, CD- cluster of differentiation , CLL- chronic lymphocytic leukemia, CPS - counts per second, CTL - cytotoxic T lymphocyte, ELISA - enzyme linked immunosorbent assay, FBS - fetal bovine serum, Fc - fragment crystallizable region, FITC - fluorescein isothiocyanate, GFP-green fluorescent protein, GM-CSF-granulocyte macrophage colony stimulating factor, GMP - good manufacturing practice, HCL - hairy cell leukemia, HEK - human embryonic kidney cells, Her2 - human epidermal growth factor receptor two, IFNy- interferon gamma, IL-2 - interleukin two, IU- international
- T cells control from same donor, OBI - Oklahoma Blood Institute, PE- Phycoerythrin, PLL - prolymphocytic leukemia, ROR1- Receptor tyrosine kinase-like orphan receptor 1 , RPM - revolutions per minute, scFv - single chain variable fragment, SDS-PAGE - sodium dodecyl sulfate polyacrylamide gel electrophoresis, SLVL - splenic lymphoma with villous lymphocytes, T.A.- tumor alone control group, TNFa - tumor necrosis factor alpha, VH - variable heavy chain domain, VL - variable light chain domain.
- CD20 is a molecular target for scFvFc: zeta receptor redirected T cells: implications for cellular immunotherapy of CD20+ malignancy. Biology of Blood and Marrow Transplantation, 1998. 4(2): p. 75-83.
- TanCAR a novel bispecific chimeric antigen receptor for cancer immunotherapy. Molecular Therapy— Nucleic Acids, 2013. 2(7): p. e! 05.
- CD 19 chimeric antigen receptor (CD19 CAR)- redirected adoptive T-cell immunotherapy for the treatment of relapsed or refractory B-cell Non- Hodgkin's Lymphomas CD 19 chimeric antigen receptor (CD19 CAR)- redirected adoptive T-cell immunotherapy for the treatment of relapsed or refractory B-cell Non- Hodgkin's Lymphomas.
- CD19 CAR CD 19 chimeric antigen receptor
- CD 19 function in early and late B cell development. II. CD19 facilitates the pro-B/pre-B transition. The Journal of Immunology, 2003. 171 (1 1 ): p. 5921- 5930.
- CD19 is a major B cell receptor-independent activator of MYC- driven B-lymphomagenesis. The Journal of clinical investigation, 2012. 122(6): p. 2257-2266.
- nucleic and amino acid sequences listed below are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1 .822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
- SEQ ID NO: 1 nucleotide sequence of Leader-CD 19 VL- Whitlow linker CD 19 VH (GGGGS)-5 CD20 VH (GGGGS)-3 CD20 VL CD8 hinge+TM-4-l BB- CD3z (Construct CAR 1920)
- SEQ ID NO: 3 nucleotide sequence of Leader-CD20 VH (GGGGS)3 - CD20 VL - (GGGGS)5 -CD 19 VL- Whitlow linker- CD19 VH CD8 hinge+TM-4-l BB- CD3z (Construct 2019)
- SEQ ID NO: 7 nucleotide sequence of CD19 LTG1538 (CAR 19B) DNA
- SEQ ID NO: 11 nucleotide sequence of leader/signal peptide sequence (LP) atgctgctgctggtgaccagcctgctgctgtgcgaactgccgcatccggcgtttctgctgattccg
- SEQ ID NO: 37 nucleotide sequence of DNA CD8 hinge domain
- SEQ ID NO: 40 nucleotide sequence of DNA signaling domain of 4- IBB aagaggggccggaagaagctgctttacatcttcaagcagccgttcatgcggcccgtgcag
- SEQ ID NO: 44 nucleotide sequence of ScFv CD 19 (FMC63)
- SEQ ID NO: 46 nucleotide sequence of anti-CD33 CAR (LTG1936)
- EIGM GERRRG GHDGLYQGLSTATKDTYDALHMQALPP SEQ ID NO: 48 nucleotide sequence of anti-mesothelin CAR (LTG1904)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Cell Biology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Hematology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Virology (AREA)
- Engineering & Computer Science (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201880063737.4A CN111183156A (zh) | 2017-07-31 | 2018-07-31 | 用于用抗cd19/cd20免疫治疗来治疗癌症的组合物和方法 |
| EP18779075.3A EP3661964A1 (en) | 2017-07-31 | 2018-07-31 | Compositions and methods for treating cancer with anti-cd19/cd20 immunotherapy |
| JP2020505240A JP7237926B2 (ja) | 2017-07-31 | 2018-07-31 | 抗cd19/cd20免疫療法によりがんを処置するための組成物および方法 |
| AU2018309735A AU2018309735B2 (en) | 2017-07-31 | 2018-07-31 | Compositions and methods for treating cancer with anti-CD19/CD20 immunotherapy |
| CA3071624A CA3071624A1 (en) | 2017-07-31 | 2018-07-31 | Compositions and methods for treating cancer with anti-cd19/cd20 immunotherapy |
| JP2023030980A JP7574348B2 (ja) | 2017-07-31 | 2023-03-01 | 抗cd19/cd20免疫療法によりがんを処置するための組成物および方法 |
| JP2024180515A JP7838050B2 (ja) | 2017-07-31 | 2024-10-16 | 抗cd19/cd20免疫療法によりがんを処置するための組成物および方法 |
| AU2025204005A AU2025204005A1 (en) | 2017-07-31 | 2025-05-29 | Compositions and methods for treating cancer with anti-CD19/CD20 immunotherapy |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762539483P | 2017-07-31 | 2017-07-31 | |
| US62/539,483 | 2017-07-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019028051A1 true WO2019028051A1 (en) | 2019-02-07 |
Family
ID=63686059
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/044654 Ceased WO2019028051A1 (en) | 2017-07-31 | 2018-07-31 | COMPOSITIONS AND METHODS FOR TREATING CANCER BY ANTI-CD19 / CD20 IMMUNOTHERAPY |
Country Status (7)
| Country | Link |
|---|---|
| US (3) | US10442867B2 (https=) |
| EP (1) | EP3661964A1 (https=) |
| JP (3) | JP7237926B2 (https=) |
| CN (1) | CN111183156A (https=) |
| AU (2) | AU2018309735B2 (https=) |
| CA (1) | CA3071624A1 (https=) |
| WO (1) | WO2019028051A1 (https=) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110981971A (zh) * | 2019-12-25 | 2020-04-10 | 华夏源(上海)细胞基因工程股份有限公司 | 一种靶向cd19和cd20的双靶点嵌合抗原受体及其表达载体和应用 |
| WO2021046653A1 (en) * | 2019-09-13 | 2021-03-18 | Centre For Drug Research And Development | Anti-oncolytic virus antigen antibodies and methods of using same |
| CN113549155A (zh) * | 2020-04-23 | 2021-10-26 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | 同时靶向cd19和cd20的嵌合抗原受体及其应用 |
| JP2022524507A (ja) * | 2019-03-06 | 2022-05-06 | レンティジェン・テクノロジー・インコーポレイテッド | 自己駆動型キメラ抗原受容体を用いてがんを処置するための組成物および方法 |
| JP2023502190A (ja) * | 2019-12-17 | 2023-01-23 | 合源生物科技(天津)有限公司 | Cd19標的キメラ抗原受容体およびその使用 |
| JP2023514232A (ja) * | 2020-02-14 | 2023-04-05 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Cd2活性化を伴うキメラ抗原受容体 |
| WO2024182516A1 (en) | 2023-02-28 | 2024-09-06 | Juno Therapeutics, Inc. | Cell therapy for treating systemic autoimmune diseases |
| WO2024173607A3 (en) * | 2023-02-14 | 2024-11-07 | Evolveimmune Therapeutics, Inc. | Combination of bispecific antibodies and chimeric antigen receptor t cells for treatment |
| WO2025006895A1 (en) * | 2023-06-28 | 2025-01-02 | Saliogen Therapeutics Inc. | Nucleic acid constructs and engineered cells for allogeneic therapies |
| US12258381B2 (en) | 2018-02-09 | 2025-03-25 | National University Of Singapore | Activating chimeric receptors and uses thereof in natural killer cell immunotherapy |
| US12398187B2 (en) | 2019-03-05 | 2025-08-26 | Nkarta, Inc. | CD19-directed chimeric antigen receptors and uses thereof in immunotherapy |
| US12441787B2 (en) | 2018-04-02 | 2025-10-14 | National University Of Singapore | Neutralization of human cytokines with membrane-bound anti-cytokine non-signaling binders expressed in immune cells |
| US12448432B2 (en) | 2020-03-17 | 2025-10-21 | AbelZeta Inc. | Combined chimeric antigen receptor targeting CD19 and CD20 and application thereof |
| WO2025231185A1 (en) | 2024-05-01 | 2025-11-06 | Legend Biotech Ireland Limited | Viral glycoprotein variants and uses thereof |
| WO2026050426A2 (en) | 2024-08-28 | 2026-03-05 | Juno Therapeutics, Inc. | Cd19-directed chimeric antigen receptor cell therapy for treating autoimmune and neurological diseases |
| US12583903B2 (en) | 2017-02-08 | 2026-03-24 | AbelZeta Inc. | Construction of chimeric antigen receptor targeting CD20 antigen and activity identification of engineered T cells thereof |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3234120B1 (en) | 2014-12-15 | 2025-09-03 | The Regents of the University of California | Cytotoxic molecules responsive to intracellular ligands for selective t cell mediated killing |
| EP4400516A1 (en) | 2014-12-15 | 2024-07-17 | The Regents of the University of California | Bispecific or-gate chimeric antigen receptor responsive to cd19 and cd20 |
| DK3368571T5 (da) | 2015-10-30 | 2024-09-30 | Univ California | Transformerende, vækstfaktor-beta-responsive polypeptider og fremgangsmåder til anvendelse deraf |
| US10442867B2 (en) * | 2017-07-31 | 2019-10-15 | Lentigen Technology, Inc. | Compositions and methods for treating cancer with anti-CD19/CD20 immunotherapy |
| CN109423495A (zh) * | 2017-08-24 | 2019-03-05 | 上海恒润达生生物科技有限公司 | 一种双靶向嵌合抗原受体及其用途 |
| EP3829312A4 (en) * | 2018-08-04 | 2022-07-06 | Abcyte Therapeutics Inc. | MULTIFUNCTIONAL AND MULTI-TARGETING CAR SYSTEM AND METHODS OF USE |
| KR102840400B1 (ko) | 2018-12-12 | 2025-08-04 | 카이트 파마 인코포레이티드 | 키메라 항원 수용체 및 car-t 세포 및 사용 방법 |
| CN109929807A (zh) * | 2018-12-28 | 2019-06-25 | 青岛麦迪赛斯生物科技有限公司 | 一种靶向血液肿瘤的双嵌合抗原受体修饰的t淋巴细胞 |
| US20220133791A1 (en) * | 2019-01-23 | 2022-05-05 | Miltenyi Biotec B.V. & Co. KG | A Combination of compositions for elimination and enhanced engraftment of hematopoietic stem cells in the bone marrow of a subject |
| CN111825769B (zh) * | 2019-04-16 | 2022-03-25 | 上海科技大学 | 一种泛素化缺失的嵌合抗原受体及其用途 |
| MX2021015967A (es) * | 2019-06-27 | 2022-04-06 | Eutilex Co Ltd | Receptor de antigeno quimerico con dominio coestimulador 4-1bb. |
| CN112390891B (zh) * | 2019-08-14 | 2022-06-03 | 苏州方德门达新药开发有限公司 | 嵌合抗原受体及其构建方法和应用 |
| WO2021262723A1 (en) * | 2020-06-22 | 2021-12-30 | Lentigen Technology, Inc. | Compositions and methods for treating cancer with tslpr-cd19 or tslpr-cd22 immunotherapy |
| WO2022011065A1 (en) * | 2020-07-07 | 2022-01-13 | The Nemours Foundation | Tumor-activated alloreactive and xenoreactive t cells and their use in immunotherapy against cancer |
| KR102393776B1 (ko) * | 2020-12-30 | 2022-05-04 | (주)이노베이션바이오 | Cd22에 특이적인 인간화 항체 및 이를 이용한 키메라 항원 수용체 |
| CA3209218A1 (en) * | 2021-01-27 | 2022-08-04 | H. Lee Moffitt Cancer Center And Research Institute Inc. | Bi-specific car t cells for b cell malignancies |
| EP4384549A1 (en) * | 2021-08-12 | 2024-06-19 | Cellogen Therapeutics Pvt. Ltd. | Chimeric antigen receptors (car) for b cell malignancies |
| TW202334400A (zh) | 2021-12-30 | 2023-09-01 | 美商Tr1X股份有限公司 | 表現il-10及嵌合抗原受體之cd4+ t細胞及其用途 |
| WO2024192134A1 (en) * | 2023-03-13 | 2024-09-19 | Immpact Bio Usa, Inc. | Bispecific cars for the treatment of lupus and autoimmune diseases |
| CA3278900A1 (en) | 2023-03-31 | 2024-10-03 | AbelZeta Inc. | BISPECIFIC CHIMERIC ANTIGENIC RECEPTORS TARGETING CD20 AND BCMA |
| CN119522238A (zh) * | 2023-05-19 | 2025-02-25 | 恺兴生命科技(上海)有限公司 | 免疫效应细胞及其应用 |
| WO2025059162A1 (en) | 2023-09-11 | 2025-03-20 | Dana-Farber Cancer Institute, Inc. | Car-engager containing il-2 variants to enhance the functionality of car t cells |
| WO2025076127A1 (en) | 2023-10-05 | 2025-04-10 | Capstan Therapeutics, Inc. | Constrained ionizable cationic lipids and lipid nanoparticles |
| WO2025076113A1 (en) | 2023-10-05 | 2025-04-10 | Capstan Therapeutics, Inc. | Ionizable cationic lipids with conserved spacing and lipid nanoparticles |
| WO2025217454A2 (en) | 2024-04-11 | 2025-10-16 | Capstan Therapeutics, Inc. | Ionizable cationic lipids and lipid nanoparticles |
| WO2025217452A1 (en) | 2024-04-11 | 2025-10-16 | Capstan Therapeutics, Inc. | Constrained ionizable cationic lipids and lipid nanoparticles |
| WO2025246739A1 (zh) * | 2024-05-29 | 2025-12-04 | 深圳豪石生物科技有限公司 | 人源化cd20抗体及其相关产品和应用 |
| CN120248134B (zh) * | 2025-03-31 | 2025-12-23 | 深圳大学总医院 | 一种CD19 CD20 CAR/TRuC-T细胞及其相关产品和应用 |
| WO2026015450A1 (en) | 2024-07-06 | 2026-01-15 | Tr1X, Inc. | Cd4+ t cells expressing il-10 and chimeric antigen receptors and uses thereof |
Citations (81)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3060165A (en) | 1962-10-23 | Preparation of toxic ricin | ||
| US3896111A (en) | 1973-02-20 | 1975-07-22 | Research Corp | Ansa macrolides |
| US4137230A (en) | 1977-11-14 | 1979-01-30 | Takeda Chemical Industries, Ltd. | Method for the production of maytansinoids |
| US4151042A (en) | 1977-03-31 | 1979-04-24 | Takeda Chemical Industries, Ltd. | Method for producing maytansinol and its derivatives |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4248870A (en) | 1978-10-27 | 1981-02-03 | Takeda Chemical Industries, Ltd. | Maytansinoids and use |
| US4256746A (en) | 1978-11-14 | 1981-03-17 | Takeda Chemical Industries | Dechloromaytansinoids, their pharmaceutical compositions and method of use |
| US4260608A (en) | 1978-11-14 | 1981-04-07 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and methods of use thereof |
| US4265814A (en) | 1978-03-24 | 1981-05-05 | Takeda Chemical Industries | Matansinol 3-n-hexadecanoate |
| US4294757A (en) | 1979-01-31 | 1981-10-13 | Takeda Chemical Industries, Ltd | 20-O-Acylmaytansinoids |
| US4307016A (en) | 1978-03-24 | 1981-12-22 | Takeda Chemical Industries, Ltd. | Demethyl maytansinoids |
| US4308268A (en) | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4308269A (en) | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4309428A (en) | 1979-07-30 | 1982-01-05 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4313946A (en) | 1981-01-27 | 1982-02-02 | The United States Of America As Represented By The Secretary Of Agriculture | Chemotherapeutically active maytansinoids from Trewia nudiflora |
| US4315929A (en) | 1981-01-27 | 1982-02-16 | The United States Of America As Represented By The Secretary Of Agriculture | Method of controlling the European corn borer with trewiasine |
| US4317821A (en) | 1979-06-08 | 1982-03-02 | Takeda Chemical Industries, Ltd. | Maytansinoids, their use and pharmaceutical compositions thereof |
| US4322348A (en) | 1979-06-05 | 1982-03-30 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4331598A (en) | 1979-09-19 | 1982-05-25 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4362663A (en) | 1979-09-21 | 1982-12-07 | Takeda Chemical Industries, Ltd. | Maytansinoid compound |
| US4364866A (en) | 1979-09-21 | 1982-12-21 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4371533A (en) | 1980-10-08 | 1983-02-01 | Takeda Chemical Industries, Ltd. | 4,5-Deoxymaytansinoids, their use and pharmaceutical compositions thereof |
| US4424219A (en) | 1981-05-20 | 1984-01-03 | Takeda Chemical Industries, Ltd. | 9-Thiomaytansinoids and their pharmaceutical compositions and use |
| US4450254A (en) | 1980-11-03 | 1984-05-22 | Standard Oil Company | Impact improvement of high nitrile resins |
| US4486414A (en) | 1983-03-21 | 1984-12-04 | Arizona Board Of Reagents | Dolastatins A and B cell growth inhibitory substances |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4689401A (en) | 1986-03-06 | 1987-08-25 | Cetus Corporation | Method of recovering microbially produced recombinant ricin toxin a chain |
| US4816444A (en) | 1987-07-10 | 1989-03-28 | Arizona Board Of Regents, Arizona State University | Cell growth inhibitory substance |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US4879278A (en) | 1989-05-16 | 1989-11-07 | Arizona Board Of Regents | Isolation and structural elucidation of the cytostatic linear depsipeptide dolastatin 15 |
| US4880935A (en) | 1986-07-11 | 1989-11-14 | Icrf (Patents) Limited | Heterobifunctional linking agents derived from N-succinimido-dithio-alpha methyl-methylene-benzoates |
| US4902505A (en) | 1986-07-30 | 1990-02-20 | Alkermes | Chimeric peptides for neuropeptide delivery through the blood-brain barrier |
| US4957735A (en) | 1984-06-12 | 1990-09-18 | The University Of Tennessee Research Corporation | Target-sensitive immunoliposomes- preparation and characterization |
| US4978744A (en) | 1989-01-27 | 1990-12-18 | Arizona Board Of Regents | Synthesis of dolastatin 10 |
| US4986988A (en) | 1989-05-18 | 1991-01-22 | Arizona Board Of Regents | Isolation and structural elucidation of the cytostatic linear depsipeptides dolastatin 13 and dehydrodolastatin 13 |
| US5004697A (en) | 1987-08-17 | 1991-04-02 | Univ. Of Ca | Cationized antibodies for delivery through the blood-brain barrier |
| US5019369A (en) | 1984-10-22 | 1991-05-28 | Vestar, Inc. | Method of targeting tumors in humans |
| US5055303A (en) | 1989-01-31 | 1991-10-08 | Kv Pharmaceutical Company | Solid controlled release bioadherent emulsions |
| US5076973A (en) | 1988-10-24 | 1991-12-31 | Arizona Board Of Regents | Synthesis of dolastatin 3 |
| US5079163A (en) | 1985-03-29 | 1992-01-07 | Cetus Corporation | Recombinant ricin toxin fragments |
| US5122368A (en) | 1988-02-11 | 1992-06-16 | Bristol-Myers Squibb Company | Anthracycline conjugates having a novel linker and methods for their production |
| US5138036A (en) | 1989-11-13 | 1992-08-11 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Isolation and structural elucidation of the cytostatic cyclodepsipeptide dolastatin 14 |
| US5188837A (en) | 1989-11-13 | 1993-02-23 | Nova Pharmaceutical Corporation | Lipsopheres for controlled delivery of substances |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5208021A (en) | 1987-10-05 | 1993-05-04 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of preparing diphtheria immunotoxins |
| US5254342A (en) | 1991-09-30 | 1993-10-19 | University Of Southern California | Compositions and methods for enhanced transepithelial and transendothelial transport or active agents |
| US5268164A (en) | 1990-04-23 | 1993-12-07 | Alkermes, Inc. | Increasing blood-brain barrier permeability with permeabilizer peptides |
| US5271961A (en) | 1989-11-06 | 1993-12-21 | Alkermes Controlled Therapeutics, Inc. | Method for producing protein microspheres |
| US5410024A (en) | 1993-01-21 | 1995-04-25 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide amides |
| US5413797A (en) | 1992-03-12 | 1995-05-09 | Alkermes Controlled Therapeutics, Inc. | Controlled release ACTH containing microspheres |
| US5449752A (en) | 1991-05-02 | 1995-09-12 | Seikagaku Kogyo K.K. | Polypeptides with affinity to lipopolysaccharides and their uses |
| US5504191A (en) | 1994-08-01 | 1996-04-02 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide methyl esters |
| US5514670A (en) | 1993-08-13 | 1996-05-07 | Pharmos Corporation | Submicron emulsions for delivery of peptides |
| US5521284A (en) | 1994-08-01 | 1996-05-28 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide amides and esters |
| US5530097A (en) | 1994-08-01 | 1996-06-25 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory peptide amides |
| US5534496A (en) | 1992-07-07 | 1996-07-09 | University Of Southern California | Methods and compositions to enhance epithelial drug transport |
| US5554725A (en) | 1994-09-14 | 1996-09-10 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Synthesis of dolastatin 15 |
| EP0425235B1 (en) | 1989-10-25 | 1996-09-25 | Immunogen Inc | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5599902A (en) | 1994-11-10 | 1997-02-04 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Cancer inhibitory peptides |
| US5622929A (en) | 1992-01-23 | 1997-04-22 | Bristol-Myers Squibb Company | Thioether conjugates |
| US5635483A (en) | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
| US5663149A (en) | 1994-12-13 | 1997-09-02 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide heterocyclic and halophenyl amides |
| US5780588A (en) | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
| US5792458A (en) | 1987-10-05 | 1998-08-11 | The United States Of America As Represented By The Department Of Health And Human Services | Mutant diphtheria toxin conjugates |
| US5824805A (en) | 1995-12-22 | 1998-10-20 | King; Dalton | Branched hydrazone linkers |
| US6034065A (en) | 1992-12-03 | 2000-03-07 | Arizona Board Of Regents | Elucidation and synthesis of antineoplastic tetrapeptide phenethylamides of dolastatin 10 |
| US6214345B1 (en) | 1993-05-14 | 2001-04-10 | Bristol-Myers Squibb Co. | Lysosomal enzyme-cleavable antitumor drug conjugates |
| US6239104B1 (en) | 1997-02-25 | 2001-05-29 | Arizona Board Of Regents | Isolation and structural elucidation of the cytostatic linear and cyclo-depsipeptides dolastatin 16, dolastatin 17, and dolastatin 18 |
| US6323315B1 (en) | 1999-09-10 | 2001-11-27 | Basf Aktiengesellschaft | Dolastatin peptides |
| US6441163B1 (en) | 2001-05-31 | 2002-08-27 | Immunogen, Inc. | Methods for preparation of cytotoxic conjugates of maytansinoids and cell binding agents |
| US20020197266A1 (en) | 2000-02-08 | 2002-12-26 | Waldemar Debinski | Immunotherapy using interleukin 13 receptor subunit alpha 2 |
| WO2004010957A2 (en) | 2002-07-31 | 2004-02-05 | Seattle Genetics, Inc. | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
| US6884869B2 (en) | 2001-04-30 | 2005-04-26 | Seattle Genetics, Inc. | Pentapeptide compounds and uses related thereto |
| US20050238649A1 (en) | 2003-11-06 | 2005-10-27 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US20060024317A1 (en) | 2004-05-19 | 2006-02-02 | Medarex, Inc | Chemical linkers and conjugates thereof |
| US20110070248A1 (en) | 2009-09-24 | 2011-03-24 | Seattle Genetics, Inc. | Dr5 ligand drug conjugates |
| US20110212088A1 (en) | 2010-02-26 | 2011-09-01 | Sabbadini Roger A | Anti-paf antibodies |
| WO2013123061A1 (en) * | 2012-02-13 | 2013-08-22 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Bispecific chimeric antigen receptors and therapeutic uses thereof |
| WO2017025038A1 (en) * | 2015-08-11 | 2017-02-16 | Nanjing Legend Biotech Co., Ltd. | Chimeric antigen receptors based on single-domain antibodies and methods of use thereof |
| WO2017222593A1 (en) * | 2016-06-24 | 2017-12-28 | Icell Gene Therapeutics Llc | Chimeric antigen receptors (cars), compositions and methods thereof |
| WO2018045325A1 (en) * | 2016-09-02 | 2018-03-08 | Lentigen Technology, Inc. | Compositions and methods for treating cancer with duocars |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000023573A2 (en) | 1998-10-20 | 2000-04-27 | City Of Hope | Cd20-specific redirected t cells and their use in cellular immunotherapy of cd20+ malignancies |
| US7435596B2 (en) | 2004-11-04 | 2008-10-14 | St. Jude Children's Research Hospital, Inc. | Modified cell line and method for expansion of NK cell |
| US20130266551A1 (en) | 2003-11-05 | 2013-10-10 | St. Jude Children's Research Hospital, Inc. | Chimeric receptors with 4-1bb stimulatory signaling domain |
| US20050113564A1 (en) | 2003-11-05 | 2005-05-26 | St. Jude Children's Research Hospital | Chimeric receptors with 4-1BB stimulatory signaling domain |
| PH12013501201A1 (en) | 2010-12-09 | 2013-07-29 | Univ Pennsylvania | Use of chimeric antigen receptor-modified t cells to treat cancer |
| CN110200997A (zh) | 2011-03-23 | 2019-09-06 | 弗雷德哈钦森癌症研究中心 | 用于细胞免疫治疗的方法和组合物 |
| US11041021B2 (en) * | 2014-05-23 | 2021-06-22 | University Of Florida Research Foundation, Incorporated | Car based immunotherapy |
| EP4400516A1 (en) | 2014-12-15 | 2024-07-17 | The Regents of the University of California | Bispecific or-gate chimeric antigen receptor responsive to cd19 and cd20 |
| WO2017027291A1 (en) * | 2015-08-07 | 2017-02-16 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Bispecific car t-cells for solid tumor targeting |
| US10442867B2 (en) | 2017-07-31 | 2019-10-15 | Lentigen Technology, Inc. | Compositions and methods for treating cancer with anti-CD19/CD20 immunotherapy |
-
2018
- 2018-07-31 US US16/050,754 patent/US10442867B2/en active Active
- 2018-07-31 CN CN201880063737.4A patent/CN111183156A/zh active Pending
- 2018-07-31 EP EP18779075.3A patent/EP3661964A1/en active Pending
- 2018-07-31 JP JP2020505240A patent/JP7237926B2/ja active Active
- 2018-07-31 WO PCT/US2018/044654 patent/WO2019028051A1/en not_active Ceased
- 2018-07-31 CA CA3071624A patent/CA3071624A1/en active Pending
- 2018-07-31 AU AU2018309735A patent/AU2018309735B2/en active Active
-
2019
- 2019-10-11 US US16/599,473 patent/US11680103B2/en active Active
-
2023
- 2023-03-01 JP JP2023030980A patent/JP7574348B2/ja active Active
- 2023-05-04 US US18/312,112 patent/US20240034802A1/en active Pending
-
2024
- 2024-10-16 JP JP2024180515A patent/JP7838050B2/ja active Active
-
2025
- 2025-05-29 AU AU2025204005A patent/AU2025204005A1/en active Pending
Patent Citations (89)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3060165A (en) | 1962-10-23 | Preparation of toxic ricin | ||
| US3896111A (en) | 1973-02-20 | 1975-07-22 | Research Corp | Ansa macrolides |
| US4151042A (en) | 1977-03-31 | 1979-04-24 | Takeda Chemical Industries, Ltd. | Method for producing maytansinol and its derivatives |
| US4137230A (en) | 1977-11-14 | 1979-01-30 | Takeda Chemical Industries, Ltd. | Method for the production of maytansinoids |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4265814A (en) | 1978-03-24 | 1981-05-05 | Takeda Chemical Industries | Matansinol 3-n-hexadecanoate |
| US4361650A (en) | 1978-03-24 | 1982-11-30 | Takeda Chemical Industries, Ltd. | Fermentation process of preparing demethyl maytansinoids |
| US4307016A (en) | 1978-03-24 | 1981-12-22 | Takeda Chemical Industries, Ltd. | Demethyl maytansinoids |
| US4248870A (en) | 1978-10-27 | 1981-02-03 | Takeda Chemical Industries, Ltd. | Maytansinoids and use |
| US4260608A (en) | 1978-11-14 | 1981-04-07 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and methods of use thereof |
| US4256746A (en) | 1978-11-14 | 1981-03-17 | Takeda Chemical Industries | Dechloromaytansinoids, their pharmaceutical compositions and method of use |
| US4294757A (en) | 1979-01-31 | 1981-10-13 | Takeda Chemical Industries, Ltd | 20-O-Acylmaytansinoids |
| US4322348A (en) | 1979-06-05 | 1982-03-30 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4317821A (en) | 1979-06-08 | 1982-03-02 | Takeda Chemical Industries, Ltd. | Maytansinoids, their use and pharmaceutical compositions thereof |
| US4308268A (en) | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4308269A (en) | 1979-06-11 | 1981-12-29 | Takeda Chemical Industries, Ltd. | Maytansinoids, pharmaceutical compositions thereof and method of use thereof |
| US4309428A (en) | 1979-07-30 | 1982-01-05 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4331598A (en) | 1979-09-19 | 1982-05-25 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4364866A (en) | 1979-09-21 | 1982-12-21 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| US4362663A (en) | 1979-09-21 | 1982-12-07 | Takeda Chemical Industries, Ltd. | Maytansinoid compound |
| US4371533A (en) | 1980-10-08 | 1983-02-01 | Takeda Chemical Industries, Ltd. | 4,5-Deoxymaytansinoids, their use and pharmaceutical compositions thereof |
| US4450254A (en) | 1980-11-03 | 1984-05-22 | Standard Oil Company | Impact improvement of high nitrile resins |
| US4315929A (en) | 1981-01-27 | 1982-02-16 | The United States Of America As Represented By The Secretary Of Agriculture | Method of controlling the European corn borer with trewiasine |
| US4313946A (en) | 1981-01-27 | 1982-02-02 | The United States Of America As Represented By The Secretary Of Agriculture | Chemotherapeutically active maytansinoids from Trewia nudiflora |
| US4424219A (en) | 1981-05-20 | 1984-01-03 | Takeda Chemical Industries, Ltd. | 9-Thiomaytansinoids and their pharmaceutical compositions and use |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4486414A (en) | 1983-03-21 | 1984-12-04 | Arizona Board Of Reagents | Dolastatins A and B cell growth inhibitory substances |
| US4957735A (en) | 1984-06-12 | 1990-09-18 | The University Of Tennessee Research Corporation | Target-sensitive immunoliposomes- preparation and characterization |
| US5019369A (en) | 1984-10-22 | 1991-05-28 | Vestar, Inc. | Method of targeting tumors in humans |
| US5079163A (en) | 1985-03-29 | 1992-01-07 | Cetus Corporation | Recombinant ricin toxin fragments |
| US4689401A (en) | 1986-03-06 | 1987-08-25 | Cetus Corporation | Method of recovering microbially produced recombinant ricin toxin a chain |
| US4880935A (en) | 1986-07-11 | 1989-11-14 | Icrf (Patents) Limited | Heterobifunctional linking agents derived from N-succinimido-dithio-alpha methyl-methylene-benzoates |
| US4902505A (en) | 1986-07-30 | 1990-02-20 | Alkermes | Chimeric peptides for neuropeptide delivery through the blood-brain barrier |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US4816444A (en) | 1987-07-10 | 1989-03-28 | Arizona Board Of Regents, Arizona State University | Cell growth inhibitory substance |
| US5004697A (en) | 1987-08-17 | 1991-04-02 | Univ. Of Ca | Cationized antibodies for delivery through the blood-brain barrier |
| US5792458A (en) | 1987-10-05 | 1998-08-11 | The United States Of America As Represented By The Department Of Health And Human Services | Mutant diphtheria toxin conjugates |
| US5208021A (en) | 1987-10-05 | 1993-05-04 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of preparing diphtheria immunotoxins |
| US5122368A (en) | 1988-02-11 | 1992-06-16 | Bristol-Myers Squibb Company | Anthracycline conjugates having a novel linker and methods for their production |
| US5076973A (en) | 1988-10-24 | 1991-12-31 | Arizona Board Of Regents | Synthesis of dolastatin 3 |
| US4978744A (en) | 1989-01-27 | 1990-12-18 | Arizona Board Of Regents | Synthesis of dolastatin 10 |
| US5055303A (en) | 1989-01-31 | 1991-10-08 | Kv Pharmaceutical Company | Solid controlled release bioadherent emulsions |
| US4879278A (en) | 1989-05-16 | 1989-11-07 | Arizona Board Of Regents | Isolation and structural elucidation of the cytostatic linear depsipeptide dolastatin 15 |
| US4986988A (en) | 1989-05-18 | 1991-01-22 | Arizona Board Of Regents | Isolation and structural elucidation of the cytostatic linear depsipeptides dolastatin 13 and dehydrodolastatin 13 |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5416064A (en) | 1989-10-25 | 1995-05-16 | Immunogen, Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| EP0425235B1 (en) | 1989-10-25 | 1996-09-25 | Immunogen Inc | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5271961A (en) | 1989-11-06 | 1993-12-21 | Alkermes Controlled Therapeutics, Inc. | Method for producing protein microspheres |
| US5138036A (en) | 1989-11-13 | 1992-08-11 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Isolation and structural elucidation of the cytostatic cyclodepsipeptide dolastatin 14 |
| US5188837A (en) | 1989-11-13 | 1993-02-23 | Nova Pharmaceutical Corporation | Lipsopheres for controlled delivery of substances |
| US5268164A (en) | 1990-04-23 | 1993-12-07 | Alkermes, Inc. | Increasing blood-brain barrier permeability with permeabilizer peptides |
| US5506206A (en) | 1990-04-23 | 1996-04-09 | Alkermes, Inc. | Increasing blood-brain barrier permeability with permeabilizer peptides |
| US5449752A (en) | 1991-05-02 | 1995-09-12 | Seikagaku Kogyo K.K. | Polypeptides with affinity to lipopolysaccharides and their uses |
| US5254342A (en) | 1991-09-30 | 1993-10-19 | University Of Southern California | Compositions and methods for enhanced transepithelial and transendothelial transport or active agents |
| US5622929A (en) | 1992-01-23 | 1997-04-22 | Bristol-Myers Squibb Company | Thioether conjugates |
| US5413797A (en) | 1992-03-12 | 1995-05-09 | Alkermes Controlled Therapeutics, Inc. | Controlled release ACTH containing microspheres |
| US5534496A (en) | 1992-07-07 | 1996-07-09 | University Of Southern California | Methods and compositions to enhance epithelial drug transport |
| US5635483A (en) | 1992-12-03 | 1997-06-03 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Tumor inhibiting tetrapeptide bearing modified phenethyl amides |
| US6034065A (en) | 1992-12-03 | 2000-03-07 | Arizona Board Of Regents | Elucidation and synthesis of antineoplastic tetrapeptide phenethylamides of dolastatin 10 |
| US5410024A (en) | 1993-01-21 | 1995-04-25 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide amides |
| US5780588A (en) | 1993-01-26 | 1998-07-14 | Arizona Board Of Regents | Elucidation and synthesis of selected pentapeptides |
| US6214345B1 (en) | 1993-05-14 | 2001-04-10 | Bristol-Myers Squibb Co. | Lysosomal enzyme-cleavable antitumor drug conjugates |
| US5514670A (en) | 1993-08-13 | 1996-05-07 | Pharmos Corporation | Submicron emulsions for delivery of peptides |
| US5521284A (en) | 1994-08-01 | 1996-05-28 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide amides and esters |
| US5665860A (en) | 1994-08-01 | 1997-09-09 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory peptide amides |
| US5530097A (en) | 1994-08-01 | 1996-06-25 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory peptide amides |
| US5504191A (en) | 1994-08-01 | 1996-04-02 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide methyl esters |
| US5554725A (en) | 1994-09-14 | 1996-09-10 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Synthesis of dolastatin 15 |
| US5599902A (en) | 1994-11-10 | 1997-02-04 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Cancer inhibitory peptides |
| US5663149A (en) | 1994-12-13 | 1997-09-02 | Arizona Board Of Regents Acting On Behalf Of Arizona State University | Human cancer inhibitory pentapeptide heterocyclic and halophenyl amides |
| US5824805A (en) | 1995-12-22 | 1998-10-20 | King; Dalton | Branched hydrazone linkers |
| US6239104B1 (en) | 1997-02-25 | 2001-05-29 | Arizona Board Of Regents | Isolation and structural elucidation of the cytostatic linear and cyclo-depsipeptides dolastatin 16, dolastatin 17, and dolastatin 18 |
| US6323315B1 (en) | 1999-09-10 | 2001-11-27 | Basf Aktiengesellschaft | Dolastatin peptides |
| US7338929B2 (en) | 2000-02-08 | 2008-03-04 | The Penn State Research Foundation | Cancer immunotherapy |
| US20020197266A1 (en) | 2000-02-08 | 2002-12-26 | Waldemar Debinski | Immunotherapy using interleukin 13 receptor subunit alpha 2 |
| US6884869B2 (en) | 2001-04-30 | 2005-04-26 | Seattle Genetics, Inc. | Pentapeptide compounds and uses related thereto |
| US6441163B1 (en) | 2001-05-31 | 2002-08-27 | Immunogen, Inc. | Methods for preparation of cytotoxic conjugates of maytansinoids and cell binding agents |
| US20060074008A1 (en) | 2002-07-31 | 2006-04-06 | Senter Peter D | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
| WO2004010957A2 (en) | 2002-07-31 | 2004-02-05 | Seattle Genetics, Inc. | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
| US7964566B2 (en) | 2003-11-06 | 2011-06-21 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US20050238649A1 (en) | 2003-11-06 | 2005-10-27 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US7498298B2 (en) | 2003-11-06 | 2009-03-03 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US20060024317A1 (en) | 2004-05-19 | 2006-02-02 | Medarex, Inc | Chemical linkers and conjugates thereof |
| US20110070248A1 (en) | 2009-09-24 | 2011-03-24 | Seattle Genetics, Inc. | Dr5 ligand drug conjugates |
| US20110212088A1 (en) | 2010-02-26 | 2011-09-01 | Sabbadini Roger A | Anti-paf antibodies |
| WO2013123061A1 (en) * | 2012-02-13 | 2013-08-22 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Bispecific chimeric antigen receptors and therapeutic uses thereof |
| WO2017025038A1 (en) * | 2015-08-11 | 2017-02-16 | Nanjing Legend Biotech Co., Ltd. | Chimeric antigen receptors based on single-domain antibodies and methods of use thereof |
| WO2017222593A1 (en) * | 2016-06-24 | 2017-12-28 | Icell Gene Therapeutics Llc | Chimeric antigen receptors (cars), compositions and methods thereof |
| WO2018045325A1 (en) * | 2016-09-02 | 2018-03-08 | Lentigen Technology, Inc. | Compositions and methods for treating cancer with duocars |
Non-Patent Citations (142)
| Title |
|---|
| "Antibody Engineering", vol. 1-2, 2010, SPRINGER PRESS |
| "Chemotherapy Service", 1992, WILLIAMS & WILKINS |
| "Epitope Mapping", 2001, OXFORD UNIVERSITY PRESS |
| "GenBank", Database accession no. AAA35664.1 |
| "Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, VCH PUBLISHERS, INC. |
| "Peptide and Protein Drug Analysis", 2000, MARCEL DEKKER, INC. |
| "Pierce Catalog and Handbook", 1994, PIERCE CHEMICAL CO. |
| "Remington's Pharmaceutical Science", 1995, MACK PUBLISHING COMPANY |
| "Suicide Gene Therapy: Methods and Reviews", 2004, HUMANA PRESS |
| "The Encyclopedia of Molecular Biology", 1994, BLACKWELL SCIENCE LTD. |
| "Uniprot", Database accession no. P15391 |
| AHMAD ET AL., CLIN. DEV. IMMUNOL., 2012 |
| AL-LAZIKANI ET AL., JMB, vol. 273, 1997, pages 927 - 948 |
| ANDERSON, KC; BATES, MP; SLAUGHENHOUT BL; PINKUS GS; SCHLOSSMAN SF; NADLER LM, BLOOD, vol. 63, 1984, pages 1424 - 1433 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1994, GREENE PUBLISHING ASSOCIATES AND JOHN WILEY & SONS |
| BANGA, A.J.: "Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems", 1995, TECHNOMIC PUBLISHING COMPANY, INC. |
| BARBAS ET AL.: "Phage display: A Laboratory Manuel", 2004, COLD SPRING HARBOR LABORATORY PRESS |
| BARRETT, D.M. ET AL.: "Noninvasive bioluminescent imaging of primary patient acute lymphoblastic leukemia: a strategy for preclinical modeling", BLOOD, vol. 118, no. 15, 2011, pages ell2 - el 17 |
| BEERS, S.A. ET AL.: "Antigenic modulation limits the efficacy of anti-CD20 antibodies: implications for antibody selection", BLOOD, vol. 115, no. 25, 2010, pages 5191 - 5201 |
| BENJAMIN LEWIN: "Genes VII", 1999, OXFORD UNIVERSITY PRESS |
| BENJAMIN, JE; STEIN AS, THERAPEUTIC ADVANCES IN HEMATOLOGY, vol. 7, 2016, pages 142 - 156 |
| BETAGERI ET AL.: "Liposome Drug Delivery Systems", 1993, TECHNOMIC PUBLISHING CO., INC. |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 426 |
| BORRABECK: "Antibody Engineering", 1995, OXFORD UNIVERSITY PRESS |
| BRADBURY, LE; KANSAS GS; LEVY S; EVANS RL; TEDDER TF, J IMMUNOL, vol. 149, 1992, pages 2841 - 50 |
| BROWN CE ET AL., CLIN CANCER RES., vol. 18, no. 8, 2012, pages 2199 - 209 |
| CAPECCHI, CELL, vol. 22, 1980, pages 479 - 488 |
| CARTER, RH; FEARON, DT, SCIENCE, vol. 256, 1992, pages 105 - 107 |
| CHAN ET AL.: "Fmoc Solid Phase Peptide Synthesis", 2000, OXFORD UNIVERSITY PRESS |
| CHU ET AL., GENE, vol. 13, 1981, pages 97 |
| CHUNG, E.Y. ET AL.: "CD19 is a major B cell receptor-independent activator of MYC-driven B-lymphomagenesis", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 122, no. 6, 2012, pages 2257 - 2266, XP055250174, DOI: doi:10.1172/JCI45851 |
| CLAY ET AL., J. IMMUNOL, vol. 163, 1999, pages 507 - 513 |
| DAVIS ET AL.: "Basic Methods in Molecular Biology", 1986, ELSEVIER |
| DAVIS KL; MACKALL CL, BLOOD ADVANCES, vol. 1, 2016, pages 265 - 268 |
| DEPOIL, D. ET AL.: "CD19 is essential for B cell activation by promoting B cell receptor-antigen microcluster formation in response to membrane-bound ligand", NATURE IMMUNOLOGY, vol. 9, no. 1, 2008, pages 63 - 72 |
| DI STASI A ET AL., N ENGL J MED., vol. 365, no. 18, 2011, pages 1673 - 83 |
| DINA SCHNEIDER ET AL: "A tandem CD19/CD20 CAR lentiviral vector drives on-target and off-target antigen modulation in leukemia cell lines", JOURNAL FOR IMMUNOTHERAPY OF CANCER, BIOMED CENTRAL LTD, LONDON, UK, vol. 5, no. 1, 16 May 2017 (2017-05-16), pages 1 - 17, XP021245145, DOI: 10.1186/S40425-017-0246-1 * |
| DINA SCHNEIDER ET AL: "Abstract 2297: Tandem anti-CD20 and -CD19 scFV-based chimeric antigen receptors (CARs) mitigate tumor escape in hematologic malignancies", CANCER RESEARCH, vol. 76, no. 14, 1 July 2016 (2016-07-01), XP055518913 * |
| DUBOWCHIK; WALKER, PHARM. THERAPEUTICS, vol. 83, 1999, pages 67 - 123 |
| E. ZAH ET AL: "T Cells Expressing CD19/CD20 Bispecific Chimeric Antigen Receptors Prevent Antigen Escape by Malignant B Cells", CANCER IMMUNOLOGY RESEARCH, vol. 4, no. 6, 8 April 2016 (2016-04-08), US, pages 498 - 508, XP055290967, ISSN: 2326-6066, DOI: 10.1158/2326-6066.CIR-15-0231 * |
| FEIGNER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7413 - 7417 |
| FENLU ZHU ET AL: "CAR-T Cell Production Using the Clinimacs Prodigy System", BLOOD, vol. 128, no. 22, 2 December 2016 (2016-12-02), pages 5724, XP055518893 * |
| FENLU ZHU ET AL: "Closed-system manufacturing of CD19 and dual-targeted CD20/19 chimeric antigen receptorT cells using the CliniMACS Prodigy device at an academic medical center", CYTOTHERAPY, vol. 20, 26 December 2017 (2017-12-26), pages 394 - 406, XP055518886, DOI: 10.1016/j.jcyt.2017.09.005 * |
| FOSTER AE ET AL., J IMMUNOTHER, vol. 31, no. 5, 2008, pages 500 - 5 |
| FUNATSU ET AL., AGR. BIOL. CHEM., vol. 52, 1988, pages 1095 |
| GARDNER, R. ET AL.: "Acquisition of a CD19-negative myeloid phenotype allows immune escape of MLL-rearranged B-ALL from CD19 CAR-T-cell therapy", BLOOD, vol. 127, no. 20, 2016, pages 2406 - 2410 |
| GILLESPIE ET AL., ANN. ONCOL., vol. 11, 2000, pages 735 - 41 |
| GINALDI, L. ET AL.: "Levels of expression of CD 19 and CD20 in chronic B cell leukaemias", JOURNAL OF CLINICAL PATHOLOGY, vol. 51, no. 5, 1998, pages 364 - 369 |
| GOYAL; BATRA, BIOCHEM., vol. 345, 2000, pages 247 - 54 |
| GRADA, Z. ET AL.: "TanCAR: a novel bispecific chimeric antigen receptor for cancer immunotherapy", MOLECULAR THERAPY—NUCLEIC ACIDS, vol. 2, no. 7, 2013, pages el05, XP055152438, DOI: doi:10.1038/mtna.2013.32 |
| GRAHAM ET AL., VIROLOGY, vol. 52, 1973, pages 456 - 467 |
| GRUPP, S.A. ET AL.: "Chimeric antigen receptor-modified T cells for acute lymphoid leukemia", NEW ENGLAND JOURNAL OF MEDICINE, vol. 368, no. 16, 2013, pages 1509 - 1518, XP055169041, DOI: doi:10.1056/NEJMoa1215134 |
| GRUPP, S.A. ET AL.: "Durable remissions in children with relapsed/refractory aLL treated with T cells engineered with a CD19-targeted chimeric antigen receptor (CTL019", BLOOD, vol. 126, no. 23, 2015, pages 681 - 681 |
| HAMERS-CASTERMAN ET AL., NATURE, vol. 363, 1993, pages 446 - 448 |
| HARLOW; LANE: "Antibodies, A Laboratory Manual", 2013, COLD SPRING HARBOR PUBLICATIONS |
| HASO W; LEE DW; SHAH NN; STETLER-STEVENSON M; YUAN CM; PASTAN IH; DIMITROV DS; MORGAN RA; FITZGERALD DJ; BARRETT DM: "Anti-CD22-chimeric antigen receptors targeting B cell precursor acute lymphoblastic leukemia", BLOOD, vol. 121, no. 7, 2013, pages 1165 - 74 |
| HASO, W. ET AL.: "Anti-CD22 chimeric antigen receptors targeting B-cell precursor acute lymphoblastic leukemia", BLOOD, vol. 121, no. 7, 2013, pages 1165 - 1174 |
| HEGDE M ET AL., MOL THER., vol. 21, no. 11, 2013, pages 2087 - 101 |
| HILYARD ET AL.: "Protein Engineering: A practical approach", 1992, IRL PRESS |
| HOLLIGER ET AL., PROC. NATL. ACAD. SCI., vol. 90, 1993, pages 6444 6448 |
| HUDECEK, M. ET AL.: "Receptor affinity and extracellular domain modifications affect tumor recognition by ROR1-specific chimeric antigen receptor T cells", CLINICAL CANCER RESEARCH, vol. 19, no. 12, 2013, pages 3153 - 3164, XP055177780, DOI: doi:10.1158/1078-0432.CCR-13-0330 |
| HUSE ET AL., SCIENCE, vol. 246, 1989, pages 1275 - 1281 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 5879 5883 |
| IJNTEMA ET AL., INT. J. PHARM., vol. 112, 1994, pages 215 - 224 |
| JACOBY, E. ET AL.: "CD19 CAR immune pressure induces B-precursor acute lymphoblastic leukaemia lineage switch exposing inherent leukaemic plasticity", NATURE COMMUNICATIONS, vol. 7, 2016 |
| JENSEN, M. ET AL.: "CD20 is a molecular target for scFvFc: zeta receptor redirected T cells: implications for cellular immunotherapy of CD20+ malignancy", BIOLOGY OF BLOOD AND MARROW TRANSPLANTATION, vol. 4, no. 2, 1998, pages 75 - 83, XP000910525, DOI: doi:10.1053/bbmt.1998.v4.pm9763110 |
| JOHNSON ET AL., ANTICANCER RES., vol. 15, 1995, pages 1387 - 93 |
| JOHNSTON ET AL., PHARM. RES., vol. 9, 1992, pages 425 - 434 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES |
| KAISER AD ET AL., CANCER GENE THER., vol. 22, no. 2, 2015, pages 72 - 78 |
| KINDT ET AL.: "Kuby Immunology", 2007, W.H. FREEMAN AND CO., pages: 91 |
| KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73 |
| KLOSS CC ET AL., NAT BIOTECHNOL., vol. 31, no. 1, 2013, pages 71 - 5 |
| KOCHENDERFER JN ET AL., BLOOD, vol. 119, no. 12, 2012, pages 2709 - 20 |
| KOCHENDERFER JN; WILSON WH; JANIK JE; DUDLEY ME; STETLER-STEVENSON M; FELDMAN SA; MARIC I; RAFFELD M; NATHAN DA; LANIER BJ, BLOOD, vol. 116, 2010, pages 4099 - 102 |
| KOCHENDERFER, J.N. ET AL.: "B-cell depletion and remissions of malignancy along with cytokine-associated toxicity in a clinical trial of anti-CD 19 chimeric-antigen-receptor-transduced T cells", BLOOD, vol. 119, no. 12, 2012, pages 2709 - 2720, XP055145503, DOI: doi:10.1182/blood-2011-10-384388 |
| KOCHENDERFER, J.N. ET AL.: "Construction and pre-clinical evaluation of an anti-CD 19 chimeric antigen receptor", JOURNAL OF IMMUNOTHERAPY, vol. 32, no. 7, 1997, pages 689 |
| KREUTER, J.: "Colloidal Drug Delivery Systems", 1994, MARCEL DEKKER, INC., pages: 219 - 342 |
| KUBY, J.: "Immunology", 1997, W.H. FREEMAN & CO. |
| KURODA, H. ET AL.: "Simplified lentivirus vector production in protein-free media using polyethylenimine-mediated transfection", JOURNAL OF VIROLOGICAL METHODS, vol. 157, no. 2, 2009, pages 113 - 121, XP026064560, DOI: doi:10.1016/j.jviromet.2008.11.021 |
| LAIRD; GROMAN, J. VIROL., vol. 19, 1976, pages 220 |
| LANGER, ACCOUNTS CHEM. RES., vol. 26, 1993, pages 537 - 542 |
| LANITIS E ET AL., CANCER IMMUNOL RES., vol. 1, no. 1, 2013, pages 43 - 53 |
| LAU ET AL., BIOORG-MED-CHEM., vol. 3, no. 10, 1995, pages 1299 - 1304 |
| LAU ET AL., BIOORG-MED-CHEM., vol. 3, no. 10, 1995, pages 1305 - 12 |
| LEE DW ET AL., AMERICAN SOCIETY OF HEMATOLOGY ANNUAL MEETING, 7 December 2013 (2013-12-07) |
| LEE DW; KOCHENDERFER JN; STETLER-STEVENSON M; CUI YK; DELBROOK C; FELDMAN SA; ORENTAS R; SABATINO M; SHAH NN; STEINBERG SM, LANCET, vol. 385, 2015, pages 517 - 28 |
| LEE DW; KOCHENDERFER JN; STETLER-STEVENSON M; CUI YK; FELDMAN SA; ORENTAS R; SABATINO M; SHAH NN; STEINBERG SM; STRONCEK D, LANCET, vol. 385, 2015, pages 517 - 28 |
| LEE ET AL., J. ANTIBIOT., vol. 42, 1989, pages 1070 - 87 |
| LEE, D.W. ET AL.: "T cells expressing CD19 chimeric antigen receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial", THE LANCET, vol. 385, no. 9967, 2015, pages 517 - 528, XP055388598, DOI: doi:10.1016/S0140-6736(14)61403-3 |
| LEE, D.W. ET AL.: "The future is now: chimeric antigen receptors as new targeted therapies for childhood cancer", CLINICAL CANCER RESEARCH, vol. 18, no. 10, 2012, pages 2780 - 2790, XP002725492, DOI: doi:10.1158/1078-0432.CCR-11-1920 |
| LEFRANC ET AL.: "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains", DEV. COMP. IMMUNOL., vol. 27, 2003, pages 55 - 77, XP055144492, DOI: doi:10.1016/S0145-305X(02)00039-3 |
| LEHNER M ET AL., PLOS ONE, vol. 7, no. 2, 2012, pages e31210 |
| LIM, SEAN H. ET AL.: "Anti-CD20 Monoclonal Antibodies: Historical and Future Perspectives", HAEMATOLOGICA, vol. 95.1, 2010, pages 135 - 143, XP002717672, DOI: doi:10.3324/haematol.2008.001628 |
| LONBERG, NAT. BIOTECH., vol. 23, 2005, pages 1117 - 1125 |
| LONENBERG, CURR. OPIN. IMMUNOL., vol. 20, 2008, pages 450 - 459 |
| MANNINO ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 682 - 690 |
| MARBRY, IDRUGS, vol. 13, 2010, pages 543 - 549 |
| MAUDE SL; TEACHEY DT; RHEINGOLD SR; SHAW PA; APLENC R; BARRETT DM; BARKER CS; CALLAHAN C; FREY NV; FARZANA N, J CLIN ONCOL, vol. 34, no. 15, May 2016 (2016-05-01), pages 3011 - 3011 |
| MILONE ET AL., MOL. THER., vol. 17, no. 8, 2009, pages 1453 - 1464 |
| NEVILLE ET AL., BIOL. CHEM., vol. 264, 1989, pages 14653 - 14661 |
| NICHOLSON; BLAUSTEIN, J. BIOCHIM. BIOPHYS. ACTA, vol. 266, 1972, pages 543 |
| OLSNES ET AL., NATURE, vol. 249, 1974, pages 627 - 631 |
| OLSNES, METHODS ENZYMOL., vol. 50, 1978, pages 330 - 335 |
| ONEA, A.S.; A.R. JAZIREHI: "CD 19 chimeric antigen receptor (CD19 CAR)-redirected adoptive T-cell immunotherapy for the treatment of relapsed or refractory B-cell Non-Hodgkin's Lymphomas", AMERICAN JOURNAL OF CANCER RESEARCH, vol. 6, no. 2, 2016, pages 403, XP055403323 |
| OTERO, D.C.; A.N. ANZELON; R.C. RICKERT: "CD19 function in early and late B cell development: I. Maintenance of follicular and marginal zone B cells requires CD19-dependent survival signals", THE JOURNAL OF IMMUNOLOGY, vol. 170, no. 1, 2003, pages 73 - 83 |
| OTERO, D.C.; R.C. RICKERT: "CD19 function in early and late B cell development. II. CD19 facilitates the pro-B/pre-B transition", THE JOURNAL OF IMMUNOLOGY, vol. 171, no. 11, 2003, pages 5921 - 5930 |
| PEC ET AL., J. PARENT. SCI. TECH., vol. 44, no. 2, 1990, pages 58 - 65 |
| PHILLIPS ET AL., CANCER RES., vol. 68, 2008, pages 92809290 |
| POE, J.C. ET AL.: "A c-Myc and surface CD19 signaling amplification loop promotes B cell lymphoma development and progression in mice", THE JOURNAL OF IMMUNOLOGY, vol. 189, no. 5, 2012, pages 2318 - 2325 |
| POLJAK ET AL., STRUCTURE, vol. 2, 1994, pages 1121 1123 |
| PORTER DL ET AL., N ENGL J MED., vol. 365, no. 8, 2011, pages 725 - 33 |
| PORTER, D.L. ET AL.: "Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia", NEW ENGLAND JOURNAL OF MEDICINE, vol. 365, no. 8, 2011, pages 725 - 733, XP055247863, DOI: doi:10.1056/NEJMoa1103849 |
| RATHORE ET AL., GENE, vol. 190, 1997, pages 31 - 5 |
| RUELLA, M. ET AL.: "Dual CD 19 and CD 123 targeting prevents antigen-loss relapses after CD19-directed immunotherapies", THE JOURNAL OF CLINICAL INVESTIGATION, vol. 126, no. 10, 2016, XP055420115, DOI: doi:10.1172/JCI87366 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR PRESS |
| SCHNEIDER DINA ET AL: "Leukemia Cell Surface Antigen Modulation Induced By Dual CD19/CD20 Chimeric Antigen Receptor (CAR)-T Cells", BIOLOGY OF BLOOD AND MARROW TRANSPLANTATION, vol. 23, no. 3, 1 March 2017 (2017-03-01), XP029931875, ISSN: 1083-8791, DOI: 10.1016/J.BBMT.2016.12.418 * |
| SCHNEIDER ET AL., JOURNAL FOR IMMUNOTHERAPY OF CANCER, vol. 5, 2017, pages 42 |
| SHAH NIRAV ET AL: "Dual Targeted CD20/19 CAR-T Cell Production Using the Clinimacs Prodigy System", BIOLOGY OF BLOOD AND MARROW TRANSPLANTATION, vol. 23, no. 3, 1 March 2017 (2017-03-01), XP029931740, ISSN: 1083-8791, DOI: 10.1016/J.BBMT.2016.12.274 * |
| SHERIFF ET AL., NAT. STRUCT. BIOL., vol. 3, 1996, pages 733 - 736 |
| SHIGEKAWA ET AL., BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751 |
| SOTILLO, E. ET AL.: "Convergence of acquired mutations and alternative splicing of CD19 enables resistance to CART-19 immunotherapy", CANCER DISCOVERY, vol. 5, no. 12, 2015, pages 1282 - 1295, XP055376174, DOI: doi:10.1158/2159-8290.CD-15-1020 |
| STIRPE ET AL., BIO/TECHNOLOGY, vol. 10, 1992, pages 405 - 412 |
| SUZUKI ET AL., NAT. BIOTECH., vol. 17, 1999, pages 265 - 70 |
| TEDDER TF; ISAACS, CM, J IMMUNOL, 1989, pages 712 - 171 |
| THORPE ET AL., CANCER RES., vol. 47, 1987, pages 5924 - 5931 |
| TICE; TABIBI: "Treatise on Controlled Drug Delivery", 1992, MARCEL DEKKER, INC., pages: 315 - 339 |
| UCKUN FM; BURKHARDT AL; JARVIS L; JUN X; STEALY B; DIBIRDIK I; MYERS DE; TUEL-AHLGREN L; BOLEN JB, J BIOL CHEM, vol. 268, 1983, pages 21172 - 84 |
| USANARAT ANURATHAPAN, R.C.C.; HAKEEM F HINDI; ROOPA MUCHARLA; PRADIP BAJGAIN; BRENDAN C HAYES; WILLIAM E FISHER; HELEN E HESLOP; C: "Kinetics of Tumor Destruction by Chimeric Antigen Receptor-modified T Cells", MOLECULAR THERAPY, vol. 22, no. 3, 2014, pages 623 - 633 |
| VILPO J ET AL.: "Surface membrane antigen expression changes induced in vitro by exogenous growth factors in chronic lymphocytic leukemia cells", LEUKEMIA, vol. 16, 2002, pages 1691 - 1698 |
| WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546 |
| WAWRZYNCZAK ET AL.: "Immunoconjugates: Antibody Conjugates in Radioimagery and Therapy of Cancer", 1987, OXFORD U. PRESS |
| WHITLOW, M. ET AL.: "An improved linker for single-chain Fv with reduced aggregation and enhanced proteolytic stability", PROTEIN ENGINEERING, vol. 6, no. 8, 1993, pages 989 - 995 |
| WINTER; HARRIS, IMMUNOL. TODAY, vol. 14, 1993, pages 243 - 246 |
| WU, A.M. ET AL.: "Multimerization of a chimeric anti-CD20 single-chain Fv-Fc fusion protein is mediated through variable domain exchange", PROTEIN ENGINEERING, vol. 14, no. 12, 2001, pages 1025 - 1033, XP002982160, DOI: doi:10.1093/protein/14.12.1025 |
| YING XIONG ET AL: "648. Mitigating tumor escape: Tandem- CD20-and CD19 SCFV-Based Chimeric Antigen Receptors (CARs) in Leukemia/Lymphoma", MOLECULAR THERAPY, vol. 24, no. S1, 1 May 2016 (2016-05-01), XP055518921, DOI: 10.1016/S1525-0016(16)33456-6 * |
| YU ET AL., PNAS, vol. 99, 2002, pages 7968 - 7973 |
| YVON E ET AL., CLIN CANCER RES., vol. 15, no. 18, 2009, pages 5852 - 60 |
| ZAH, E. ET AL.: "T cells expressing CD 19/CD20 bi-specific chimeric antigen receptors prevent antigen escape by malignant B cells", CANCER IMMUNOLOGY RESEARCH, 2016 |
| ZHAO ET AL., J. IMMUNOL, vol. 174, 2005, pages 4415 - 4423 |
| ZHAO Y ET AL., J IMMUNOL., vol. 183, no. 9, 2009, pages 5563 - 74 |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12583903B2 (en) | 2017-02-08 | 2026-03-24 | AbelZeta Inc. | Construction of chimeric antigen receptor targeting CD20 antigen and activity identification of engineered T cells thereof |
| US12258381B2 (en) | 2018-02-09 | 2025-03-25 | National University Of Singapore | Activating chimeric receptors and uses thereof in natural killer cell immunotherapy |
| US12441787B2 (en) | 2018-04-02 | 2025-10-14 | National University Of Singapore | Neutralization of human cytokines with membrane-bound anti-cytokine non-signaling binders expressed in immune cells |
| US12398187B2 (en) | 2019-03-05 | 2025-08-26 | Nkarta, Inc. | CD19-directed chimeric antigen receptors and uses thereof in immunotherapy |
| JP7650809B2 (ja) | 2019-03-06 | 2025-03-25 | レンティジェン・テクノロジー・インコーポレイテッド | 自己駆動型キメラ抗原受容体を用いてがんを処置するための組成物および方法 |
| JP2022524507A (ja) * | 2019-03-06 | 2022-05-06 | レンティジェン・テクノロジー・インコーポレイテッド | 自己駆動型キメラ抗原受容体を用いてがんを処置するための組成物および方法 |
| JP2025108415A (ja) * | 2019-03-06 | 2025-07-23 | レンティジェン・テクノロジー・インコーポレイテッド | 自己駆動型キメラ抗原受容体を用いてがんを処置するための組成物および方法 |
| WO2021046653A1 (en) * | 2019-09-13 | 2021-03-18 | Centre For Drug Research And Development | Anti-oncolytic virus antigen antibodies and methods of using same |
| JP7734771B2 (ja) | 2019-12-17 | 2025-09-05 | 合源生物科技(天津)有限公司 | Cd19標的キメラ抗原受容体およびその使用 |
| JP2024056873A (ja) * | 2019-12-17 | 2024-04-23 | 合源生物科技(天津)有限公司 | Cd19標的キメラ抗原受容体およびその使用 |
| JP7439128B2 (ja) | 2019-12-17 | 2024-02-27 | 合源生物科技(天津)有限公司 | Cd19標的キメラ抗原受容体およびその使用 |
| US12441779B2 (en) | 2019-12-17 | 2025-10-14 | Juventas Cell Therapy Ltd. | Plasmid combination and application thereof in preparing modified immune cells |
| JP7430202B2 (ja) | 2019-12-17 | 2024-02-09 | 合源生物科技(天津)有限公司 | プラスミドの組合せおよび改変免疫細胞の調製におけるその適用 |
| JP2023502191A (ja) * | 2019-12-17 | 2023-01-23 | 合源生物科技(天津)有限公司 | プラスミドの組合せおよび改変免疫細胞の調製におけるその適用 |
| JP2023502190A (ja) * | 2019-12-17 | 2023-01-23 | 合源生物科技(天津)有限公司 | Cd19標的キメラ抗原受容体およびその使用 |
| CN110981971A (zh) * | 2019-12-25 | 2020-04-10 | 华夏源(上海)细胞基因工程股份有限公司 | 一种靶向cd19和cd20的双靶点嵌合抗原受体及其表达载体和应用 |
| CN110981971B (zh) * | 2019-12-25 | 2022-12-16 | 华夏源(上海)细胞基因工程股份有限公司 | 一种靶向cd19和cd20的双靶点嵌合抗原受体及其表达载体和应用 |
| JP2023514232A (ja) * | 2020-02-14 | 2023-04-05 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Cd2活性化を伴うキメラ抗原受容体 |
| US12448432B2 (en) | 2020-03-17 | 2025-10-21 | AbelZeta Inc. | Combined chimeric antigen receptor targeting CD19 and CD20 and application thereof |
| CN113549155A (zh) * | 2020-04-23 | 2021-10-26 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | 同时靶向cd19和cd20的嵌合抗原受体及其应用 |
| WO2024173607A3 (en) * | 2023-02-14 | 2024-11-07 | Evolveimmune Therapeutics, Inc. | Combination of bispecific antibodies and chimeric antigen receptor t cells for treatment |
| WO2024182516A1 (en) | 2023-02-28 | 2024-09-06 | Juno Therapeutics, Inc. | Cell therapy for treating systemic autoimmune diseases |
| WO2025006895A1 (en) * | 2023-06-28 | 2025-01-02 | Saliogen Therapeutics Inc. | Nucleic acid constructs and engineered cells for allogeneic therapies |
| WO2025231185A1 (en) | 2024-05-01 | 2025-11-06 | Legend Biotech Ireland Limited | Viral glycoprotein variants and uses thereof |
| WO2026050426A2 (en) | 2024-08-28 | 2026-03-05 | Juno Therapeutics, Inc. | Cd19-directed chimeric antigen receptor cell therapy for treating autoimmune and neurological diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| US10442867B2 (en) | 2019-10-15 |
| EP3661964A1 (en) | 2020-06-10 |
| US11680103B2 (en) | 2023-06-20 |
| JP2020533958A (ja) | 2020-11-26 |
| US20240034802A1 (en) | 2024-02-01 |
| AU2025204005A9 (en) | 2026-03-19 |
| AU2018309735A1 (en) | 2020-02-20 |
| US20200109210A1 (en) | 2020-04-09 |
| JP7237926B2 (ja) | 2023-03-13 |
| AU2025204005A1 (en) | 2025-06-19 |
| AU2018309735B2 (en) | 2025-03-13 |
| CN111183156A (zh) | 2020-05-19 |
| JP2023071842A (ja) | 2023-05-23 |
| JP7574348B2 (ja) | 2024-10-28 |
| JP7838050B2 (ja) | 2026-03-31 |
| US20180355052A1 (en) | 2018-12-13 |
| JP2025020154A (ja) | 2025-02-12 |
| CA3071624A1 (en) | 2019-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240034802A1 (en) | Compositions and methods for treating cancer with anti-cd19/cd20 immunotherapy | |
| US12037403B2 (en) | Compositions and methods for treating cancer with anti-CD123 immunotherapy | |
| US20250084166A1 (en) | Compositions and Methods for Treating Cancer with Anti-CD19/CD22 Immunotherapy | |
| US11878052B2 (en) | Compositions and methods for treating cancer with anti-CD22 immunotherapy | |
| US20240067724A1 (en) | Compositions and Methods for Treating Cancer with Anti-CD19 Immunotherapy | |
| EP3507304A1 (en) | Compositions and methods for treating cancer with duocars | |
| WO2017062820A1 (en) | Chimeric antigen receptors and methods of use | |
| US20240075142A1 (en) | Compositions and Methods for Treating Cancer with Fully Human Anti-CD20/CD19 Immunotherapy | |
| US20230256020A1 (en) | Compositions and Methods for Treating Cancer with TSLPR-CD19 or TSLPR-CD22 Immunotherapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18779075 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3071624 Country of ref document: CA Ref document number: 2020505240 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018309735 Country of ref document: AU Date of ref document: 20180731 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018779075 Country of ref document: EP Effective date: 20200302 |