WO2018186704A1 - 무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법 - Google Patents

무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법 Download PDF

Info

Publication number
WO2018186704A1
WO2018186704A1 PCT/KR2018/004038 KR2018004038W WO2018186704A1 WO 2018186704 A1 WO2018186704 A1 WO 2018186704A1 KR 2018004038 W KR2018004038 W KR 2018004038W WO 2018186704 A1 WO2018186704 A1 WO 2018186704A1
Authority
WO
WIPO (PCT)
Prior art keywords
infa
plasmid
gene
expression cassette
gene expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/004038
Other languages
English (en)
French (fr)
Inventor
정규열
서상우
강채원
임현규
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
POSTECH Academy Industry Foundation
Original Assignee
Seoul National University R&DB Foundation
POSTECH Academy Industry Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation, POSTECH Academy Industry Foundation filed Critical Seoul National University R&DB Foundation
Priority to US16/500,637 priority Critical patent/US12247242B2/en
Publication of WO2018186704A1 publication Critical patent/WO2018186704A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • C12N15/69Increasing the copy number of the vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/02Preparation of hydrocarbons or halogenated hydrocarbons acyclic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/02Preparation of hydrocarbons or halogenated hydrocarbons acyclic
    • C12P5/026Unsaturated compounds, i.e. alkenes, alkynes or allenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44Polycarboxylic acids
    • C12P7/46Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/101Plasmid DNA for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/36Vector systems having a special element relevant for transcription being a transcription termination element
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/10Vectors comprising a special translation-regulating system regulates levels of translation

Definitions

  • the present invention provides a synthetic 5 ′ untranslated region (UTR), a gene expression cassette comprising a promoter and a regulatory gene, an origin of replication and a recombinant vector comprising the gene expression cassette, and improved segregational instability into which the recombinant vector is introduced.
  • the present invention relates to a method for preparing a recombinant microorganism, a recombinant microorganism having improved separation anxiety by introducing the recombinant vector, and a method for quantitatively controlling the number of plasmid copies in a recombinant microorganism.
  • Plasmids were first discovered in the 1930's and are the representative carriers used to introduce genes into cells in the biological engineering field to this day with the development of restriction enzymes. Since they exist independently in cells, they are convenient for genetic manipulation and small in size, and have high efficiency of introduction into cells. Therefore, they have been applied to construct long and complex genetic metabolic circuits necessary for producing foreign proteins.
  • One of the biggest advantages of chromosomes is that since there are at least one and as many as 1000 copies in the cell, gene overexpression can be changed as easily and extensively as the desired intensity.
  • Plasmids can generally persist in cells over generations by providing genes for survival, such as antibiotic resistance, to host cells. At this time, if the cell is not treated with chemicals such as antibiotics, the plasmid is naturally excluded from the host cell because it is only a parasite that does not provide any benefit to the host cell. If a subpopulation with fewer plasmids occurs due to segregational instability when cell division occurs, the population has less metabolic burden to maintain the plasmid, thus increasing its influence in the medium and reducing production performance. Because of this, it is essential to use antibiotics to maintain intracellular plasmids. However, antibiotics are reluctant because of their high cost, contaminating the end product, and the potential for the emergence of multi-drug resistance organisms. Furthermore, antibiotics are degraded by antibiotic resistant proteins during prolonged incubation, which makes them unsuitable for stable plasmid maintenance. Therefore, a new strategy for stable plasmid in cells without requiring antibiotics is required.
  • an antibiotic-free plasmid system has been developed since the 1980s.
  • this system are the essential gene complementation system, the toxin-antitoxin system, the operator-repressor titration system, and the RNA-based selection marker system (RNA-based). selection marker system).
  • the essential gene complementation system is a system that maintains the plasmid by expressing the essential gene in the plasmid instead of removing the essential gene of the chromosome, which is generally used because there are many essential genes that can be used and there is no off-target effect and cytotoxicity. Is preferred. Previous studies from the 1990s over the past few years have applied the system to a variety of host organisms, targeting key metabolites, reducing cofactors, proteins and essential genes involved in cell wall synthesis.
  • Plasmid copy number determines the amount of expression of the entire gene present in the plasmid, independent of the promoter of the gene or the 5'-UTR (5'-untranslated region) intensity. It is possible to control the expression level of target genes and metabolic pathways, so it plays an important role in the mass production of bio-based compounds. Metabolic engineering has used different origins of replication with multiple PCNs as a tool to balance multiple gene pathways. However, the PCN of commonly used plasmids has a very wide range and the intercellular variation is large, and even though the culture conditions are the same, the intercellular variation is large and the results are inconsistent.
  • the inventors of the present invention while studying a system that can control the number of plasmid copies in the non-antibiotic medium, infA which is a survival essential gene as a regulatory gene And By using efp and precisely controlling the expression level of the gene with a promoter, it was confirmed that PCN is predictably regulated quantitatively through this.
  • the system was named STAPL (Stable and TunAble PLasmid) and completed the present invention. .
  • an object of the present invention is a synthetic 5 ′ untranslated region (UTR), a gene expression cassette comprising a promoter and a regulatory gene, a origin of replication and a recombinant vector comprising the gene expression cassette, and a segregational instability into which the recombinant vector is introduced.
  • the present invention provides a method for preparing a recombinant microorganism having improved), a method for preparing a recombinant microorganism having improved separation anxiety by introducing the recombinant vector, and a method for quantifying plasmid copy number in the recombinant microorganism.
  • the present invention provides a gene expression cassette comprising a synthetic 5 'untranslated region (UTR), a promoter and a regulatory gene.
  • UTR 5 'untranslated region
  • the present invention also provides a recombinant vector comprising the origin of replication and the gene expression cassette.
  • the present invention also provides a recombinant microorganism having improved segregational instability into which the recombinant vector is introduced.
  • the present invention comprises the steps of introducing the recombinant vector; It provides a method of producing a recombinant microorganism, the separation anxiety (segregational instability) is improved.
  • the present invention comprises the steps of (a) selecting a promoter having a desired amount of transcription according to the target plasmid copy number; (b) wherein (a) a promoter selected from the step, the synthetic 5'UTR and iiribF, ileS, lspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ , ftsA, ftsZ, lpxC, secM , secA, coaE, can, folK, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB ,
  • InfA a gene encoding a translation initiation factor essential for cells according to the present invention And efp encoding protein elongation factor (EF-P) Is removed from the chromosome of the microorganism and the gene expression cassette containing the regulatory gene Escherichia By introducing coli as a host, the plasmid can be stably maintained in an antibiotic-free medium without intrinsic mutations between cells.
  • infA in the recombinant microorganism And efp When the expression level is precisely controlled through a promoter, PCN can also be quantitatively controlled with high efficiency, and can be widely applied in various industries to produce recombinant proteins.
  • Figure 2 is a schematic diagram showing the process of maintaining a stable plasmid in the conventional plasmid separation anxiety phenomenon and the STAPL applied strain of the present invention with or without antibiotics.
  • Figure 3 shows the plasmid retention ratio measured by incubating for 40 generations of STG1 and STG0 E. coli strains without the STAPL application of the recombinant vector of the present invention (Fig. 3A), culture 0, 10, 20, and 40 generations Fig. 3B shows the fluorescence profile of each cell.
  • Figure 4 shows the ratio of the STGC1 strain with STAPL and the STGC0 strain without STAPL, which were transformed by introducing two plasmids each containing infA and efp, maintained the plasmid for 40 generations, either eGFP (FIG. 4A) or mCherry (FIG. Fig. 4B shows the result of fluorescence measurement.
  • Figure 5 is a diagram showing the plasmid retention ratio measured by incubating for 40 generations of STG7 and E. coli strains without the STAPL introduced high replication number recombinant plasmid of the present invention.
  • Figure 6 is a schematic diagram of the mechanism of PCN regulation through the mechanism of regulating the expression level of infA in the STAPL strain of the present invention.
  • Figure 7 shows the relative fluorescence of specific fluorescence (FIG. 7A) and actual PCN and infA in the antibiotic-free medium of the STG1-5 strain produced by applying STAPL to the STG0 strain and introducing gene expression cassettes containing promoters of infA of varying intensity.
  • Figure 8 is a diagram showing the results of measuring the fluorescence profile per cell of the 0, 10, 20, and 40 generation of the STG2-5 strain of the present invention.
  • FIG. 9 is a diagram schematically illustrating a STAPL system including a cad gene for producing itaconic acid as a target gene and a corresponding plasmid.
  • FIG. 10 shows the results (FIG. 10A) and PCN (FIG. 10B) after 30 hours of itaconic acid production using the recombinant strain STI0-5 of the present invention.
  • FIG. 11 is a diagram schematically illustrating an STAPL system and a corresponding plasmid containing idi , ispA , and crtEBI genes for producing lycopene as target genes.
  • FIG. 12 is a diagram showing a specific production aspect of lycopene (FIG. 12A) and PCN (FIG. 12B) when the OD of the lycopene production strain using the recombinant strain STL0-5 of the present invention is about 0.8.
  • the present invention provides a gene expression cassette comprising a synthetic 5 ′ untranslated region (UTR), a promoter and a regulatory gene.
  • UTR 5 ′ untranslated region
  • the term “regulatory gene” refers to a survival essential gene that is directly linked to the viability of the host cell.
  • the regulatory gene When the regulatory gene is expressed on a plasmid other than the host cell chromosome, it is essential for the host cell to survive.
  • the required survival essential genes can be expressed in the plasmid, and the transcription level of the plasmid can be regulated through a mechanism of regulating the amount of survival essential gene expression.
  • Gene expression cassette of the invention may take advantage of a gene known as the essential gene in E. coli as a control gene, preferably iiribF, ileS, lspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folK, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF, ribD
  • promoter of the present invention of the present invention is involved in the binding of RNA polymerase to initiate transcription as part of DNA. Generally, it refers to a sequence located upstream of and adjacent to a target gene on the same strand as the target gene.
  • iiribF, ileS, lspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can , folK, hemL, yadR, dapD , map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE, accA, tilS, proS, hemB, secD, secF , ribD , ribE , nusB , thiL , dxs , isp
  • Constitutive promoter means a promoter capable of always express the gene, regardless of the characteristics such as the external stimulus, the growth stage, the organization and, constitutive promoter of the present invention iiribF, ileS, lspA, ispH, dapB , folA, imp, ftsL, ftsI , murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folK, hemL, yadR, dapD, map, rpsB , tsf, pyrH, frr, dxr , ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB, dnaE,
  • the constant promoter of the present invention is preferably a promoter comprising a sequence represented by SEQ ID NOS: 1 to 5, having at least 60%, preferably 70%, more preferably 80% or more sequence homology with the sequence. As long as it can play a substantially homogeneous role, it can be added, deleted, or substituted appropriately by those skilled in the art.
  • the constant promoter of the present invention is preferably, for example, J23112, J23116, J23109, J23118 and J23100 promoters, which may be purchased or synthesized.
  • the expression level of the control gene operably linked to the promoter can be selected and regulated by a promoter having a desired level of expression intensity, thereby controlling PCN, and further, gene production of the target gene.
  • Synthetic 5 ′ UTR included in the expression cassette of the present invention is for low expression of the gene, UTR Designer (doi: 10.1016 / j.ymben.2012.10.006, http://sbi.postech.ac.kr/utr_designer)
  • a low intensity 5'UTR indicating a value of 100 to 100,000 calculated through the use may be used, preferably 5'UTR indicating a value of 1000 to 2000 can be used.
  • one synthetic 5′UTR selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 54, 55, 56 and 59 is used as a preferred example.
  • the gene expression cassette of the present invention may further comprise a target gene.
  • target gene used in the present invention means a gene encoding a metabolite which is a target product of a recombinant microorganism incorporating the gene expression cassette of the present invention.
  • the gene of interest included in the gene expression cassette may include a gene encoding a substance required for mass production.
  • a gene encoding itaconic acid or lycopene is used, but is not limited thereto.
  • the gene encoding itaconic acid is Aspergillus A cad foreign gene derived from terreus may be used, but is not limited thereto.
  • any sequence capable of achieving the production of itaconic acid may be interpreted as being included in the sequence of the present invention without limitation.
  • the gene encoding lycopene is Escherichia ispA and idi from coli And Pantoea
  • the crtEBI gene derived from agglomerans may be used, but is not limited thereto, and any sequence capable of achieving the production of lycopene may be interpreted as being included in the sequence of the present invention without limitation.
  • the gene expression cassette of the present invention may further comprise a terminator.
  • the terminator included in the gene expression cassette of the present invention is connected to the end of the gene expression cassette DNA to terminate the transcription of the gene expression cassette DNA, and can be adopted and used at an appropriate level selected by those skilled in the art to suit the promoter.
  • BBa_B1002 represented by SEQ ID NO: 53 was used.
  • the present invention also provides a recombinant vector comprising the origin of replication and the gene expression cassette.
  • vector refers to a gene construct containing a nucleotide sequence of a gene operably linked to a suitable regulatory sequence to allow expression of the gene of interest in a suitable host, wherein the regulatory sequence is a promoter capable of initiating transcription. , Any operator sequence for regulating such transcription, and a sequence regulating termination of transcription and translation.
  • a plasmid can be used as the recombinant vector used in the present invention.
  • a plasmid without limitation may be used irrespective of the origin of the plasmid, but preferably, a plasmid including a replication origin to have a number of 1 to 600 copies per cell may be used, and more preferably, a cell. One having 40 to 500 copies per sugar can be used.
  • the recombinant vector of the present invention includes a replication origin (replicon), and any sequence capable of replicating the recombinant vector can be used without limitation in the sequence of the present invention.
  • a replication origin replicon
  • any sequence capable of replicating the recombinant vector can be used without limitation in the sequence of the present invention.
  • infA when infA was used as a regulatory gene, CloDF -13 or PMB1 was used as a replication origin, and CloE1 was used when efp was used as a regulatory gene.
  • the recombinant vector of the present invention may include a promoter for regulating the expression of a regulatory gene and a restriction enzyme site for inserting a target gene for use as a copy number control cloning vector, and the selection of cells having the recombinant vector. It may include a selection marker for.
  • the present invention also provides a recombinant microorganism having improved segregational instability into which the recombinant vector is introduced.
  • improved separation anxiety means that a microorganism into which a recombinant vector is introduced can stably maintain a number of recombinant vectors in a strain even in a series of passages.
  • wild type E. coli W3110 strain was used as a preferred example of the recombinant microorganism, but may be used without limitation.
  • wild-type E. coli means a natural E. coli, which is not subjected to artificial gene recombination, substitution, mutation, or the like.
  • Recombinant microorganism of the invention is separation anxiety the number of eliminated, and the recombinant vector by a gene cassette to be introduced, and more preferably, on the inner chromosomal recombinant microorganism iiribF, ileS, lspA, ispH, dapB to quantitatively adjust the copy number plasmid , folA, imp, ftsL, ftsI , murE, murF, mraY, murD, ftsW, murG, murC, ftsQ, ftsA, ftsZ, lpxC, secM, secA, coaE, can, folK, hemL, yadR, dapD, map, rpsB , tsf, pyrH, frr, dxr , ispU, cdsA, yaeL, yaeT, lpxD, fabZ,
  • the present invention comprises the steps of introducing a recombinant vector; It provides a method of producing a recombinant microorganism, the separation anxiety (segregational instability) is improved.
  • recombinant microorganism production method of the present invention it is possible to produce a recombinant microorganism capable of quantitatively controlling the number of recombinant vectors, more preferably the plasmid copy number, by a gene cassette in which separation anxiety is improved and introduced.
  • the present invention comprises the steps of (a) selecting a promoter having a desired amount of transcription according to the target plasmid copy number; (b) wherein (a) a promoter selected from the step, the synthetic 5'UTR and iiribF, ileS, lspA, ispH, dapB, folA, imp, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ftsQ , ftsA, ftsZ, lpxC, secM , secA, coaE, can, folK, hemL, yadR, dapD, map, rpsB, tsf, pyrH, frr, dxr, ispU, cdsA, yaeL, yaeT, lpxD, fabZ, lpxA, lpxB ,
  • step (a) it is possible to quantitatively control the plasmid copy number by selecting a promoter having a desired transcription amount according to the target plasmid copy number.
  • a strong promoter in step (a) it is possible to keep the number of plasmid copies in the recombinant microorganism low.
  • a promoter of weak strength is selected, the number of plasmid copies in the recombinant microorganism can be kept high.
  • the gene expression cassette introduced into the recombinant microorganism may further include a target gene or terminator.
  • the promoter included in the gene expression cassette is preferably a promoter comprising a sequence represented by SEQ ID NO: 1 to 5, at least 60%, preferably 70%, more preferably at least 80% sequence homology with the sequence. As long as it can have a substantially homogeneous role, it can be added, deleted, or substituted appropriately by those skilled in the art.
  • the constant promoter of the present invention is, for example, one promoter selected from the group consisting of promoters represented by SEQ ID NOS: 1 to 5 (J23112, J23116, J23109, J23118 and J23100), the promoters are purchased or synthesized Can be introduced.
  • the plasmid When the regulatory gene is removed from the chromosome in the microorganism and expressed in the plasmid, the plasmid expresses the survival essential genes essential for the host cell to survive, and the transcriptional level of the plasmid is controlled by the survival essential gene expression control mechanism. Bar, quantitative control of the plasmid copy number in the recombinant microorganism is possible.
  • the control of the plasmid copy number can be controlled through the intensity of the selected promoter.
  • the number of plasmid copies in the recombinant microorganism can be kept low.
  • the number of plasmid copies in the recombinant microorganism can be kept high.
  • PCN shows the value calculated by dividing the number of copies of the chromosome by the number of copies of the plasmid.
  • the terminator and 5'-UTR sequence and gene sequence used in the present invention are shown in Table 5 below.
  • the infA expression cassette was constructed with a medium intensity constant promoter (J23116), a low intensity 5'-UTR representing a value of 1115.3 that was computed by the UTR designer, and a synthetic terminator (BBa_B1002). Since the plasmid-based expression system exists in several copy numbers, cloning in the same amount as the expression amount on the chromosome can design the expression cassette so that it may burden cells and hinder growth and thus lower infA expression. In order to indirectly observe plasmid copy number (PCN) eGFP was expressed as a reporter protein under the strong constitutive promoter (J23100) and 5′-UTR in the same plasmid.
  • PCN plasmid copy number
  • Escherichia for this The chromosome of the strain W3110 of coli was used as a template, and the infA gene was amplified using the O-infA-F1v1 / O-infA-F2 / O-infA-B primer set shown in Table 3, and cloned using the Bsu 36I restriction enzyme sequence. Inserted into the plasmid. EGFP was then amplified using a set of O-eGFP-F1 / O-eGFP-F2 / O-eGFP-B primers, and finally inserted into the plasmid by cloning with Sac I restriction enzyme sequences to finally produce the pSTAPL_eGFPv1 plasmid. .
  • the completed plasmid is Escherichia It was inserted into the W3110 strain of coli .
  • the Lambda-Red recombination system known in the art was used to remove infA on the chromosome of the strain to maintain nutritional requirements, and the pKD46 plasmid was used.
  • DNA fragments for infA removal were based on FRT- Kan R -FRT and amplified with D-infA-F / D-infA-B primer sets to prepare recombinant E. coli STG1 from which infA was removed.
  • Recombinant plasmids and strains produced through the above process are shown in FIG. 1.
  • the cell culture was performed with E. coli (STG0) having a conventional antibiotic-dependent plasmid maintenance system.
  • FIG. 3 shows the conventional plasmid separation anxiety according to the presence or absence of antibiotics and the process of stably maintaining the plasmid in the STAPL-applied strain, and the plasmid maintenance ratio measured by culturing STG1 and STG0 coli strains for 40 generations (FIG. 3A And the fluorescence profile of each cell at the 0, 10, 20, and 40th generation of culture (FIG. 3B) are shown in FIG. 3.
  • the strain without the addition of antibiotics STG0 strain generated about 56.2% cells without plasmid in the 10th generation, the fluorescence ratio was 13.7% in the 40th generation to maintain the plasmid in the strain It was confirmed that one ratio decreased drastically.
  • the fluorescence ratio was 65% at 40 generations after the 0 generation. It was.
  • the STG1 strain applied with STAPL maintained the fluorescence ratio as high as 100% for 40 generations without the addition of antibiotics, and the fluorescence ratio was 97.2% in the 40 generations compared to the 0 generation, resulting in a uniform cell population showing the plasmid in the strain. It was confirmed that the inherent variation is small.
  • the recombinant plasmid can be stably maintained for a long time using the recombinant E. coli with the STAPL system.
  • Expression cassette is within a regulatory gene associated with viability of the cell and direct it efp coding for the translation initiation in the cross-feeding effect can be minimized and a protein factor -1 infA elongation factor (EF-P) coding for the (IF-1) was selected to build the STAPL system.
  • EFP protein factor -1 infA elongation factor
  • plasmids for introducing efp into strains were prepared using pETduet, known as intermediate copy (40 copies per cell), and CloE1 as the origin of replication (replicon).
  • the expression cassette contained in a plasmid for introducing efp was constructed, including the 5'-UTR, and the synthetic terminator (BBa_B1002) of the low strength of 1169.4 designed by a constitutive promoter (J23116) and UTR designer of medium intensity .
  • BBa_B1002 synthetic terminator of the low strength of 1169.4 designed by a constitutive promoter (J23116) and UTR designer of medium intensity .
  • Cloning in the same amount of expression on the chromosome was designed such that the expression cassette was designed to lower the efp expression because it could burden cells and hinder growth.
  • mCherry was expressed as a reporter protein under the strong constitutive promoter (J23100) and 5′-UTR in the same plasmid.
  • mCherry was templated and amplified using the O-mCherry-F1 / O-mCherry-F2 / O-mCherry-B primer sets in Table 2 and inserted into the pET plasmid via cloning with Sac I restriction enzyme sequences. PET-mCherry plasmid was produced.
  • the chromosome of the strain W3110 of Escherichia coli was used as a template, and the efp gene was amplified using the O-efp-F1 / O-efp-F2 / O-efp-B primer sets shown in Table 3. .
  • STGC0 and STGC1 strains were modified in a modified 3 ml glucose M9 medium (100 mM phosphate buffer, 0.5 g / L MgSO 4 .7H 2 O, 2 g / L NH 4 Cl, 2 g / L) as medium conditions for plasmid stability testing.
  • NaCl, containing 1 g / L casamino acid was added to 4 g / L glucose as the sole carbon source), and then incubated at 37 ° C at 250 rpm, and passaged once every 5 generations for 40 generations.
  • the culture was carried out. Initial cell concentration was diluted to an OD 600 concentration of 0.05 to be identical to cells prepared through incubation in the same medium beforehand.
  • STGC0 conventional antibiotic dependent plasmid maintenance system
  • STGC0 conventional antibiotic dependent plasmid maintenance system
  • eGFP fluorescence was measured using a VICTOR 1420 multilabel plate reader and a 486 nm wavelength filter and a 535 nm emission filter. Measured using.
  • mCherry fluorescence was measured using a Hidex Sense microplate reader, a 575 nm wavelength filtration filter and a 610 nm wavelength emission filter, and the results of the measured fluorescence are shown in FIGS. 4A and 4B.
  • the pCDF plasmid in the STGC0 strain without antibiotics was reduced in 40 strains compared to the 0 generation, indicating that the fluorescence ratio was 6.6%.
  • the pCDF plasmid of the STGC0 strain with antibiotics showed a fluorescence rate of 62.4% in 40 strains, which was higher than that of the STGC0 strain with antibiotics, but the number of plasmids decreased through repeated passages.
  • the STGC1 strains to which STAPL was applied to multiple plasmids maintained high fluorescence for 40 generations without the addition of antibiotics. It was confirmed. As shown in FIG.
  • the STGC0 strain was confirmed to maintain a low number of plasmids with or without antibiotics. Specifically, the strain without antibiotics showed a fluorescence rate value of 11.6% after 40 generations, and when the antibiotics were added, the strain after 40 generations showed a fluorescence rate of 78.5%. STGC1 strains to which the STAPL system was applied did not add antibiotics, but the plasmid remained stable for 40 generations, and the fluorescence ratio increased with generation, and the fluorescence ratio was 247% in the 40 generation strains. It was confirmed.
  • the antibiotic-dependent plasmid maintenance system was compared with the STAPL system, and it was confirmed that the plasmid could be stably maintained for a long time even when the infA and efp genes were used as the regulatory gene in the STAPL system. When applied, it was confirmed that the number of plasmids in the recombinant strain could be stably maintained for a long time.
  • the expression cassette was constructed including the low strength of the 5'-UTR, and the synthetic terminator (BBa_B1002) of the design 263.75 by the constitutive promoter (J23112) and UTR designer of lower intensity contained in the plasmid for introducing the infA .
  • the expression cassette was designed so that the burden on the cells and hinder growth, thereby lowering infA expression.
  • eGFP was expressed as a reporter protein under the strong constitutive promoter (J23118) and 5′-UTR in the same plasmid.
  • pUC19 was used as a template and amplified using the O-pUC19-F / O-pUC19-B primer set in Table 3, and eGFP was used as the template for eGFP and O-eGFP-F1v2 / O-eGFP- in Table 3. Amplified using a set of F2v2 / O-eGFP-Bv2 primers, pUC19-eGFP plasmid was prepared by inserting into pUC19 plasmid by cloning with Bsu36 I and Xho I restriction enzyme sequences.
  • the chromosome of the strain W3110 of Escherichia coli was used as a template, and the O-infA-F1v2 / O-infA-F2v2 / O-infA-B1v2 / O-infA-B2v2 primer set of Table 3 was used. InfA gene was amplified. Subsequently, the cells were inserted into the previously prepared pUC19-eGFP plasmid through cloning using Sac I and Aat II restriction enzyme sequences, and pSTAPL_eGFPv7 was prepared.
  • STG6 and STG7 strains were modified in 3 ml of glucose M9 medium (100 mM phosphate buffer, 0.5 g / L MgSO 4 .7H 2 O, 2 g / L NH 4 Cl, 2 g / L) as medium conditions for plasmid stability testing.
  • NaCl, containing 1 g / L casamino acid was added to 4 g / L glucose as the sole carbon source), and then incubated at 37 ° C at 250 rpm, and passaged once every 5 generations for 40 generations.
  • the culture was carried out.
  • Initial cell concentration was diluted to an OD 600 concentration of 0.05 to be identical to cells prepared through incubation in the same medium beforehand.
  • the conventional antibiotic dependent plasmid maintenance system STG6 used as a positive control, the culture was carried out further comprising 50 ⁇ g / ml of ampicillin as an antibiotic for plasmid maintenance.
  • Cell growth in culture was measured by measuring the absorbance at 600 nM wavelength using UV-1700 spectrophotometer.
  • the eGFP fluorescence was measured using a VICTOR 1420 multilabel plate reader and a 486 nm wavelength filter and a 535 nm emission filter. Measured using. The results of the measured fluorescence are shown in FIG. 5.
  • the pUC19 plasmid decreased in 40 strains compared to the 0 generation, indicating that the fluorescence ratio was 37.7%.
  • the pUC19 plasmid of the antibiotic-added STG6 strain showed a fluorescence rate of 54.6% in 40 strains, which was higher than that of the antibiotic-treated STG6 strain, but the number of plasmids decreased through repeated passages.
  • the STG7 strains to which STAPL was applied to the plasmids with high copy numbers maintained high fluorescence for 40 generations without the addition of antibiotics. Log expression was confirmed to increase.
  • the plasmid can be stably maintained for a long time even for a plasmid having a high copy number in the STAPL system.
  • InfA cassettes with promoters of different intensities were amplified with a set of O-infA-F1v2-5 / O-infA-B primers and finally inserted into the plasmid by cloning with the Bsu 36I restriction enzyme sequence to finally obtain the pSTAPL_eGFPv2-5 plasmid.
  • the completed plasmid is Escherichia It was inserted into the W3110 strain of coli , and then infA on the chromosome was removed to maintain nutritional requirements.
  • a conventionally known Lambda-Red recombination system was used to remove infA and the pKD46 plasmid.
  • DNA fragments for infA removal were amplified with the FRT- Kan R- FRT template using the D-infA-F / D-infA-B primer set.
  • STG1 prepared in Example 1 through the above procedure to prepare a recombinant E. coli STG2-5 infA was removed on the chromosome.
  • Promoter strength was measured by RT-qPCR using the StepOnePlus Real-time PCR system in the actual system used to determine the amount of infA transcript actually transcribed. It was used for Q-infA-F / Q- infA-B primer set to amplify the infA transcript, a housekeeping gene hcaT and cysG in the chromosome as a reference, and to amplify the hcaT and cysG transcripts Q-hcaT-F / Q-hcaT-B and Q-cysG-F / Q-cysG-B primer sets were used.
  • the relative amount of infA transcript was quantified by the C T comparison method and its relative intensity is shown in Table 2 above. The predicted intensity and actual expression level of the promoters used were slightly different, but the general tendency was confirmed to be consistent.
  • PCN was defined as the number of plasmids per chromosome. PCN was measured using a StepOnePlus Real-time PCR system and quantitative polymerase chain reaction (qPCR). Q-pCDF-F / Q-pCDF-B and Q-polA-F / Q-polA-B primer sets were used to amplify specific portions of plasmids and chromosomes, respectively. Finally, infA -inserted STAPL strains having five different expression levels were cultured in the same medium used in 20 ml of Example 1.
  • the STAPL system of the present invention does not impose a metabolic burden on cells from the specific growth rate of the STG1 to 5 strains, all showing a similar value at 0.47 h ⁇ 1 .
  • STG2-5 strains were confirmed to maintain a stable fluorescence per cell even if the number of generations increased by continued passage culture as in the previous strain STG1 in Example 1.
  • the STAPL system of the present invention can quantitatively control PCN up to 5.6 times without additional metabolic burden in cells expressing the system by precisely adjusting the expression level of infA .
  • the strain to which the system is applied can maintain the plasmid for a long time stably and minimize the intercellular variation, compared to the conventional antibiotic dependent plasmid maintenance system, and also precisely regulate the PCN by controlling the infA expression amount.
  • Aspergillus to produce itaconic acid the target product of E. coli A cad foreign gene derived from terreus was used in a codon optimized form by Thermo Fisher.
  • the expression cassette was used in place of the expression cassette utilizing the tac promoter and synthetic 5 ′ UTR.
  • the synthetic 5 ′ UTR was designed to maximize the expression level of the gene, and the synthetic 5 ′ UTR was designed to have a predicted expression amount of 1 million or more through the UTR Designer.
  • a pCDFDuet plasmid having an intermediate copy number was used as a template and amplified using the O-pCDF-F / O-pCDF-B primer set shown in Table 3.
  • cad was subsequently amplified with O-cad-F1 / O-cad-B1 and O-cad-F2 / O-cad-B2 primer sets, and then inserted into the plasmid by cloning with Bsa I restriction enzyme sequences.
  • pCDF-CAD plasmid was prepared. Escherichia to prepare pSTAPL_CAD_v1-5 to which STAPL was applied to the plasmid
  • the infA gene was amplified using the O-infA-F1v1-5 / O-infA-F2 / O-infA-B primer set shown in Table 3 using the chromosome of the W3110 strain of coli , and cloned using the Bsu 36I restriction enzyme sequence. Inserted into the plasmid via. The completed plasmid was inserted into the W3110 strain of Escherichia coli .
  • the result of 30 hours after the production of 0.28 g / L of itaconic acid was found to be negligible in the STI0 strain containing no antibiotics, but in the STI0 strain containing antibiotics. Approximately twice that of 0.42 g / L of production was confirmed.
  • the STAPL applied production system without antibiotics identified 0.69 g / L of itaconic acid, which is 170% higher than the STI0 strain containing antibiotics in the STI1 strain, which has the lowest infA expression and maintains the highest PCN. It was confirmed that these values represented values of about 0.6 g / L.
  • InfA was amplified using the O-infA-F1v1-5 / O-infA-F2 / O-infA-B primer set in Table 3 using the chromosome of the W3110 strain of coli , and cloned using the Bsu 36I restriction enzyme sequence. Inserted into the plasmid via. The completed plasmid was inserted into the W3110 strain of Escherichia coli .
  • Recombinant E. coli strain STL0-5 comprises a modified 20 ml glucose 2X M9 medium (200 mM phosphate buffer, 1 g / L MgSO 4 .7H 2 O, 4 g / L NH 4 Cl, 4 g / L NaCl, 4 g / a L of glucose used as the only carbon source) was placed in, were cultured for 24 hours at 37 ° C under the conditions of 250 rpm, an initial cell concentration is equal to the cells prepared by incubation in a culture medium, such as a pre OD 600 Dilute to 0.05 concentration.
  • a culture medium such as a pre OD 600 Dilute to 0.05 concentration.
  • Escherichia Applying the STAPL system using infA using coli as a host cell can precisely quantitatively control PCN according to the infA expression level, thus solving the conventional problem that expensive antibiotics must be added to the medium to effectively control PCN. It was confirmed that this is possible.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 합성 5' UTR(untranslated region), 프로모터 및 조절 유전자를 포함하는 유전자 발현 카세트, 복제원점 및 상기 유전자 발현 카세트를 포함하는 재조합 벡터, 상기 재조합 벡터가 도입된 분리 불안(segregational instability)이 개선된 재조합 미생물, 상기 재조합 벡터를 도입하여 분리 불안이 개선된 재조합 미생물의 제조 방법 및 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법에 관한 것이다. 본 발명에 따른 세포에 필수적인 번역 개시 인자를 코딩하는 유전자인 infA 및 단백질 신장 인자(EF-P)를 코딩하는 efp를 미생물의 염색체에서 제거시키고 상기 조절 유전자를 포함하는 유전자 발현 카세트를 Escherichia coli를 숙주로 하여 도입하면, 세포 간 고유변이 없이 무항생제 배지에서 플라스미드를 안정적으로 유지할 수 있다. 또한, 상기 재조합 미생물에서 infA efp 발현량을 프로모터를 통하여 정밀하게 조절할 경우, PCN 역시 높은 효율로 정량적으로 제어할 수 있어, 재조합 단백질을 생산하고자 하는 다양한 산업에서 광범위하게 적용할 수 있다.

Description

무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법
본 발명은 합성 5′ UTR(untranslated region), 프로모터 및 조절 유전자를 포함하는 유전자 발현 카세트, 복제원점 및 상기 유전자 발현 카세트를 포함하는 재조합 벡터, 상기 재조합 벡터가 도입된 분리 불안(segregational instability)이 개선된 재조합 미생물, 상기 재조합 벡터를 도입하여 분리 불안이 개선된 재조합 미생물의 제조 방법 및 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법에 관한 것이다.
플라스미드는 1930년대에 처음 발견되어 제한 효소의 발전으로 오늘날까지 생물 공학 분야에서 유전자를 세포 내로 도입하기 위해 사용되고 있는 대표적인 운반체이다. 이는 세포 내에서 독립적으로 존재하여 유전자 조작이 편리하고 크기가 작아 세포로의 도입 효율이 좋아서 외래 단백질을 생산하기 위해 필요한 길고 복잡한 유전적 대사회로를 구축하는데 응용되고 있다. 크로모솜과 차별되는 가장 큰 장점으로 세포 내에서 적게는 1개, 많게는 1000카피까지 존재하기 때문에 유전자 발현량을 원하는 세기만큼 쉽고 광범위하게 바꿀 수 있기 때문에, 유전자 과발현을 활용한 연구들이 많이 진행되었다.
플라스미드는 일반적으로 숙주 세포에게 항생제 저항성과 같이 생존에 필요한 유전자를 제공함으로써 세대가 지나도 계속해서 세포 안에 존재할 수 있다. 그런데 이때, 세포에게 항생제와 같은 화학적 처리를 하지 않으면 플라스미드는 그 숙주 세포에게 어떠한 혜택도 주지 않는 기생물질에 불과하기 때문에 자연스럽게 숙주 세포로부터 배제된다. 세포 분열이 일어날 때 분리 불안 (segregational instability) 현상으로 플라스미드를 적게 가지는 부분모집단이 발생하면 그 집단은 플라스미드를 유지하기 위한 신진 대사 부담을 적게 가지므로 배지에서 그 영향력이 증가하고 생산 성능을 감소시킨다. 때문에 세포 내 플라스미드를 계속해서 유지시키기 위해 항생제를 사용하는 것이 필수적이다. 하지만 항생제는 가격이 비싸고 최종 생산물을 오염시키며 다중 약물 내성 생물 (multi-drug resistance organism)을 잠재적으로 출현시킬 가능성 등의 문제가 많아 사용이 꺼려진다. 더욱이 장시간 배양 시에는 항생제 저항성 단백질에 의해 항생제가 분해되기 때문에 플라스미드의 안정적 유지에 적합하지 않기에, 항생제를 필요로 하지 않으면서 세포 내에서 플라스미드를 안정하게 유지하는 새로운 전략이 요구된다.
항생제를 사용하지 않고 플라스미드의 분리 불안을 해결하는 대안으로, 1980년대부터 항생제 없는 플라스미드 시스템 (antibiotic-free plasmid system)이 개발되었다. 이 시스템의 예로는 필수 유전자 보완 시스템 (essential gene complementation system), 독소-항독소 시스템 (toxin-antitoxin system), 조작자-억제제 적정 시스템 (operator-repressor titration system), 그리고 RNA 기반 선택 마커 시스템 (RNA-based selection marker system) 등이 있다. 이 중 필수 유전자 보완 시스템은 크로모좀의 필수 유전자를 제거하는 대신 플라스미드에 그 필수 유전자를 발현시켜서 플라스미드가 유지되도록 하는 시스템인데, 일반적으로 사용될 수 있는 필수 유전자가 많고 오프 타겟 효과와 세포 독성이 없어서 가장 선호된다. 1990년대부터 지난 몇 년간 진행된 선행 연구들에서 주요 대사산물, 환원 보조 인자, 단백질 및 세포벽 합성에 관여하는 필수 유전자를 타겟으로 다양한 숙주 생물에 해당 시스템을 적용시킨 바 있다.
플라스미드 카피 수 (plasmid copy number, PCN) 는 유전자의 프로모터나 5‘-UTR (5'-untranslated region) 세기와는 별개로 플라스미드에 존재하는 유전자 전체의 발현량을 결정함으로서, 이를 조절할 수 있다는 것은 곧 타겟 유전자와 대사경로의 발현량 조절을 가능하게 하는 것이기 때문에 바이오기반 화합물을 산업적으로 대량 생산하는데 매우 중요한 역할을 한다. 대사공학 분야에서는 다중 유전자 경로의 균형을 맞추는 도구로서 다양한 PCN을 가지는 다른 복제 원점을 사용해 왔다. 하지만 일반적으로 사용되는 플라스미드의 PCN은 매우 넓은 범위를 가지고 세포 간 변이가 커서 배양 조건을 동일하게 하더라도 세포 간 변이가 커서 결과가 일관성 있지 않다. 또한 지금까지 개발된 PCN 조절 시스템은 모두 항생제가 필요한 조건이고, 무작위 돌연변이와 같은 합리적 접근법으로 카피 수를 조절하는 연구는 패턴을 분석하기 어렵고 정교한 조절이 어렵다는 단점이 있다. 또한, 특히 배지에 값 비싼 항생제가 반드시 첨가되어야 한다는 점에서 무항생제 배지에서 안정적으로 플라스미드 카피 수를 조절할 수 있는 시스템에 대한 필요성이 대두되고 있다.
이에, 본 발명자들은 무항생제 배지 내 플라스미드 카피 수를 조절할 수 있는 시스템에 관하여 연구하던 중 조절 유전자로 생존 필수 유전자인 infA efp를 이용하고 프로모터로 상기 유전자의 발현량을 정교하게 조절하면 이를 통해 정량적으로 PCN이 예측 가능하게 조절됨을 확인하였는바, 본 시스템을 STAPL (Stable and TunAble PLasmid) 이라 명명하고, 본 발명을 완성하였다.
따라서 본 발명의 목적은 합성 5′ UTR(untranslated region), 프로모터 및 조절 유전자를 포함하는 유전자 발현 카세트, 복제원점 및 상기 유전자 발현 카세트를 포함하는 재조합 벡터, 상기 재조합 벡터가 도입된 분리 불안(segregational instability)이 개선된 재조합 미생물, 상기 재조합 벡터를 도입하여 분리 불안이 개선된 재조합 미생물의 제조 방법 및 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 합성 5′ UTR(untranslated region), 프로모터 및 조절 유전자를 포함하는 유전자 발현 카세트를 제공한다.
또한 본 발명은 복제원점 및 상기 유전자 발현 카세트를 포함하는 재조합 벡터를 제공한다.
또한 본 발명은 상기 재조합 벡터가 도입된 분리 불안(segregational instability)이 개선된 재조합 미생물을 제공한다.
또한 본 발명은 상기 재조합 벡터를 도입하는 단계; 를 포함하는, 분리 불안(segregational instability)이 개선된 재조합 미생물의 제조 방법을 제공한다.
또한 본 발명은 (a) 목적 플라스미드 카피 수에 따라 목적 전사량을 가지는 프로모터를 선택하는 단계; (b) 상기 (a) 단계에서 선택된 프로모터, 합성 5′UTR 및 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE, can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ, lpxA , lpxB , dnaE , accA , tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX, adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA, ftsK , lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ, fabD , fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA, ribA , fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT, pgsA , metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda, der , hisS , ispG , suhB , acpS , era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA, alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca, folB , ygjD , dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK, yhbN , yhbG , rpsI , rplM , degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE, glyT , thrU , coaA , birA , murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX, rho, trpT , glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA, gpsA , glyQ , glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD, rplW , rplB , rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE, rpmD , rplO , secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS, groL , efp , psd , rsgA , orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자를 포함하는 유전자 발현 카세트를 제조하는 단계; 및 (c) 상기 (b) 단계에서 제조한 유전자 발현 카세트를 미생물에 도입하는 단계;를 포함하는 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법을 제공한다.
본 발명에 따른 세포에 필수적인 번역 개시 인자를 코딩하는 유전자인 infA 및 단백질 신장 인자(EF-P)를 코딩하는 efp 를 미생물의 염색체에서 제거시키고 상기 조절 유전자를 포함하는 유전자 발현 카세트를 Escherichia coli를 숙주로 하여 도입하면, 세포 간 고유변이 없이 무항생제 배지에서 플라스미드를 안정적으로 유지할 수 있다. 또한, 상기 재조합 미생물에서 infA efp 발현량을 프로모터를 통하여 정밀하게 조절할 경우, PCN 역시 높은 효율로 정량적으로 제어할 수 있어, 재조합 단백질을 생산하고자 하는 다양한 산업에서 광범위하게 적용할 수 있다.
도 1은 야생형 Escherichia coli W3110 균주에 본 발명의 유전자 발현 카세트를 포함하는 재조합 벡터가 도입된 STAPL을 적용시킨 STG1 균주에 대한 모식도이다.
도 2는 항생제 유무에 따른 종래 플라스미드 분리 불안 현상과 본 발명의 STAPL 적용 균주에서 플라스미드가 안정적으로 유지되는 과정을 나타낸 모식도이다.
도 3은 본 발명의 재조합 벡터를 도입한 STG1과 STAPL 적용이 없는 STG0 대장균 균주를 40 세대 간 배양하며 측정한 플라스미드 유지 비율을 나타낸 결과(도 3A), 배양 0, 10, 20, 그리고 40 세대 째의 세포 하나 당 형광 프로파일을 측정한 결과(도 3B)를 나타낸 도이다.
도 4는 infA와 efp를 각각 포함하는 2개의 플라스미드를 도입하여 형질 전환시킨 STAPL 적용시킨 STGC1 균주 및 STAPL 적용이 없는 STGC0 균주가 40 세대 동안 플라스미드를 유지한 비율을 eGFP(도 4A) 또는 mCherry(도 4B)로 형광 측정한 결과를 나타낸 도이다.
도 5는 본 발명의 고 복제 수 재조합 플라스미드를 도입한 STG7과 STAPL 적용이 없는 STG6 대장균 균주를 40 세대 간 배양하여 측정한 플라스미드 유지 비율을 나타낸 도이다.
도 6은 본 발명의 STAPL 균주에서 infA의 발현량 조절의 메커니즘을 통한 PCN 조절의 메커니즘을 모식화한 도이다.
도 7은 STG0 균주에 STAPL을 적용시키고 다양한 세기의 infA의 프로모터를 포함하는 유전자 발현 카세트들을 도입하여 제작된 STG1-5 균주의 무항생제 배지에서의 특정 형광(도 7A)과 실제 PCN 및 infA의 상대적인 프로모터 세기(도 7B), 그리고 균주의 특이적 성장률(도 7C)을 측정한 결과를 나타낸 도이다.
도 8은 본 발명의 STG2-5 균주의 0, 10, 20, 그리고 40 세대 째의 세포 하나 당 형광 프로파일을 측정한 결과를 나타낸 도이다.
도 9는 이타콘산을 생산하기 위한 cad 유전자를 목적 유전자로 포함한 STAPL 시스템 및 및 해당 플라스미드를 모식화하여 나타낸 도이다.
도 10은 본 발명의 재조합 균주 STI0-5를 이용한 이타콘산 생산의 30시간 후의 결과(도 10A) 및 그 때의 PCN(도 10B)을 나타낸 도이다.
도 11은 라이코펜을 생산하기 위한 idi, ispA, 그리고 crtEBI 유전자를 목적 유전자로 포함한 STAPL 시스템 및 해당 플라스미드를 모식화하여 나타낸 도이다.
도 12는 본 발명의 재조합 균주 STL0-5를 이용한 라이코펜 생산의 균주의 OD가 약 0.8일 때의 라이코펜의 특정 생산 양상(도 12A)과 그 때의 PCN(도 12B)을 나타낸 도이다.
본 발명은 합성 5′ UTR(untranslated region), 프로모터 및 조절 유전자를 포함하는 유전자 발현 카세트를 제공한다.
이하, 본 발명에 대하여 상세히 설명한다.
본 발명에서 사용하는 “조절 유전자”는 숙주 세포의 생존력과 직접적으로 연관되어 있는 생존 필수 유전자를 의미하며, 상기 조절 유전자를 숙주세포 염색체가 아닌 플라스미드에 발현시킬 경우, 숙주세포가 생존하기 위해 필수적으로 요구하는 생존 필수 유전자를 플라스미드에서 발현할 수 있고, 플라스미드의 전사 수준을 생존 필수 유전자 발현량 조절의 메커니즘을 통하여 조절 가능하다.
본 발명의 유전자 발현 카세트는 조절 유전자로 대장균 내에서 필수 유전자로 알려진 유전자를 이용할 수 있으며, 바람직하게는 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY, murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR , dapD, map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE , accA , tilS, proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH , cysS , folD, argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK , lolA , serS , rpsA, msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD , fabG , acpP , tmk , holB, lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA , fabI , tyrS , ribC, pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA , metG , folE , yejM, gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS , ispG , suhB , acpS, era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD , ftsB , eno, pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD , dnaG , rpoD , infB, nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG , rpsI , rplM , degS, mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU , coaA , birA , murB, murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX , rho, trpT , glmU , glmS , yidC, rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ , glyS , ftsY , ftsE, ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB , rpsS , rplV , rpsC, rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO , secY , rpsM , rpsK, rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp , psd , rsgA, orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자일 수 있고, 더욱 바람직하게는 infA efp 를 조절 유전자일 수 있다.
본 발명의 본 발명의 용어 “프로모터”는 DNA의 일부분으로 전사를 개시할 수 있도록 RNA 중합효소의 결합에 관여한다. 일반적으로 표적 유전자와 동일 가닥상에 표적 유전자에 인접하여 이의 상류에 위치하는 서열을 말한다. 본 발명에서는 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF, mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR, dapD , map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE , accA, tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH , cysS, folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK , lolA , serS, rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD , fabG , acpP, tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA , fabI , tyrS, ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA , metG , folE, yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS , ispG , suhB, acpS , era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD , ftsB, eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD , dnaG , rpoD, infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG , rpsI , rplM, degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU , coaA , birA, murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX , rho, trpT , glmU , glmS, yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ , glyS , ftsY, ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB , rpsS , rplV, rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO , secY , rpsM, rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp , psd , rsgA, orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자를 발현하기 위하여 합성된 프로모터를 도입하는 것을 특징으로 하며, 상기 프로모터는 항시성 프로모터를 이용하는 것이 바람직하다. 항시성 프로모터(constituitive promoter)란 외부의 자극, 생장단계, 조직 등의 특성과 관계없이 언제나 유전자를 발현시킬 수 있는 프로모터를 의미하며, 본 발명의 항시성 프로모터는 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY , murD , ftsW , murG, murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH, frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE , accA , tilS , proS , hemB , secD , secF, ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD, holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK , lolA , serS , rpsA , msbA , lpxK , kdsB , mukF, mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD , fabG , acpP , tmk , holB , lolC , lolD , lolE , pth, prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA , fabI , tyrS , ribC , pheT , pheS , rplT , infC, thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA , metG , folE , yejM , gyrA , nrdA , nrdB , folC, accD , fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS , ispG , suhB , acpS , era, lepB , pssA , yfiO, rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA, pgk , metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD , dnaG , rpoD , infB , nusA , leuU , glmM , ftsH, obgE , rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG , rpsI , rplM , degS , mreD , mreC , mreB , accB, accC , rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU , coaA , birA , murB , murI , priA , ftsN , yihA, polA , hemG , hemC , hemD , proM , hisR , argX , rho, trpT , glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN, gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ , glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF, trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB , rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN, rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO , secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt, def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp , psd , rsgA, orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자의 발현을 지속적으로 유도하기 위한 목적으로 사용된다. 본 발명의 항시성 프로모터는 서열번호 1 내지 5로 표시된 서열을 포함하는 프로모터인 것이 바람직하며, 상기 서열과 적어도 60%, 바람직하게는 70%, 보다 바람직하게는 80% 이상의 서열 상동성을 갖는 것으로 실질적으로 동질의 역할을 수행할 수 있는 것이라면 당 분야의 전문가들에 의해 적절하게 부가, 결실, 또는 치환되어 사용될 수 있다. 본 발명의 항시성 프로모터는 예컨대, J23112, J23116, J23109, J23118 및 J23100 프로모터인 것이 바람직하며, 상기 프로모터 들은 구입하거나 합성하여 도입할 수 있다. 본 발명에서는 프로모터에 작동가능하게 연결된 조절 유전자의 발현 정도를 원하는 정도의 발현세기를 갖는 프로모터로 선별하여 조절할 수 있으며, 이를 통해 PCN, 나아가 목적 유전자 생산을 조절할 수 있다.
본 발명의 발현 카세트에 포함된 합성 5′ UTR은 유전자를 저발현시키기 위한 것이며, UTR Designer (doi:10.1016/j.ymben.2012.10.006, http://sbi.postech.ac.kr/utr_designer)를 통해 계산된 예측 발현량이 100 내지 100,000의 값을 나타내는 낮은 세기의 5′UTR을 사용할 수 있으며, 바람직하게는 1000 내지 2000의 값을 나타내는 5′UTR을 사용할 수 있다. 본 발명에서는 바람직한 일 예로 서열번호 54, 55, 56 및 59으로 표시되는 염기서열로 이루어진 군으로부터 선택된 1종의 합성 5′UTR을 사용하였다.
본 발명의 유전자 발현 카세트는 목적 유전자를 더 포함할 수 있다. 본 발명에서 사용하는 용어 “목적 유전자”는 본 발명의 유전자 발현 카세트를 도입한 재조합 미생물로 목표하는 생산물인 대사물질을 코딩하는 유전자를 의미한다. 본 발명에 있어서 유전자 발현 카세트에 포함된 목적 유전자는 대량 생산에 필요로 하는 물질을 코딩하는 유전자를 포함할 수 있으며, 본 발명에서는 이타콘산 또는 라이코펜을 코딩하는 유전자를 사용하였으나, 이에 제한되지 않는다. 이타콘산을 코딩하는 유전자는 Aspergillus terreus에서 유래된 cad 외래 유전자를 사용할 수 있으나, 이에 제한되지 않으며, 이타콘산의 생산을 달성할 수 있는 서열이라면 본 발명의 서열에 모두 제한없이 포함되는 것으로 해석될 수 있다. 또한 라이코펜을 코딩하는 유전자는 Escherichia coli에서 유래된 ispAidi Pantoea agglomerans에서 유래된 crtEBI 유전자를 사용할 수 있으나, 이에 제한되지 않으며, 라이코펜의 생산을 달성할 수 있는 서열이라면 본 발명의 서열에 모두 제한없이 포함되는 것으로 해석될 수 있다.
본 발명의 유전자 발현 카세트는 터미네이터를 더 포함할 수 있다. 본 발명의 유전자 발현 카세트에 포함된 터미네이터는 유전자 발현 카세트 DNA의 전사를 종결하기 위해 유전자 발현 카세트 DNA 말단에 연결되는 것으로, 프로모터에 맞게 당업자의 적정 선택 수준에서 채택하여 사용할 수 있어 특별히 제한되지 않는다. 본 발명에서는 바람직한 일 예로, 서열번호 53으로 표시되는 BBa_B1002를 사용하였다.
또한 본 발명은 복제원점 및 상기 유전자 발현 카세트를 포함하는 재조합 벡터를 제공한다.
용어 "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 함유하는 유전자 작제물을 의미하는 것으로, 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 본 발명에서 사용하는 재조합 벡터로 바람직하게는 플라스미드를 이용할 수 있다.
본 발명에 있어서, 상기 플라스미드의 origin과 관계없이 제한 없는 플라스미드를 사용할 수 있으나, 바람직하게는 세포 당 1 내지 600 카피 수를 가지도록 하는 복제원점을 포함하는 플라스미드를 사용할 수 있으며, 보다 바람직하게는 세포 당 40 내지 500 카피수를 가지는 것을 사용할 수 있다.
본 발명의 재조합 벡터는 복제원점(레플리콘)을 포함하며, 재조합 벡터의 복제를 가능케 할 수 있는 서열이라면 본 발명의 서열에 모두 제한없이 사용할 수 있다. 본 발명에서는 바람직한 일예로, 조절 유전자로 infA를 사용한 경우에는 복제원점으로 CloDF-13 또는 PMB1을 사용하였고, 조절 유전자로 efp을 사용한 경우에는 CloE1을 사용하였다.
또한 본 발명의 재조합 벡터는 복제수 조절가능한 클로닝 벡터로 사용하기 위하여 조절 유전자의 발현을 조절하기 위한 프로모터 및 목적 유전자를 삽입하기 위한 제한효소 부위를 포함할 수 있으며, 상기 재조합 벡터를 가진 세포의 선별을 위한 선택 마커를 포함할 수 있다.
또한 본 발명은 상기 재조합 벡터가 도입된 분리 불안(segregational instability)이 개선된 재조합 미생물을 제공한다.
본 발명에서 사용된 “분리 불안이 개선된”은 재조합 벡터가 도입된 미생물이 일련의 계대 배양에도 일정 수 이상의 재조합 벡터의 수를 균주 내에 안정적으로 유지할 수 있는 것을 의미한다.
본 발명에서는 재조합 미생물의 바람직한 일예로 야생형 대장균 W3110 균주를 이용하였으나, 이에 제한됨 없이 사용할 수 있다. 본 발명에 있어서, 야생형 대장균이란 인공적인 유전자의 재조합, 치환, 돌연변이 등이 가해지지 않은 천연 상태의 대장균을 의미한다.
본 발명의 재조합 미생물은 분리 불안을 해소하고 도입되는 유전자 카세트에 의하여 재조합 벡터의 수, 보다 바람직하게는 플라스미드 카피 수를 정량적으로 조절하기 위하여, 재조합 미생물 내 염색체 상의 iiribF, ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY , murD , ftsW , murG , murC , ftsQ, ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH , frr , dxr, ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE , accA , tilS , proS , hemB , secD , secF , ribD, ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA, rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK , lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE, mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD , fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA, ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA , fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS, nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA , metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD, fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS , ispG , suhB , acpS , era, lepB , pssA , yfiO , rplS, trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk, metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD , dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE, rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG , rpsI , rplM , degS , mreD , mreC , mreB , accB , accC, rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU , coaA , birA , murB , murI , priA , ftsN , yihA , polA, hemG , hemC , hemD , proM , hisR , argX , rho, trpT , glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB, spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ , glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS, rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB , rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX, rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO , secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC, ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp , psd , rsgA , orn , yjeE, rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자가 제거된 것을 특징으로 하며, 바람직하게는 infA efp로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자가 제거된 것을 특징으로 한다.
또한 본 발명은 재조합 벡터를 도입하는 단계; 를 포함하는, 분리 불안(segregational instability)이 개선된 재조합 미생물의 제조 방법을 제공한다.
본 발명의 재조합 미생물 제조방법을 이용하면, 분리 불안이 개선되고 도입되는 유전자 카세트에 의하여 재조합 벡터의 수, 보다 바람직하게는 플라스미드 카피 수를 정량적으로 조절 가능한 재조합 미생물을 제조할 수 있다.
또한 본 발명은 (a) 목적 플라스미드 카피 수에 따라 목적 전사량을 가지는 프로모터를 선택하는 단계; (b) 상기 (a) 단계에서 선택된 프로모터, 합성 5′UTR 및 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE, can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ, lpxA , lpxB , dnaE , accA , tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX, adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA, ftsK , lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ, fabD , fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA, ribA , fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT, pgsA , metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda, der , hisS , ispG , suhB , acpS , era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA, alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca, folB , ygjD , dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK, yhbN , yhbG , rpsI , rplM , degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE, glyT , thrU , coaA , birA , murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX, rho, trpT , glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA, gpsA , glyQ , glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD, rplW , rplB , rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE, rpmD , rplO , secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS, groL , efp , psd , rsgA , orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자를 포함하는 유전자 발현 카세트를 제조하는 단계; 및 (c) 상기 (b) 단계에서 제조한 유전자 발현 카세트를 미생물에 도입하는 단계;를 포함하는 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법을 제공한다.
본 발명의 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법에 있어서, 목적 플라스미드 카피 수에 따라 목적 전사량을 가지는 프로모터를 선택하여 플라스미드 카피수의 정량 조절이 가능하다. 상기 (a) 단계에서 세기가 강한 프로모터를 선택하는 경우, 재조합 미생물 내 플라스미드 카피 수를 낮게 유지할 수 있다. 반면, 세기가 약한 프로모터를 선택하는 경우, 재조합 미생물 내 플라스미드 카피 수를 높게 유지할 수 있다. 따라서, 재조합 미생물 내 플라스미드 카피 수를 목적하는 양으로 조절하기 위하여, 재조합 벡터 내 목적 전사량을 가지는 프로모터를 선택하여 도입함으로써 재조합 미생물 내 플라스미드 카피 수의 정량적인 조절이 가능하다.
본 발명의 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법에서 재조합 미생물 내 도입되는 유전자 발현 카세트는 목적 유전자 또는 터미네이터를 더 포함할 수 있다. 또한 상기 유전자 발현 카세트에 포함되는 프로모터는 서열번호 1 내지 5로 표시된 서열을 포함하는 프로모터인 것이 바람직하며, 상기 서열과 적어도 60%, 바람직하게는 70%, 보다 바람직하게는 80% 이상의 서열 상동성을 갖는 것으로 실질적으로 동질의 역할을 수행할 수 있는 것이라면 당 분야의 전문가들에 의해 적절하게 부가, 결실, 또는 치환되어 사용될 수 있다. 본 발명의 항시성 프로모터는 예컨대, 서열번호 1 내지 5로 표시되는 프로모터로 이루어진 군으로부터 선택된 1종의 프로모터(J23112, J23116, J23109, J23118 및 J23100) 인 것이 바람직하며, 상기 프로모터 들은 구입하거나 합성하여 도입할 수 있다.
본 발명의 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법에서는 재조합 미생물 내 염색체 상의 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY , murD , ftsW , murG , murC, ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH , frr, dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE , accA , tilS , proS , hemB , secD , secF , ribD, ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA, rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK , lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE, mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD , fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA, ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA , fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS, nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA , metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD, fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS , ispG , suhB , acpS , era, lepB , pssA , yfiO , rplS, trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk, metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD , dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE, rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG , rpsI , rplM , degS , mreD , mreC , mreB , accB , accC, rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU , coaA , birA , murB , murI , priA , ftsN , yihA , polA, hemG , hemC , hemD , proM , hisR , argX , rho, trpT , glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB, spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ , glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS, rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB , rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX, rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO , secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC, ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp , psd , rsgA , orn , yjeE , rpsR , ppa, valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자가 제거된 것을 특징으로 한다. 상기 조절 유전자가 미생물 내 염색체에서 제거되고 플라스미드에서 발현되는 경우, 숙주세포가 생존하기 위해 필수적으로 요구하는 생존 필수 유전자를 플라스미드에서 발현하여, 생존 필수 유전자 발현량 조절 메커니즘으로 플라스미드의 전사 수준이 조절되는바, 상기 재조합 미생물 내 플라스미드 카피수의 정량적인 조절이 가능하다.
본 발명의 재조합 미생물 내 플라스미드 카피수의 정량 조절 방법을 이용하면 항생제가 포함되지 않은 배지에서 수행하여도 안정적으로 플라스미드 카피수의 정량 조절이 가능하다.
본 발명의 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법에 있어서, 플라스미드 카피수의 조절은 선택된 프로모터의 세기를 통하여 조절이 가능하다. 세기가 강한 프로모터를 선택하는 경우, 재조합 미생물 내 플라스미드 카피 수를 낮게 유지할 수 있다. 반면, 세기가 약한 프로모터를 선택하는 경우, 재조합 미생물 내 플라스미드 카피 수를 높게 유지할 수 있다. 따라서, 재조합 미생물 내 플라스미드 카피 수를 원하는 양으로 조절하기 위하여, 재조합 벡터 내 원하는 세기의 프로모터를 선택하여 도입함으로써 재조합 미생물 내 플라스미드 카피 수의 정량적인 조절이 가능하다.
본 발명을 이하 실시예를 통하여 상세히 설명하기로 한다. 이들 실시예는 오로지 발명을 설명하기 위한 것으로 본 발명의 범위를 한정하는 것은 아니다.
사용한 균주 및 플라스미드
하기 실시예에서 사용한 균주 및 플라스미드를 하기 표 1에 정리하여 나타내었다.
이름 관련 특징 소스
균주
Mach-T1R E. coli F-
Figure PCTKR2018004038-appb-I000001
80(lacZ)ΔM15 ΔlacX74 hsdR(rK-mK+) ΔrecA1398 endA1 tonA
Invitrogen
W3110 E. coli F-λ-rph-1IN(rrnD, rrnE)1 ATCC27325
STG0 W3110/pCDF-eGFP 본 발명
STG1 W3110 △infA::KanR/pSTAPL_eGFPv1 본 발명
STG2 W3110 △infA::KanR/pSTAPL_eGFPv2 본 발명
STG3 W3110 △infA::KanR/pSTAPL_eGFPv3 본 발명
STG4 W3110 △infA::KanR/pSTAPL_eGFPv4 본 발명
STG5 W3110 △infA::KanR/pSTAPL_eGFPv5 본 발명
STI0 W3110/pCDF-CAD 본 발명
STI1 W3110 △infA::KanR/pSTAPL_CADv1 본 발명
STI2 W3110 △infA::KanR/pSTAPL_CADv2 본 발명
STI3 W3110 △infA::KanR/pSTAPL_CADv3 본 발명
STI4 W3110 △infA::KanR/pSTAPL_CADv4 본 발명
STI5 W3110 △infA::KanR/pSTAPL_CADv5 본 발명
STL0 W3110/pCDF_idi_ispA_crtEBI 선행 연구
STL1 W3110 △infA::KanR/pSTAPL_LYCv1 본 발명
STL2 W3110 △infA::KanR/pSTAPL_LYCv2 본 발명
STL3 W3110 △infA::KanR/pSTAPL_LYCv3 본 발명
STL4 W3110 △infA::KanR/pSTAPL_LYCv4 본 발명
STL5 W3110 △infA::KanR/pSTAPL_LYCv5 본 발명
STGC0 W3110 pCDF-eGFP/pET-mCherry 본 발명
STGC1 W3110 △infA△efp::KanR/pSTAPL_eGFPv1/pSTAPL_mCherry 본 발명
STG6 W3110/pUC19-eGFP 본 발명
STG7 W3110 △infA::KanR/pSTAPL_eGFPv7 본 발명
플라스미드
pKD46 Red recombinase expression vector, AmpR 선행 연구
pCDF_Duet Expression vector, SmR,cloDF13ori Novagen
pFRT72variant T-vector containing kanamycin resistance gene 선행연구
pCDF-eGFP pCDF_Duet/PJ23100-synUTRegfp-egfp-TBBa_B1002 본 발명
pSTAPL_eGFPv1 pCDF_eGFP/PJ23116-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_eGFPv2 pCDF_eGFP/PJ23112-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_eGFPv3 pCDF_eGFP/PJ23109-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_eGFPv4 pCDF_eGFP/PJ23118-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_eGFPv5 pCDF_eGFP/PJ23100-synUTRinfA-infA-TBBa_B1002 본 발명
pCDF-CAD pCDF_Duet-Ptac-synUTRcad-cad-TT7 본 발명
pSTAPL_CADv1 pCDF-CAD/PJ23116-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_CADv2 pCDF-CAD/PJ23112-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_CADv3 pCDF-CAD/PJ23109-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_CADv4 pCDF-CAD/PJ23118-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_CADv5 pCDF-CAD/PJ23100-synUTRinfA-infA-TBBa_B1002 본 발명
pCDF_idi_ispA_crtEBI pCDF-Duet/PJ23100-idi-TBBa_B1005/PJ23100-ispA-TBBa_B1005/PJ23100-crtE-crtB-crtI-TBBa_B1005 선행 연구
pSTAPL_LYCv1 pCDF_idi_ispA_crtEBI/PJ23116-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_LYCv2 pCDF_idi_ispA_crtEBI/PJ23112-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_LYCv3 pCDF_idi_ispA_crtEBI/PJ23109-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_LYCv4 pCDF_idi_ispA_crtEBI/PJ23118-synUTRinfA-infA-TBBa_B1002 본 발명
pSTAPL_LYCv5 pCDF_idi_ispA_crtEBI/PJ23100-synUTRinfA-infA-TBBa_B1002 본 발명
pCP20 Flippase expression vector, AmpR, CmR 선행 연구
pETDuet Expression vector, AmpR,pMB1ori Novagen
pFRT2161 T-vector containing kanamycin resistance gene 본 발명
pZ-mCherry pZS21 plasmid containing mcherry gene 선행 연구
pET-mCherry pETDuet/PJ23100-synUTRmcherry-mcherry-TBBa_B1002 본 발명
pSTAPL_mCherry pET-mCherry/PJ23116-synUTRefp-efp-TBBa_B1002 본 발명
pUC19-eGFP pUC19/PJ23118-synUTRegfp-egfp-TBBa_B1002 본 발명
pSTAPL_eGFPv7 pUC19_eGFP/PJ23112-synUTRinfA-infA-TBBa_B1002 본 발명
사용한 프로모터 및 프라이머 시퀀스
하기 실시예에서 사용한 프로모터 및 프라이머 시퀀스를 표 2 및 표 3에 정리하여 나타내었다.
프로모터 명 서열 (5′- 3′) 라이브러리에서의 서열* 알려져 있는 상대적인 세기 실제 측정된 상대적인 세기‡,§,|| 서열 번호
J23112 ctgatagctagctcagtcctagggattatgctagc 1 1 1.27 ± 0.20 1
J23109 tttacagctagctcagtcctagggactgtgctagc 4 106 2.26 ± 0.42 2
J23116 ttgacagctagctcagtcctagggactatgctagc 8 396 1.00 ± 0.30 3
J23118 ttgacggctagctcagtcctaggtattgtgctagc 14 1429 6.41 ± 2.60 4
J23100 ttgacggctagctcagtcctaggtacagtgctagc 19 2547 7.38 ± 2.64 5
*라이브러리에서의 서열은 19개의 프로모터 세기의 오름차순 순서를 의미한다.
알려져 있는 상대적인 세기는 형광값을 기반으로 하였다(Registry of Standard Biological Parts, http://parts.igem.org/).
실제 측정된 상대적인 세기는 STG1-5 균주의 infA 전사체 양을 각각의 PCN으로 나눈 값으로 결정하였다.
§실제 측정된 상대적인 세기는 가장 작은 값으로 정규화하였으며, 그 결과를 나타내었다.
||프로모터의 알려져 있는 세기와 실제 측정된 세기의 차이는 유전적 배경에 따라 차이가 난다.
프라이머명 폴리뉴클레오타이드 서열 (5′- 3′)*,†,‡,§,|| 서열번호
C-infA-F gtggcgagtccatgttcagccg 6
C-infA-B aaacctcatgggtggcaacggg 7
D-infA-F tgccgaataatttctgggtaccacgatgcttgttttcaccacaagaatgagcatgaccggcgcgatgc 8
D-infA-B ctcgttctttctcttcgcccatcaggcggtaaaacaatcagcgactacgggctcagcggatctcatgcgc 9
O-eGFP-F2 gagagttcaGAGCTCTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC 10
O-eGFP-B gcatgcggctGAGCTCGCGAAAAAACCCCGCCGAAGCG 11
O-infA-F2 ctgaaaCCTCAGGTTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGC 12
O-infA-B CCTGAGGGCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCGtcagcgactacggaagacaatgcg 13
O-infA-F1v1 ctgaaaCCTCAGGTTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGCgtagtactggaaatgagcatcc 14
O-infA-F1v2 ctgaaaCCTCAGGCTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCgtagtactggaaatgagcatcc 15
O-infA-F1v3 ctgaaaCCTCAGGTTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGCgtagtactggaaatgagcatcc 16
O-infA-F1v4 ctgaaaCCTCAGGTTGACGGCTAGCTCAGTCCTAGGTATTGTGCTAGCgtagtactggaaatgagcatcc 17
O-infA-F1v5 ctgaaaCCTCAGGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCgtagtactggaaatgagcatcc 18
O-eGFP-F1 ctcagtcctaggtacagtgctagcatcctgcattaaaggagcatccattatggctagcaagggcgagg 19
Q-pCDF-F catgttagtcatgccccgc 20
Q-pCDF-B ctcactcattaggcaccggg 21
Q-polA-F gcgagcgatccagaagatct 22
Q-polA-B gggtaaaggatgccacagaca 23
Q-infA-F ggaaatgagcatccagtatggcc 24
Q-infA-B gtagtttttgcgcattttaccggag 25
O-cad-F1 ggaattgtgagcggataacaattaaaaaaaacaaaaggagcatcacccatgaccaaacagagcgcagatagca 26
O-cad-F2 catccaGGTCTCgggTTGACAATTAATCATCGGCTCGTATAATGtgtggaattgtgagcggataacaattaaaaaaa 27
O-cad-B1 aaaaaaaaaccccgccgaagcggggtttttttttggtgcgatttaaaccagcggacttttaaccggaca 28
O-cad-B2 catccaGGTCTCgccaaaaaaaaaccccgccgaagcgg 29
O-pCDF-F catccaGGTCTCgttggacctcaggcatttgagaagcacac 30
O-pCDF-B catccaGGTCTCctcgaaccaggagtcgcataagggagagcgtc 31
C-efp-F ggcacacgcagggcaaaaag 32
C-efp-B ctggcagcgcgagagatgg 33
D-efp-F gagggccttatggcaacgtactatagcaacgattttcgtgctggtcttaaaccgcatgaccgcgcgatgc 34
D-efp-B ctctgacctgaataagtgatggtgcagcctgcaggccgcaccacaaccgccgcgacgacaggcacatgcg 35
O-mCherry-F1 caggcgcgccGAGCTCTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCccctggattaaaagg 36
O-mCherry-F2 TGCTAGCccctggattaaaaggagcatctttaatggtttccaagggcgag 37
O-mCherry-B attcgaattcGAGCTCGCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCGtcattatttgtacagctcatccatgccac 38
O-efp-F1 CTAGGGACTATGCTAGCtcctgattctcacataacccagaaaattatggcaacgtactatagcaacg 39
O-efp-F2 cgtcggtaccctcgagTTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGCtcctgattc 40
O-efp-B ctttaccagactcgagGCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCGttacttcacgcgagagacgtattc 41
FRT2161_F ccgcatgaccgcgcgatgcgaagttcctatactctctggagaataggaacttctcaagatcccctcacgctgccgc 42
FRT2161_B cgcgacgacaggcacatgcggaagttcctattctccagagagtataggaacttcagagcgcttttgaagctggggtgg 43
O-pUC19-F tttgcgtgaaaCTCGAGcgccaagcttgcatgcctgc 44
O-pUC19-B aggagtttacCCTGAGGggccagcaaaaggccaggaac 45
O-eGFP-F1v2 TGCTAGCagggtgtgcgaaaggagcatctttaatggctagcaagggcgagg 46
O-eGFP-F2v2 tttgctgaaaCCTCAGGTTGACGGCTAGCTCAGTCCTAGGTATTGTGCTAGCagggtgtgcgaaaggag 47
O-eGFP-Bv2 tagaccatttctcgagGCGAAAAAACCCCGCC 48
O-infA-F1v2 GTCCTAGGGATTATGCTAGCgtagtactggatttttgcatccagtatggccaaagaagacaatattg 49
O-infA-F2v2 cccgggtacccccgggtaccGAGCTCCTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGCgtag 50
O-infA-B1v2 TCAGTGAGACCTCAGCGACTACGGAAGACAATG 51
O-infA-B2v2 agtgccacctGACGTCGCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCGtcagtgagacctcagcgactac 52
*이탈릭체의 서열은 리콤비네이션을 위한 상응하는 유전자 서열을 나타낸다.
밑줄 친 소문자 서열은 5'-UTR 서열을 나타낸다.
밑줄 친 대문자 서열은 프로모터 서열을 나타낸다.
§대문자로 처리된 서열은 제한효소 서열을 나타낸다.
||이탈릭체의 대문자로 처리된 서열은 터미네이터 서열을 나타낸다.
STAPL 시스템에서의 플라스미드 카피 수
하기 실시예로 측정한 STAPL 시스템에서의 플라스미드 카피 수를 표 4에 정리하여 나타내었다.
eGFP Itaconic acid Lycopene
Promoter Sm Strain PCN* Strain PCN* Strain PCN*
- - STG0 1 ± 0 STI0 613 ± 74 STL0 21 ± 3
- + STG0 176 ± 12 STI0 1365 ± 28 STL0 65 ± 12
J23116 - STG1 261 ± 21 STI1 3390 ± 105 STL1 684 ± 155
J23112 - STG2 208 ± 12 STI2 1174 ± 305 STL2 265 ± 43
J23109 - STG3 251 ± 31 STI3 1373 ± 73 STL3 70 ± 11
J23118 - STG4 200 ± 10 STI4 663 ± 160 STL4 38 ± 1
J23100 - STG5 46 ± 6 STI5 726 ± 46 STL5 93 ± 9
*PCN은 염색체의 카피 수를 플라스미드의 카피 수로 나누어 계산한 값을 나타내었다.
사용한 터미네이터 및 5′- UTR 서열 및 유전자 서열
본 발명에서 사용한 터미네이터 및 5′-UTR 서열 및 유전자 서열을 하기 표 5에 정리하여 나타내었다.
  염기서열(5′ - 3′) 서열번호
터미네이터 BBa_1002 cgcaaaaaaccccgcttcggcggggttttttcgc 53
5'-UTR infA(STG1-5) gtagtactggaaatgagcatccagt 54
  infA(STG7) gtagtactggatttttgcatccagt 55
  efp(STGC1) tcctgattctcacataacccagaaaatt 56
  eGFP(STG0) atcctgcattaaaggagcatccatt 57
  eGFP(STG6) agggtgtgcgaaaggagcatcttta 58
  mCherry(STGC0) ccctggattaaaaggagcatcttta 59
     
유전자   염기서열
infA   atggccaaagaagacaatattgaaatgcaaggaaccgttcttgaaacgttgcctaataccatgttccgcgtagagttagaaaacggtcacgtggttactgcacacatctccggtaaaatgcgcaaaaactacatccgcatcctgacgggcgacaaagtgactgttgaactgaccccgtacgacctgagcaaaggccgcattgtcttccgtagtcgctga 60
efp   atggcaacgtactatagcaacgattttcgtgctggtcttaaaatcatgttagacggcgaaccttacgcggttgaagcgagtgaattcgtaaaaccgggtaaaggccaggcatttgctcgcgttaaactgcgtcgtctgctgaccggtactcgcgtagaaaaaaccttcaaatctactgattccgctgaaggcgctgatgttgtcgatatgaacctgacttacctgtacaacgacggtgagttctggcacttcatgaacaacgaaactttcgagcagctgtctgctgatgcaaaagcaattggtgacaacgctaaatggctgctggatcaggcagagtgtatcgtaactctgtggaatggtcagccgatctccgttactccgccgaacttcgttgaactggaaatcgttgataccgatccgggcctgaaaggtgataccgcaggtactggtggcaaaccggctaccctgtctactggcgctgtggttaaagttccgctgtttgtacaaatcggcgaagtcatcaaagtggatacccgctctggtgaatacgtctctcgcgtgaagtaa 61
eGFP   atggctagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtga 62
mCherry   atggtttccaagggcgaggaggataacatggctatcattaaagagttcatgcgcttcaaagttcacatggagggttctgttaacggtcacgagttcgagatcgaaggcgaaggtgagggccgtccgtatgaaggcacccagaccgccaaactgaaagtgactaaaggcggcccgctgccttttgcgtgggacatcctgagcccgcaatttatgtacggttctaaagcttatgttaaacacccagcggatatcccggactatctgaagctgtcttttccggaaggtttcaagtgggaacgcgtaatgaattttgaagatggtggtgtcgtgaccgtcactcaggactcctccctgcaggatggcgagttcatctataaagttaaactgcgtggtactaattttccatctgatggcccggtgatgcagaagaagacgatgggttgggaggcgtctagcgaacgcatgtacccggaagatggtgcgctgaaaggcgaaattaaacagcgcctgaaactgaaagatggcggccattatgacgctgaagtgaaaaccacgtacaaagccaagaaacctgtgcagctgcctggcgcgtacaatgtgaatattaaactggacatcacctctcataatgaagattatacgatcgtagagcaatatgagcgcgcggagggtcgtcattctaccggtggcatggatgagctgtacaaataa 63
codon optimized cad CGGAAGAACGTCCGATTAGCAGCATTGCAGGTCAGATGAGCGTTGCATATATTCTGGCCGTTCAGCTGGTTGATCAGCAGTGTCTGCTGAGCCAGTTTAGCGAATTTGATGATAACCTGGAACGTCCGGAAGTTTGGGATCTGGCACGTAAAGTTACCAGCAGCCAGAGCGAAGAATTTGATCAGGATGGTAATTGTCTGAGCGCAGGTCGTGTTCGTATTGAATTTAATGATGGTTCCAGCATTACCGAAAGCGTTGAAAAACCGCTGGGTGTTAAAGAACCGATGCCGAATGAACGTATCCTGCATAAATATCGTACCCTGGCAGGTAGCGTTACCGATGAAAGCCGTGTGAAAGAAATTGAAGATCTGGTTCTGGGTCTGGATCGTCTGACCGATATTAGTCCGCTGCTGGAACTGCTGAACTGTCCGGTTAAAAGTCCGCTGGTTTAA 64
idi ATGCAGACCGAACATGTGATTCTGCTGAACGCGCAGGGCGTGCCGACCGGCACCCTGGAAAAATATGCGGCGCATACCGCGGATACCCGCCTGCATCTGGCGTTTAGCAGCTGGCTGTTTAACGCGAAAGGCCAGCTGCTGGTGACCCGCCGCGCGCTGAGCAAAAAAGCGTGGCCGGGCGTGTGGACCAACAGCGTGTGCGGCCATCCGCAGCTGGGCGAAAGCAACGAAGATGCGGTGATTCGCCGCTGCCGCTATGAACTGGGCGTGGAAATTACCCCGCCGGAAAGCATTTATCCGGATTTTCGCTATCGCGCGACCGATCCGAGCGGCATTGTGGAAAACGAAGTGTGCCCGGTGTTTGCGGCGCGCACCACCAGCGCGCTGCAGATTAACGATGATGAAGTGATGGATTATCAGTGGTGCGATCTGGCGGATGTGCTGCATGGCATTGATGCGACCCCGTGGGCGTTTAGCCCGTGGATGGTGATGCAGGCGACCAACCGCGAAGCGCGCAAACGCCTGAGCGCGTTTACCCAGCTGAAATAA 65
ispA ATGGATTTCCCGCAGCAGCTGGAAGCGTGTGTGAAACAGGCGAACCAGGCGCTGAGCCGCTTTATTGCGCCGCTGCCGTTTCAGAACACCCCGGTGGTGGAAACCATGCAGTATGGCGCGCTGCTGGGCGGCAAACGCCTGCGCCCGTTTCTGGTGTATGCGACCGGCCACATGTTTGGCGTGAGCACCAACACCCTGGATGCGCCGGCGGCGGCGGTGGAATGCATTCATGCGTATAGCCTGATTCATGATGATCTGCCGGCGATGGATGATGATGATCTGCGCCGCGGCCTGCCGACCTGCCATGTGAAATTTGGCGAAGCGAACGCGATTCTGGCGGGCGATGCGCTGCAGACCCTGGCGTTTAGCATTCTGAGCGATGCGGATATGCCGGAAGTGAGCGATCGCGATCGCATTAGCATGATTAGCGAACTGGCGAGCGCGAGCGGCATTGCGGGCATGTGCGGCGGCCAGGCGCTGGATCTGGATGCGGAAGGCAAACATGTGCCGCTGGATGCGCTGGAACGCATTCATCGCCATAAAACCGGCGCGCTGATTCGCGCGGCGGTGCGCCTGGGCGCGCTGAGCGCGGGCGATAAAGGCCGCCGCGCGCTGCCGGTGCTGGATAAATATGCGGAAAGCATTGGCCTGGCGTTTCAGGTGCAGGATGATATTCTGGATGTGGTGGGCGATACCGCGACCCTGGGCAAACGCCAGGGCGCGGATCAGCAGCTGGGCAAAAGCACCTATCCGGCGCTGCTGGGCCTGGAACAGGCGCGCAAAAAAGCGCGCGATCTGATTGATGATGCGCGCCAGAGCCTGAAACAGCTGGCGGAACAGAGCCTGGATACCAGCGCGCTGGAAGCGCTGGCGGATTATATTATTCAGCGCAACAAATAA 66
crtE ATGGTATCTGGCTCAAAGGCTGGCGTCTCGCCACATCGCGAAATTGAAGTGATGCGCCAGAGCATTGATGATCATCTGGCGGGCCTGCTGCCGGAAACCGATAGCCAGGATATTGTGAGCCTGGCGATGCGCGAAGGCGTGATGGCGCCGGGCAAACGCATTCGCCCGCTGCTGATGCTGCTGGCGGCGCGCGATCTGCGCTATCAGGGCAGTATGCCGACCCTGCTGGATCTGGCGTGCGCGGTGGAACTGACCCATACCGCGAGCCTGATGCTGGATGATATGCCGTGCATGGATAACGCGGAACTGCGCCGCGGCCAGCCGACCACCCATAAAAAATTTGGCGAAAGCGTGGCGATTCTGGCGAGCGTGGGCCTGCTGAGCAAAGCGTTTGGCCTGATTGCGGCGACCGGCGATCTGCCGGGCGAACGCCGCGCGCAGGCGGTGAACGAACTGAGCACCGCGGTGGGCGTGCAGGGCCTGGTGCTGGGCCAGTTTCGCGATCTGAACGATGCGGCGCTGGATCGCACCCCGGATGCGATTCTGAGCACCAACCATCTGAAAACCGGCATTCTGTTTAGCGCGATGCTGCAGATTGTGGCGATTGCGAGCGCGAGCAGCCCGAGCACCCGCGAAACCCTGCACGCGTTTGCGCTGGATTTTGGCCAGGCGTTTCAGCTGCTGGATGATCTGCGCGATGATCATCCGGAAACCGGCAAAGATCGCAACAAAGATGCGGGCAAAAGCACCCTGGTGAACCGCCTGGGCGCGGATGCGGCGCGCCAGAAACTGCGCGAACATATTGATAGCGCGGATAAACATCTGACCTTTGCGTGCCCGCAGGGCGGCGCGATTCGCCAGTTTATGCATCTGTGGTTTGGCCATCATCTGGCGGATTGGAGCCCGGTGATGAAAATTGCGTAA 67
crtB ATGTCCCAACCCCCCTTGCTAGACCACGCAACCCAGACGATGGCGAACGGCAGCAAGAGCTTTGCGACCGCGGCGAAACTGTTTGATCCGGCGACCCGCCGCAGCGTGCTGATGCTGTATACCTGGTGCCGCCATTGCGATGATGTGATTGATGATCAGACGCATGGCTTTGCGAGCGAAGCGGCGGCGGAAGAAGAAGCGACCCAGCGCCTGGCGCGCCTGCGCACCCTGACCCTGGCGGCGTTTGAAGGCGCGGAAATGCAGGACCCGGCGTTTGCGGCGTTTCAGGAAGTGGCGCTGACCCACGGCATTACCCCGCGCATGGCGCTGGATCATCTGGATGGCTTTGCGATGGATGTGGCGCAGACCCGCTATGTGACCTTTGAAGATACCCTGCGCTATTGCTATCATGTGGCGGGCGTGGTGGGCCTGATGATGGCGCGCGTGATGGGCGTGCGCGATGAACGCGTGCTGGATCGCGCGTGCGATCTGGGCCTGGCGTTTCAGCTGACCAACATTGCGCGCGATATTATTGATGATGCGGCGATTGATCGCTGCTATCTGCCGGCGGAATGGCTGCAGGATGCGGGCCTGACCCCGGAAAACTATGCGGCGCGCGAAAACCGCGCGGCGCTGGCGCGCGTGGCGGAACGCCTGATTGATGCGGCGGAACCGTATTATATTAGCAGCCAGGCGGGCCTGCATGATCTGCCGCCGCGCTGCGCGTGGGCGATTGCGACCGCGCGCAGCGTGTATCGCGAAATTGGCATTAAAGTGAAAGCGGCGGGCGGCAGCGCGTGGGATCGCCGCCAGCATACCAGCAAAGGCGAAAAAATTGCGATGCTGATGGCGGCGCCGGGCCAGGTGATTCGCGCGAAAACCACCCGCGTGACCCCGCGCCCGGCGGGCCTGTGGCAGCGCCCGGTGTAA 68
실시예 1. STAPL 시스템 대장균 제조 및 STAPL 시스템에서의 플라스미드 수 유지의 확인
STAPL을 기본으로 하는 영양 요구성 보완(auxotrophic complementation) 시스템을 구축하기 위해 염색체(chromosome) 상의 필수 유전자를 제거하고 플라스미드에 해당 필수 유전자를 발현시키는 실험을 수행하였다. IF-1 단백질이 세포의 생존력과 직접적으로 연관되어 있어 교차 먹이 효과 (cross-feeding effect)를 최소화 시킬 수 있으므로, 조절 유전자로 번역 개시 인자-1(IF-1)를 암호화 하는 infA를 선택하여 상기 조절 유전자를 발현하는 발현 카세트를 포함하는 플라스미드를 설계하였다. 균주에 infA를 도입하기 위한 플라스미드는 중간 카피 (세포 당 40 카피)로 알려져 있는 pCDFduet을 사용하고, 복제원점(레플리콘)으로 CloDF13 을 이용하여 제조하였다.
먼저, infA 발현 카세트를 중간 세기의 항시성 프로모터(J23116)와 UTR designer에 의해 계산적으로 디자인된 1115.3의 값을 나타내는 낮은 세기의 5‘-UTR, 그리고 합성 터미네이터 (BBa_B1002)를 포함하여 구축하였다. 플라스미드 기반 발현 시스템은 여러 카피 수로 존재하기 때문에 염색체 상의 발현량과 같은 양으로 클로닝 하면 세포에게 부담을 주고 성장을 방해할 수 있어 infA 발현이 낮게 되도록 상기 발현 카세트를 디자인하였다. 플라스미드 카피 수(PCN)를 간접적으로 관찰하기 위해 같은 플라스미드에서 강한 항시성 프로모터 (J23100)와 5’-UTR 하에서 eGFP를 리포터 단백질로써 발현시켰다.
이를 위해 Escherichia coli의 W3110 균주의 염색체를 주형으로 하고 표 3의 O-infA-F1v1/O-infA-F2/O-infA-B 프라이머 세트를 이용해 infA 유전자를 증폭하였고, Bsu36I 제한 효소 서열을 이용한 클로닝을 통해 상기 플라스미드에 삽입하였다. 계속해서 eGFP는 O-eGFP-F1/O-eGFP-F2/O-eGFP-B 프라이머 세트를 이용해 증폭하였고, SacI 제한 효소 서열을 이용한 클로닝을 통해 상기 플라스미드에 삽입함으로써 최종적으로 pSTAPL_eGFPv1 플라스미드를 제작하였다.
완성된 플라스미드는 Escherichia coli의 W3110 균주에 삽입하였다. 그 다음으로 영양 요구성 유지를 위해 균주의 염색체 상 infA를 제거하기 위하여 기존에 알려진 Lambda-Red 리콤비네이션 시스템을 이용하였고, pKD46 플라스미드를 이용하였다. infA 제거를 위한 DNA 단편은 FRT-Kan R-FRT을 주형으로 하고, D-infA-F/D-infA-B 프라이머 세트로 증폭하여 infA가 제거된 재조합 대장균 STG1을 제조하였다. 상기의 과정을 통해 제작된 재조합 플라스미드와 균주를 도 1에 나타내었다.
상기 제조한 STAPL이 적용된 재조합 대장균에서의 플라스미드가 장시간 안정성을 가질 수 있는지 평가하기 위하여, 종래의 항생제 의존성 플라스미드 유지 시스템을 가진 대장균(STG0)과 함께 세포 배양을 진행하였다.
재조합 대장균 pSTAPL_eGFPv1을 포함한 모든 재조합 균주를 플라스미드 안정성 테스트를 위한 배지 조건인 변형된 3 ml의 글루코오스 M9 배지 (100 mM 인산버퍼, 0.5 g/L MgSO4.7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 1 g/L casamino acid를 포함하며, 20 g/L의 글루코오스를 유일 탄소원으로 사용)에 넣은 후, 37°C에서 250 rpm로 하여 배양하였고, 40 세대 동안 5 세대에 한 번씩 일련의 계대 배양을 진행하였다. 초기 세포 농도는 사전에 같은 배지에서 배양을 통해 준비된 세포와 동일하도록 OD600 농도 0.05로 희석하였다. 플라스미드 유지를 위한 항생제로는 50 ㎍/ml의 스트렙토마이신을 사용하였다.
배양 중의 세포 성장은 UV-1700 spectrophotometer를 이용하여 600 nM 파장의 흡광도를 측정하는 방법으로 정량하였다. 세포 형광을 VICTOR 1420 multilabel plate reader를 이용하고 486 nm 파장의 여가 필터와 535 nm 파장의 방출 필터를 사용하여 측정하였다. 세포를 인산염 완충 식염수 (phosphate-buffered saline, PBS)로 씻은 다음 S3e cell sorter를 이용하여 세포 하나 당 형광을 측정하였다. 항생제 유무에 따른 종래 플라스미드 분리 불안 현상과 STAPL 적용 균주에서 플라스미드가 안정적으로 유지되는 과정을 모식도로 하여 도 2에 나타내었고, STG1 및 STG0 대장균 균주를 40 세대 간 배양하며 측정한 플라스미드 유지 비율(도 3A) 및 배양 0, 10, 20, 40세대 째의 세포 하나 당 형광 프로파일을 측정한 결과(도 3B)를 도 3에 나타내었다.
도 2 및 도 3A, 3B에 나타난 바와 같이, 항생제가 첨가되지 않은 STG0 균주는 10세대 째에서 플라스미드가 없는 세포 56.2% 정도 발생하였고, 40세대 째에는 형광 비율이 13.7% 으로 나타나 균주 내 플라스미드를 유지한 비율이 급격하게 감소하는 것을 확인하였다. 항생제가 첨가된 STG0 균주의 경우는 플라스미드가 없는 세포가 발생하지는 않았지만, 플라스미드를 적게 가지는 세포 집단이 12.3% 정도로 발생하였고, 배양 후 0 세대에 비해 40 세대 째에는 형광 비율이 65%로 나타남을 확인하였다. 반면 STAPL이 적용된 STG1 균주는 항생제의 첨가 없이도 40 세대 동안 형광 비율이 100%와 가깝게 높게 유지되었고 0 세대에 비해 40 세대에는 형광비율이 97.2%로 나타나, 균주 내 플라스미드를 나타나는 세포 집단이 균일하게 나타나 고유 변이가 적은 것을 확인할 수 있었다. 종합적으로, 종래의 항생제 의존성 플라스미드 유지 시스템과 STAPL 시스템을 대비한 결과, STAPL 시스템이 적용된 재조합 대장균을 이용하면 플라스미드가 장시간 안정적으로 유지될 수 있음을 확인하였다.
실시예 2. 다중 플라스미드 시스템에서의 STAPL 시스템 적용
STAPL을 기본으로 하는 영양 요구성 보완 시스템을 두 개의 플라스미드에 대해 구축하기 위해 염색체 상의 두 개의 필수 유전자를 제거하고 플라스미드에 필수 유전자를 각각 발현시켰다. 발현 카세트 내 조절 유전자로 세포의 생존력과 직접적으로 연관되어 있어 교차 먹이 효과가 최소화시킬 수 있는 번역 개시 인자-1(IF-1)를 암호화 하는 infA와 단백질 신장 인자(EF-P)를 암호화 하는 efp를 선택하여 STAPL 시스템을 구축하였다. infA을 사용한 STAPL 시스템을 도입한 균주에 추가적으로 균주에 efp를 도입하기 위한 플라스미드는 중간 카피 (세포 당 40 카피)로 알려져 있는 pETduet을 사용하고, 복제원점(레플리콘)으로 CloE1 을 이용하여 제조하였다.
efp를 도입하기 위한 플라스미드에 포함되는 efp 발현 카세트를 중간 세기의 항시성 프로모터(J23116)와 UTR designer에 의해 디자인 된 1169.4의 낮은 세기의 5′-UTR, 그리고 합성 터미네이터 (BBa_B1002)를 포함하여 구축하였다. 염색체 상의 발현량과 같은 양으로 클로닝 하면 세포에게 부담을 주고 성장을 방해할 수 있어 efp 발현이 낮게 되도록 상기 발현 카세트를 디자인하였다. PCN을 간접적으로 관찰하기 위해 같은 플라스미드에서 강한 항시성 프로모터 (J23100)와 5′-UTR 하에서 mCherry를 리포터 단백질로써 발현시켰다.
컨트롤 플라스미드로, mCherry를 주형으로 하고 표 2의 O-mCherry-F1/ O-mCherry-F2/ O-mCherry-B 프라이머 세트를 이용해 증폭하였고, SacI 제한 효소 서열을 이용한 클로닝을 통해 pET 플라스미드에 삽입함으로써 pET-mCherry 플라스미드를 제작하였다. pET 플라스미드를 STAPL 시스템으로 적용하기 위하여, Escherichia coli의 W3110 균주의 염색체를 주형으로 하고 표 3의 O-efp-F1/O-efp-F2/O-efp-B 프라이머 세트를 이용해 efp 유전자를 증폭하였다. 이 후 XhoI 제한 효소 서열을 이용한 클로닝을 통해 앞서 제작한 pET-mCherry 플라스미드에 삽입하였다. infA를 조절 유전자로 사용하여 STAPL 시스템을 도입한 실시예 1의 STG1 균주의 발현 카세트의 프로모터와 같은 세기의 항시성 프로모터인 J23116을 사용한 infA 발현 카세트가 도입된 STG1 균주에 상기 제조된 플라스미드를 삽입하였다.
이후, 영양 요구성 유지를 위해 STG1 균주의 염색체 상의 efp를 제거하기 전, 염색체 상의 카나마이신 저항성 유전자를 제거하기 위하여, pCP20 플라스미드를 사용하여 리콤비네이션을 진행하였다. 염색체 상의 efp를 제거하기 위해 기존에 알려진 Lambda-Red 리콤비네이션 시스템을 이용하고 pKD46 플라스미드를 사용하였다. 영양 요구성 유지를 위해 염색체 상의 efp를 제거하기 위한 DNA 단편을 pFRT2161을 주형으로 하고, 표 3의 D-efp-F/D-efp-B 프라이머 세트로 증폭하여 상기 염색체 상의 efp가 제거된 재조합 대장균 STGC1을 제조하였다. 상기 제조한 다중 플라스미드 STAPL이 적용된 재조합 대장균에서 플라스미드의 장시간 안정성을 평가하기 위하여, 종래의 항생제 의존성 플라스미드 유지 시스템(STGC0)과 함께 세포 배양을 진행하였다.
STGC0와 STGC1 균주를 플라스미드 안정성 테스트를 위한 배지 조건인 변형된 3 ml의 글루코오스 M9 배지 (100 mM 인산버퍼, 0.5 g/L MgSO4.7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 1 g/L casamino acid를 포함하며, 4 g/L의 글루코오스를 유일 탄소원으로 사용)에 넣은 후, 37°C에서 250 rpm로 하여 배양하였고, 40세대 동안 5 세대에 한 번씩 일련의 계대 배양을 진행하였다. 초기 세포 농도는 사전에 같은 배지에서 배양을 통해 준비된 세포와 동일하도록 OD600 농도 0.05로 희석하였다. 양성 제어로 사용된 전통적인 항생제 의존성 플라스미드 유지 시스템(STGC0)의 경우에 플라스미드 유지를 위한 항생제로 50 ㎍/ml의 스트렙토마이신과 암피실린을 배지에 더 포함하여 배양을 실시하였다.
배양 중의 세포 성장을 UV-1700 spectrophotometer를 이용하여 600 nM 파장의 흡광도를 측정하는 방법으로 측정하였고, eGFP 형광을 VICTOR 1420 multilabel plate reader를 이용하고 486 nm 파장의 여과 필터와 535 nm 파장의 방출 필터를 사용하여 측정하였다. mCherry 형광을 Hidex Sense microplate reader, 575 nm 파장의 여과 필터와 610 nm 파장의 방출 필터를 사용하여 측정하였고, 상기 측정한 형광의 결과를 도 4A 및 4B에 나타내었다.
도 4A에서 나타난 바와 같이, 항생제가 첨가되지 않은 STGC0 균주에서 pCDF 플라스미드는 0 세대에 비해 40 세대의 균주에서 그 값이 감소하여 형광비율이 6.6%의 값을 나타내는 것을 확인하였다. 항생제가 첨가된 STGC0 균주의 pCDF 플라스미드는 40세대의 균주에서 형광비율 값이 62.4%로 나타나 항생제가 첨가된 STGC0 균주보다는 그 값이 증가하였으나, 거듭된 계대 배양을 통하여 플라스미드의 수가 감소한 것을 확인하였다. 반면, 다중 플라스미드에 대해 STAPL이 적용된 STGC1 균주는 항생제의 첨가 없이 40 세대 동안 형광이 높게 유지되었고, 거듭된 계대 배양에도 플라스미드 수가 점차 증가하여 40 세대에서의 균주에서는 형광비율이 169.6%로 그 발현이 증가한 것을 확인하였다. 도 4B에서 확인한 바와 같이, pET 플라스미드에 대해서도 마찬가지로, STGC0 균주는 항생제 첨가 유무와는 상관없이 플라스미드의 수가 낮게 유지됨을 확인하였다. 구체적으로 항생제가 첨가되지 않은 균주는 40세대 후에 11.6%의 형광비율 값을 보였고, 항생제가 첨가된 경우 40세대 후의 균주는 형광비율이 78.5%로 나타남을 확인하였다. STAPL 시스템이 적용된 STGC1 균주는 항생제를 첨가하지 않더라도 40 세대 동안 플라스미드가 안정하게 유지되고 세대가 높아질수록 그 형광비율이 증가하여, 40 세대의 균주에서는 형광비율이 247%로 나타나 매우 안정적으로 플라스미드 수가 유지됨을 확인하였다. 종합적으로, 항생제 의존성 플라스미드 유지 시스템과 STAPL 시스템을 대비한 결과, STAPL 시스템에서 조절 유전자로 infA 뿐 아니라 efp 유전자를 사용한 경우에도 플라스미드가 장시간 안정적 유지가 가능함을 확인하였고, 아울러 다중 플라스미드에 대해서도 STAPL 시스템을 적용하면 재조합 균주 내 플라스미드의 수가 장시간 안정적으로 유지가 가능함을 확인하였다.
실시예 3. 고복제 수 플라스미드에서의 STAPL 시스템 적용
고복제 수 플라스미드 (high copy plasmid)의 경우 플라스미드의 확률적 변동이 크기 때문에 카피 수가 급격히 줄어드는 것이 일반적이다. 다만, 본 발명의 STAPL시스템을 이용하면 고복제 수 플라스미드를 이용한 경우에도 안정적으로 PCN을 유지하는지를 알아보기 위한 실험을 수행하였다. STAPL 시스템을 high copy plasmid 시스템에 도입하기 위해 플라스미드에 필수 유전자를 발현시키고 염색체 상의 동일 필수 유전자를 제거하였다. 발현 카세트 내 조절 유전자로 세포의 생존력과 직접적으로 연관되어 있어 교차 먹이 효과가 최소화시킬 수 있는 번역 개시 인자-1(IF-1)를 암호화 하는 infA를 선택하여 STAPL 시스템을 구축하였다. infA을 도입하기 위한 플라스미드는 높은 카피 (세포 당 500 카피)로 알려져 있는 pUC19을 사용하고, 복제원점(레플리콘)으로 pMB1을 이용하여 제조하였다.
infA를 도입하기 위한 플라스미드에 포함되는 infA 발현 카세트를 낮은 세기의 항시성 프로모터(J23112)와 UTR designer에 의해 디자인 된 263.75의 낮은 세기의 5‘-UTR, 그리고 합성 터미네이터 (BBa_B1002)를 포함하여 구축하였다. 염색체 상의 발현량과 같은 양으로 클로닝 하면 세포에게 부담을 주고 성장을 방해할 수 있어 infA 발현이 낮게 되도록 상기 발현 카세트를 디자인하였다. PCN을 간접적으로 관찰하기 위해 같은 플라스미드에서 강한 항시성 프로모터 (J23118)와 5’-UTR 하에서 eGFP를 리포터 단백질로써 발현시켰다.
컨트롤 플라스미드로, pUC19를 주형으로 하여 표 3의 O-pUC19-F/O-pUC19-B 프라이머 세트를 이용해 증폭하였고, eGFP는 eGFP를 주형으로 하고 표 3의 O-eGFP-F1v2/ O-eGFP-F2v2/O-eGFP-Bv2 프라이머 세트를 이용해 증폭하였으며, Bsu36I과 XhoI 제한 효소 서열을 이용한 클로닝을 통해 pUC19 플라스미드에 삽입함으로써 pUC19-eGFP 플라스미드를 제작하였다. pUC19 플라스미드를 STAPL 시스템으로 적용하기 위하여, Escherichia coli의 W3110 균주의 염색체를 주형으로 하고 표 3의 O-infA-F1v2/O-infA-F2v2/O-infA-B1v2/O-infA-B2v2 프라이머 세트를 이용해 infA 유전자를 증폭하였다. 이 후 SacI과 AatII 제한 효소 서열을 이용한 클로닝을 통해 앞서 제작한 pUC19-eGFP 플라스미드에 삽입하였고, pSTAPL_eGFPv7을 제작하였다.
이후, 영양 요구성 유지를 위해 STG6 균주의 염색체 상의 infA를 제거하기 위해 기존에 알려진 Lambda-Red 리콤비네이션 시스템을 이용하고 pKD46 플라스미드를 사용하였다. 영양 요구성 유지를 위해 염색체 상의 infA를 제거하기 위한 DNA 단편을 pFRT72를 주형으로 하고, 표 3의 D-infA-F/D-infA-B 프라이머 세트로 증폭하여 상기 염색체 상의 infA가 제거된 재조합 대장균 STG7을 제조하였다. 상기 제조한 다중 플라스미드 STAPL이 적용된 재조합 대장균에서 플라스미드의 장시간 안정성을 평가하기 위하여, 종래의 항생제 의존성 플라스미드 유지 시스템(STG6)과 함께 세포 배양을 진행하였다.
STG6와 STG7 균주를 플라스미드 안정성 테스트를 위한 배지 조건인 변형된 3 ml의 글루코오스 M9 배지 (100 mM 인산버퍼, 0.5 g/L MgSO4.7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 1 g/L casamino acid를 포함하며, 4 g/L의 글루코오스를 유일 탄소원으로 사용)에 넣은 후, 37°C에서 250 rpm로 하여 배양하였고, 40세대 동안 5 세대에 한 번씩 일련의 계대 배양을 진행하였다. 초기 세포 농도는 사전에 같은 배지에서 배양을 통해 준비된 세포와 동일하도록 OD600 농도 0.05로 희석하였다. 양성 제어로 사용된 종래의 항생제 의존성 플라스미드 유지 시스템(STG6)의 경우에 플라스미드 유지를 위한 항생제로 50 ㎍/ml의 암피실린을 배지에 더 포함하여 배양을 실시하였다.
배양 중의 세포 성장을 UV-1700 spectrophotometer를 이용하여 600 nM 파장의 흡광도를 측정하는 방법으로 측정하였고, eGFP 형광을 VICTOR 1420 multilabel plate reader를 이용하고 486 nm 파장의 여과 필터와 535 nm 파장의 방출 필터를 사용하여 측정하였다. 상기 측정한 형광의 결과를 도 5에 나타내었다.
도 5에서 나타난 바와 같이, 항생제가 첨가되지 않은 STG6 균주에서 pUC19 플라스미드는 0 세대에 비해 40 세대의 균주에서 그 값이 감소하여 형광비율이 37.7%의 값을 나타내는 것을 확인하였다. 항생제가 첨가된 STG6 균주의 pUC19 플라스미드는 40세대의 균주에서 형광비율 값이 54.6%로 나타나 항생제가 첨가된 STG6 균주보다는 그 값이 증가하였으나, 거듭된 계대 배양을 통하여 플라스미드의 수가 감소한 것을 확인하였다. 반면, 높은 복제수를 가지는 플라스미드에 대해 STAPL이 적용된 STG7 균주는 항생제의 첨가 없이 40 세대 동안 형광이 높게 유지되었고, 거듭된 계대 배양에도 플라스미드 수가 안정하게 유지되어 40 세대에서의 균주에서는 형광비율이 79.5%로 그 발현이 증가한 것을 확인하였다. 종합적으로, 항생제 의존성 플라스미드 유지 시스템과 STAPL 시스템을 대비한 결과, STAPL 시스템에서 높은 복제 수를 가지는 플라스미드에 대해서도 플라스미드가 장시간 안정적 유지가 가능함을 확인하였다.
실시예 4. STAPL에서의 PCN 조절
세포가 생존하기 위해 필수적으로 요구하는 infA의 발현량은 정해져 있는바, 세포의 infA 발현량 조절의 메커니즘을 이용하여 전사 수준을 조절하면 PCN을 조절할 수 있는지 여부를 확인하기 위한 실험을 수행하였다. 상기 실시예 1에서 사용한 대장균 STG1의 infA 발현량을 기준으로 추가적인 4개의 다른 infA 발현량을 가지는 STG2-5 균주를 제조하였다.
서로 다른 세기의 프로모터를 가지는 infA 카세트는 O-infA-F1v2-5/O-infA-B 프라이머 세트로 증폭되었고, Bsu36I 제한 효소 서열을 이용한 클로닝을 통해 플라스미드에 삽입함으로써 최종적으로 pSTAPL_eGFPv2-5 플라스미드를 제작하였다. 완성된 플라스미드는 Escherichia coli의 W3110 균주에 삽입되었고, 그 다음으로 영양 요구성 유지를 위해 염색체 상의 infA를 제거하였다. infA를 제거하기 위하여 종래에 알려진 Lambda-Red 리콤비네이션 시스템이 이용되었으며 pKD46 플라스미드가 이용되었다. infA 제거를 위한 DNA 단편을 FRT-Kan R-FRT 주형을 D-infA-F/D-infA-B 프라이머 세트를 이용하여 증폭시켰다. 상기 과정을 통하여 실시예 1에서 제조된 STG1외에 추가적으로 염색체 상의 infA가 제거된 재조합 대장균 STG2-5를 제조하였다.
실제 사용된 시스템에서 프로모터 세기를 StepOnePlus Real-time PCR system로 RT-qPCR을 수행하여 실제 전사된 infA 전사물의 양을 측정하였다. infA 전사물을 증폭시키기 위해 Q-infA-F/Q-infA-B 프라이머 세트를 사용하였고, 염색체 상에 있는 하우스키핑 유전자인 hcaTcysG를 레퍼런스로 하고, 상기 hcaTcysG 전사물을 증폭시키기 위해 Q-hcaT-F/Q-hcaT-B와 Q-cysG-F/Q-cysG-B 프라이머 세트를 사용하였다. 상대적인 infA 전사체의 양은 CT 비교 방법을 통해 정량화 하였고 상기 표 2에 그 상대적인 세기를 나타내었다. 이용한 프로모터들의 예측 세기와 실제 발현 정도는 조금 차이를 보였으나, 대체적인 경향은 일치함이 확인되었다.
PCN은 염색체 당 플라스미드 개수로 정의하였고, StepOnePlus Real-time PCR system을 사용하고 quantitative polymerase chain reaction(qPCR)을 수행하여 PCN을 측정하였다. 플라스미드와 염색체의 특정 부분을 증폭하기 위해 각각 Q-pCDF-F/Q-pCDF-B 그리고 Q-polA-F/Q-polA-B 프라이머 세트를 사용하였다. 최종적으로, 5개의 각기 다른 발현량을 가지는 infA가 삽입된 STAPL 균주를 20 ml의 실시예 1에서 사용한 배지와 같은 배지에서 배양을 진행하였다. infA의 발현량 조절의 메커니즘을 통한 PCN 조절의 메커니즘을 도 6에 나타내었고, STG1-5 균주의 무항생제 배지에서의 특정 형광을 도 7A에, 실제 PCN, infA의 상대적인 프로모터 세기를 도 7B에, 그리고 균주의 특이적 성장률을 도 7C에 나타내었으며, 상기 STG2-5 균주의 0, 10, 20, 그리고 40 세대 째의 세포 하나 당 형광 프로파일을 도 8에 나타내었다.
도 7A에서 확인한 바와 같이, infA의 전사 레벨에 따라 특정형광의 상대적인 값이 감소함을 확인하였다. 또한 도 7B에서는 infA의 전사 레벨에 따라 세포의 PCN 값이 변화하는 것을 확인하였다. 상기와 같은 실험 결과를 통하여, 프로모터 세기로 필수 유전자의 전사의 조절을 통하여 infA 발현량을 조절하면 PCN이 성공적으로 조절될 수 있음을 확인하였다. 이는 도 6에 모식화하여 나타낸 바와 같이, infA 발현량이 낮으면 세포는 생존을 위해 infA를 더 요구하므로 플라스미드가 많은 세포들이 선택되어 살아남는 반면, infA 발현량이 낮으면 세포에게 대사 부담을 주는 플라스미드가 많이 유지될 필요가 없기 때문에 플라스미드가 적은 세포가 많은 비중을 차지하게 되기 때문에 발생하는 결과이다. 즉, 도 7A 및 7B에서 확인한 바와 같이, infA 발현량을 조절하면 PCN이 조절되며, PCN 값은 정량적으로 최대 5.6배까지 조절될 수 있음을 확인하였으며, 이를 표 4에 상기 PCN 값을 정리하여 나타내었다.
도 7C에서 확인한 바와 같이, STG1 내지 5 균주들의 특이 성장률은 0.47 h-1로 모두 비슷한 값을 나타낸다는 것으로부터 본 발명의 STAPL 시스템이 세포에게 대사 부담을 주지 않는다는 것을 확인하였다. 또한, 도 8에서 확인한 바와 같이, STG2-5 균주들은 앞선 실시예 1에서의 STG1 균주와 마찬가지로 계속된 계대 배양으로 그 세대수가 높아져도 세포 하나 당 형광이 안정적으로 유지됨을 확인하였다.
따라서, 본 발명의 STAPL 시스템은 infA의 발현량을 정밀하게 조절함으로써 상기 시스템을 발현하는 세포에서 추가적인 대사 부담을 주지 않으면서 PCN을 정량적으로 5.6배까지 조절할 수 있음을 확인하였다.
실시예 5. STAPL을 통한 목표 생산물의 생산
5.1 STAPL 시스템을 이용한 이타콘산의 생산
본 발명의 STAPL 시스템을 이용하면 상기 시스템을 적용시킨 균주가 종래의 항생제 의존 플라스미드 유지 시스템에 비해 플라스미드를 장시간 안정적으로 세포 간 변이를 최소화하여 유지할 수 있고, 또한 infA 발현량을 조절하여 PCN을 정교하게 조절할 수 있는 바, 이를 이용하여 목표 생산물인 이타콘산(itaconic acid)을 효율적으로 생산할 수 있는지 확인하는 실험을 수행하였다. 대장균의 목표 생산물인 이타콘산을 생산하기 위하여 Aspergillus terreus에서 유래된 cad 외래 유전자를 Thermo Fisher 사에서 코돈 최적화된 형태로 이용하였다. 유전자 발현량을 최대화하기 위하여, 발현 카세트로 tac 프로모터와 합성 5′ UTR을 활용한 발현 카세트로 교체하여 사용하였다. 합성 5′ UTR의 경우 유전자의 발현량을 최대화할 수 있게 설계한 것으로 UTR Designer를 통하여 예측 발현량이 100만 이상이 되게 설계한 합성 5′ UTR을 이용하였다. pCDF-CAD 플라스미드를 제작하기 위해 중간 복제 수를 가지는 pCDFDuet 플라스미드를 주형으로 하여, 표 3에 나타낸O-pCDF-F/O-pCDF-B 프라이머 세트를 이용해 증폭하였다. cad를 O-cad-F1/O-cad-B1 그리고 O-cad-F2/O-cad-B2 프라이머 세트로 차례로 증폭시킨 뒤, BsaI 제한 효소 서열을 이용한 클로닝을 통해 상기 플라스미드에 삽입함으로써 최종적으로 pCDF-CAD 플라스미드를 제작하였다. 상기 플라스미드로 STAPL을 적용시킨 pSTAPL_CAD_v1-5를 제작하기 위해서 Escherichia coli의 W3110 균주의 염색체를 주형으로 하여 표 3의 O-infA-F1v1-5/O-infA-F2/O-infA-B 프라이머 세트를 이용해 infA 유전자를 증폭하였고, Bsu36I 제한 효소 서열을 이용한 클로닝을 통해 상기 플라스미드에 삽입하였다. 완성된 플라스미드는 Escherichia coli의 W3110 균주에 삽입하였다. 그 다음으로 영양 요구성 유지를 위해 균주의 염색체 상 infA를 제거하기 위하여 기존에 알려진 Lambda-Red 리콤비네이션 시스템을 이용하였고, pKD46 플라스미드를 사용하였다. infA 제거를 위한 DNA 단편은 FRT-Kan R-FRT 주형으로 하고, D-infA-F/D-infA-B 프라이머 세트로 증폭하여 infA를 제거된 재조합 대장균 STI1-5를 제조하였다.
상기 제조한 재조합 대장균에서 생산된 이타콘산 생산량을 비교하기 위하여, 음성, 양성 대조군(STI0)과 함께 세포 배양을 진행하였다. 재조합 대장균 균주 STI0-5를 변형된 25 ml의 글루코오스 M9 배지 (100 mM 인산버퍼, 0.5 g/L MgSO4.7H2O, 2 g/L NH4Cl, 2 g/L NaCl, 2 g/L yeast extract, 10 mL/L의 ATCC trace mineral solution을 포함하며, 20 g/L의 글루코오스를 유일 탄소원으로 사용)에 넣은 후, 30°C에서 200 rpm의 조건으로 48시간 동안 배양하였고, 초기 세포 농도는 사전에 같은 배지에서 배양을 통해 준비된 세포와 동일하게 OD600 농도 0.05로 희석하였다. 양성 제어로 사용한 종래의 항생제 의존성 플라스미드 유지 시스템(STI0)의 경우에만 플라스미드 유지를 위한 항생제로 50 ㎍/ml의 스트렙토마이신을 배지에 포함하여 사용하였다. 배양 후, 이타콘산과 배지 내 다른 유기물들은 Aminex HPX-87H 칼럼과 분당 0.6 ml의 5 mM H2SO4를 이동상으로 이용하여 측정하였고, 검출에는 Shodex RI-101 기기를 사용하였다. 이타콘산 생산을 위한 STAPL 시스템 및 해당 플라스미드를 모식화하여 도 9에 나타내었고, STI0-5를 이용한 이타콘산 생산의 30시간 후의 결과를 도 10A에, 그 때의 PCN을 10B에 나타내었다.
도 10A에 나타난 바와 같이, 30시간 후의 결과에서 항생제를 포함하지 않은 STI0 균주에서는 다른 사용된 균주에 비해 무시할 수 있을 만큼의 0.28 g/L의 이타콘산의 생산이 확인되었으나, 항생제를 포함한 STI0 균주에서는 대략 그 2배 정도의 0.42 g/L의 생산이 확인되었다. 한편, 항생제가 포함되지 않은 STAPL 적용 생산 시스템은 infA 발현이 가장 낮아서 PCN이 가장 높게 유지되는 STI1 균주에서 항생제를 포함한 STI0 균주에 비해 170% 증가한 0.69 g/L의 이타콘산을 확인하였으며, 이외 다른 균주들이 0.6 g/L의 양 정도의 값을 나타내는 것을 확인하였다. 이러한 결과는 배양 초기에는 세포 성장이 빨라서 PCN이 많은 것이 생산에 유리하지만, 이후에는 성장을 거의 하지 않으므로 PCN이 적은 것이 오히려 생산에 유리해진다는 사실을 의미하는 것이다. 또한, 도 10B에 나타난 바와 같이, 균주의 배양 30시간 후에 PCN은 infA 발현이 증가할수록 감소하는 것을 확인하였다. 보다 구체적으로, STI4에서 663 카피 수로 최저값이 나타났고, STI1에서 3390 카피 수로 최고값이 나타남을 확인하였고, 그 상세한 값은 표 4에 해당 PCN 값으로 나타내었다. 종합적으로, STAPL이 이타콘산 생산 시스템에서도 성공적으로 플라스미드를 유지할 수 있음을 확인하였고, 이는 생산을 최대화하기 위해 표적 유전자의 최적 발현을 찾는 데에 적용할 수 있음을 확인하였다.
실시예 5.2 STAPL 시스템을 이용한 라이코펜의 생산
상기 실시예 1 내지 3에서 STAPL 적용 균주를 분석한 것을 기반으로 상기 시스템을 이용하여 목표 생산물인 라이코펜(Lycopene)을 효율적으로 생산할 수 있는지 확인하는 실험을 수행하였다. 목표 생산물을 라이코펜으로 하고 STAPL 시스템을 이용을 통한 라이코펜의 생산 양상을 비교 분석하였다. 라이코펜 생산을 위하여 Escherichia coli에서 유래된 ispAidi Pantoea agglomerans에서 유래된 crtEBI를 Thermo Fisher 사에서 코돈 최적화된 형태로 이용하였다. 표 1에 나타난 pCDF_idi_ispA_crtEBI 플라스미드를 사용하여 STAPL을 적용시킨 pSTAPL_LYCv1-5를 제작하기 위해서 Escherichia coli의 W3110 균주의 염색체를 주형으로 하여 표 3의 O-infA-F1v1-5/O-infA-F2/O-infA-B 프라이머 세트를 이용해 infA를 증폭하였고, Bsu36I 제한 효소 서열을 이용한 클로닝을 통해 상기 플라스미드에 삽입하였다. 상기 완성된 플라스미드를 Escherichia coli의 W3110 균주에 삽입하였다. 그 다음으로 영양 요구성 유지를 위해 균주의 염색체 상 infA를 제거하기 위하여 기존에 알려진 Lambda-Red 리콤비네이션 시스템을 이용하였고, pKD46 플라스미드를 사용하였다. infA 제거를 위한 DNA 단편은 FRT-Kan R-FRT 을 주형으로 하고, D-infA-F/D-infA-B 프라이머 세트로 증폭하여 infA가 제거된 재조합 대장균 STL1-5를 제조하였다.
상기 제조한 재조합 대장균에서 라이코펜 생산량을 비교하기 위하여, 음성, 양성 대조군(STL0)과 함께 세포 배양을 진행하였다. 재조합 대장균 균주 STL0-5를 변형된 20 ml의 글루코오스 2X M9 배지 (200 mM 인산버퍼, 1 g/L MgSO4.7H2O, 4 g/L NH4Cl, 4 g/L NaCl을 포함하며, 4 g/L의 글루코오스를 유일 탄소원으로 사용)에 넣은 후, 37°C에서 250 rpm의 조건으로 24시간 동안 배양하였고, 초기 세포 농도는 사전에 같은 배지에서 배양을 통해 준비된 세포와 동일하게 OD600 농도 0.05로 희석하였다. 양성 제어로 사용한 종래의 항생제 의존성 플라스미드 유지 시스템(STL0)의 경우에만 플라스미드 유지를 위한 항생제로 50 ㎍/ml의 스트렙토마이신을 배지에 포함하여 사용하였다. 배양 후, 라이코펜 생산양은 기존에 알려진 변형된 비색적 방법(colorimetric assay)을 통해 측정하였고, VICTOR 1420 Multilabel Plate Reader를 이용해 475 nm의 흡광도 측정을 통해 정량하였다. 라이코펜 생산을 위한 STAPL 시스템 및 사용된 플라스미드를 모식화하여 도 11에 나타내었고, STL0-5 균주의 배양 24시간 후 라이코펜의 특정 생산 양상을 도 12A에, OD가 0.8일 때의 PCN을 도 12B에 나타내었다.
도 12A에 나타난 바와 같이, 라이코펜의 특이 생산 경향은 infA의 프로모터 세기와 반비례 관계로, 양자는 매우 밀접한 관련이 있음을 확인하였다. infA 발현이 높을수록 PCN이 적게 유지되므로 라이코펜 생산 유전자들의 유전자 레벨 양이 상대적으로 감소하고, 라이코펜 합성에 대한 탄소 플럭스가 감소되어 결과적으로 라이코펜의 특이 생산양도 감소하는 결과를 확인하였다. 특히, infA 발현이 가장 낮아서 PCN이 가장 높게 유지되는 STL1 균주는 항생제를 포함하는 STL0 균주에 비해 200% 증가된 27.1 mg/g DCW로 높은 라이코펜 생산량을 나타나는 것을 확인하였다. 도 12B에 나타난 바와 같이, 균주의 배양 30시간 후에 PCN은 infA 발현이 증가할수록 감소하는 경향을 나타내는 것을 확인하였다. 보다 구체적으로, STI4에서 38 카피 수로 최저값이 나타났고, STI1에서 684 카피 수로 최고값이 나타남을 확인하였고, 그 상세한 값은 표 4에 해당 PCN 값을 나타내었다. 종합적으로, STAPL이 라이코펜 생산 시스템에서도 성공적으로 플라스미드를 유지할 수 있음을 확인하였고, 이는 생산을 최대화하기 위해 표적 유전자의 최적 발현을 찾는 데에 적용할 수 있음을 또한 재확인하였다.
본 실시예에 따라, Escherichia coli를 숙주세포로 하여 infA를 사용하는 STAPL 시스템을 적용시키면 infA 발현량에 따라 PCN을 정교하게 정량적으로 조절할 수 있으므로, 배지에 값 비싼 항생제가 반드시 첨가되어야 한다는 기존의 문제점을 해결하여 효과적으로 PCN의 조절이 가능함을 확인하였다.
비록 본 발명이 상기에 언급된 바람직한 실시예로서 설명되었으나, 발명의 요지와 범위로부터 벗어남이 없이 다양한 수정이나 변형을 하는 것이 가능하다. 또한 첨부된 청구 범위는 본 발명의 요지에 속하는 이러한 수정이나 변형을 포함한다.

Claims (25)

  1. 합성 5′ UTR(untranslated region), 프로모터, 조절 유전자를 포함하는, 유전자 발현 카세트.
  2. 제1항에 있어서, 상기 조절 유전자는 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE, murF , mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL, yadR , dapD , map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE, accA , tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH, cysS , folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK , lolA, serS , rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD , fabG, acpP , tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA , fabI, tyrS , ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA , metG, folE , yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS , ispG, suhB , acpS , era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD, ftsB , eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD , dnaG, rpoD , infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG , rpsI, rplM , degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU , coaA, birA , murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX , rho, trpT , glmU, glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ , glyS, ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB , rpsS, rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO , secY, rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp , psd, rsgA , orn , yjeE, rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상인, 유전자 발현 카세트.
  3. 제1항에 있어서, 상기 프로모터는 서열번호 1 내지 5로 표시되는 프로모터로 이루어진 군으로부터 선택된 1종의 프로모터인, 유전자 발현 카세트.
  4. 제1항에 있어서, 상기 합성 5′ UTR은 유전자를 저발현시키기 위한 것인, 유전자 발현 카세트.
  5. 제1항에 있어서, 상기 합성 5′ UTR은 서열번호 54, 55, 56 및 59으로 표시되는 염기서열로 이루어진 군으로부터 선택된 1종의 5′ UTR인 것을 특징으로 하는, 유전자 발현 카세트.
  6. 제1항에 있어서, 상기 유전자 발현 카세트는 목적 유전자를 더 포함하는 것을 특징으로 하는, 유전자 발현 카세트.
  7. 제6항에 있어서, 상기 목적 유전자는 이타콘산 또는 라이코펜 생산 유전자인 것을 특징으로 하는, 유전자 발현 카세트.
  8. 제1항에 있어서, 상기 유전자 발현 카세트는 터미네이터를 더 포함하는 것을 특징으로 하는, 유전자 발현 카세트.
  9. 제8항에 있어서, 상기 터미네이터는 서열번호 53으로 표시되는 염기서열로 이루어진 것을 특징으로 하는, 유전자 발현 카세트.
  10. 복제원점 및 제1항의 유전자 발현 카세트를 포함하는, 재조합 벡터.
  11. 제10항에 있어서, 상기 재조합 벡터는 플라스미드인 것을 특징으로 하는, 재조합 벡터.
  12. 제11항에 있어서, 상기 플라스미드는 세포당 1 내지 600 카피 수를 가지도록 하는 복제원점을 포함하는 것을 특징으로 하는, 재조합 벡터.
  13. 제10항에 있어서, 상기 재조합 벡터는 복제원점으로 CloDF-13 또는 PMB1을 포함하고, 조절 유전자로 infA 를 포함하는 것을 특징으로 하는, 재조합 벡터.
  14. 제10항에 있어서, 상기 재조합 벡터는 복제원점으로 CloE1을 포함하고, 조절 유전자로 efp 를 포함하는 것을 특징으로 하는, 재조합 벡터.
  15. 제10항의 재조합 벡터가 도입된, 분리 불안(segregational instability)이 개선된 재조합 미생물.
  16. 제15항에 있어서, 상기 재조합 미생물은 제13항의 재조합 벡터 및 제14항의 재조합 벡터로 이루어진 군으로부터 선택된 1개 이상의 재조합 벡터가 도입된 것을 특징으로 하는, 분리 불안(segregational instability)이 개선된 재조합 미생물.
  17. 제15항에 있어서, 상기 재조합 미생물은 재조합 벡터의 수를 안정적으로 유지할 수 있는 것을 특징으로 하는, 분리 불안(segregational instability)이 개선된 재조합 미생물.
  18. 제15항에 있어서, 상기 재조합 미생물은 염색체 상의 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL, ftsI , murE , murF , mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA, lpxB , dnaE , accA , tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk, hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK, lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD, fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA, fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA, metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda , der , hisS, ispG , suhB , acpS , era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF, ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD, dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG, rpsI , rplM , degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU, coaA , birA , murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX , rho, trpT, glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ, glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB, rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO, secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp, psd, rsgA , orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자가 제거된 것을 특징으로 하는, 분리 불안(segregational instability)이 개선된 재조합 미생물.
  19. 제10항의 재조합 벡터를 도입하는 단계; 를 포함하는, 분리 불안(segregational instability)이 개선된 재조합 미생물의 제조 방법.
  20. (a) 목적 플라스미드 카피 수에 따라 목적 전사량을 가지는 프로모터를 선택하는 단계;
    (b) 상기 (a) 단계에서 선택된 프로모터, 합성 5′UTR 및 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL , ftsI , murE , murF , mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE, can, folK , hemL , yadR , dapD , map, rpsB , tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ, lpxA , lpxB , dnaE , accA , tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX, adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA, ftsK , lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ, fabD , fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA, ribA , fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT, pgsA , metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX , ligA , zipA , dapE , dapA , hda, der , hisS , ispG , suhB , acpS , era, lepB , pssA , yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA, alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca, folB , ygjD , dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK, yhbN , yhbG , rpsI , rplM , degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE, glyT , thrU , coaA , birA , murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX, rho, trpT , glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA, gpsA , glyQ , glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD, rplW , rplB , rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE, rpmD , rplO , secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS, groL , efp , psd , rsgA , orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자를 포함하는 유전자 발현 카세트를 제조하는 단계; 및
    (c) 상기 (b) 단계에서 제조한 유전자 발현 카세트를 미생물에 도입하는 단계;를 포함하는 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법.
  21. 제20항에 있어서, 상기 유전자 발현 카세트는 목적 유전자를 더 포함하는 것을 특징으로 하는, 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법.
  22. 제20항에 있어서, 상기 유전자 발현 카세트는 터미네이터를 더 포함하는 것을 특징으로 하는, 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법.
  23. 제20항에 있어서, 상기 프로모터는 서열번호 1 내지 5로 표시되는 프로모터로 이루어진 군으로부터 선택된 1종의 프로모터인, 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법.
  24. 제20항에 있어서, 상기 재조합 미생물은 염색체 상의 iiribF , ileS , lspA , ispH , dapB , folA , imp, ftsL, ftsI , murE , murF , mraY , murD , ftsW , murG , murC , ftsQ , ftsA , ftsZ , lpxC , secM , secA , coaE , can, folK , hemL , yadR , dapD , map, rpsB, tsf , pyrH , frr , dxr , ispU , cdsA , yaeL , yaeT , lpxD , fabZ , lpxA , lpxB , dnaE, accA , tilS , proS , hemB , secD , secF , ribD , ribE , nusB , thiL , dxs , ispA , ffs, dnaX , adk , hemH , lpxH , cysS , folD , argU , mrdB , mrdA , nadD , holA , rlpB , leuS , lnt , leuW , glnS , fldA , infA , ftsK, lolA , serS , rpsA , msbA , lpxK , kdsB , mukF , mukE , mukB , asnS , fabA , serT , mviN , rne , yceQ , fabD, fabG , acpP , tmk , holB , lolC , lolD , lolE , pth , prsA , ispE , lolB , hemA , prfA , prmC , kdsA , topA , ribA, fabI , tyrS , ribC , pheT , pheS , rplT , infC , thrS , nadE , gapA , yeaZ , aspS , argS , leuZ , cysT , pgsA, metG , folE , yejM , gyrA , nrdA , nrdB , folC , accD , fabB , gltX, ligA , zipA , dapE , dapA , hda , der , hisS , ispG , suhB , acpS , era, lepB , pssA, yfiO , rplS , trmD , rpsP , ffh , grpE , yfjB , serV , csrA , alaS , ispF , ispD , ftsB , eno , pyrG , lgt, prfB , fbaA , pgk , metK , yqgF , plsC , parC , parE , ribB , cca , folB , ygjD, dnaG , rpoD , infB , nusA , leuU , glmM , ftsH , obgE , rpmA , rplU , ispB , murA , kdsC , yrbK , yhbN , yhbG, rpsI , rplM , degS , mreD , mreC , mreB , accB , accC , rpoC , rpoB , rplL , rplJ , nusG , secE , glyT , thrU, coaA , birA , murB , murI , priA , ftsN , yihA , polA , hemG , hemC , hemD , proM , hisR , argX , rho, trpT, glmU , glmS , yidC , rnpA , rpmH , dnaA , dnaN , gyrB , spoT , gmk , dut , dfp , rpmB , coaD , kdtA , gpsA , glyQ, glyS , ftsY , ftsE , ftsX , rpoH , asd , yrfF , trpS , rpsL , rpsG , fusA , rpsJ , rplC , rplD , rplW , rplB, rpsS , rplV , rpsC , rplP , rpmC , rpsQ , rplN , rplX , rplE , rpsN , rpsH , rplF , rplR , rpsE , rpmD , rplO, secY , rpsM , rpsK , rpsD , rpoA , rplQ , fmt , def , yrdC , ubiA , plsB , lexA , dnaB , ssb, groS , groL , efp, psd, rsgA , orn , yjeE , rpsR , ppa , valS , yjgP , yjgQ , dnaC dnaT로 이루어진 군으로부터 선택된 1종 이상의 조절 유전자가 제거된 것을 특징으로 하는, 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법.
  25. 제20항에 있어서, 상기 재조합 미생물을 항생제 미포함 배지에서 배양하는 단계를 더 포함하는 것을 특징으로 하는 재조합 미생물 내 플라스미드 카피 수의 정량 조절 방법.
PCT/KR2018/004038 2017-04-06 2018-04-05 무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법 Ceased WO2018186704A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/500,637 US12247242B2 (en) 2017-04-06 2018-04-05 Method for quantitatively controlling plasmid copy number in antibiotic-free plasmid maintenance system

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170044979 2017-04-06
KR10-2017-0044979 2017-04-06

Publications (1)

Publication Number Publication Date
WO2018186704A1 true WO2018186704A1 (ko) 2018-10-11

Family

ID=63712554

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/004038 Ceased WO2018186704A1 (ko) 2017-04-06 2018-04-05 무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법

Country Status (3)

Country Link
US (1) US12247242B2 (ko)
KR (1) KR102050870B1 (ko)
WO (1) WO2018186704A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112029786A (zh) * 2020-08-04 2020-12-04 无锡生基医药科技有限公司 低拷贝质粒菌种的质粒发酵方法
CN112342234A (zh) * 2020-10-27 2021-02-09 江南大学 一种调控n-乙酰神经氨酸产量提高的重组枯草芽孢杆菌

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110804617B (zh) * 2019-09-27 2020-09-22 黑龙江伊品生物科技有限公司 一种kdtA基因改造的重组菌株及其构建方法与应用
JP7661015B2 (ja) * 2020-06-12 2025-04-14 ナガセヴィータ株式会社 目的タンパク質の製造方法
KR102774894B1 (ko) * 2021-06-14 2025-03-05 연세대학교 산학협력단 프룩토오스 대사 유전체가 돌연변이된 균주
KR102743474B1 (ko) * 2022-03-04 2024-12-17 울산과학기술원 대장균 및 슈도모나스 푸티다에서 사용하기 위한 재조합 발현 시스템
KR102774454B1 (ko) * 2023-02-09 2025-03-05 울산과학기술원 형질전환된 대장균을 이용한 4-하이드록시발레르산의 생산 방법

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070150978A1 (en) * 1999-05-17 2007-06-28 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
US20030204075A9 (en) * 1999-08-09 2003-10-30 The Snp Consortium Identification and mapping of single nucleotide polymorphisms in the human genome
CA2404260A1 (en) * 2000-03-21 2001-09-27 Elitra Pharmaceuticals, Inc. Identification of essential genes in prokaryotes
WO2010075441A1 (en) * 2008-12-22 2010-07-01 Trustees Of Boston University Modular nucleic acid-based circuits for counters, binary operations, memory, and logic
WO2012012739A2 (en) * 2010-07-22 2012-01-26 President And Fellows Of Harvard College Multiple input biologic classifier circuits for cells
WO2014161988A1 (en) * 2013-04-05 2014-10-09 Université Du Luxembourg Biotechnological production of itaconic acid
CA2955375A1 (en) * 2014-07-17 2016-01-21 Modernatx, Inc. Terminal modifications of polynucleotides
WO2016095211A1 (en) * 2014-12-19 2016-06-23 Adagene Inc. Methods and systems for autoinduction of protein expression

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide 7 November 2016 (2016-11-07), "Synthetic plasmid pTig-PhiF, complete sequence", XP055613711, retrieved from NCBI Database accession no. KX353597 *
DATABASE Nucleotide 8 June 2015 (2015-06-08), "Boolean integrase logic vector NAND gate BCD-RFP, complete sequence 20150608", XP055613715, retrieved from NCBI Database accession no. KM234321 *
KANORIA ET AL.: "A 28 nt long synthetic 5' UTR (synJ) as an enhancer of transgene expression in dicotyledonous plants", BMC BIOTECHNOLOGY, vol. 12, no. 85, 2012, pages 1 - 14, XP021135803 *
MARTINEZ-GARCIA ET AL.: "Mining environmental plasmids for synthetic biology parts and devices", PLASMIDS-BIOLOGY AND IMPACT IN BIOTECHNOLOGY AND DISCOVERY, vol. 3, no. 1, 2015, pages 1 - 16, XP055613710 *
SELVAMANI ET AL.: "Antibiotic-free segregational plasmid stabilization in Escherichia coli owing to the knockout of triosephosphate isomerase (tiA)", MICROBIAL CELL FACTORIES, vol. 13, no. 58, 2014, pages 1 - 13, XP021184766 *
ZHOU, S.: "Obtaining a Panel of Cascade Promoter-5' -UTR Complexes in Escherichia coli", ACS SYNTHETIC BIOLOGY, vol. 6, 2 March 2017 (2017-03-02), pages 1065 - 1075, XP055613730 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112029786A (zh) * 2020-08-04 2020-12-04 无锡生基医药科技有限公司 低拷贝质粒菌种的质粒发酵方法
CN112342234A (zh) * 2020-10-27 2021-02-09 江南大学 一种调控n-乙酰神经氨酸产量提高的重组枯草芽孢杆菌
CN112342234B (zh) * 2020-10-27 2023-02-21 江南大学 一种调控n-乙酰神经氨酸产量提高的重组枯草芽孢杆菌

Also Published As

Publication number Publication date
KR102050870B1 (ko) 2019-12-02
US12247242B2 (en) 2025-03-11
US20240200108A1 (en) 2024-06-20
KR20180113469A (ko) 2018-10-16

Similar Documents

Publication Publication Date Title
WO2018186704A1 (ko) 무항생제 플라스미드 유지 시스템에서 플라스미드 카피 수의 정량적 조절 방법
US12385035B2 (en) Synthetic genome
US8178339B2 (en) Reduced genome E. coli
Haddadin et al. Transcriptome profiles for high‐cell‐density recombinant and wild‐type Escherichia coli
Wells et al. The Sinorhizobium meliloti stringent response affects multiple aspects of symbiosis
JPWO2009116566A1 (ja) 工業的に有用な微生物
US20080009041A1 (en) Industrially Useful Microorganism
CN101115832A (zh) 工业上有用的微生物
JP2024521175A (ja) 微生物及びその使用
JP2022533040A5 (ko)
EP3535399B1 (en) Temperature based plasmid regulation system
WO2018083116A1 (en) Temperature based plasmid regulation system
WO2015170907A1 (ko) L-라이신 생산능이 향상된 미생물 및 이를 이용한 l-라이신 생산방법
WO2011141027A1 (en) A METHOD OF STABILIZING mRNA
Kawasaki et al. Mini-F plasmid mutants able to replicate in the absence of sigma 32: mutations in the repE coding region producing hyperactive initiator protein
DE102004040134A1 (de) Neue essentielle Gene von Bacillus licheniformis und darauf aufbauende verbesserte biotechnologische Produktionsverfahren
JP5415763B2 (ja) 新規選択系
WO2020180132A1 (ko) D-글루타메이트 영양요구성 대장균 및 이를 이용한 목적 물질 생산 방법
WO2025143878A1 (ko) 아세트산 적응 진화를 통한 이타콘산 고효율 생산 균주 및 이의 용도
WO2026005490A1 (ko) 목적 유전자의 발현 조절을 위한 인공 핵산 및 이를 이용한 다수 유전자의 발현 조절 시스템
WO2025101028A1 (ko) TdT(Terminal deoxynucleotidyl transferase) 및 dNTP를 이용한 비번역영 역 (untranslated region) 라이브러리 합성 방법
WO2018212627A1 (ko) 숙신산 생산능이 향상된 변이 미생물 및 이를 이용한 숙신산 생산방법
Freed et al. Full Title: 1 Combining Shigella Tn-seq data with Gold-standard E. coli Gene Deletion Data 2 Suggests Rare Transitions between Essential and Non-essential Gene Functionality 3 Short Title: 4 Transitions between Essential and Non-essential Functionality 5
KR20250037556A (ko) 유전자 코드
WO2024262952A1 (ko) 변이된 rbs 염기 서열을 포함하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 미생물, 및 이를 이용한 글리신 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18780716

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18780716

Country of ref document: EP

Kind code of ref document: A1

WWG Wipo information: grant in national office

Ref document number: 16500637

Country of ref document: US