WO2018156998A1 - Compositions and related methods for modulating endosymbionts - Google Patents
Compositions and related methods for modulating endosymbionts Download PDFInfo
- Publication number
- WO2018156998A1 WO2018156998A1 PCT/US2018/019577 US2018019577W WO2018156998A1 WO 2018156998 A1 WO2018156998 A1 WO 2018156998A1 US 2018019577 W US2018019577 W US 2018019577W WO 2018156998 A1 WO2018156998 A1 WO 2018156998A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- spp
- host
- insect
- instances
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/02—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms
- A01N43/04—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
- A01N43/06—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom five-membered rings
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/02—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms
- A01N43/04—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
- A01N43/14—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom six-membered rings
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/02—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms
- A01N43/04—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
- A01N43/14—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom six-membered rings
- A01N43/16—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom six-membered rings with oxygen as the ring hetero atom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/32—Yeast
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/60—Isolated nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/557—Eicosanoids, e.g. leukotrienes or prostaglandins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- Invertebrate organisms e.g., insects, mollusks, or nematodes
- invertebrates serve beneficial roles, such as nematodes or arthropods utilized in agriculture for pollination efforts and pest control or in commerce for the production of commercial products (e.g., honey or silk).
- invertebrates can be detrimental, including some species of mollusks (e.g., snails and slugs), nematodes, or insects that can be serious crop pests or carriers of disease.
- compositions and methods for modulating the fitness of invertebrates including insects, nematodes, or mollusks, by altering the interactions between the host and one or more microorganisms resident in the host.
- a method for decreasing the fitness of an insect including delivering to the insect an effective amount of a polynucleotide that includes a dsRNA that decreases expression of an insect bacteriocyte regulatory gene or an insect immunoregulatory gene in the insect relative to an insect that has not been administered the dsRNA.
- the gene encodes a protein from the bacteriocyte-specific cysteine rich proteins BCR family, a protein from the secreted proteins SP family, BicD (Protein bicaudal D), Cact (cactus), DIF (Dorsal related immunity factor), Toll (Toll Interacting Protein), or imd (immune deficiency protein).
- BicD Protein bicaudal D
- Cact Cact
- DIF Dorsal related immunity factor
- Toll Toll Interacting Protein
- imd imd (immune deficiency protein).
- the gene encodes a protein having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% amino acid sequence identity to a protein listed in Table 5, Table 8, or Table 9.
- the gene encodes a functional homolog of a protein listed in Table 5, Table 8, or Table 9.
- the gene may encode a cactus-like protein in aphids (e.g., any one of the proteins described by GenBank Accession Nos: XP 022175228.1 ,
- XP_01 6656687.1 NP_001 156668.1 , XP_008179071 .1 , or XP_016656686.1 , the associated amino acid and nucleotide sequences of which are incorporated by reference).
- the dsRNA is complementary to 10 to 30 nucleotides of the gene in the insect (e.g., 1 0 to 30 nucleotides, 12 to 28 nucleotides, 14 to 26 nucleotides, 16 to 24 nucleotides, 14 to 22 nucleotides, or 1 8 to 20 nucleotides).
- the dsRNA is complementary to 10, 1 1 , 12, 13, 14, 15, 1 6, 1 7, 18, 1 9, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides of the gene in the insect.
- the entire length of the dsRNA is complementary to the gene. In alternative embodiments, only a portion of the dsRNA is complementary to the gene.
- the method is effective to decrease expression of the gene in the insect, e.g., by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% or greater relative to an insect that has not been administered the polynucleotide.
- the method is effective to decrease expression of the gene in the insect, e.g., by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% or greater as compared to a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points).
- a reference level e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points).
- the method is effective to decrease expression of the gene in the insect, e.g., by about 1 .5x, 1 .75x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 25x, 50x, 75x, or 1 0Ox fold less relative to an insect that has not been administered the polynucleotide.
- the method is effective to decrease expression of the gene in the insect, e.g., by about 1 .5x, 1 .75x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 25x, 50x, 75x, or 100x fold less as compared to a reference level (e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points).
- a reference level e.g., as compared to expression of one or more control genes (e.g., a housekeeping gene), expression of the same gene in a different sample (e.g., one or more control samples), or expression of the same gene in the same sample at one or more earlier time points).
- the method is effective to inhibit expression of the gene in the insect or to decrease expression of the gene to an undetectable level.
- the method is effective to decrease the level, diversity, or metabolism of one or more microorganisms resident in the insect relative to an insect that has not been delivered the polynucleotide. In some embodiments, the method is effective to decrease the level, diversity, or metabolism of one or more microorganisms resident in the insect, e.g., by about 1 .5x, 1 .75x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 25x, 50x, 75x, or 100x fold less relative to an insect that has not been delivered the polynucleotide.
- the method is effective to decrease the level, diversity, or metabolism of one or more microorganisms resident in the insect, e.g., by about 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% less relative to an insect that has not been delivered the polynucleotide.
- the one or more microorganisms is a Buchnera spp.
- the method is effective to decrease the fitness of the insect relative to an insect that has not been delivered the polynucleotide. In some embodiments, the method is effective to decrease the fitness of the insect, e.g., by about 1 .5x, 1 .75x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 25x, 50x, 75x, or 100x fold less relative to an insect that has not been delivered the polynucleotide.
- the method is effective to decrease the fitness of the insect, e.g., by about 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% less relative to an insect that has not been delivered the polynucleotide.
- the polynucleotide is delivered in a composition formulated for delivery to insects.
- the delivery includes delivering the polynucleotide to at least one habitat where the insect pest grows, lives, reproduces, feeds, or infests.
- the delivery comprises spraying the antimicrobial peptide on an agricultural crop.
- the polynucleotide is delivered as an insect comestible composition for ingestion by the insect.
- the polynucleotide is formulated with an agriculturally acceptable carrier as a liquid, a solid, an aerosol, a paste, a gel, or a gas composition.
- the insect is an aphid.
- compositions including a polynucleotide that includes a dsRNA formulated for delivery to an insect, wherein the dsRNA is complementary to 15 to 30 nucleotides of an insect bacteriocyte regulatory gene or an insect immunoregulatory gene.
- the gene encodes a protein selected from the group consisting of a protein from the bacteriocyte-specific cysteine rich proteins BCR family, a protein from the secreted proteins SP family, BicD (Protein bicaudal D), Cact (cactus), DIF (Dorsal related immunity factor), Toll (Toll Interacting Protein), and imd (immune deficiency protein).
- the gene encodes a protein having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% amino acid sequence identity to a protein listed in Table 5, Table 8, or Table 9.
- the gene encodes a functional homolog of a protein listed in Table 5, Table 8, or Table 9.
- the gene may encode a cactuslike protein in aphids (e.g., any one of the proteins described by GenBank Accession Nos:
- the dsRNA is complementary to 10 to 30 nucleotides of the gene in the insect (e.g., 1 0 to 30 nucleotides, 12 to 28 nucleotides, 14 to 26 nucleotides, 16 to 24 nucleotides, 14 to 22 nucleotides, or 18 to 20 nucleotides).
- the dsRNA is complementary to 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides of the gene in the insect. In some embodiments, the entire length of the dsRNA is complementary to the gene. In alternative embodiments, only a portion of the dsRNA is complementary to the gene.
- compositions described herein are provided herein.
- a transgenic plant cell having in its genome a recombinant DNA construct, wherein the recombinant DNA construct includes a heterologous promoter operably linked to a DNA encoding a RNA including at least one double-stranded RNA region, at least one strand of which includes a nucleotide sequence that is complementary to 15 to 30 nucleotides of an insect bacteriocyte regulatory gene or an insect immunoregulatory gene.
- the gene encodes a protein selected from the group consisting of a protein from the bacteriocyte-specific cysteine rich proteins BCR family, a protein from the secreted proteins SP family, BicD (Protein bicaudal D), Cact (cactus), DIF (Dorsal related immunity factor), Toll (Toll Interacting Protein), and imd (immune deficiency protein).
- the gene encodes a protein having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% amino acid sequence identity to a protein listed in Table 5, Table 8, or Table 9.
- the gene encodes a functional homolog of a protein listed in Table 5, Table 8, or Table 9.
- the gene may encode a cactuslike protein in aphids (e.g., any one of the proteins described by GenBank Accession Nos:
- the dsRNA is complementary to 10 to 30 nucleotides of the gene in the insect (e.g., 1 0 to 30 nucleotides, 12 to 28 nucleotides, 14 to 26 nucleotides, 16 to 24 nucleotides, 14 to 22 nucleotides, or 18 to 20 nucleotides).
- the dsRNA is complementary to 10, 1 1 , 12, 13, 14, 15, 16, 17, 1 8, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides of the gene in the insect. In some embodiments, the entire length of the dsRNA is complementary to the gene. In alternative embodiments, only a portion of the dsRNA is complementary to the gene.
- compositions that include a modulating agent (e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) that modulates (e.g., increases or decreases) the fitness of an invertebrate host (e.g., insect, mollusk, or nematode), wherein the modulating agent alters interactions between the host and one or more microorganisms resident in the host.
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a
- the modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) targets one or more host pathways that mediate interactions between the host and the one or more microorganisms resident in the host (e.g., host-microbiota interactions).
- a polypeptide e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide
- a nucleic acid e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi,
- the targeting (e.g., upregulation, downregulation, or inhibition) of the one or more host pathways alters the level, diversity, or function of the one or more microorganisms resident in the host in comparison to a host organism to which the modulating agent has not been administered. In certain embodiments, the targeting (e.g., upregulation, downregulation, or inhibition) of the one or more host pathways increases the level, diversity, or function of the one or more
- the targeting e.g., upregulation, downregulation, or inhibition
- the targeting decreases the level, diversity, or function of the one or more microorganisms resident in the host in comparison to a host organism to which the modulating agent has not been administered.
- the host pathway is a pathway that regulates bacteriocyte function or development.
- the targeting of bacteriocyte function or development may increase and/or decrease the level, diversity, and/or function of one or more microorganisms resident in the bacteriocyte in comparison to a host organism to which the modulating agent has not been administered.
- the targeting of bacteriocyte function or development decreases the level, diversity, or function of one or more microorganisms resident in the bacteriocyte (e.g., a bacteriocyte of an aphid) in comparison to a host organism to which the modulating agent has not been administered.
- the targeting of bacteriocyte function or development increases the level, diversity, or function of one or more microorganisms resident in the bacteriocyte (e.g., a bacteriocyte of an aphid) in comparison to a host organism to which the modulating agent has not been administered.
- bacteriocyte e.g., a bacteriocyte of an aphid
- the host pathway is a pathway that regulates the host's immune system.
- the modulating agent activates an immune response against the one or more microorganisms resident in the host, thereby decreasing the level, diversity, and/or function of the one or more microorganisms in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent suppresses an immune response against the one or more microorganisms resident in the host, thereby increasing the level, diversity, and/or function of the one or more microorganisms in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) targets one or more host pathways by altering gene expression in the host in comparison to a host organism to which the modulating agent has not been administered.
- a polypeptide e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide
- a nucleic acid e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)
- the modulating agent may increase and/or decrease gene expression in the host in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent alters expression of a gene that encodes a protein listed in Table 3, Table 4, Table 5, Table 7, Table 8, or Table 9 in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent decreases expression of a gene that encodes a protein listed in Table 3, Table 4, Table 5, Table 7, Table 8, or Table 9 in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent decreases expression of a gene that encodes a protein listed in Table 3, Table 4, Table 5, Table 7, Table 8, or Table 9 in comparison to a host organism to which the modulating agent has not been administered.
- the gene encodes a bacteriocyte regulatory peptide.
- the bacteriocyte regulatory peptide may be one listed in Table 5 or Table 8 (e.g., BCR1 ).
- the gene encodes an immune system component.
- the modulating agent targets a polypeptide in the host.
- the polypeptide is an enzyme or cell receptor.
- the modulating agent increases and/or decreases enzyme activity in comparison to a host organism to which the modulating agent has not been administered. In some embodiments, the modulating agent increases and/or decreases cell receptor signaling in comparison to a host organism to which the modulating agent has not been administered. In some embodiments, the host protein is one listed in Table 4, Table 5, Table 8, or Table 9.
- the modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) may additionally or alternatively target one or more microbial pathways that mediate interactions between the host and one or more microorganisms resident in the host.
- a polypeptide e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide
- a nucleic acid e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)
- the modulating agent alters gene expression in one or more microorganisms resident in the host in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent may increase and/or decrease gene expression in the one or more microorganisms in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent alters (e.g., increases or decreases) the expression of a gene that encodes a protein listed in Table 3 or Table 7 in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent targets (e.g., binds, antagonizes, and/or agonizes) a polypeptide in one or more microorganisms resident in the host (e.g., a protein listed in Table 3 or Table 7).
- the one or more microorganisms resident in the host is an endosymbiotic microorganism. In some embodiments, the one or more microorganisms is resident in the host's gut. In some embodiments, the one or more microorganisms is resident in a bacteriocyte in the host. In some embodiments, the one or more microorganisms resident in the host is a fungus or bacterium.
- the bacterium resident in the host is at least one selected from the group consisting of Candidatus spp, Buchenera spp, Blattabacterium spp, Baumania spp, Wigglesworthia spp, Wolbachia spp, Rickettsia spp, Orientia spp, Sodalis spp, Burkholderia spp, Cupriavidus spp, Frankia spp,
- the modulating agent alters the growth, division, viability, metabolism, and/or longevity of the modulating agent
- the modulating agent decreases the growth, division, viability, metabolism, and/or longevity of the one or more microorganisms. In some embodiments, the modulating agent decreases the growth, division, viability, metabolism, and/or longevity of the one or more microorganisms. In some embodiments, the modulating agent decreases the growth, division, viability, metabolism, and/or longevity of the one or more microorganisms. In some embodiments, the modulating agent decreases the growth, division, viability, metabolism, and/or longevity of the one or more microorganisms. In some embodiments, the modulating agent decreases the growth, division, viability, metabolism, and/or longevity of the one or more microorganisms.
- the modulating agent increases the growth, division, viability, metabolism, and/or longevity of the one or more microorganisms.
- the modulating agent is a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or any combination thereof.
- a polypeptide e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide
- a nucleic acid e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)
- CRISPR nucleic acid e.g., a small molecule
- prostaglandin e.g., prostaglandin
- the modulating agent is a nucleic acid.
- the nucleic acid may be a DNA molecule, a RNA molecule (e.g., double-stranded RNA (dsRNA) or single-stranded RNA (ssRNA)), or a hybrid DNA-RNA molecule.
- the RNA is a messenger RNA (mRNA), a guide RNA (gRNA), or an inhibitory RNA.
- the inhibitory RNA is RNAi, shRNA, or miRNA.
- the nucleic acid encodes a polypeptide.
- the nucleic acid is an expression vector encoding a polypeptide.
- the nucleic acid is a CRISPR nucleic acid.
- the modulating agent is a small molecule.
- the small molecule is an agonist, antagonist, inhibitor, or an activator of a component of a host immune system pathway or bacteriocyte regulatory pathway.
- the small molecule is prostaglandin.
- the modulating agent is a polypeptide.
- the polypeptide is an antibody or an antibody fragment.
- the antibody or antibody fragment may be an agonist or antagonist of an enzyme in the host (e.g., an immune system or bacteriocyte-regulatory enzyme) or in the microorganism resident in the host, including any of the proteins listed in Table 5, Table 7, Table 8, or Table 9.
- the modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) modulates the host's fitness by increasing or decreasing the host's susceptibility to a pesticide (e.g., a pesticide listed in Table 1 1 ).
- the pesticide is a bactericide or fungicide.
- the pesticide is an insecticide
- the composition includes a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) of different modulating agents (e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g.,
- the composition includes a modulating agent and a pesticide (e.g., a pesticide listed in Table 1 1 ).
- the pesticide is a bactericide or fungicide.
- the pesticide is an insecticide, molluscicide, or nematicide.
- the composition includes a modulating agent and an agent that increases crop growth.
- the modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) is linked to a second moiety.
- the second moiety is selected from the group consisting of a modulating agent, peptide nucleic acid, cell penetrating peptide (CPP), and targeting domain.
- the modulating agent includes a linker.
- the linker is a cleavable linker.
- the CPP is any one listed in Table 10.
- the composition further includes a carrier.
- the carrier is an agriculturally acceptable carrier.
- the composition further includes a host bait, a sticky agent, or a combination thereof.
- the host bait is a comestible agent.
- the host bait is a chemoattractant.
- the composition is at a dose effective to modulate host fitness. In some embodiments, the composition is at a dose effective to increase host fitness. In alternative embodiments, the composition is at a dose effective to decrease host fitness. In some embodiments, host fitness is measured by survival, lifespan, reproduction, or metabolism of the host.
- the composition is formulated for delivery to a microorganism inhabiting the gut of the host. In some embodiments, the composition is formulated for delivery to a microorganism inhabiting a bacteriocyte of the host. In some embodiments, the composition is formulated for delivery to a plant. In some embodiments, the composition is formulated for use in a host feeding station. In some embodiments, the composition is formulated as a liquid, a powder, granules, or nanoparticles. In some embodiments, the composition is formulated as one selected from the group consisting of a liposome, polymer, bacteria secreting peptide, and synthetic nanocapsule. In some embodiments, the synthetic nanocapsule delivers the composition to a target site in the host. In some embodiments, the target site is the gut of the host. In some embodiments, the target site is a bacteriocyte in the host.
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof)).
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide)
- a nucleic acid e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)
- CRISPR nucleic acid e.g., a small molecule (e
- the plant includes a nucleic acid integrated into the plant genome, wherein the nucleic acid encodes any of the previous modulating agents (e.g., a polypeptide (e.g., an antibody, a bacteriocin (e.g., colA), an antimicrobial peptide, a bacteriocyte regulatory peptide, a nucleic acid, or a small molecule).
- the modulating agent may be non-endogenous to the plant.
- the plant further includes a comestible agent for invertebrates (e.g., insect, mollusk, or nematode), wherein the comestible agent produces and/or carries the modulating agent.
- the comestible agent includes one or more components of the plant.
- the one or more components of the plant includes a root, stem, leaf, flower, sap, bark, wood, spine, pollen, nectar, seed, fruit, or any combination thereof.
- the plant produces a modulating agent that the insect ingests by eating one or more components of the plant.
- hosts including any of the previous compositions (e.g., a modulating agent (e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof)).
- the host may be an invertebrate (e.g., insect, mollusk, or nematode).
- the invertebrate is an insect.
- the insect is a bacteriocyte-containing insect.
- the bacteriocyte-containing insect may be an aphid (e.g., a corn leaf aphid or green peach aphid).
- the insect is a beetle, weevil, fly, aphid, whitefly, leafhopper, scale, moth, butterfly, grasshopper, cricket, thrip, or mite.
- the invertebrate is a mollusk.
- the mollusk is a species belonging to Veronicellidae, Ampullariidae, Achatinidae, Helicidae, Hydromiidae, Planobidae, Lymnaeidae, Urocyclidae,
- the invertebrate may be a nematode.
- the nematode is a species belonging to Criconematidae,
- a system for modulating e.g., increasing or decreasing a host's fitness.
- the system includes a modulating agent (e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof) that alters interactions between the host and one or more microorganisms resident in the host, wherein the system is effective to modulate (e.g., increasing or decreasing) the host's fitness, and wherein the host is an invertebrate (e.g., insect (e.g., an aphid), mollusk, or nematode).
- a modulating agent e
- the modulating agent of the system is any of the previous compositions. In some embodiments, the modulating agent is formulated as a powder. In some embodiments, the modulating agent is formulated as a solvent. In some embodiments, the modulating agent is formulated as a concentrate. In some embodiments, the modulating agent is formulated as a diluent. In some embodiments, the modulating agent is prepared for delivery by combining any of the previous compositions with a carrier.
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof))to the host, wherein the modulating agent modulates one or more interactions between the host and one or more microorganisms resident in the host.
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g.,
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof))to the host and wherein the modulating agent alters interactions between the host and one or more microorganisms resident in the host.
- a modulating agent e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide)
- a nucleic acid e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNA
- the one or more microorganisms resident in the host may be a fungus or bacterium. In some embodiments, the one or more microorganisms is an endosymbiotic microorganism. In some embodiments, the one or more microorganisms is resident in the host's gut. In some embodiments, the one or more microorganisms is resident in a bacteriocyte in the host. In some embodiments, the one or more microorganisms are required for host fitness or host survival.
- the modulating agent may target one or more host pathways that mediate interactions between the host and the one or more microorganisms.
- the host pathway is a pathway that regulates insect (e.g., an aphid) bacteriocyte function or development.
- the targeting of the host bacteriocyte function or development decreases the level, diversity, and/or function of one or more microorganisms resident in the bacteriocyte.
- the targeting of the host bacteriocyte function or development increases the level, diversity, and/or function of one or more microorganisms resident in the bacteriocyte.
- the host pathway is a pathway that regulates the host's immune system.
- the modulating agent activates an immune response against the one or more microorganisms resident in the host, thereby decreasing the level, diversity, and/or function of the one or more microorganisms. In some embodiments, the modulating agent suppresses an immune response against the one or more microorganisms resident in the host, thereby increasing the level, diversity, and/or function of the one or more microorganisms.
- the modulating agent targets one or more microbial pathways that mediate interactions between the host and the one or more microorganisms.
- the delivering step includes providing the modulating agent at a dose and time sufficient to effect the one or more microorganisms, thereby modulating microbial diversity in the host.
- the delivering step includes topical application of any of the previous compositions to a plant.
- the delivering step includes providing the modulating agent through a genetically modified, engineered, or transgenic plant (e.g., any of the plants described herein).
- the delivering step includes providing the modulating agent to the host as a comestible agent for invertebrates (e.g., insect, mollusk, or nematode).
- the delivering step includes providing a host carrying the modulating agent.
- the host carrying the modulating agent can transmit the modulating agent to one or more additional hosts.
- screening assays to identify a modulating agent that modulates (e.g., increases or decreases) the fitness of a host.
- the screening assay may include the steps of (a) exposing a microorganism that can be resident in the host to one or more candidate modulating agents and (b) identifying a modulating agent that increases or decreases the fitness of the host.
- the modulating agent is a microorganism resident in the host.
- the microorganism is a bacterium.
- the bacterium when resident in the host, increases host fitness.
- the bacterium when resident in the host, decreases host fitness.
- the modulating agent is any of the modulating agents described herein (e.g., a modulating agent (e.g., a polypeptide (e.g., antibody, bacteriocin, antimicrobial peptide, or bacteriocyte regulatory peptide (e.g., Coleoptericin A), a nucleic acid (e.g., DNA, RNA (e.g., mRNA, gRNA, or inhibitory RNA (e.g., RNAi, shRNA, miRNA)), CRISPR nucleic acid), a small molecule (e.g., prostaglandin), or a combination thereof)).
- the modulating agent is provided by a genetically modified phage or bacteria.
- the host's fitness is modulated by modulating the host microbiota.
- bacteriocyte refers to a specialized cell found in invertebrates, e.g., insects, nematodes, or mollusks, where intracellular bacteria reside with symbiotic bacterial properties. In some instances, the bacteriocyte may be clustered with other bacteriocytes to form a bacteriome.
- the term "effective amount” refers to an amount of a modulating agent (e.g., a polypeptide, nucleic acid, small molecule, or combinations thereof) or composition including said agent sufficient to effect the recited result, e.g., to increase or decrease the fitness of a host organism (e.g., insect, nematode, or mollusk); to reach a target level (e.g., a predetermined or threshold level) of a modulating agent concentration inside a target host; to reach a target level (e.g., a predetermined or threshold level) of a modulating agent concentration inside a target host gut; to reach a target level (e.g., a predetermined or threshold level) of a modulating agent concentration inside a target host bacteriocyte; to modulate the level, or an activity, of one or more microorganisms (e.g., endosymbiont) in the target host.
- a modulating agent e.g., a polypeptide, nu
- the term "fitness" refers to the ability of a host invertebrate (e.g., insect, mollusk, or nematode) to survive, and/or to produce surviving offspring.
- Fitness of a host may be measured by one or more parameters, including, but not limited to, life span, reproductive rate, mobility, body weight, or metabolic rate. Depending on the host, fitness may additionally be measured based on measures of activity (e.g., biting animals or humans, plant pollination), disease transmission (e.g., vector-vector transmission or vector-animal transmission), or production (e.g., honey or silk).
- gut refers to any portion of a host's gut, including, the foregut, midgut, or hindgut of the host.
- the term "host” refers to an organism, such as an invertebrate (e.g., insect, mollusk, or nematode) carrying resident microorganisms (e.g., endogenous microorganisms,
- endosymbiotic microorganisms e.g., primary or secondary endosymbionts
- commensal organisms e.g., primary or secondary endosymbionts
- pathogenic microorganisms e.g., primary or secondary endosymbionts
- decreasing host fitness refers to any disruption to host physiology, or any activity carried out by said host, as a consequence of administration of a modulating agent, including, but not limited to, any one or more of the following desired effects: (1 ) decreasing a population of a host (e.g., insect, mollusk, or nematode) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (2) decreasing the reproductive rate of a host (e.g., insect, mollusk, or nematode) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 1 00% or more; (3) decreasing the mobility of a host (e.g., insect, mollusk, or nematode) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (4)
- increasing host fitness or “promoting host fitness” refers to any favorable alteration in host physiology, or any activity carried out by said host, as a consequence of administration of a modulating agent, including, but not limited to, any one or more of the following desired effects: (1 ) increasing a population of a host by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (2) increasing the reproductive rate of a host (e.g., insect, mollusk, or nematode) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (3) increasing the mobility of a host (e.g., insect, mollusk, or nematode) by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more; (4) increasing the body weight of a host (e.g., insect, mollusk,
- reactions between a host and microorganisms resident in the host refer to (i) any pathways (e.g., metabolic, gene regulation, cell signaling, or immune-inflammatory pathways) in the host that directly or indirectly influences the survival, growth, or metabolism of microorganisms resident in the host (e.g., endosymbiotic microorganisms), (ii) any pathways (e.g., metabolic or cell signaling pathways) in a resident microorganism that directly or indirectly influences the fitness of the host invertebrate (e.g., insect, nematode, or mollusk), and/or (iii) any pathways (e.g., metabolic, cell signaling, or immune-inflammatory pathways) in a resident microorganism that directly or indirectly influences surivival, growth or metabolism of the host, and/or (iv) any pathways (e.g., metabolic, gene regulation, cell signaling, or immune-inflammatory pathways) in the host that directly or
- insects includes any organism belonging to the phylum Arthropoda and to the class Insecta or the class Arachnida, in any stage of development, i.e., immature and adult insects.
- mollusk includes any organism belonging to the phylum Mollusca, including organisms of the class Gastropoda (e.g., snails and slugs), in any stage of development, i.e., immature and adult mollusks.
- Gastropoda e.g., snails and slugs
- nematode includes any organism belonging to the phylum Nematoda (e.g., nematodes) in any stage of development, i.e., immature and adult nematodes.
- microorganism or “microbiota” refers to bacteria or fungi.
- Microorganisms may refer to microorganisms resident in a host organism (e.g., endogenous
- target microorganism refers to a microorganism that is resident in the host and impacted by a modulating agent, either directly or indirectly.
- the term “modulating agent” or “agent” refers to an agent that is capable of altering the levels and/or functioning of microorganisms resident in a host organism (e.g., invertebrate, e.g., insect, mollusk, or nematode), and thereby modulate (e.g., increase or decrease) the fitness of the host organism.
- a host organism e.g., invertebrate, e.g., insect, mollusk, or nematode
- nucleic acid and “polynucleotide” are interchangeable and refer to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof, regardless of length (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 150, 200, 250, 500, 1000, or more nucleic acids).
- the term also encompasses RNA/DNA hybrids.
- Nucleotides are typically linked in a nucleic acid by phosphodiester bonds, although the term "nucleic acid” also encompasses nucleic acid analogs having other types of linkages or backbones (e.g., phosphoramide, phosphorothioate, phosphorodithioate, O- methylphosphoroamidate, morpholino, locked nucleic acid (LNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), and peptide nucleic acid (PNA) linkages or backbones, among others).
- the nucleic acids may be single-stranded, double-stranded, or contain portions of both single-stranded and double- stranded sequence.
- a nucleic acid can contain any combination of deoxyribonucleotides and
- ribonucleotides as well as any combination of bases, including, for example, adenine, thymine, cytosine, guanine, uracil, and modified or non-canonical bases (including, e.g., hypoxanthine, xanthine, 7- methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5 hydroxymethylcytosine).
- bases including, for example, adenine, thymine, cytosine, guanine, uracil, and modified or non-canonical bases (including, e.g., hypoxanthine, xanthine, 7- methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5 hydroxymethylcytosine).
- the term “pest” refers to invertebrates (e.g., insects, nematodes, or mollusks) that cause damage to plants or other organisms, or otherwise are detrimental to humans, for example, human agricultural methods or products.
- the term "pesticide” or “pesticidal agent” refers to a substance that can be used in the control of agricultural, environmental, and domestic/household pests, such as insects, mollusks, nematodes, fungi, bacteria, and viruses.
- the term “pesticide” is understood to encompass naturally occurring or synthetic insecticides (larvicides or adulticides), insect growth regulators, nematicides, molluscicides, acaricides (miticides), nematicides, ectoparasiticides, bactericides, fungicides, or herbicides (substance which can be used in agriculture to control or modify plant growth).
- pesticides or pesticidal agents are listed in Table 1 1 .
- the pesticide is an allelochemical.
- allelochemical or “allelochemical agent” is a substance produced by an organism that can effect a physiological function (e.g., the germination, growth, survival, or reproduction) of another organism (e.g., an insect, mollusk, or nematode).
- peptide encompasses any chain of naturally or non-naturally occurring amino acids (either D- or L-amino acids), regardless of length (e.g., at least 2, 3, 4, 5, 6, 7, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 1 00, or more amino acids), the presence or absence of post-translational modifications (e.g., glycosylation or phosphorylation), or the presence of, e.g., one or more non-amino acyl groups (for example, sugar, lipid, etc.) covalently linked to the peptide, and includes, for example, natural proteins, synthetic, or recombinant polypeptides and peptides, hybrid molecules, peptoids, or peptidomimetics.
- amino acids either D- or L-amino acids
- length e.g., at least 2, 3, 4, 5, 6, 7, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 1 00, or more amino acids
- post-translational modifications e.g., glycosylation or
- percent identity between two sequences is determined by the BLAST 2.0 algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410, 1990. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds, or progeny of the same.
- Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, or microspores.
- Plant parts include differentiated and undifferentiated tissues including, but not limited to the following: roots, stems, shoots, leaves, pollen, seeds, tumor tissue, or various forms of cells and culture (e.g., single cells, protoplasts, embryos, and callus tissue).
- the plant tissue may be in a plant or in a plant organ, tissue, or cell culture.
- transgenic plant As used herein a "transgenic plant,” “genetically engineered plant,” or “genetically modified plant” refers to a plant whose genome (e.g., chromosomal DNA, chloroplast DNA, or mitochondrial DNA) has been altered by the stable integration of recombinant DNA.
- a transgenic plant includes a plant regenerated from an originally-transformed plant cell and progeny transgenic plants from later generations or crosses of a transformed plant.
- a transgenic plant may be genetically engineered to produce a heterologously (e.g., non-endogenous) or non-heterologously (e.g., endogenous) encoded protein or RNA, for example, of any of the modulating agents in the methods or compositions described herein.
- transgenic plants of the compositions and methods described herein may be derived from any of the following diclotyledonous plant families: Leguminosae, including plants such as pea, alfalfa and soybean; Umbelliferae, including plants such as carrot and celery; Solanaceae, including the plants such as tomato, potato, aubergine, tobacco, and pepper; Cruciferae, particularly the genus Brassica, which includes plant such as oilseed rape, beet, cabbage, cauliflower and broccoli); and Arabidopsis thaliana; Compositae, which includes plants such as lettuce; Malvaceae, which includes cotton ; Fabaceae, which includes plants such as peanut, and the like.
- Leguminosae including plants such as pea, alfalfa and soybean
- Umbelliferae including plants such as carrot and celery
- Solanaceae including the plants such as tomato, potato, aubergine, tobacco, and pepper
- Cruciferae particularly the genus Brassica, which includes
- Transgenic plants of the invention may be derived from monocotyle- donous plants, such as, for example, wheat, barley, sorghum, millet, rye, triticale, maize, rice, oats, switchgrass, miscanthus, and sugarcane.
- Transgenic plants of the invention are also embodied as trees such as apple, pear, quince, plum, cherry, peach, nectarine, apricot, papaya, mango, and other woody species including coniferous and deciduous trees such as poplar, pine, sequoia, cedar, oak, willow, and the like.
- Fig. 1 is a panel of graphs showing that treatment with P. pastoris delayed aphid development.
- Fig. 2 is a graph showing that P. pastoris treatment resulted in aphid death.
- Fig. 3 is a panel of graphs showing that P. pastoris treatment via leaf spraying did not affect aphid development.
- Fig. 4 is a graph showing that P. pastoris treatment increased aphid mortality.
- First and second instar LSR-1 aphids were placed on leaves sprayed with water (control) or P. pastoris and survival was monitored over time.
- N 60 aph ids/treatment group.
- Figs. 5A and 5B are graphs showing that spraying P. pastoris on fava bean leaves reduced endosymbiotic Buchnera in aphids feeding on the leaves. Symbiont titer was determined at 6 (A) and 9 (B) days post-treatment with P. pastoris. Shown are the mean Buchnera/aphid copies ⁇ SD. The number in the box above the indicated dataset represents the median value of that group. Each dot represents a single aphid.
- Fig. 6 is a graph showing microinjection of BCR-4 PNA reduced BCR-4 expression.
- Fourth and fifth instar A pisum aphids were injected with 20 nl water or 321 ng/ul of BCR-4 PNA, RNA was extracted from aphids after 7 days, and RT-qPCR was performed to measure expression of BCR-4. Shown are the mean BCR-4/Actin copies ⁇ SD. Each data point represents a single aphid. The number in the box above each dataset represents the median of the data.
- Fig. 8 is a graph showing injection of aphids with a PNA to BCR-4 resulted in decreased fecundity. Fourth and fifth instar A. pisum aphids were injected with water or with a PNA to BCR-4.
- Fig. 9 is a panel of graphs showing treatment with BCR-4 PNA delayed aphid development.
- First and second instar LSR-1 aphids were placed on leaves perfused with water (negative control) or with a solution of BCR-4 PNA in water and developmental stage was monitored at each indicated time point during the experiment. Shown are the mean percentages of aphids in each group ⁇ SD.
- Fig. 1 0 is a graph showing BCR-4 treatment resulted in increased aphid death.
- First and second instar LSR-1 aphids were treated with water (control) or with BCR-4 PNA via leaf perfusion and survival was monitored daily during the experiment.
- N 60 aphids/group.
- Statistically significant differences were determined using Log-Rank (Mantel Cox) test.
- Fig. 1 1 is a graph showing treatment with BCR-4 PNA delivered via leaf perfusion increased Buchnera titers.
- First and second instar LSR-1 aphids were treated with water (control) or BCR4 PNA via leaf perfusion and dead aphids were collected on days 5 and 6 after treatment.
- DNA was extracted, and qPCR was performed to determine the number of Buchnera/aphid DNA copies. Shown are the mean number of Buchnera/aphid DNA copies ⁇ SD of 6-7 aphids/group.
- Fig. 12 is a graph showing treatment of aphids with a PNA against BCR-4 via leaf perfusion resulted in a reduction of BCR-4 expression.
- First and second instar LSR-1 aphids were treated with water (control) or BCR-4 PNA via leaf perfusion and on day 7, RNA was extracted from living aphids and RT-qPCR was performed to quantify expression of BCR-4 relative to actin expression. The number in the box represents the median of the dataset.
- Fig. 13 is a graph showing treatment with dsRNA-ApGLNT1 knocked down the expression of
- ApGLNTI aphids were injected with water or dsRNA-ApGLNT1 in water. At 2 days post-treatment, total RNA was extracted and RT-qPCR was performed to determine ApGLNTI gene relative expression (Actin as internal reference gene). Shown is the mean ratio of relative expression of
- Fig. 14 is a graph showing treatment with dsRNA-ApGLNT1 increased aphid mortality.
- Fig. 15 is a graph showing treatment with dsRNA-ApGLNT1 resulted in decreased Buchnera titers.
- LSR-1 A pisum aphids were injected with water or dsRNA-ApGLNT1 in water, DNA was extracted from aphids at 5 days post-injection, and qPCR was performed to quantify Buchnera. Shown are the mean copies of Buchnera/aphid DNA ⁇ SD. Each dot represents an individual aphid. The number in the box above each data set represents the median of the group.
- Figs. 16A and 16B are a panel of graphs showing offspring from aphids microinjected with dsRNA-ApGLNT1 displayed delayed development.
- Fig. 1 6B 4 days after offspring were collected, images were taken of each aphid to determine the area of each aphid.
- Fig. 17 is an illustration showing the dsRNA expression cassette.
- pCaMV 35S promoter is placed upstream of the dsRNA expressing sequence.
- the sense and the antisense strands of a region of the target aphid gene are placed in tandem with a small spacer which will act as the hairpin loop. Once expressed, the RNA formed will assume a double stranded configuration due to the complementarity of the sequence.
- Fig. 18 is an illustration of the shuttle vector for the constructs for expressing dsRNA in N.
- the plasmid includes origins of replications compatible with E. coli and A. tumefaciens, kanamycin and gentamycin resistance markers, green fluorescence expression cassette under a parsley ubiquitin promoter, and finally the dsRNA expression cassette driven by the pCaMV 35S.
- Fig. 19 is a panel of images showing GFP expression in N. tabacum plant infiltrated by A.
- top panels are N. tabacum infiltrated with A. tumefaciens containing a plasmid that can constitutively drive the expression of GFP in N. tabacum (Top left is brightfield, and top right is green channel).
- the bottom panels are negative control leaves not infiltrated by A. tumefaciens. DETAILED DESCRIPTION
- compositions for modulating the fitness of a host invertebrate e.g., insect, mollusk, or nematode
- the invention features a composition including a modulating agent (e.g., a polypeptide, nucleic acid, small molecule, or combinations thereof) that can indirectly induce changes in the host's microbiota in a manner that modulates (e.g., increases or decreases) host fitness.
- a modulating agent e.g., a polypeptide, nucleic acid, small molecule, or combinations thereof
- the modulating agent may target host pathways (e.g., immune system or bacteriocyte pathways) or microbial pathways that alter (e.g., increase or decrease) microbial levels, microbial activity, microbial metabolism, and/or microbial diversity, and in turn modulates (e.g., increase or decrease) the fitness of a variety of invertebrates (e.g., insect, mollusk, or nematode) that are important for agriculture, commerce, and/or public health.
- host pathways e.g., immune system or bacteriocyte pathways
- microbial pathways that alter (e.g., increase or decrease) microbial levels, microbial activity, microbial metabolism, and/or microbial diversity
- modulates e.g., increase or decrease
- the fitness of a variety of invertebrates e.g., insect, mollusk, or nematode
- RNA may be used to impair bacteriocyte function in an aphid, thereby disrupting endosymbiotic microorganism populations resident in the bacteriocyte of the aphid.
- RNAs e.g., dsRNA
- PNAs small molecules
- small molecules e.g., prostaglandin
- the present disclosure describes a variety of different approaches for the use of agents that modulates (e.g., increases or decreases) the fitness of an invertebrate host (e.g., insect, mollusk, or nematode), wherein the modulating agent alters interactions between the host and one or more microorganisms resident in the host.
- an invertebrate host e.g., insect, mollusk, or nematode
- the host described herein is an organism belonging to the phylum Arthropoda.
- the insect is considered a pest, e.g., an agricultural pest.
- the insect carries a bacterium or virus that is considered a plant pest that causes disease in a plant (e.g., Agrobacterium or tomato yellow leaf curl virus (TYLCV)).
- the host may be at any stage developmentally. For instance, the host may be an embryo, a larva, a pupa, or an adult.
- the insect may belong to the following orders: Acari, Araneae, Anoplura, Coleoptera, Collembola, Dermaptera, Dictyoptera, Diplura, Diptera (e.g., spotted-wing Drosophila),
- Embioptera Ephemeroptera, Grylloblatodea, Hemiptera (e.g., an aphid, Greenhous whitefly, or stinkbug), Homoptera, Hymenoptera, Isoptera, Lepidoptera, Mallophaga, Mecoptera, Neuroptera, Odonata, Orthoptera, Phasmida, Plecoptera, Protura, Psocoptera, Siphonaptera, Siphunculata, Thysanura, Strepsiptera, Thysanoptera, Trichoptera, or Zoraptera.
- Hemiptera e.g., an aphid, Greenhous whitefly, or stinkbug
- Homoptera Hymenoptera
- Isoptera Isoptera
- Lepidoptera Mallophaga
- Mecoptera Neuroptera
- Odonata Orthoptera
- Phasmida Phasmida
- the insect is from the class Arachnida, for example, Acarus spp., Aceria sheldoni, Aculops spp., Aculus spp., Amblyomma spp., Amphitetranychus viennensis, Argas spp., Boophilus spp., Brevipalpus spp., Bryobia graminum, Bryobia praetiosa, Centrum ides spp., Chorioptes spp., Dermanyssus gallinae, Dermatophagoides pteronyssinus, Dermatophagoides farinae, Dermacentor spp., Eotetranychus spp., Epitrimerus pyri, Eutetranychus spp., Eriophyes spp., Glycyphagus domesticus, Halotydeus destructor, Hemitarsonemus spp., Hyalomma
- Steneotarsonemus spp. Steneotarsonemus spinki, Tarsonemus spp., Tetranychus spp., Trombicula alfreddugesi, Vaejovis spp., Vasates lycopersici.
- the insect is from the class Chilopoda, for example, Geophilus spp., Scutigera spp.
- the insect is from the order Collembola, for example, Onychiurus armatus.
- the insect is from the class Diplopoda, for example, Blaniulus guttulatus.
- the insect is from the class Insecta, e.g. from the order Blattodea, for example, Blattella asahinai, Blattella germanica, Blatta orientalis, Leucophaea maderae, Panchlora spp.,
- the insect is from the order Coleoptera, for example, Acalymma vittatum, Acanthoscelides obtectus, Adoretus spp., Agelastica alni, Agriotes spp., Alphitobius diaperinus,
- Diloboderus spp. Diloboderus spp., Epilachna spp., Epitrix spp., Faustinus spp., Gibbium psylloides, Gnathocerus cornutus, Hellula undalis, Heteronychus arator, Heteronyx spp., Hylamorpha elegans, Hylotrupes bajulus, Hypera postica, Hypomeces squamosus, Hypothenemus spp.
- the insect is from the order Heteroptera, for example, Anasa tristis,
- Antestiops is spp., Boisea spp., Blissus spp., Calocoris spp., Campylomma livida, Cavelerius spp., Cimex spp., Collaria spp., Creontiades dilutus, Dasynus piperis, Dichelops furcatus, Diconocoris hewetti, Dysdercus spp., Euschistus spp., Eurygaster spp., Heliopeltis spp., Horcias nobilellus, Leptocorisa spp., Leptocorisa varicornis, Leptoglossus phyllopus, Lygus spp., Macropes excavatus, Miridae, Monalonion atratum, Nezara spp., Oebalus spp., Pentomidae, Piesma quadrata, Piezodorus
- the insect is from the order Hemiptera or suborder Homoptera, for example, Acizzia acaciaebaileyanae, Acizzia dodonaeae, Acizzia uncatoides, Acrida turrita, Acyrthosipon spp., Acrogonia spp., Aeneolamia spp., Agonoscena spp., Aleyrodes proletella, Aleurolobus barodensis, Aleurothrixus floccosus, Allocaridara malayensis, Amrasca spp., Anuraphis cardui, Aonidiella spp., Aphanostigma pini, Aphis spp.
- Homoptera for example, Acizzia acaciaebaileyanae, Acizzia dodonaeae, Acizzia uncatoides, Acrida turrita, Acyrthosipon spp.
- insect is an aphid (e.g., Rhopalosiphum maidis or Myzus persicae).
- the insect is from the order Isopoda, for example, Armadillidium vulgare,
- the insect is from the order Isoptera, for example, Coptotermes spp., Cornitermes cumulans, Cryptotermes spp., Incisitermes spp., Microtermes obesi, Odontotermes spp., Reticulitermes spp.
- the insect is from the order Lepidoptera, for example, Achroia grisella,
- the insect is from the order Orthoptera or Saltatoria, for example, Acheta domesticus, Dichroplus spp., Gryllotalpa spp., Hieroglyphus spp., Locusta spp., Melanoplus spp., Schistocerca gregaria.
- Orthoptera or Saltatoria for example, Acheta domesticus, Dichroplus spp., Gryllotalpa spp., Hieroglyphus spp., Locusta spp., Melanoplus spp., Schistocerca gregaria.
- the insect is from the order Phthiraptera, for example, Damalinia spp., Haematopinus spp., Linognathus spp., Pediculus spp., Ptirus pubis, Trichodectes spp.
- the insect is from the order Psocoptera for example Lepinatus spp., Liposcelis spp.
- the insect is from the order Siphonaptera, for example, Ceratophyllus spp., Ctenocephalides spp., Pulex irritans, Tunga penetrans, Xenopsylla cheopsis.
- Siphonaptera for example, Ceratophyllus spp., Ctenocephalides spp., Pulex irritans, Tunga penetrans, Xenopsylla cheopsis.
- the insect is from the order Thysanoptera, for example, Anaphothrips obscurus, Baliothrips biformis, Drepanothrips reuteri, Enneothrips flavens, Frankliniella spp., Heliothrips spp., Hercinothrips femoralis, Rhipiphorothrips cruentatus, Scirtothrips spp., Taeniothrips cardamomi, Thrips spp.
- Thysanoptera for example, Anaphothrips obscurus, Baliothrips biformis, Drepanothrips reuteri, Enneothrips flavens, Frankliniella spp., Heliothrips spp., Hercinothrips femoralis, Rhipiphorothrips cruentatus, Scirtothrips spp., Taeniothrips cardamomi, Thrips spp
- Ctenolepisma spp. Lepisma saccharina, Lepismodes inquilinus, Thermobia domestica.
- the insect is from the class Symphyla, for example, Scutigerella spp.
- the insect is a mite, including but not limited to, Tarsonemid mites, such as Phytonemus pallidus, Polyphagotarsonemus latus, Tarsonemus bilobatus, or the like; Eupodid mites, such as Penthaleus erythrocephalus, Penthaleus major, or the like; Spider mites, such as Oligonychus shinkajii, Panonychus citri, Panonychus mori, Panonychus ulmi, Tetranychus kanzawai, Tetranychus urticae, or the like; Eriophyid mites, such as Acaphylla theavagrans, Aceria tulipae, Aculops lycopersici, Aculops pelekassi, Aculus convincedendali, Eriophyes chibaensis, Phyllocoptruta oleivora, or the like; Acarid mites, such as Rhizoglyphus robin
- Cheyletidae such as Cheyletiella yasguri, Cheyletiella blakei, or the like; Demodicidae, such as
- Scarcoptidae such as Sarcoptes scabiei, Notoedres cati, Knemidocoptes spp., or the like.
- the methods and compositions provided herein may be used with any insect host that is considered a vector for a pathogen that is capable of causing disease in animals.
- the insect host may include, but is not limited to those with piercing-sucking mouthparts, as found in Hemiptera and some Hymenoptera and Diptera such as mosquitoes, bees, wasps, midges, lice, tsetse fly, fleas and ants, as well as members of the Arachnidae such as ticks and mites; order, class or family of Acarina (ticks and mites) e.g.
- Mallophaga bitsing lice
- Damalina spp. Felicola spp., Heterodoxus spp. or Trichodectes spp.
- Siphonaptera wingless insects
- the insect is a blood-sucking insect from the order Diptera (e.g., suborder Nematocera, e.g., family Colicidae). In some instances, the insect is from the subfamilies Culicinae, Corethrinae, Ceratopogonidae, or Simuliidae.
- the insect is of a Cu/ex spp., Theobaldia spp., Aedes spp., Anopheles spp., Aedes spp., Forciponiyia spp., Culicoides spp. , or A7e/ea spp.
- the host described herein may be an organism belonging to the phylum Mollusca.
- the mollusk is considered a pest, e.g., an agricultural pest.
- the methods and compositions are suitable for controlling terrestrial Gastropods (e.g., slugs and snails) in agriculture and horticulture. They include all terrestrial slugs and snails which mostly occur as polyphagous pests on agricultural and horticultural crops.
- the mollusk belongs to the family Achatinidae, Agriolimacidae, Ampullariidae, Arionidae, Bradybaenidae, Helicidae, Hydromiidae, Lymnaeidae, Milacidae, Urocyclidae, or
- the mollusk is Achatina spp., Agriolimax spp., /Anon spp. (e.g., /A. afer, /A. circumscriptus, A. distinctus, A. fasciatus, A. hortensis, A. intermedius, A. rufus, A. subfuscus, A. silvaticus, A. lusitanicus) , Biomphalaria spp., Bradybaen a spp. (e.g., B. fruticum), Bulinus spp., Cantareus spp. (e.g., C. asperses), Cepaea spp.
- Achatina spp. e.g., Agriolimax spp.
- /Anon spp. e.g., /A. afer, /A. circumscriptus, A. distinctus, A. fasciatus, A. hort
- Helicigona spp. e.g., A7. arbustorum
- Helicodiscus spp. Helix spp.
- Limax spp. e.g., ... cinereoniger, ... flaws, ... marginatus, L. maximus, L. tenellus
- Lymnaea spp. e.g., ... stagnalis
- Milax spp. e.g., M gagates, M. marginatus, M. sowerbyi, M.
- Oncomelania spp. Opeas spp.
- Oxyloma spp. e.g., O. pfeifferi
- Pomacea spp. e.g., P. canaliculata
- Succinea spp. Tandonia spp. (e.g., ⁇ .
- the host of any of the compositions or methods described herein may also be any organism belonging to the phylum Nematoda.
- the nematode is considered a pest, e.g., an agricultural pest.
- the nematode may be parasitic or cause health problems to plant or to fungi (for example species of the orders Aphelenchida, Meloidogyne, Tylenchida and others) or to humans and animals (for example species of the orders Trichinellida, Tylenchida, Rhabditina, and Spirurida).
- Plant nematodes encompass plant parasitic nematodes and nematodes living in the soil.
- Plant parasitic nematodes include, but are not limited to, ectoparasites such as Xiphinema spp., Longidorus spp., and Trichodorus spp.; semiparasites such as Tylenchulus spp.
- migratory endoparasites such as Pratylenchus spp., Radopholus spp., and Scutellonema spp.
- sedentary parasites such as Heterodera spp., Globodera spp., and Meloidogyne spp.
- stem and leaf endoparasites such as Ditylenchus spp., Aphelenchoides spp., and Hirshmaniella spp.
- Especially harmful root parasitic soil nematodes are such as cystforming nematodes of the genera Heterodera or Globodera, and/or root knot nematodes of the genus Meloidogyne.
- Harmful species of these genera are for example Meloidogyne incognita, Heterodera glycines (soybean cyst nematode), Globodera pallida and Globodera rostochiensis (potato cyst nematode), which species are effectively controlled with the modulating agents described herein.
- modulating agents described herein is in no way restricted to these genera or species, but also extends in the same manner to other nematodes.
- Plant nematodes include but are not limited to e.g. Aglenchus agricola, Anguina tritici,
- Bursaphelenchus cocophilus Bursaphelenchus eremus, Bursaphelenchus xylophilus, Bursaphelenchus mucronatus, and Bursaphelenchus spp. in general, Cacopaurus pestis, Criconemella curvata,
- Criconemella onoensis Criconemella ornata
- Criconemella rusium Criconemella xenoplax
- Criconemoides femiae Criconemoides onoense
- Criconemoides ornatum Criconemoides spp. in general, Ditylenchus destructor
- Hemicycliophora arenaria, Hemicycliophora nudata, Hemicycliophora parvana, Heterodera avenae, Heterodera cruciferae, Heterodera glycines (soybean cyst nematode), Heterodera oryzae, Heterodera schachtii, Heterodera zeae and the sedentary, cyst forming parasites Heterodera spp. in general, Hirschmaniella gracilis, Hirschmaniella oryzae Hirschmaniella spinicaudata and the stem and leaf endoparasites Hirschmaniella spp. in general, Hoplolaimus aegyptii, Hoplolaimus califomicus,
- Hoplolaimus columbus Hoplolaimus galeatus, Hoplolaimus indicus, Hoplolaimus magnistylus,
- Meloinema spp. Meloinema spp., Nacobbus aberrans, Neotylenchus vigissi, Paraphelenchus pseudoparietinus, Paratrichodorus allius, Paratrichodorus lobatus,
- Paratrichodorus minor Paratrichodorus nanus, Paratrichodorus porosus, Paratrichodorus teres and Paratrichodorus spp. in general, Paratylenchus hamatus, Paratylenchus minutus, Paratylenchus projectus and Paratylenchus spp.
- Pratylenchus agilis in general, Pratylenchus agilis, Pratylenchus alleni, Pratylenchus andinus, Pratylenchus brachyurus, Pratylenchus cerealis, Pratylenchus coffeae, Pratylenchus crenatus, Pratylenchus delattrei, Pratylenchus giibbicaudatus, Pratylenchus goodeyi, Pratylenchus hamatus, Pratylenchus hexincisus, Pratylenchus loosi, Pratylenchus neglectus, Pratylenchus penetrans,
- Scutellonema bradys Scutellonema clathricaudatum and the migratory endoparasites Scutellonema spp. in general, Subanguina radiciola, Tetylenchus nicotianae, Trichodorus cylindricus, Trichodorus minor, Trichodorus primitivus, Trichodorus proximus, Trichodorus similis, Trichodorus sparsus and the ectoparasites Trichodorus spp. in general, Tylenchorhynchus agri, Tylenchorhynchus brassicae,
- Tylenchorhynchus clarus Tylenchorhynchus claytoni
- Tylenchorhynchus digitatus Tylenchorhynchus ebriensis
- Tylenchorhynchus maximus Tylenchorhynchus nudus
- Tylenchorhynchus vulgaris and Tylenchorhynchus spp. Tylenchulus semipenetrans and the semiparasites Tylenchulus spp. in general, Xiphinema americanum, Xiphinema brevicolle, Xiphinema dimorphicaudatum, Xiphinema index and the ectoparasites Xiphinema spp. in general.
- nematode hosts include species belonging to the family Criconematidae, Belonolaimidae, Hoploaimidae, Heteroderidae, Longidoridae, Pratylenchidae, Trichodoridae, or
- the host described herein is a beneficial insect, mollusk, or nematode (e.g., a pollinator, a natural competitor of a pest, or a producer of useful substances for humans).
- a beneficial insect e.g., a pollinator, a natural competitor of a pest, or a producer of useful substances for humans.
- beneficial insect refers to an insect, mollusk, or nematode that confers a benefit (e.g., economical and/or ecological) to humans, animals, an ecosystem, and/or the environment.
- the host may be an invertebrate (e.g., insect, mollusk, or nematode) that is involved in the production of a commercial product, including, but not limited to, invertebrates cultivated to produce food (e.g., honey from honey bees, e.g., Apis mellifera), materials (such as silk from Bombyx mori), and/or substances (e.g., lac from Laccifer lacca or pigments from Dactylopius coccus and Cynipidae).
- invertebrate e.g., insect, mollusk, or nematode
- a commercial product including, but not limited to, invertebrates cultivated to produce food (e.g., honey from honey bees, e.g., Apis mellifera), materials (such as silk from Bombyx mori), and/or substances (e.g., lac from Laccifer lacca or pigments from Dactylopius coccus
- the host may include invertebrates (e.g., insects, mollusks, or nematodes) that are used in agricultural applications, including invertebrates (e.g., insects, mollusks, or nematodes) that aid in the pollination of crops, spreading seeds, or pest control.
- invertebrates e.g., insects, mollusks, or nematodes
- the host may be an invertebrate (e.g., insect, mollusk, or nematode) that is useful for waste disposal and/or organic recycling (e.g., earthworms, termites, or Diptera larvae).
- the host produces a useable product (e.g., honey, silk, beeswax, or shellac).
- a useable product e.g., honey, silk, beeswax, or shellac.
- the host is a bee.
- Exemplary bee genera include, but are not limited to Apis, Bombus, Trigona, and Osmia.
- the bee is a honeybee (e.g., an insect belonging to the genus Apis).
- the honeybee is the species Apis mellifera (the European or Western honey bee), Apis cerana (the Asiatic, Eastern, or Himalayan honey bee), Apis dorsata (the "giant” honey bee), Apis florea (the “red dwarf” honey bee), Apis andreniformis (the “black dwarf” honey bee), or Apis nigrocincta.
- the host is a silkworm.
- the silkworm may be a species in the family Bombycidae or Saturniidae. In some instances, the silkworm is Bombyx mori.
- the host is a lac bug.
- the lac bug may be a species in the family Kerriidae. In some instances, the lac bug is Kerria lacca.
- the host aids in pollination of a plant (e.g., bees, beetles, wasps, flies, butterflies, or moths).
- the host aiding in pollination of a plant is beetle.
- the beetle is a species in the family Buprestidae, Cantharidae, Cerambycidae, Chrysomelidae, Cleridae, Coccinellidae, Elateridae, Melandryidae, Meloidae, Melyridae, Mordellidae, Nitidulidae, Oedemeridae, Scarabaeidae, or Staphyllinidae.
- the host aiding in pollination of a plant is a butterfly or moth (e.g., Lepidoptera) .
- the butterfly or moth is a species in the family Geometridae, Hesperiidae, Lycaenidae, Noctuidae, Nymphalidae, Papilionidae, Pieridae, or
- the host aiding in pollination of a plant is a fly (e.g., Diptera).
- the fly is in the family Anthomyiidae, Bibionidae, Bombyliidae, Calliphoridae, Cecidomiidae, Certopogonidae, Chrionomidae, Conopidae, Culicidae, Dolichopodidae, Empididae, Ephydridae, Lonchopteridae, Muscidae, Mycetophilidae, Phoridae, Simuliidae, Stratiomyidae, or Syrphidae.
- the host aiding in pollination is an ant (e.g., Formicidae), sawfly (e.g., Tenthredinidae), or wasp (e.g., Sphecidae or Vespidae).
- the host aiding in pollination of a plant is a bee.
- the bee is in the family Andrenidae, Apidae, Colletidae, Halictidae, or Megachilidae.
- the host aids in pest control.
- the host aiding in pest control is a predatory nematode.
- the nematode is a species of Heterorhabditis or Steinernema.
- the host aiding in pest control is an insect.
- the host aiding in pest control may be a species belonging to the family Braconidae (e.g., parasitoid wasps), Carabidae (e.g., ground beetles), Chrysopidae (e.g., green lacewings), Coccinellidae (e.g., ladybugs), Hemerobiidae (e.g., brown lacewings), lchneumonidae (e.g., ichneumon wasps), Lampyridae (e.g., fireflies), Mantidae (e.g., praying mantises), Myrmeleontidae (e.g., antilions), Odonata (e.g., dragonflies and damselflies), or Syrphidae (e.g., hoverfly).
- Braconidae e.g., parasitoid wasps
- Carabidae e.g., ground beet
- the host aiding in pest control is an insect that competes with an insect that is considered a pest (e.g., an agricultural pest).
- a pest e.g., an agricultural pest.
- the Mediterranean fruit fly, Ceratitis capitata is a common pest of fruits and vegetables worldwide.
- One way to control C. captitata is to release the sterilized male insect into the environment to compete with wild males to mate the females.
- the host may be a sterilized male belonging to a species that is typically considered a pest.
- the host aids in degradation of waste or organic material.
- the host aiding in degradation of waste or organic material belongs to Coleoptera or Diptera.
- the host belonging to Diptera is in the family Calliphoridae, Curtonotidae, Drosophilidae, Fanniidae, Heleomyzidae, Milichiidae, Muscidae, Phoridae, Psychodidae, Scatopsidae, Sepsidae, Sphaeroceridae, Stratiomyidae, Syrphidae, Tephritidae, or Ulidiidae.
- the host belonging to Coleoptera is in the family Carabidae, Hydrophilidae, Phalacaridae, Ptiliidae, or
- the host may be an insect or an arachnid that may be cultivated for a consumable product (e.g., food or feed).
- the host may be a moth, butterfly, fly, cricket, spider, or beetle.
- the host is in the order Anoplura, Araneae, Blattodea, Coleoptera, Dermaptera, Dictyoptera, Diplura, Diptera, Embioptera, Ephemeroptera, Grylloblatodea, Hemiptera, Homoptera, Hymenoptera, Isoptera, Lepidoptera, Mantodea, Mecoptera, Neuroptera, Odonata,
- Orthoptera Phasmida, Plecoptera, Protura, Psocoptera, Siphonaptera, Siphunculata, Thysanura, Strepsiptera, Thysanoptera, Trichoptera, or Zoraptera.
- the host is a black soldier fly (Hermetia illucens), a common house fly, a lesser mealworm, a weaver ant, a silkworm (Bombyx mori), a grasshopper, a Chinese grasshopper (Acrida cinerea), a yellow mealworm (Clarias gariepinns), a moth (Anaphe infracta or Bombyx mori), Spodoptera littoralis, a house cricket, a termite, a palm weevil ⁇ Rhynchophorus ferruginens), a giant water bug (Lethocerus indicus), a water beetle, a termite (Macrotermes subhyalinus), a drugstore beetle (Stegobium paniceum), Imbrasia belina, Rhynchophorus phoenicis, Oryctes rhinoceros, Macrotermes bellicosus, Ruspolia differens, Oryctes
- the methods and compositions provided herein may be used to decrease the fitness of any of the host invertebrates (e.g., insects, mollusks, or nematodes) described herein.
- the decrease in fitness arises from alterations in host pathways that mediate interactions between the host and microorganisms resident in the host, wherein the alterations are a consequence of administration of a modulating agent and have detrimental effects on the host.
- the decrease in host fitness may manifest as a deterioration or decline in the physiology of the host (e.g., reduced health or survival) as a consequence of administration of a modulating agent.
- the fitness of an organism may be measured by one or more parameters, including, but not limited to, reproductive rate, fertility, lifespan, viability, mobility, fecundity, host development, body weight, metabolic rate or activity, or survival in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the overall health of the host or to decrease the overall survival of the host.
- the decreased survival of the host is about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% greater relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the methods and compositions are effective to decrease host reproduction (e.g., reproductive rate, fertility) in comparison to a host organism to which the modulating agent has not been administered.
- the methods and compositions are effective to decrease other physiological parameters, such as mobility, body weight, life span, fecundity, or metabolic rate, by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the decrease in host fitness may manifest as a decrease in the production of one or more nutrients in the host (e.g., vitamins, carbohydrates, amino acids, or polypeptides) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the production of nutrients in the host (e.g., vitamins, carbohydrates, amino acids, or polypeptides) by about 2%, 5%, 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the methods or compositions provided herein may decrease nutrients in the host by decreasing the production of nutrients by one or more microorganisms (e.g., endosymbiont) in the host in comparison to a host organism to which the modulating agent has not been administered.
- microorganisms e.g., endosymbiont
- the decrease in host fitness may manifest as an increase in the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) and/or a decrease in the host's resistance to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) in comparison to a host organism to which the modulating agent has not been administered.
- a pesticidal agent e.g., a pesticide listed in Table 1 1
- a decrease in the host's resistance to a pesticidal agent e.g., a pesticide listed in Table 1 1
- the methods or compositions provided herein may be effective to increase.the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a pesticidal agent may be any pesticidal agent known in the art, including insecticidal agents.
- the methods or compositions provided herein may increase the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) by decreasing the host's ability to metabolize or degrade the pesticidal agent into usable substrates in comparison to a host organism to which the modulating agent has not been administered.
- a pesticidal agent e.g., a pesticide listed in Table 1 1
- the decrease in host fitness may manifest as an increase in the host's sensitivity to an allelochemical agent and/or a decrease in the host's resistance to an allelochemical agent in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the host's resistance to an allelochemical agent by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 00%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the allelochemical agent is caffeine, soyacystatin, fenitrothion, monoterpenes, diterpene acids, or phenolic compounds (e.g., tannins, flavonoids).
- the methods or compositions provided herein may increase the host's sensitivity to an allelochemical agent by decreasing the host's ability to metabolize or degrade the allelochemical agent into usable substrates in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decease the host's resistance to parasites or pathogens (e.g., fungal, bacterial, or viral pathogens or parasites) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the host's resistance to a pathogen or parasite (e.g., fungal, bacterial, or viral pathogens; or parasitic mites) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the methods or compositions provided herein may be effective to decrease the host's ability to carry or transmit a plant pathogen (e.g., plant virus (e.g., TYLCV) or a plant bacterium (e.g., Agrobacterium spp)) in comparison to a host organism to which the modulating agent has not been administered.
- a plant pathogen e.g., plant virus (e.g., TYLCV) or a plant bacterium (e.g., Agrobacterium spp)
- a plant pathogen e.g., plant virus (e.g., TYLCV) or a plant bacterium (e.g., Agrobacterium spp)
- the methods or compositions provided herein may be effective to decrease the host's ability to carry or transmit a plant pathogen (e.g., a plant virus (e.g., TYLCV) or plant bacterium (e.g., Agrobacterium spp)) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 00%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a plant pathogen e.g., a plant virus (e.g., TYLCV) or plant bacterium (e.g., Agrobacterium spp)
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the decrease in host fitness may manifest as other fitness disadvantages, such as a decreased tolerance to certain environmental factors (e.g., a high or low temperature tolerance), a decreased ability to survive in certain habitats, or a decreased ability to sustain a certain diet in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease host fitness in any plurality of ways described herein.
- the modulating agent may decrease host fitness in any number of host classes, orders, families, genera, or species (e.g., 1 host species, 2, 3, 4, 5, 6, 7, 8, 9 ,10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 200, 250, 500, or more host species).
- the modulating agent acts on a single host class, order, family, genus, or species.
- Host fitness may be evaluated using any standard methods in the art. In some instances, host fitness may be evaluated by assessing an individual host. Alternatively, host fitness may be evaluated by assessing a host population. For example, a decrease in host fitness may manifest as a decrease in successful competition against other insects, thereby leading to a decrease in the size of the host population. vi. Increasing host fitness
- the methods and compositions provided herein may be used to increase the fitness of any of the hosts described herein.
- the increase in fitness arises from alterations in host pathways that mediate interactions between the host and microorganisms resident in the host, wherein the alterations are a consequence of administration of a modulating agent and have beneficial effects on the host.
- the increase in host fitness may manifest as an improvement in the physiology of the host (e.g., improved health or survival) as a consequence of administration of a modulating agent.
- the fitness of an organism may be measured by one or more parameters, including, but not limited to, reproductive rate, lifespan, mobility, fecundity, body weight, metabolic rate or activity, or survival in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to improve the overall health of the host or to improve the overall survival of the host in comparison to a host organism to which the modulating agent has not been administered.
- the improved survival of the host is about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% greater relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the methods and compositions are effective to increase host reproduction (e.g., reproductive rate) in comparison to a host organism to which the modulating agent has not been administered.
- the methods and compositions are effective to increase other physiological parameters, such as mobility, body weight, life span, fecundity, or metabolic rate, by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 00%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the increase in host fitness may manifest as an increased production of a product generated by said host in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to increase the production of a product generated by the host, as described herein (e.g., honey, beeswax, beebread, propolis, silk, or lac), by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the increase in host fitness may manifest as an increase in the frequency or efficacy of a desired activity carried out by the host (e.g., pollination, predation on pests, seed spreading, or breakdown of waste or organic material) in comparison to a host organism to which the modulating agent has not been administered.
- a desired activity carried out by the host e.g., pollination, predation on pests, seed spreading, or breakdown of waste or organic material
- the methods or compositions provided herein may be effective to increase the frequency or efficacy of a desired activity carried out by the host (e.g., pollination, predation on pests, seed spreading, or breakdown of waste or organic material) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a desired activity carried out by the host e.g., pollination, predation on pests, seed spreading, or breakdown of waste or organic material
- a reference level e.g., a level found in a host that does not receive a modulating agent
- the increase in host fitness may manifest as an increase in the production of one or more nutrients in the host (e.g., vitamins, carbohydrates, amino acids, or polypeptides) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to increase the production of nutrients in the host (e.g., vitamins, carbohydrates, amino acids, or polypeptides) by about 2%, 5%, 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the methods or compositions provided herein may increase nutrients in the host by increasing the production of nutrients by one or more microorganisms (e.g., endosymbiont) in the host in comparison to a host organism to which the modulating agent has not been administered.
- the increase in host fitness may manifest as a decrease in the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) and/or an increase in the host's resistance to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to decrease the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a pesticidal agent may be any pesticidal agent known in the art, including insecticidal agents.
- the pesticidal agent is a neonicotinoid.
- the methods or compositions provided herein may decrease the host's sensitivity to a pesticidal agent (e.g., a pesticide listed in Table 1 1 ) by increasing the host's ability to metabolize or degrade the pesticidal agent into usable substrates in comparison to a host organism to which the modulating agent has not been administered.
- a pesticidal agent e.g., a pesticide listed in Table 1 1
- the increase in host fitness may manifest as a decrease in the host's sensitivity to an allelochemical agent and/or an increase in the host's resistance to an allelochemical agent in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to increase the host's resistance to an allelochemical agent by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 00%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- the allelochemical agent is caffeine, soyacystatin, fenitrothion, monoterpenes, diterpene acids, or phenolic compounds (e.g., tannins, flavonoids).
- the methods or compositions provided herein may decrease the host's sensitivity to an allelochemical agent by increasing the host's ability to metabolize or degrade the allelochemical agent into usable substrates in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to increase the host's resistance to parasites or pathogens (e.g., fungal, bacterial, or viral pathogens; or parasitic mites (e.g., Varroa destructor mite in honeybees)) in comparison to a host organism to which the modulating agent has not been administered.
- parasites or pathogens e.g., fungal, bacterial, or viral pathogens; or parasitic mites (e.g., Varroa destructor mite in honeybees)
- the methods or compositions provided herein may be effective to increase the host's resistance to a pathogen or parasite (e.g., fungal, bacterial, or viral pathogens; or parasitic mites (e.g., Varroa destructor mite in honeybees)) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% relative to a reference level (e.g., a level found in a host that does not receive a modulating agent).
- a pathogen or parasite e.g., fungal, bacterial, or viral pathogens; or parasitic mites (e.g., Varroa destructor mite in honeybees)
- a reference level e.g., a level found in a host that does not receive a modulating agent.
- the increase in host fitness may manifest as other fitness advantages, such as improved tolerance to certain environmental factors (e.g., a high or low temperature tolerance), improved ability to survive in certain habitats, or an improved ability to sustain a certain diet (e.g., an improved ability to metabolize soy vs corn) in comparison to a host organism to which the modulating agent has not been administered.
- the methods or compositions provided herein may be effective to increase host fitness in any plurality of ways described herein.
- the modulating agent may increase host fitness in any number of host classes, orders, families, genera, or species (e.g., 1 host species, 2, 3, 4, 5, 6, 7, 8, 9 ,10, 1 5, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 200, 250, 500, or more host species). In some instances, the modulating agent acts on a single host class, order, family, genus, or species.
- Host fitness may be evaluated using any standard methods in the art. In some instances, host fitness may be evaluated by assessing an individual host. Alternatively, host fitness may be evaluated by assessing a host population. For example, an increase in host fitness may manifest as an increase in successful competition against other insects, thereby leading to an increase in the size of the host population. vii. Hosts in agriculture
- the modulating agents described herein may be useful to promote the growth of plants. For example, by reducing the fitness of harmful invertebrates (e.g., insects, mollusks, or nematodes), the modulating agents provided herein may be effective to promote the growth of plants that are typically harmed by a host. Alternatively, by increasing the fitness of beneficial invertebrates (e.g., insects, mollusks, or nematodes), the modulating agents provided herein may be effective to promote the growth of plants that benefit from said hosts.
- harmful invertebrates e.g., insects, mollusks, or nematodes
- beneficial invertebrates e.g., insects, mollusks, or nematodes
- the modulating agent may be delivered to the plant using any of the formulations and delivery methods described herein, in an amount and for a duration effective to modulate (e.g., increase or decrease) host fitness and thereby benefit the plant, e.g., increase crop growth, increase crop yield, decrease pest infestation, and/or decrease damage to plants.
- This may or may not involve direct application of the modulating agent to the plant.
- the modulating agent may be applied to either the primary host habitat, the plants of interest, or a combination of both.
- the plant may be an agricultural food crop, such as a cereal, grain, legume, fruit, or vegetable crop, or a non-food crop, e.g., grasses, flowering plants, cotton, hay, hemp.
- the compositions described herein may be delivered to the crop any time prior to or after harvesting the cereal, grain, legume, fruit, vegetable, or other crop.
- Crop yield is a measurement often used for crop plants and is normally measured in metric tons per hectare (or kilograms per hectare). Crop yield can also refer to the actual seed generation from the plant.
- the modulating agent may be effective to increase crop yield (e.g., increase metric tons of cereal, grain, legume, fruit, or vegetable per hectare and/or increase seed generation) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%,
- a reference level e.g., a crop to which the modulating agent has not been administered.
- the plant e.g., crop
- a pest infestation e.g., by an insect, mollusk, or nematode
- the methods and compositions described herein may be used to reduce or prevent pest infestation in such crops by reducing the fitness of invertebrates (e.g., insect, mollusk, or nematode) that infest the plants.
- the modulating agent may be effective to reduce crop infestation (e.g., reduce the number of plants infested, reduce the pest population size, reduce damage to plants) by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in comparison to a reference level (e.g., a crop to which the modulating agent has not been administered).
- the modulating agent may be effective to prevent or reduce the likelihood of crop infestation by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in comparison to a reference level (e.g., a crop to which the modulating agent has not been administered).
- any suitable plant tissues may benefit from the compositions and methods described herein, including, but not limited to, somatic embryos, pollen, leaves, stems, calli, stolons, microtubers, or shoots.
- the methods and compositions described herein may include treatment of angiosperm or gymnosperm plants such as acacia, alfalfa, apple, apricot, artichoke, ash tree, asparagus, avocado, banana, barley, beans, beet, birch, beech, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassaya, cauliflower, cedar, a cereal, celery, chestnut, cherry, Chinese cabbage, citrus, clemintine, clover, coffee, corn, cotton, conifers, cowpea, cucumber, cypress, eggplant, elm, endive, eucalyptus, fava beans, fennel, forage crops, figs, fir, fruit and nut trees
- the host may be harvested and, if desired, processed for use in the manufacture of a consumable product.
- the harvested invertebrate host e.g., insect, mollusk, or nematode
- the whole harvested host is processed (e.g., ground up) and distributed as a consumable product.
- one or more parts of the host e.g., one or more body parts or one or more substances
- the consumable product may be any product safe for human or animal consumption (e.g., ingestion).
- the host may be used in the manufacture of a feed for an animal.
- the animal is livestock or a farm animal (e.g., chicken, cow, horse, or pig).
- the animal is a bird, reptile, amphibian, mammal, or fish.
- the host may be used in the manufacture of a product that replaces the normal feed of an animal.
- the host may be used in the manufacture of a product that supplements the normal feed of an animal.
- the host may also be used in the manufacture of a food, food additive, or food ingredient for humans.
- the host is used in the manufacture of a nutritional supplement (e.g., protein supplement) for humans.
- a nutritional supplement e.g., protein supplement
- the host may be a wild or domesticated host. Additionally, the host may be at any combination thereof.
- the host may be at any developmental stage at the time of harvesting the host for use in the manufacture of a consumable product.
- the host is a larva, pupa, or adult insect at the time of harvesting, using, processing, or manufacturing.
- the delivery of the modulating agent and the harvesting steps may occur at the same time or different times.
- a host species is selected based upon their natural nutritional profile.
- the modulating agent is used to improve the nutritional profile of the insect, wherein the modulating agent leads to an increased production of a nutrient in comparison to a host organism to which the modulating agent has not been administered.
- nutrients include vitamins, carbohydrates, amino acids, polypeptides, or fatty acids.
- the increased production may arise from increased production of a nutrient by a microorganism resident in the host. Alternatively, the increased production may arise from increased production of a nutrient by the host insect itself, wherein the host has increased fitness following delivery or administration of a modulating agent.
- a first insect species is combined with a second insect species whose nutritional profile provides a complementary benefit to the overall nutritional value of the food or feed product.
- a species containing a high protein profile could be combined with a species containing a high omega 3/6 fatty acid profile.
- host protein meal may be custom blended to suit the needs of humans or different species of animals.
- the modulating agents provided herein may be effective to reduce the spread of vector-borne diseases.
- the modulating agent may be delivered to the hosts using any of the formulations and delivery methods described herein, in an amount and for a duration effective to reduce transmission of the disease, e.g., reduce vertical or horizontal transmission between vectors and/or reduce transmission to humans and/or animals.
- the modulating agent described herein may reduce vertical or horizontal transmission of a vector-borne pathogen by about 2%, 5%, 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1 00%, or more in comparison to a host organism to which the modulating agent has not been administered.
- the modulating agent described herein may reduce vectorial competence of an host vector by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more in comparison to a host organism to which the modulating agent has not been administered.
- Non-limiting examples of diseases that may be controlled by the compositions and methods provided herein include diseases caused by Togaviridae viruses (e.g., Chikungunya, Ross River fever, Mayaro, Onyon-nyong fever, Sindbis fever, Eastern equine enchephalomyeltis, Wesetern equine encephalomyelitis, deciualan equine encephalomyelitis, or Barmah forest); diseases caused by Flavivirdae viruses (e.g., Dengue fever, Yellow fever, Kyasanur Forest disease, Omsk haemorrhagic fever, Japaenese encephalitis, Murray Valley encephalitis, Rocio, St.
- Togaviridae viruses e.g., Chikungunya, Ross River fever, Mayaro, Onyon-nyong fever, Sindbis fever, Eastern equine enchephalomyeltis, Wesetern equine ence
- microorganisms targeted by the modulating agent described herein may include any microorganism resident in or on an invertebrate host (e.g., insect, mollusk, or nematode), including, but not limited to, any bacteria and/or fungi described herein.
- Microorganisms resident in the host may include, for example, symbiotic (e.g., endosymbiotic microorganisms that provide beneficial nutrients or enzymes to the host), commensal, pathogenic, or parasitic microorganisms.
- a symbiotic microorganism e.g., bacteria or fungi
- Microorganisms resident in the host may be acquired by any mode of transmission, including vertical, horizontal, or multiple origins of transmission. / ' .
- Exemplary bacteria that may be targeted in accordance with the methods and compositions provided herein, include, but are not limited to, Xenorhabdus spp, Photorhabdus spp, Candidatus spp, Buchnera spp, Blattabacterium spp, Baumania spp, Wigglesworthia spp, Wolbachia spp, Rickettsia spp, Orientia spp, Sodalis spp, Burkholderia spp, Cupriavidus spp, Frankia spp, Snirhizobium spp,
- Streptococcus spp Wolinella spp, Xylella spp (e.g., Xylella fastidiosa), Erwinia spp, Agrobacterium spp, Bacillus spp, Commensalibacter spp. (e.g., Commensalibacter intestini), Paenibacillus spp, Streptomyces spp, Micrococcus spp, Corynebacterium spp, Acetobacter spp (e.g., Acetobacter pomorum),
- Cyanobacteria spp Salmonella spp, Rhodococcus spp, Pseudomonas spp (e.g., Psuedomonas fulva or Pseudomonas mandelii, Pseudomonas migulae), Pantoea spp. (e.g., Pantoea vagans), Lactobacillus spp (e.g., Lactobacillus plantarum), Lysobacter spp., Herbaspirillum spp., Enterococcus spp, Gluconobacter spp.
- Pseudomonas spp e.g., Psuedomonas fulva or Pseudomonas mandelii, Pseudomonas migulae
- Pantoea spp. e.g., Pantoea vagans
- Lactobacillus spp e.g
- Gluconobacter morbifer Alcaligenes spp, Hamiltonella spp., Klebsiella spp, Paenibacillus spp, Serratia spp. (e.g., Serratia marcescens), Rahnella spp. (e.g., Rahnella aquatilis), Arthrobacter spp, Azotobacter spp., Corynebacterium spp, Brevibacterium spp, Regiella spp. (e.g., Regiella insecticola), Thermus spp, Pseudomonas spp, Clostridium spp, Mortierella spp.
- the targeted bacteria are species in the genera Xenorhabdus spp., Photorhabdus spp., or Wolbachia spp. In some instances, the targeted bacteria are species in the order Streptomycetales, Rhizobiales, Pseudomonadales, Xanthomondadales, Sphingobacteriales,
- Chlorofelxales Rhodospirllales, Enterobacteriales, Sphingomonadales, Gemmatimonadales,
- Micrococcales Caulobacterales, Cytophagales, Firmicutes, Micromonosporales, Burkholderiales, Rickettsials, Flavobacteriales, Acidimicroiales, Rhodocyclales, or Bdellovibrionales.
- the targeted bacteria are Armatimonadetes, Firmicutes, TM7, Bacteroidetes, Proteobacteria, or
- the targeted bacteria are bacteria in the genera Lactococcus spp., Aeromonas spp., Pseudomonas spp., Enterobacter spp., Citrobacter spp., Sulfurospillium spp.,
- the bacteria targeted by the modulating agent may be ones that can be transmitted from the host (e.g., insect, mollusk, or nematode) to a plant, including, but not limited to, bacterial plant pathogens (e.g., Agrobacterium spp.).
- bacterial plant pathogens e.g., Agrobacterium spp.
- Non-limiting examples of bacteria that may be targeted by the methods and compositions provided herein are shown in Table 1 .
- the 1 6S rRNA sequence of the bacteria targeted by the modulating agent has at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 99%, 99.9%, or 100% identity with a sequence listed in Table 1 .
- AATT AG G AC A AATTTTTT A CAGAATAAAGAAATTATTAA TCAGATAATTAA 1 1 1 AATAA ATATTAATAAAAATGATAAT ATTATTGAAATAGGATCAGG ATTAGGAGCGTTAAC 1 1 1 1 C CTA 1 1 1 1 GTAGAATCATTAAA AAAATGATAGTATTAGAAAT TGATGAAGATCTTGTG 1 1 1 1 1
- TTTTTTTTAAAAACAATTAAA TTTC 1 1 1 ATAATATAATTGAT ATGCATTTTATGTTTCAAAA AGAAGTAGCAAAGAGATTA TTAG CTACTCCTG GTACTAA
- Annandia pinicola (Phylloxeroid bacteriocytes AGATTGAACGCTGGCGGCA ea) TGCCTTACACATGCAAGTC
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Pest Control & Pesticides (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Dentistry (AREA)
- Agronomy & Crop Science (AREA)
- Environmental Sciences (AREA)
- Virology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Insects & Arthropods (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2019126303A RU2821260C2 (ru) | 2017-02-24 | 2018-02-23 | Композиции и соответствующие способы модулирования эндосимбионтов |
| US16/487,661 US11974574B2 (en) | 2017-02-24 | 2018-02-23 | Compositions and related methods for modulating endosymbionts |
| BR112019016719A BR112019016719A2 (pt) | 2017-02-24 | 2018-02-23 | composições e métodos relacionados para modulação de endossimbiontes |
| EP18758134.3A EP3585171A4 (en) | 2017-02-24 | 2018-02-23 | COMPOSITIONS AND ASSOCIATED PROCESSES FOR THE MODULATION OF ENDOSYMBIONTES |
| JP2019545243A JP7231551B2 (ja) | 2017-02-24 | 2018-02-23 | 内部共生体を調節するための組成物及び関連方法 |
| CA3048497A CA3048497A1 (en) | 2017-02-24 | 2018-02-23 | Compositions and related methods for modulating endosymbionts |
| CN201880010183.1A CN111132552A (zh) | 2017-02-24 | 2018-02-23 | 用于调节内共生体的组合物和相关方法 |
| AU2018224862A AU2018224862B2 (en) | 2017-02-24 | 2018-02-23 | Compositions and related methods for modulating endosymbionts |
| US16/399,200 US20190246647A1 (en) | 2017-02-24 | 2019-04-30 | Compositions and related methods for modulating endosymbionts |
| JP2022154905A JP7536062B2 (ja) | 2017-02-24 | 2022-09-28 | 内部共生体を調節するための組成物及び関連方法 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762463451P | 2017-02-24 | 2017-02-24 | |
| US62/463,451 | 2017-02-24 | ||
| US201762583990P | 2017-11-09 | 2017-11-09 | |
| US62/583,990 | 2017-11-09 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/399,200 Continuation US20190246647A1 (en) | 2017-02-24 | 2019-04-30 | Compositions and related methods for modulating endosymbionts |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018156998A1 true WO2018156998A1 (en) | 2018-08-30 |
Family
ID=63252972
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/019577 Ceased WO2018156998A1 (en) | 2017-02-24 | 2018-02-23 | Compositions and related methods for modulating endosymbionts |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US11974574B2 (https=) |
| EP (1) | EP3585171A4 (https=) |
| JP (2) | JP7231551B2 (https=) |
| CN (1) | CN111132552A (https=) |
| AU (1) | AU2018224862B2 (https=) |
| BR (1) | BR112019016719A2 (https=) |
| CA (1) | CA3048497A1 (https=) |
| WO (1) | WO2018156998A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019079795A1 (en) * | 2017-10-20 | 2019-04-25 | BiOWiSH Technologies, Inc. | COMPOSITIONS AND METHODS FOR REDUCING CYANURIC ACID IN WATER SYSTEMS USED FOR RECREATIONAL PURPOSES |
| WO2020023699A1 (en) * | 2018-07-25 | 2020-01-30 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for agriculture |
| JP2020506961A (ja) * | 2017-01-24 | 2020-03-05 | フラグシップ パイオニアリング イノベーションズ ブイ,インコーポレーテッド | 農業のための組成物及び関連する方法 |
| WO2021253115A1 (en) * | 2020-06-15 | 2021-12-23 | Melio Peptide Systems Inc. | Microorganisms and methods for reducing bacterial contamination |
| US12171801B2 (en) | 2017-01-24 | 2024-12-24 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for controlling vector-borne diseases |
| WO2025252597A1 (en) * | 2024-05-28 | 2025-12-11 | Concert Bio Ltd | Microbial composition for enhancing plant growth |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11471433B1 (en) * | 2019-08-01 | 2022-10-18 | Flagship Pioneering Innovations V, Inc. | Postbiotic compositions and related methods for agriculture |
| WO2021231791A2 (en) * | 2020-05-13 | 2021-11-18 | Greenlight Biosciences, Inc. | Rna-based control of lepidopteran pests |
| CN113913468B (zh) * | 2020-07-10 | 2023-09-29 | 北京大学 | 一种蜘蛛的基因编辑方法 |
| CN111944532B (zh) * | 2020-08-14 | 2021-06-25 | 西南大学 | 一种调酸控病的土壤调理剂及其应用 |
| LT4039093T (lt) * | 2021-02-09 | 2023-11-10 | Biobab R&D, S.L. | 3,4-dihidroksifenilalanino (dopa) enantiomerų naudojimas ir metodas, skirtas augalų patrauklumui naudingiesiems vabzdžiams didinti |
| CN113493791A (zh) * | 2021-07-26 | 2021-10-12 | 广西壮族自治区兽医研究所 | 一种牛抗菌肽基因Cath及其制备方法和应用 |
| CN113912698B (zh) * | 2021-10-20 | 2023-07-04 | 河南农业大学 | 咖啡短体线虫Pc-CD蛋白、其编码基因及应用 |
| GB202215797D0 (en) | 2022-10-25 | 2022-12-07 | Solasta Bio Ltd | Insect neuropeptide analogues |
| CN116925968B (zh) * | 2023-07-20 | 2024-09-06 | 青岛农业大学 | 一种改变烟粉虱内共生菌Rickettsia滴度的方法 |
| CN116790777A (zh) * | 2023-07-28 | 2023-09-22 | 深圳市库源生物科技有限公司 | 一种同时检测细菌、支原体污染的引物组合及试剂盒 |
| US12356995B2 (en) | 2023-10-23 | 2025-07-15 | Solasta Bio Limited | Insect neuropeptides 9 |
| US12245596B1 (en) * | 2023-10-23 | 2025-03-11 | Solasta Bio Limited | Insect neuropeptides 8 |
| US12302908B2 (en) | 2023-10-23 | 2025-05-20 | Solasta Bio Limited | Insect neuropeptides 4 |
| US12279621B1 (en) | 2023-10-23 | 2025-04-22 | Solasta Bio Limited | Insect neuropeptides 3 |
| US12245588B1 (en) | 2023-10-23 | 2025-03-11 | Solasta Bio Limited | Insect neuropeptides 2 |
| US12281143B1 (en) | 2023-10-23 | 2025-04-22 | Solasta Bio Limited | Insect neuropeptides 1 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090298787A1 (en) * | 2006-01-12 | 2009-12-03 | Devgen N.V. | Dsrna as Insect Control Agent |
Family Cites Families (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4011391A (en) | 1971-04-20 | 1977-03-08 | Takeda Chemical Industries, Ltd. | Validamycin c, d, e and f antibiotics |
| US4089947A (en) | 1971-04-20 | 1978-05-16 | Takeda Chemical Industries Ltd. | Antibiotic compositions containing validamycin compounds |
| EP0590301A2 (en) | 1986-07-25 | 1994-04-06 | Louisiana State University and Agricultural and Mechanical College | Method for protecting plants from disease and infestation by gene insertion, and vectors and plant cells containing said genes |
| US5580852A (en) | 1993-12-17 | 1996-12-03 | Pioneer Hi-Bred International, Inc. | Derivatives of tachyplesin having inhibitory activity towards plant pathogenic fungi |
| US6372480B1 (en) | 1996-04-19 | 2002-04-16 | Mycogen Corporation | Pesticidal proteins |
| US6503881B2 (en) | 1996-08-21 | 2003-01-07 | Micrologix Biotech Inc. | Compositions and methods for treating infections using cationic peptides alone or in combination with antibiotics |
| US7892798B2 (en) | 1999-06-25 | 2011-02-22 | Evonik Degussa Gmbh | Nucleic acid molecules encoding metabolic regulatory proteins from Corynebacterium glutamicum, useful for increasing the production of methionone by a microorganism |
| AUPR621501A0 (en) * | 2001-07-06 | 2001-08-02 | Commonwealth Scientific And Industrial Research Organisation | Delivery of ds rna |
| PT1602717E (pt) | 2003-03-12 | 2015-02-13 | Ishihara Sangyo Kaisha | Planta e célula de planta que foram modificadas por multiplicação celular e desenvolvimento/diferenciação |
| WO2005034863A2 (en) | 2003-10-03 | 2005-04-21 | Jarikuma Corporation | Countermeasures against malaria |
| PL1687435T3 (pl) * | 2003-11-17 | 2012-02-29 | Bayer Cropscience Nv | Odporność na owady z użyciem hamowania ekspresji genów |
| CA2622671C (en) * | 2005-09-16 | 2020-12-22 | Devgen Nv | Methods for controlling pests using rnai |
| CN101370940A (zh) | 2006-01-12 | 2009-02-18 | 德福根有限公司 | 作为昆虫防治剂的dsRNA |
| CA2627795C (en) * | 2006-01-12 | 2019-01-22 | Devgen N.V. | Dsrna as insect control agent |
| US8609936B2 (en) * | 2007-04-27 | 2013-12-17 | Monsanto Technology Llc | Hemipteran-and coleopteran active toxin proteins from Bacillus thuringiensis |
| EP2205748A1 (en) | 2007-09-14 | 2010-07-14 | BASF Plant Science GmbH | Plants having increased yield-related traits and a method for making the same |
| CA2707009A1 (en) * | 2007-11-21 | 2009-06-04 | Cornell University | Methods for inhibiting fascin |
| US20110263487A1 (en) | 2007-12-20 | 2011-10-27 | University Of Georgia Research Foundation, Inc. | Plant Production and Delivery System for Recombinant Proteins as Protein-Flour or Protein-Oil Compositions |
| WO2009111838A1 (en) | 2008-03-13 | 2009-09-17 | Agriculture Victoria Services Pty Limited | Method of treatment using antimicrobial composition |
| JP2009263362A (ja) | 2008-04-04 | 2009-11-12 | Univ Of Tokushima | 二本鎖rnaを用いた害虫駆除剤 |
| US20090285937A1 (en) | 2008-05-15 | 2009-11-19 | The Bug Company Of Minnesota | Combination water and food insect supplement |
| AU2009267007B2 (en) * | 2008-07-01 | 2016-02-25 | Monsanto Technology, Llc | Recombinant DNA constructs and methods for modulating expression of a target gene |
| US8101732B2 (en) | 2008-09-17 | 2012-01-24 | State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of Oregon State University | Methods of producing validamycin A analogs and uses thereof |
| US20100184684A1 (en) | 2009-01-06 | 2010-07-22 | C3 Jian, Inc. | Antibacterial and antifungal peptides |
| US8334366B1 (en) | 2009-04-29 | 2012-12-18 | The United States Of America, As Represented By The Secretary Of Agriculture | Mutant lycotoxin-1 peptide sequences for insecticidal and cell membrane altering properties |
| WO2010140675A1 (ja) | 2009-06-05 | 2010-12-09 | 国立大学法人名古屋大学 | 害虫防除方法 |
| JP5691595B2 (ja) | 2010-03-03 | 2015-04-01 | 住友化学株式会社 | 植物病害防除組成物及び植物病害防除方法 |
| BR112014024861B1 (pt) * | 2012-04-06 | 2021-11-16 | Monsanto Technology Llc | Polipeptídeo inibidor de inseto, polinucleotídeo codificando o mesmo, célula hospedeira bacteriana, composição inibidora de inseto, mercadoria e métodos de controle de uma peste hemíptera e de produzir uma mercadoria |
| US9403881B2 (en) * | 2013-03-14 | 2016-08-02 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods of use |
| BR102014031844A2 (pt) * | 2013-12-20 | 2015-10-06 | Dow Agrosciences Llc | ras oposto (rop) e moléculas de ácido nucleico relacionadas que conferem resistência a pragas de coleópteros e hemípteros |
| WO2015100432A2 (en) | 2013-12-24 | 2015-07-02 | Symbiota, Inc. | Method for propagating microorganisms within plant bioreactors and stably storing microorganisms within agricultural seeds |
| US10450583B2 (en) * | 2014-04-23 | 2019-10-22 | The Regents Of The University Of California | Compositions and methods for controlling pests |
| CN104109671B (zh) | 2014-07-10 | 2017-01-11 | 中国农业科学院作物科学研究所 | 一种蚜虫共生菌基因的dsRNA及其在抑制蚜虫生长中的应用 |
| CN107438617A (zh) * | 2014-12-22 | 2017-12-05 | 农业生物群落股份有限公司 | 杀虫基因和使用方法 |
| TW201642741A (zh) | 2015-04-01 | 2016-12-16 | 協友股份有限公司 | 有害節足動物之誘引化合物及忌避化合物之組合物 |
| CN107529762A (zh) * | 2015-04-13 | 2018-01-02 | 弗劳恩霍夫应用研究促进协会 | 新型黄曲霉毒素和真菌感染控制方法 |
| WO2016201523A1 (en) * | 2015-06-19 | 2016-12-22 | The University Of Queensland | Composition |
| EP3317294B1 (en) | 2015-07-02 | 2023-03-15 | Dana-Farber Cancer Institute, Inc. | Stabilized anti-microbial peptides |
| CN105746585B (zh) | 2016-05-09 | 2018-11-30 | 福建省农业科学院植物保护研究所 | 一种蚜虫捕食性天敌昆虫的引诱剂 |
| US20180023076A1 (en) * | 2016-07-25 | 2018-01-25 | The United States Of America, As Represented By The Secretary Of Agriculture | Double strand rna delivery system for plant-sap-feeding insects |
| US20190387748A1 (en) | 2017-01-24 | 2019-12-26 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for agriculture |
| CN107637597A (zh) | 2017-09-26 | 2018-01-30 | 天祝藏族自治县绿龙农业科技发展有限公司 | 一种井岗霉素固体溶液及其制备方法 |
-
2018
- 2018-02-23 EP EP18758134.3A patent/EP3585171A4/en active Pending
- 2018-02-23 CA CA3048497A patent/CA3048497A1/en active Pending
- 2018-02-23 AU AU2018224862A patent/AU2018224862B2/en active Active
- 2018-02-23 JP JP2019545243A patent/JP7231551B2/ja active Active
- 2018-02-23 US US16/487,661 patent/US11974574B2/en active Active
- 2018-02-23 BR BR112019016719A patent/BR112019016719A2/pt not_active Application Discontinuation
- 2018-02-23 WO PCT/US2018/019577 patent/WO2018156998A1/en not_active Ceased
- 2018-02-23 CN CN201880010183.1A patent/CN111132552A/zh active Pending
-
2019
- 2019-04-30 US US16/399,200 patent/US20190246647A1/en not_active Abandoned
-
2022
- 2022-09-28 JP JP2022154905A patent/JP7536062B2/ja active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090298787A1 (en) * | 2006-01-12 | 2009-12-03 | Devgen N.V. | Dsrna as Insect Control Agent |
Non-Patent Citations (3)
| Title |
|---|
| GESELLCHEN ET AL.: "An RNA interference screen identifies Inhibitor of Apoptosis Protein 2 as a regulator of innate immune signalling in Drosophila", EMBO REPORTS, vol. 6, no. 10, 16 September 2005 (2005-09-16), pages 979 - 984, XP055536482, Retrieved from the Internet <URL:doi:10.1038/sj.embor.7400530> * |
| SHIGENOBU ET AL.: "Aphids evolved novel secreted proteins for symbiosis with bacterial endosymbiont", PROCEEDINGS OF THE ROYAL SOCIETY B: BIOLOGICAL SCIENCES, vol. 280, no. 1750, 7 January 2013 (2013-01-07), pages 1 - 6, XP055526819, Retrieved from the Internet <URL:https://doi.org/10.1098/rspb.2012.1952> * |
| VALLIER ET AL.: "RNAi in the cereal weevil Sitophilus spp: Systemic gene knockdown in the bacteriome tissue", BMC BIOTECHNOLOGY, vol. 9, no. 44, 15 May 2009 (2009-05-15), XP021049490, Retrieved from the Internet <URL:https://doi.org/10.1186/1472-6750-9-44> * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2020506961A (ja) * | 2017-01-24 | 2020-03-05 | フラグシップ パイオニアリング イノベーションズ ブイ,インコーポレーテッド | 農業のための組成物及び関連する方法 |
| US12171801B2 (en) | 2017-01-24 | 2024-12-24 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for controlling vector-borne diseases |
| WO2019079795A1 (en) * | 2017-10-20 | 2019-04-25 | BiOWiSH Technologies, Inc. | COMPOSITIONS AND METHODS FOR REDUCING CYANURIC ACID IN WATER SYSTEMS USED FOR RECREATIONAL PURPOSES |
| WO2020023699A1 (en) * | 2018-07-25 | 2020-01-30 | Flagship Pioneering Innovations V, Inc. | Compositions and related methods for agriculture |
| KR20210038579A (ko) * | 2018-07-25 | 2021-04-07 | 플래그쉽 파이어니어링 이노베이션스 브이, 인크. | 농업용 조성물 및 관련 방법 |
| KR102755260B1 (ko) | 2018-07-25 | 2025-01-14 | 플래그쉽 파이어니어링 이노베이션스 브이, 인크. | 농업용 조성물 및 관련 방법 |
| WO2021253115A1 (en) * | 2020-06-15 | 2021-12-23 | Melio Peptide Systems Inc. | Microorganisms and methods for reducing bacterial contamination |
| US11788053B2 (en) | 2020-06-15 | 2023-10-17 | Melio Peptide Systems Inc. | Microorganisms and methods for reducing bacterial contamination |
| US12168763B2 (en) | 2020-06-15 | 2024-12-17 | Melio Peptide Systems Inc. | Microorganisms and methods for reducing bacterial contamination |
| WO2025252597A1 (en) * | 2024-05-28 | 2025-12-11 | Concert Bio Ltd | Microbial composition for enhancing plant growth |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2023002559A (ja) | 2023-01-10 |
| EP3585171A4 (en) | 2020-08-26 |
| CN111132552A (zh) | 2020-05-08 |
| CA3048497A1 (en) | 2018-08-30 |
| RU2019126303A3 (https=) | 2021-10-28 |
| JP2020511429A (ja) | 2020-04-16 |
| US20190246647A1 (en) | 2019-08-15 |
| AU2018224862B2 (en) | 2024-01-18 |
| JP7231551B2 (ja) | 2023-03-01 |
| RU2019126303A (ru) | 2021-03-24 |
| JP7536062B2 (ja) | 2024-08-19 |
| US11974574B2 (en) | 2024-05-07 |
| BR112019016719A2 (pt) | 2020-04-14 |
| EP3585171A1 (en) | 2020-01-01 |
| US20190367943A1 (en) | 2019-12-05 |
| AU2018224862A1 (en) | 2019-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11974574B2 (en) | Compositions and related methods for modulating endosymbionts | |
| JP7499292B2 (ja) | 農業用組成物及び関連する方法 | |
| JP2023021985A (ja) | 農業のための組成物及び関連する方法 | |
| CN112739214B (zh) | 用于农业的组合物和相关方法 | |
| WO2018140518A1 (en) | Compositions and related methods for controlling vector-borne diseases | |
| AU2018212575B2 (en) | Compositions and related methods for controlling vector-borne diseases | |
| RU2821260C2 (ru) | Композиции и соответствующие способы модулирования эндосимбионтов | |
| RU2783258C2 (ru) | Композиции и соответствующие способы для сельского хозяйства | |
| RU2804136C2 (ru) | Композиции и соответствующие способы контроля заболеваний, передаваемых переносчиками | |
| RU2805081C2 (ru) | Композиции и соответствующие способы для сельского хозяйства | |
| RU2777518C2 (ru) | Композиции и соответствующие способы контроля заболеваний, передаваемых переносчиками |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18758134 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3048497 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2018224862 Country of ref document: AU Date of ref document: 20180223 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019545243 Country of ref document: JP Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019016719 Country of ref document: BR |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2019126303 Country of ref document: RU |
|
| ENP | Entry into the national phase |
Ref document number: 2018758134 Country of ref document: EP Effective date: 20190924 |
|
| ENP | Entry into the national phase |
Ref document number: 112019016719 Country of ref document: BR Kind code of ref document: A2 Effective date: 20190813 |